COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..138567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(238..1377) product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528052.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1352..2527) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533374.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene metK CDS complement(2585..3922) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533373.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 4023..4223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(4537..4797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(5361..7172) product type II secretion system effector nodulation protein NopX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857555.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene nopX CDS complement(7600..8136) product nodulation protein NolW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032490256.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene nolW CDS 8485..8994 product nodulation protein NolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857557.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene nolB CDS 9004..9867 product nodulation protein NolT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857558.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene nolT CDS complement(10112..10333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 10504..11127 product nodulation protein NolV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857560.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene nolV CDS 11124..12482 product type III secretion system ATPase SctN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015633405.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene sctN CDS 12458..12970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857562.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 13060..14088 product type III secretion system cytoplasmic ring protein SctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859390.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene sctQ CDS 14000..14746 product type III secretion system export apparatus subunit SctR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857564.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene sctR CDS 14800..15024 product EscS/YscS/HrcS family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857565.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 15033..15851 product type III secretion system export apparatus subunit SctT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859387.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene sctT CDS 15848..16885 product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857567.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 17728..18042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(18585..20699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084516.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 22046..22375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 22442..22690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 22807..23697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857572.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 23930..25993 product type III secretion system export apparatus subunit SctV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857573.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene sctV CDS complement(26101..26529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 27047..27517 product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533377.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(27740..27952) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008874821.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(29015..29257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 29642..31654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 31806..33281 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533394.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(34068..34583) product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533396.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 35400..35846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 36045..36752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 37076..37252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(37215..37847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(37744..38328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(38328..39026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 note possible pseudo, frameshifted CDS complement(39019..39390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 note possible pseudo, frameshifted CDS complement(39311..39868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 note possible pseudo, frameshifted CDS complement(40241..40516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(40827..41102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(41133..42767) product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167540391.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(42813..43157) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210315586.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene tnpB CDS complement(43154..43549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(43789..45105) product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533388.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(45095..45433) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533389.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 note possible pseudo, internal stop codon, frameshifted CDS 45864..46022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 46091..46237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(46739..46957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 46898..47239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(47170..47547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(47598..47864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(47836..48087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(48167..49171) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397358.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 49161..49367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 note possible pseudo, internal stop codon, frameshifted CDS 50053..50238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 note possible pseudo, frameshifted CDS 50589..51215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 note possible pseudo, frameshifted CDS 51485..51751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 note possible pseudo, internal stop codon, frameshifted CDS 52082..52492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 note possible pseudo, frameshifted CDS 52844..53077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 53179..54687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 assembly_gap 53405..53414 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 54965..55462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 56328..56477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 note possible pseudo, frameshifted CDS 57263..57628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 note possible pseudo, internal stop codon, frameshifted CDS complement(57625..57876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 note possible pseudo, frameshifted CDS 58662..59855 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533480.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(60601..61491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(62191..62937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 63471..63677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 63759..64574 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208514.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 64718..64939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(65153..65692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(65689..66303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(67193..67948) product delta 1-pyrroline-5-carboxylate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061123.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(67967..68308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 68771..69031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(70280..70999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(71069..71236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 note possible pseudo, frameshifted CDS complement(71233..71802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 note possible pseudo, frameshifted CDS 72147..73301 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970928.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(73406..73585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(74865..75560) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337984.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(75557..76339) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086914.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(76913..77644) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083618.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(77641..78450) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970866.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(78512..79762) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310644.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(79806..80639) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310642.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(80639..81589) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970865.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(81591..82739) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992208.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(82814..83638) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289254.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(83788..85212) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766268.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(85346..86647) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133415011.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(86672..87496) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174730.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(87582..88460) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331879.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(88829..89626) product glucosamine--fructose-6-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336747.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 89540..89830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(89839..90783) product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336746.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 90923..91147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 91074..91901 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114712.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(91898..92716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(93555..93689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(93896..94114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 94099..94764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(94919..95221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 95359..98280 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014855724.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 98580..98801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 98804..99337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 99590..99874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 99921..100190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 100168..100461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 100873..101241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 note possible pseudo, frameshifted CDS 101256..101639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 note possible pseudo, frameshifted CDS 101733..102767 product IS110-like element ISRhru3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388434.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 assembly_gap 102998..103006 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(103548..104006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 104435..104932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 note possible pseudo, frameshifted CDS 104967..105998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 note possible pseudo, frameshifted CDS complement(106099..106389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 107313..109475 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533399.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 109514..110212 product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972835.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(110521..110724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(110869..111510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 note possible pseudo, frameshifted CDS complement(111675..112253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 note possible pseudo, frameshifted CDS complement(112680..112823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(112865..113113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 note possible pseudo, frameshifted CDS complement(113074..113301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 note possible pseudo, frameshifted CDS complement(113524..115506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(115503..116447) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098364.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 116686..116955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(117106..117324) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533400.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 117434..117700 product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533401.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(118182..118415) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266521.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 118685..118813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 119602..119775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(121027..122433) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533403.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(123551..124057) product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970310.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(124067..124648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(124946..125449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(125968..126465) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533407.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(126956..128320) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533408.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(128507..129940) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533409.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(130134..131060) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533410.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(131434..132336) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533411.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(132468..133649) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172832172.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(133639..134886) product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533413.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(134929..135966) product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533429.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 136177..136611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 137034..138188 product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974131.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene doeA sequence002 source 1..129128 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(102..1037) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529089.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 1139..1798 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173266.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(1811..2131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028054075.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(2371..2676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529087.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(2985..4481) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529086.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 4704..5585 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529085.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 5690..6130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529084.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 6236..7822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 note possible pseudo, frameshifted assembly_gap 6259..6268 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7819..8301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 note possible pseudo, frameshifted CDS complement(8369..9625) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529082.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(9806..10975) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529079.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene alr CDS complement(11034..11549) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529078.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(11808..12404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 note possible pseudo, frameshifted CDS complement(12401..13027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 note possible pseudo, frameshifted assembly_gap 12424..12433 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13156..14478) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529076.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(14483..15778) product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529075.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(15954..16463) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529074.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene rlmH CDS complement(16500..16877) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529073.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene rsfS CDS 17118..17978 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529072.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(17994..19283) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529071.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(19359..20069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(20005..20736) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529070.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 assembly_gap 20134..20143 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(20759..21631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 note possible pseudo, frameshifted CDS complement(21628..22005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 note possible pseudo, frameshifted assembly_gap 21636..21645 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22123..22614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(22629..23750) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529068.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene proB CDS complement(23753..24781) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529067.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene obgE CDS 25076..25939 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529066.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(26118..26705) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173273.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(26826..27095) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529063.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene rpmA CDS complement(27197..27880) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529062.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 tRNA 28275..28364 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 28479..29801 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339202.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(29779..30114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(31256..31846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 note possible pseudo, frameshifted CDS complement(31915..33078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 note possible pseudo, internal stop codon, frameshifted CDS complement(33333..34793) product 5-demethoxyubiquinol-8 5-hydroxylase UbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533249.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene ubiM CDS complement(34795..35031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(35913..38186) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524996.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(38183..38680) product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524997.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(38677..40236) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533254.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene ccoG CDS complement(40403..41266) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524999.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene ccoP CDS complement(41269..41418) product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525000.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(41430..42161) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533257.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene ccoO CDS complement(42161..43780) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525002.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene ccoN CDS complement(44277..44870) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533259.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 45173..46522 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525005.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene hemN CDS complement(46758..47000) product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533261.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(47013..48227) product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533262.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(48224..49261) product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533263.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene trbG CDS complement(49251..49982) product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533264.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene trbF CDS complement(49983..51305) product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533265.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene trbL CDS complement(51339..52064) product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533266.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene trbJ CDS complement(52061..54511) product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533267.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene trbE CDS complement(54505..54777) product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533268.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(54777..55085) product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533269.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(55098..56066) product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533270.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene trbB CDS complement(56063..56476) product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533271.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(56593..58524) product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(58970..61921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 assembly_gap 59021..59029 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(62992..65298) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533398.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(65727..67061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 67277..67573 product DUF2604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514686.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 67566..68183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875328.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 68282..68668 product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026616817.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 68672..70201 product E2 ligase fold family C protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081162412.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(70523..71932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 note possible pseudo, internal stop codon, frameshifted assembly_gap 70679..70688 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(72002..72904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 note possible pseudo, internal stop codon CDS complement(72922..73908) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045231753.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(74264..76015) product relaxase/mobilization nuclease RlxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533275.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene rlxS CDS complement(76413..77096) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533276.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(77084..77632) product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533277.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(77629..77898) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533278.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(78080..78403) product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533279.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 79414..79761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 79824..80180 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203049.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene groES CDS 80183..81838 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532389.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene groL CDS complement(81996..82997) product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533282.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 83609..84178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(84185..85387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 86092..86481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533308.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(86671..86916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(87091..87282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(87218..87688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 note possible pseudo, frameshifted CDS 88335..88535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(88902..89534) product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533316.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(89627..90346) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533317.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(90446..91354) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533318.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene panC CDS complement(91351..91977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 note possible pseudo, frameshifted CDS 92422..93321 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533320.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 93402..94358 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533321.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene nadA CDS 94355..95896 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533322.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 95898..96779 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533323.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene nadC CDS 96957..97955 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533324.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene bioB CDS 97952..99091 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533325.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 99088..99723 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533326.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene bioD CDS 99723..100988 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533327.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 100985..101626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 note possible pseudo, frameshifted CDS 101623..101967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 note possible pseudo, frameshifted CDS 102141..103784 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533329.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(104015..105073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 note possible pseudo, frameshifted CDS complement(105040..105342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 note possible pseudo, frameshifted CDS complement(105838..106194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531395.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 106877..108016 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532601.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(108506..110377) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533629.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(110462..110929) product CpaD family pilus assembly lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857545.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(111035..112501) product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859716.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(112528..113214) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857543.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(113980..114099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 note possible pseudo, internal stop codon, frameshifted CDS complement(114891..115925) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532321.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene tdh CDS complement(115971..117158) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532322.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 117460..119529 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532323.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 119466..119642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(119658..120056) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532326.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 120198..120605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532327.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(120829..121566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532325.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 121950..122411 product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010915503.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene queF CDS complement(122431..122844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 note possible pseudo, frameshifted assembly_gap 122817..122826 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(123021..123500) product DUF3828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532330.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(123613..125649) product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325081.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 125794..126423 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018009470.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 126591..127226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 note possible pseudo, internal stop codon, frameshifted CDS 127276..127791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(127862..128971) product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331277.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 sequence003 source 1..108190 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1024..1335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(1353..1751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(1790..2791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(2913..3098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 3295..4167 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975164.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 4245..15290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(15314..16240) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261970.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(16244..16732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 16969..17613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 17631..18263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 18364..19113 product type III secretion inner membrane ring lipoprotein SctJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253017.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene sctJ CDS 19110..19727 product nodulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084622.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 19732..20349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 20346..21704 product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253014.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 21691..22179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 22188..23312 product type III secretion system cytoplasmic ring protein SctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066868854.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene sctQ CDS 23305..23958 product type III secretion system export apparatus subunit SctR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037381869.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene sctR CDS 23977..24246 product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331082.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 24256..25071 product type III secretion system export apparatus subunit SctT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040116147.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene sctT CDS 25241..26068 product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930607.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(26139..26900) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene thiD CDS complement(26891..27496) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252920.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(27493..28266) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614697.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(28269..28466) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972407.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene thiS CDS complement(28435..29436) product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969800.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene thiO CDS complement(29433..31268) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976311.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene thiC CDS complement(31579..32562) product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172832176.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(32559..33824) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533327.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(33824..34459) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533326.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene bioD CDS complement(34456..35595) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533325.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(35592..36593) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533324.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene bioB CDS complement(36656..37510) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533323.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene nadC CDS complement(37510..39045) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533322.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(39042..40016) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533321.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene nadA CDS complement(40085..41050) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533320.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 41433..42416 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173331.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 42622..43029 product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531554.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 43117..43725 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531556.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(43776..45017) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529727.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(45073..45237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(45414..46565) product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530321.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(46574..47935) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530322.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 assembly_gap 47225..47234 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(47972..49465) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530323.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(49726..50217) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530324.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 50301..51686 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530325.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 51812..52597 product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299081.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene ehuA CDS 52695..53546 product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530327.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene ehuB CDS 53737..54396 product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530328.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene ehuC CDS 54396..55055 product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530329.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene ehuD CDS 55061..55837 product ectoine utilization protein EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530330.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene eutA CDS 56021..57016 product hydroxyectoine utilization dehydratase EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167355184.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene eutB CDS 57013..58005 product ectoine utilization protein EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530332.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene eutC CDS 58044..59222 product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530333.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene doeA CDS 59228..60229 product N(2)-acetyl-L-2,4-diaminobutanoate deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530334.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene doeB CDS complement(60317..61936) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531743.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(62091..63524) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392306.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(63616..64788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(64789..66129) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(66119..66808) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940085.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(66805..68094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(68101..69411) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088825.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(69430..70482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088829.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(70735..72561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(72682..73602) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086197.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(73613..74734) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086196.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 74870..75520 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339095.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 75962..76663 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296810.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 note possible pseudo, frameshifted CDS complement(76880..78037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 78136..78723 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921379.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(78762..79496) product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225011.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(79520..80683) product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703894.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene dgoD CDS complement(80715..81812) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene ugpC CDS complement(81823..82713) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(82710..83546) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898777.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(83733..85214) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973776.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 85428..86138 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877666.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 86193..87359 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 87419..88777 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 88873..89199 product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087569.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 89209..90408 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524840.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(90561..91616) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121652022.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(91620..92453) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225802.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(92464..93300) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091310187.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(93457..94719) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225804.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(94739..95917) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226619.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(96229..96459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 96385..96936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(96933..97766) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173599.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(97763..99250) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533135.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(99270..100499) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533134.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 100641..101330 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533133.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 101520..102092 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533129.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(102157..103053) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968296.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 103222..104274 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523473.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 104271..105056 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972912.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 105145..106065 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529529.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 106138..107151 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529526.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 sequence004 source 1..104247 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525283.1:M23 family metallopeptidase locus_tag LOCUS_03680 CDS 1996..3636 product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967381.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(3691..4227) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525282.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 assembly_gap 4408..4417 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4438..5013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299099.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(5086..5379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(5397..7946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(8336..9328) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532929.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene ftsZ CDS complement(9586..10317) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050596197.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 10476..12134 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529813.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 12136..13281 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529814.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 13265..14191 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529815.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 14181..14987 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529816.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 15013..16044 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531376.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 16315..16500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(16497..17237) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525382.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 17450..17896 product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525383.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 18200..19303 product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524994.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene nirK CDS 19375..20247 product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524993.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 20272..20721 product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920892.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 20803..21234 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092588120.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(21253..22635) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525005.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene hemN CDS 22761..23489 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215732092.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(23518..24030) product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525003.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 24176..25786 product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525002.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene ccoN CDS 25797..26528 product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533257.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene ccoO CDS 26540..26689 product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525000.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 26692..27555 product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524999.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene ccoP CDS 27715..29286 product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164757824.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene ccoG CDS 29283..29777 product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524997.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 29774..32065 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533252.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 32062..32214 product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524995.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene ccoS CDS 32319..33017 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525380.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(33059..33607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089631.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(33765..34034) product DUF6455 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525379.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 34360..35916 product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525377.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 35903..36517 product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525376.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene fixJ CDS complement(36514..36738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095080464.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 36873..37319 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525374.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 37537..38184 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525373.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(38413..39222) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(39392..40957) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399701.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(41354..42355) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531159.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(42832..43512) product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088698.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(43532..46831) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108722853.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 47073..48845 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171602985.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 49065..51950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(52030..53415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970593.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(53485..53955) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310431.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(54183..55007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 55212..56627 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395351.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(56649..57128) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310724.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(57319..58500) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391469.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(58497..59495) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531312.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(59498..61414) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391465.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 assembly_gap 61273..61282 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(61411..63135) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391463.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(63449..64753) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312222.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(65249..66427) product DUF3095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391459.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 66501..67589 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061518.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 67586..68350 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061519.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(68352..69206) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391458.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(69341..69790) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531302.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(69978..72692) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850752.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 72843..73517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391489.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(73555..73743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(73872..74606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 assembly_gap 73943..73952 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(74603..75847) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061530.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(75849..77030) product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061529.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 77155..77340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 78227..80080 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067211.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 80208..81653 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192257226.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 82222..82614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(82773..83333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 83484..83687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 84198..86210 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101804821.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 86395..88359 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140190.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 88459..88764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(89988..90719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 90966..91121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(91294..92160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(92920..93138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 93025..94119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(94261..95391) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061500.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 95637..96917 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 96945..97964 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 98011..98802 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 98884..100854 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene asnB CDS 101030..102454 product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532712.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 102630..103103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337797.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 sequence005 source 1..96029 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063173609.1:branched-chain amino acid ABC transporter permease locus_tag LOCUS_04560 CDS 716..2005 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532985.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(2273..3460) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982221.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(3811..4005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(3905..4474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 4591..4962 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525071.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(5017..6258) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815690.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(7001..7825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(7822..9384) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114442713.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(9498..9653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 9925..10242 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525070.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 10359..10508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 10505..10684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 10918..11268 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969702.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 11262..12275 product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502350.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(12317..12649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 note possible pseudo, frameshifted CDS complement(13081..13512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525086.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(13562..14476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528199.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(14642..15175) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090374.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 15418..16581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525081.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 16574..17191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525082.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(17209..17640) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504647.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(17633..18151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 18038..18253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(18300..19370) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164753819.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 assembly_gap 18838..18847 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19994..20875) product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525135.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(20872..21267) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525134.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(21264..21884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525133.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 22310..22663 product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525116.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 22853..23146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525119.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(23167..23859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(24923..26440) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970696.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(26444..26758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530127.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(26820..27644) product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525031.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(27828..28211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(28423..28824) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038770.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 29671..29913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 29974..30480 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530428.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 30752..30940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(31867..32190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525091.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(32282..32596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 33020..33277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 33727..34365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396385.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(35680..37002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 assembly_gap 35933..35941 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 37591..37782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(37791..38732) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368405.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(38862..39848) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533367.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 40286..41005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 41098..42306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 42303..43709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970593.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 44056..44223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 44260..45762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(45778..46449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163562.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 46595..47344 product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525102.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 47370..47975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533175.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 48292..48867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 note possible pseudo, frameshifted CDS 48981..49280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(49550..51316) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171602985.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 51558..52277 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540175.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 52746..54581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 54676..56382 product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090750.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 56618..57472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 57685..57999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525146.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 58268..59272 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041958803.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 59236..59445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 59748..60254 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090375.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 60251..61831 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970696.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 61831..62436 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967327.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 62563..63510 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(63951..64142) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767547.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(64942..65142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 65044..65781 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086661.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene rnz CDS 65790..66257 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102894.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 66632..67639 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192256499.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 67702..68721 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192256499.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 68767..69774 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192256499.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 69771..70376 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 70342..72996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 72993..73358 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 73372..74520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 74929..76320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(76483..76701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(76732..76962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(77021..78649) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530719.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene groL CDS complement(78712..79131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 79362..79703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 79703..80005 product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501657.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(80378..80587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(80923..81234) product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525019.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(81673..82182) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525023.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(82277..82759) product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192281448.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(83048..83335) product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530721.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(83354..83659) product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531275.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(84232..84792) product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528153.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene msuE CDS complement(84899..86146) product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528154.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(86170..86961) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171068.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(87033..88373) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528156.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(88458..89513) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528157.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(89516..90415) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171066.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(90412..91326) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528159.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(91417..92520) product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528160.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene sfnG CDS complement(92684..94105) product FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528161.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(94102..94701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 note possible pseudo, frameshifted CDS complement(94637..95302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 note possible pseudo, frameshifted assembly_gap 94766..94775 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(95629..95823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528709.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 sequence006 source 1..93270 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(658..963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(1318..1530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(2686..3459) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084919.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 4220..5674 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529719.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(6139..6504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 note possible pseudo, internal stop codon, frameshifted CDS complement(6501..6755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 7837..8895 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(9502..10557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(10554..12620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(12623..13633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 14119..14469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(14491..17292) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146312796.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 17910..23810 product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061269.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 23824..24948 product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063891.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 24945..27587 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730250.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 assembly_gap 26027..26036 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(27609..27986) product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012112382.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(27991..28641) product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577776.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 29100..29351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 30794..31057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153443159.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 31720..31947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 32289..34124 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976311.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene thiC CDS 34121..35122 product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972408.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene thiO CDS 35091..35288 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969799.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene thiS CDS 35290..36063 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972406.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 36060..36665 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252920.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 36656..37471 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene thiD CDS 39053..39487 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833896.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 39532..40299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(40644..40865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(40780..40992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 note possible pseudo, frameshifted CDS complement(41943..44483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 44948..47419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 note possible pseudo, frameshifted CDS 47400..48311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 note possible pseudo, frameshifted CDS 48361..48741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 note possible pseudo, frameshifted CDS complement(49283..50770) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394607.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(51032..52876) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529051.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene recQ CDS complement(53016..54596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 55036..56049 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528896.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(56066..56404) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529048.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(56415..57206) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene kduD CDS 57570..59129 product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529040.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(59159..60079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(60232..60639) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529039.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(60739..62319) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529038.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene atpD CDS complement(62396..63283) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529037.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(63318..64595) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529036.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene atpA note possible pseudo, frameshifted assembly_gap 64521..64530 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(64803..65363) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529035.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(65610..66005) product DUF4345 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529034.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(66099..66794) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529033.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 66857..67102 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626232.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 67099..67554 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626231.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(67565..68254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 note possible pseudo, frameshifted CDS complement(68251..69765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 note possible pseudo, frameshifted assembly_gap 68357..68366 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 69855..70511 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529031.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene fsa CDS complement(70689..71255) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529029.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene lptE CDS complement(71242..71634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 note possible pseudo, frameshifted CDS complement(71661..73883) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529028.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene leuS note possible pseudo, frameshifted assembly_gap 71749..71758 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 73956..74693 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529027.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 74763..75017 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332761.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 75084..75317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 note possible pseudo, frameshifted CDS complement(75415..75639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 75547..76596 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529026.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(76659..77525) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529025.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 77654..78868 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529024.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 78919..79953 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529023.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(80060..80494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(80645..80917) product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529022.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 81212..83167 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529021.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene acs CDS 83167..83679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 assembly_gap 83211..83220 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(83989..85407) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529018.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(85726..86595) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 86845..87510 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529016.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(87652..87891) product DUF1674 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529015.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 87976..88989 product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529014.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene htpX assembly_gap 88517..88526 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 88947..90218 product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173296.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 assembly_gap 89773..89782 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 90419..92143 product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529012.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 sequence007 source 1..83929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 793..981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 1057..2115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 2013..2267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 2655..5627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 5850..6065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(6276..6989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205180329.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(6991..7500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(7656..8663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 9028..9528 product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529843.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(9601..9828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 10553..10780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 11150..11713 product nodulation O-acetyltransferase NodL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970947.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene nodL CDS complement(12021..12914) product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533515.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(12949..13161) product putative nitrogen fixation protein NifT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533514.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene nifT CDS complement(13158..13487) product nitrogen fixation protein NifZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533513.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(13564..13758) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533512.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(13788..15269) product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533511.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene nifB CDS 15528..15746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(16355..16663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(16551..17075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 note possible pseudo, frameshifted CDS complement(17341..17640) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533510.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(17653..18957) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533509.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(18968..20077) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533508.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(20094..21014) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533507.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(21134..21511) product nitrogenase stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533506.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene nifW CDS complement(21699..22913) product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533504.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene nifS CDS complement(23261..23581) product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533503.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 24174..25232 product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533502.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(25482..26714) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533492.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 27372..27686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 28204..29382 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533500.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 29412..30260 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533499.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 30409..31326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 note possible pseudo, frameshifted assembly_gap 31160..31169 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 31248..32024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 note possible pseudo, frameshifted CDS 32163..33215 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533497.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 33230..33829 product nitrogen fixation protein NifQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857649.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(33826..35217) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533495.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene rpoN CDS complement(35329..35862) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533494.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 37046..38242 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857627.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene hisC CDS 38564..39304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(39394..39759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 39667..39984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 note possible pseudo, frameshifted CDS 39870..40199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 note possible pseudo, frameshifted CDS 40244..40579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(40576..40719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 note possible pseudo, frameshifted CDS 41087..41860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(42022..42180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(42189..42377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 42848..43294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 43354..44052 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533307.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene queC CDS 44052..44408 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533306.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene queD CDS 44405..45139 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533305.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene queE CDS 45986..46684 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533332.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(47649..48002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(47984..48547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 49128..50021 product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533491.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene nifH CDS 50108..51610 product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533490.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene nifD CDS 51740..53281 product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533489.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene nifK CDS 53343..54818 product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533488.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene nifE CDS 54827..56209 product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533487.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene nifN CDS 56226..56672 product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533486.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene nifX CDS 56690..57169 product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533485.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 57166..57981 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533484.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 58077..58949 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533483.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 59791..61089 product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533481.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 61670..61852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(61861..62055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(62183..62779) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547500.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene pyrE CDS complement(63806..64555) product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089765.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 65543..65737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 65734..66012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 66162..67346 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533480.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 67692..68120 product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533485.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 68167..68370 product CCE_0567 family metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533479.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 68367..68684 product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015633444.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene fdxB CDS complement(69122..69364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 69363..70376 product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533477.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(71104..72882) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061851.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 72929..73180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 73513..74304 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533476.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(74313..74555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(75235..75429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(75499..75672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(75876..76202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(76262..76411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 77054..78310 product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533470.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene ectB CDS 78303..79142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533469.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(79457..79663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(80484..81029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 note possible pseudo, frameshifted CDS complement(80924..81535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 note possible pseudo, frameshifted CDS 82245..83087 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228672.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(83406..83711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 note possible pseudo, internal stop codon, frameshifted sequence008 source 1..77816 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(130..675) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532714.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(791..2725) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171703.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(3041..3970) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532724.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene rfbD CDS complement(3967..5043) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532725.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene rfbB CDS complement(5057..5611) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532726.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene rfbC CDS complement(5613..6494) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532727.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene rfbA CDS 6717..7658 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393201.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(7710..8300) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532736.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 8412..9320 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532737.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(9324..10109) product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532738.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(10286..11914) product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532739.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 12105..12476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532740.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 12598..12987 product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532741.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(13083..14075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(14280..15020) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532742.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(15139..16254) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532743.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(16403..19123) product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532744.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene ppdK assembly_gap 16464..16473 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 19571..20998 product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049733735.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 20998..22413 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113717.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 22501..23487 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918894.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene gmd CDS 23512..24471 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 24597..25406 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284954.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 25416..26156 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084033.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 26318..27103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(27143..28657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(28674..29033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 29051..30544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 30541..33414 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419149.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 33567..35798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(35931..36938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(36965..37843) product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(37846..38487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(38492..39538) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 39711..40835 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 40832..41950 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266713.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 42035..42379 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532745.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 tRNA 42557..42631 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(42745..43011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 43318..44022 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975534.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 44364..44990 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393330.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(45153..45428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(45993..46646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 47176..49017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 49320..50462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 tRNA 50815..50899 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 51021..51197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 51233..52348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 52385..54403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 54424..55617 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807953.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(55697..56959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(57022..58299) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259281.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(58314..59072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(59059..61059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(61029..62180) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878121.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(62186..63040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(63373..64944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 65083..66366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 66363..67424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 67425..69041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 69050..69958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 70337..71314 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 71314..73233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 73230..74231 product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 74228..74935 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884059.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 74949..75257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 75918..76109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 sequence009 source 1..72272 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 222..231 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1095..2384 product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527916.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 2494..2805 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527915.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 2771..3256 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527914.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene bfr CDS 3269..4876 product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527913.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 4876..5955 product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527912.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 5959..7074 product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527911.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(7078..7350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 7231..7968 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527910.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene tsaB CDS 7968..8462 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527909.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene rimI CDS 8490..9290 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527908.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 9376..10782 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503457.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene miaB CDS 10862..11911 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527906.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 11924..12418 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527905.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene ybeY CDS 12446..13519 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527904.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 13657..15249 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527902.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene lnt CDS 15389..15808 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527901.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 15977..17242 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527900.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene metK CDS 17263..17964 product tRNA (guanosine(46)-N(7))-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527899.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(18023..18220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527898.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 18518..19150 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene rimP CDS 19199..20794 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527896.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene nusA CDS 20833..21483 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527895.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 21480..24044 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527894.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene infB CDS 24194..24583 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527893.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene rbfA CDS 24583..25548 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527892.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene truB CDS 25695..26789 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527891.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene corA CDS 26983..27252 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006202929.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene rpsO CDS 27670..29820 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527890.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene pnp CDS 29905..30918 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527889.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(30928..32472) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527888.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(32574..33386) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527887.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene fabI CDS complement(33399..34619) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527886.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene fabB CDS complement(34743..35261) product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527885.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene fabA CDS 35560..35958 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503471.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 35969..36358 product DUF4260 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527883.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(36355..36840) product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527882.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 37073..38074 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527881.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(38080..38493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(38490..39743) product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530809.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(39740..40228) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527880.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(40153..40974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 assembly_gap 40426..40435 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(41006..42163) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527878.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene recF CDS complement(42189..43172) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527877.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene dnaN assembly_gap 42280..42289 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(43576..45120) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503475.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene dnaA CDS complement(45965..46231) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533694.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene rpsT CDS complement(46390..47163) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(47203..48090) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533692.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene mutM CDS complement(48074..49324) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533691.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 49506..50462 product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171180.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(50504..51124) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533689.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(51163..51570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(51905..52324) product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533687.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 52683..52853 product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533686.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 53007..53525 product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533685.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 53762..54544 product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533684.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene cpaB CDS 54541..56073 product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533683.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 56088..56828 product pilus assembly protein CpaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533682.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 56851..58134 product CpaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533681.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 assembly_gap 57899..57908 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 58298..58307 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 58544..59677 product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533680.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 note possible pseudo, frameshifted CDS 59707..60720 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533679.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 60730..61746 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533678.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 61905..62219 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052820167.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(62266..63090) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533677.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(63343..63579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 63469..64680 product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533676.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 64759..65097 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533675.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 65126..65986 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173545.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 66119..68596 product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171190.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 68616..69332 product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533672.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene pdeM CDS complement(69346..70317) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015931585.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 70411..71289 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112482.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(71303..72238) product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533671.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 sequence010 source 1..71803 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 50..283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 384..1385 product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(1407..2294) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242371.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 2469..2855 product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242372.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 3272..4174 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529092.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 4179..5570 product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529093.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene livM note possible pseudo, frameshifted assembly_gap 5528..5537 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5570..5791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 note possible pseudo, frameshifted CDS 5791..6891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 6891..7619 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529095.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 7732..8079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529096.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 8217..9335 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394374.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 9543..13001 product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene pyc CDS 13155..13415 product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529099.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 13855..14301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529100.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(14339..14863) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085870.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 15033..15377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529101.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(15433..15837) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529102.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene msrB CDS complement(15941..17131) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529103.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(17140..17586) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529104.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(18017..18856) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529106.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 19251..19838 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529107.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(19901..20119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(20221..20487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 assembly_gap 20270..20279 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 20371..20751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 note possible pseudo, frameshifted CDS 20823..21590 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529109.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(21642..22130) product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529111.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 22176..22499 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529112.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 22713..23462 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529113.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 23472..23801 product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173256.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(23832..24308) product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529116.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(24310..25134) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226532.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 25288..25890 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529117.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 assembly_gap 26098..26107 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(26195..26416) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529118.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene rpmE CDS 26622..28424 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529119.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(28446..28586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(28638..30122) product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529120.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 30269..30622 product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529121.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(30685..31110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529122.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(31350..32378) product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529123.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(32380..33405) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529124.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(33612..34304) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162532.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(34418..35218) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529126.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(35243..35809) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529127.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene efp CDS complement(35936..37030) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529128.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(37032..37679) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529129.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(37849..38748) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529130.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 38968..39321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(39411..40529) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965106.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 assembly_gap 40320..40329 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 40680..41114 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969510.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(41153..41611) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530753.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 41795..42565 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529133.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(42604..43155) product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529134.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 43690..44220 product DUF1465 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529136.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 44497..45006 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529137.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene ruvC CDS 45017..45637 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529140.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene ruvA CDS 45877..47001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 47047..47847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 note possible pseudo, frameshifted assembly_gap 47796..47805 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 47844..48077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 note possible pseudo, frameshifted CDS 48207..49109 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529142.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(49120..50388) product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529143.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 50423..50896 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529144.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene ybgC CDS 51204..51914 product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529145.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene tolQ CDS 51924..52376 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529146.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene tolR CDS 52384..53433 product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529147.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 53473..54777 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529148.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene tolB CDS 54960..55202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 note possible pseudo, frameshifted CDS 55444..55950 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529149.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene pal CDS 56128..57213 product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529150.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene ybgF CDS 57272..58519 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529151.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene tilS CDS 58644..60590 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529152.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene ftsH assembly_gap 60509..60518 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(60859..61317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(61928..62971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529154.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 63317..64669 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529155.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene glmM CDS 64897..65712 product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529156.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 65918..66796 product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529157.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 66997..68172 product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 68240..69841 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529159.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene serA CDS 70110..71180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 note possible pseudo, frameshifted assembly_gap 71025..71034 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 71071..71409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 note possible pseudo, frameshifted sequence011 source 1..70057 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1360..2496) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530192.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(2497..3504) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530191.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(3609..5603) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530190.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(5797..7263) product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530189.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 7477..8352 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530188.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(8387..9496) product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173620.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 9949..11718 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532808.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 11748..12500 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532807.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 12738..14063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530577.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 14056..14649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530580.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 14646..15224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530579.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 15235..15804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530578.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(15827..16444) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532806.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene pdxH CDS 16554..16949 product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532805.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 17050..17994 product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532804.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 18103..18921 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532803.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene fabI CDS 18982..19569 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(19620..19883) product DUF1344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532801.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(20052..21668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(21681..22403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(22403..22807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(22804..23823) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 24271..25380 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532800.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene aroC CDS 25474..26574 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532799.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene ribB CDS 26602..26988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 note possible pseudo, frameshifted CDS complement(27182..28405) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532797.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 28526..29119 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532796.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 29249..30229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532795.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 30317..31243 product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532793.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 31247..31498 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532792.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 31543..31809 product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532791.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 31818..32738 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532790.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 32802..34760 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532789.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene dxs CDS 34910..35197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532788.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 35251..35808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 assembly_gap 35301..35310 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 35805..37046 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532784.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(37051..38463) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532782.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene tldD CDS complement(38593..39141) product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532781.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(39306..39638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 39520..40386 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532780.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene coxB CDS 40412..42076 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532779.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene ctaD CDS 42155..43099 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532778.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 43096..43263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532777.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 43266..43895 product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532776.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 43897..44778 product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532775.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 44901..45359 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171659.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 45356..45742 product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503617.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 45790..46494 product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171660.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 46580..47584 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532771.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene ispH CDS 47592..48554 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532770.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 48551..49081 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532769.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene rnhA CDS 49124..49717 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970805.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 49817..50479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(50507..50983) product DUF2938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532768.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(51071..51550) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532767.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(51683..52489) product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532766.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 52672..53280 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532765.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(53281..56172) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532764.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(56173..56769) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532763.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(56785..58077) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532762.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(58092..59489) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532761.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene thrC CDS complement(59492..59698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 59618..60340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532760.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(60473..62035) product winged helix-turn-helix domain-containing tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533667.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 62140..62601 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533666.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(62750..63439) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532759.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 63635..64759 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532758.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(64818..65429) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532757.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(65455..66582) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532756.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene mutY CDS 66616..67116 product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532755.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 67288..67986 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532754.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 sequence012 source 1..70039 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 699..1160 product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529524.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene phnG CDS 1160..1765 product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529523.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene phnH CDS 1767..2879 product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529522.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 2876..3544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 3566..4465 product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 4462..5298 product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529518.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene phnK assembly_gap 4897..4906 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5642..6553) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529255.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene rpoH CDS complement(6788..7777) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529256.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 7885..8268 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529257.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 8265..8678 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529258.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 tRNA 8764..8838 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 9054..9644 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529260.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 9656..10534 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529261.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 10838..11206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173200.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(11434..11649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529263.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(11880..12224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529266.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 12409..14364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 note possible pseudo, frameshifted assembly_gap 14332..14341 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14361..16202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 note possible pseudo, frameshifted CDS 16752..17780 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529268.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 17974..19434 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529269.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene pstC CDS 19431..20747 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529270.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene pstA CDS 20763..21587 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529271.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene pstB CDS 21611..22321 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529272.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene phoU CDS 22341..23030 product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010911896.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene phoB CDS complement(23034..24230) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529273.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 24148..24345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 24545..25585 product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529274.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene xylF CDS 25744..27063 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529275.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 27092..27892 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529276.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 28016..29638 product CHASE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529277.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(29738..29980) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529278.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(30062..30391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529279.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(30502..30678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(30841..31875) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063169141.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(32041..32205) product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529282.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(32399..33193) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529283.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 33409..33612 product NepR family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032809255.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 33616..34167 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529285.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(34202..34579) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336897.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 34810..35136 product DUF883 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529287.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 35153..35611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529288.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(35666..37180) product HWE histidine kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173815.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 37344..37511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529290.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(37547..38467) product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529291.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 38718..40031 product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529292.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(40083..40343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 note possible pseudo, frameshifted CDS complement(40232..41641) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 note possible pseudo, frameshifted assembly_gap 40330..40339 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 41862..42794 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529294.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 42798..43433 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529295.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 43426..43725 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529296.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 43868..44926 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529297.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(44928..45095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(45092..46351) product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968121.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(46354..47928) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339387.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(47915..49534) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966434.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 49733..50527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 50534..51220 product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564165.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 51273..52355 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719295.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(52499..52765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 assembly_gap 52507..52516 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 52697..53794 product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529298.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(53758..54855) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532646.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(54987..55883) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532647.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 55966..57558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171735.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 57589..58521 product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532649.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(58637..58966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 59237..60676 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563245.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(60730..60939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533291.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(60936..61112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532732.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 61213..61533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184871738.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(61563..62267) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532730.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(62897..63355) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531548.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(63470..63619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530518.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(63676..64194) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967534.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 assembly_gap 64147..64156 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(64221..65747) product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204917.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 65882..67714 product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531526.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 67674..67841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 note possible pseudo, frameshifted CDS 67933..68094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 68347..69414 product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804101.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 sequence013 source 1..66130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(457..942) product DUF2948 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530200.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(1123..2415) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530201.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene murA CDS complement(2551..2751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530202.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 tRNA 3023..3097 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 3172..3357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(3470..3889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 note possible pseudo, frameshifted CDS complement(3886..4362) product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508791.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(4374..5159) product putative DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508790.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(5146..6180) product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508789.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(6224..6493) product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706878.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(6729..7589) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441684.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 7811..8086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528891.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 8276..8551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528891.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 8723..9637 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399088.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 9825..10325 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614725.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 10455..11618 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614724.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 11663..12127 product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614723.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(12190..13104) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399088.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 13380..14162 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529312.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 14188..15339 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085560.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 15373..16767 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086508.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 16787..18133 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023908.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(18088..18576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 18478..18978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(18962..19867) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965825.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(20254..21066) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530391.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(21070..22272) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530392.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(22272..23888) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530393.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(23885..25381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 note possible pseudo, frameshifted CDS complement(25419..25949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 note possible pseudo, frameshifted assembly_gap 25491..25500 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(25946..27616) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530395.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(27734..29131) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530396.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 assembly_gap 28811..28820 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(29196..29960) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827580.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(29971..31050) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530398.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(31054..32217) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530399.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(32295..33329) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530400.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(33418..34365) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530401.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(34450..35199) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530402.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(35201..35923) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530403.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(36205..36993) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173766.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(37044..37391) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530405.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(37405..38211) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530406.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(38204..39016) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530407.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(39021..39911) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530408.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 40021..40785 product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530409.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 40794..42011 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530410.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(42100..45639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(45950..46696) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529854.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(46917..47624) product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529853.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 47856..48392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530274.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(48429..48992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530275.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(48989..49606) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530276.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(49662..50825) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530277.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(50822..51409) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530278.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(51451..51978) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530279.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(51983..53551) product pilus assembly protein TadG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530280.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(53615..53914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530281.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(53901..55346) product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095198234.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(55401..56420) product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530283.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene cpaB CDS complement(56530..56745) product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530284.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 57273..58658 product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530285.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 58658..59629 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530286.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 59714..60598 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530287.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 60696..61196 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530288.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 61198..61737 product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(61749..62957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172992.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(63148..63840) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529851.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(63977..64345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529850.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 misc_feature complement(64421..>66130) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529849.1:VCBS domain-containing protein locus_tag LOCUS_11590 sequence014 source 1..64713 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 723..956 product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503316.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 970..1674 product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531717.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(1681..2676) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172127.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene dusA CDS complement(2864..3688) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038849.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 4552..4824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 4817..5026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530154.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 5129..5359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 5633..6295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(6556..6858) product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531722.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 7204..8661 product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531731.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(8696..9241) product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531732.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(9253..10881) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531733.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(11042..11695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 note possible pseudo, frameshifted CDS complement(11692..12159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 note possible pseudo, frameshifted assembly_gap 11729..11738 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12284..12877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 assembly_gap 12499..12508 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13039..13806) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531736.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene tpiA CDS 13952..15844 product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531737.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 15841..16851 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531738.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene trpD CDS 16856..17668 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531739.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene trpC CDS 17671..18168 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531740.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene moaC CDS 18168..19373 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531741.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 19490..20224 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531746.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene lexA CDS complement(20218..22653) product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531747.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 22780..24312 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531748.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene gltX assembly_gap 24064..24073 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 24406..25734 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531749.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene gltA CDS complement(25781..26947) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531750.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene lpxB CDS complement(26937..27836) product LpxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531751.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(27826..28665) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531752.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene lpxA CDS complement(28675..29133) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531753.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene fabZ CDS complement(29126..30181) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531754.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene lpxD CDS complement(30260..32617) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531755.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene bamA CDS complement(32836..33978) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531756.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene rseP CDS complement(34029..34925) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531757.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 assembly_gap 34136..34145 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(34922..35641) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531758.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(35675..36232) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531759.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene frr CDS complement(36351..37073) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531760.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene pyrH CDS complement(37233..38408) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531761.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(38381..38908) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531762.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 39025..39951 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531763.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(39979..40899) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531764.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene tsf CDS complement(41017..41796) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531765.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene rpsB CDS complement(41974..42585) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969757.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(42582..42860) product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531766.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(42919..43749) product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531768.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 43888..44352 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531769.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 44349..44561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 note possible pseudo, frameshifted assembly_gap 44499..44508 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 44521..45114 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531770.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 note possible pseudo, frameshifted CDS 45186..46370 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531771.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 46480..46905 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531772.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(46946..48256) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531441.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(48296..49783) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531440.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(49978..50409) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531439.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene rplQ CDS complement(50514..51524) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531438.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(51627..52016) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205444.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene rpsK CDS complement(52175..52543) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531437.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene rpsM CDS complement(52732..53331) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531436.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(53328..54668) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531435.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene secY CDS complement(54860..55333) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531434.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene rplO CDS complement(55356..55553) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205449.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene rpmD CDS complement(55579..56148) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006333394.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene rpsE CDS complement(56226..56585) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531433.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene rplR CDS complement(56676..57209) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531432.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene rplF CDS complement(57299..57697) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531431.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene rpsH CDS complement(57711..58016) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531430.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene rpsN CDS complement(58043..58621) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531429.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene rplE CDS complement(58614..58928) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531428.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene rplX CDS complement(58941..59309) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205457.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene rplN CDS complement(59382..59621) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909280.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene rpsQ CDS complement(59633..59833) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205459.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene rpmC CDS complement(59847..60260) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531427.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene rplP CDS complement(60288..61019) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531426.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene rpsC CDS complement(61019..61408) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205462.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene rplV CDS complement(61411..61689) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205463.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene rpsS CDS complement(61706..62539) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531425.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene rplB CDS complement(62562..62855) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531424.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(62852..63472) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531423.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene rplD CDS complement(63472..64155) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531422.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene rplC CDS complement(64283..64591) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909272.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene rpsJ sequence015 source 1..63547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..7137 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000331685.1:LPD5 domain-containing protein locus_tag LOCUS_12380 CDS complement(7139..7723) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174804364.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 8057..8908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 8905..9192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 9107..9325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 9336..9692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 9721..10005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 tRNA complement(10085..10161) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(10352..11233) product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142276.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 11330..12229 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091419.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 12275..14515 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532683.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(14699..16162) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532682.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene betB CDS complement(16215..17867) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532681.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene betA CDS complement(17860..18858) product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162996.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(18858..20387) product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171724.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene betC CDS complement(20384..20959) product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532678.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene betI CDS 21217..22383 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532677.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 22438..23169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 note possible pseudo, frameshifted assembly_gap 23154..23163 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23186..23455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 note possible pseudo, frameshifted CDS complement(23458..24834) product TIGR03808 family TAT-translocated repetitive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532675.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 24938..25420 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532674.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene greA CDS complement(25417..25806) product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(25803..26024) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405518.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(26096..28219) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532673.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene scpA CDS complement(28216..29658) product methylmalonyl-CoA mutase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532672.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 30051..31595 product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532671.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(31925..32548) product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533542.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 32625..34052 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533544.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(34065..34886) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532670.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(35058..35720) product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 35928..36806 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505546.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 36980..37582 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532667.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 37730..38167 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532666.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 38177..39127 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532665.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 39208..41805 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391136.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(41901..42296) product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532664.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(42546..43172) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532663.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(43237..45363) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532662.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 45481..45849 product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164745941.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 46210..46692 product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532660.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(46813..47259) product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532659.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(47352..47729) product DUF5330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 48281..48760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 note possible pseudo, frameshifted assembly_gap 48737..48746 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 48757..50016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 note possible pseudo, frameshifted CDS 49991..50773 product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532656.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 50846..51196 product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532655.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(51191..52171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171732.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 52435..52617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532653.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 assembly_gap 52575..52584 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(52746..53294) product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532652.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(53287..53871) product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532651.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(53970..56126) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532650.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(56289..56927) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501867.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 57077..57319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 57438..58991 product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530987.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 59126..59533 product DUF3168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532641.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(59543..59929) product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112418.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 60167..60466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532640.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 60537..61202 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532639.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 61186..62622 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532638.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 62798..63235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532637.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 sequence016 source 1..63085 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1390..2241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(2243..2953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 3026..3295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(3292..4953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(4954..5319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 5206..5619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(5616..6257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 assembly_gap 5977..5986 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6254..6748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(6753..7358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 7485..7835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(7832..8596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(8593..9219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(9243..9428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(9490..11160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(11161..13032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(13032..13745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(13747..14226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(14257..14454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(14514..15032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(15045..15602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(15690..16703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(16738..17811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(17778..18023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(18020..18244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(18241..18495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(18492..18815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(18812..21217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(21218..21934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(21964..22443) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313922.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(22440..22676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(22679..23089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(23086..23700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(23759..25210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(25211..25519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(25580..25870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(25882..26169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(26169..26675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(26675..27532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(27478..27816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(27813..28307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(28292..28597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(28625..28957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(28954..29115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(29112..29288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 29385..29867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 29878..30111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(30108..30338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(30328..30543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(30547..31419) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024060.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(31406..31861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460150.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(31867..33318) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532525.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(33332..33754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 34260..34421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(34430..35014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(35011..36024) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268012.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(36021..36614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(36614..37096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(37129..37884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(37911..38177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(38380..38919) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931436.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(38919..39323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(39516..40166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 40199..40441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 40634..40894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(40891..41109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 41214..41552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 41978..42199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 42196..42447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 42444..42707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 42704..43093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 43119..44183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 44187..44870 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene dnaQ CDS 44882..46021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 46021..46299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 46299..47369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 assembly_gap 47063..47072 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 47369..47830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 47830..48219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 48221..48391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 48388..48558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 48555..48758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 48891..49580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 49570..50106 product DUF1643 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975413.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 50096..50593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 50577..50987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 51126..51377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 51537..52655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 53002..53343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532688.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(53371..54990) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532689.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(54992..56113) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532690.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(56106..57029) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532691.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(57205..58833) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532692.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 59179..59544 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 59544..61364 product TadG family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532694.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(61368..63005) product alpha-glucosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532695.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 sequence017 source 1..61193 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(905..1801) product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529407.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 assembly_gap 1260..1269 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1869..3137) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529408.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene lysA CDS complement(3189..3374) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529409.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(3484..4884) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529410.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene argH CDS 4921..5607 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529411.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(5599..8046) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529412.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 8389..9741 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972753.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 9829..10713 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972754.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 10721..11635 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972755.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 11646..12746 product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972756.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 12814..13611 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086914.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(13675..14757) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529417.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(14754..15623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 note possible pseudo, frameshifted CDS complement(15602..16345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 note possible pseudo, frameshifted assembly_gap 15801..15810 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16521..17528) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529419.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 17732..18268 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529420.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 18270..18908 product NrsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529421.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 19051..20499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 note possible pseudo, frameshifted assembly_gap 20238..20247 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 20387..21058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 note possible pseudo, frameshifted CDS complement(21068..21946) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529423.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(22064..22993) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529424.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(23017..23766) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529425.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(23939..24748) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529426.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(24780..25361) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529427.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(25377..25568) product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529428.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(25592..26425) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529429.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 26509..27360 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529430.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(27330..28241) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529431.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 28397..28711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(28868..29743) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529432.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene gluQRS CDS 29841..30482 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529433.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 30648..31268 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006328497.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(31427..31945) product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529434.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(31971..32561) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529435.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 tRNA 32796..32880 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(32973..34292) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329916.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(34297..36015) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969655.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(36091..37515) product family 16 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170806.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(37822..38970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225442.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(39036..40316) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529437.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(40316..41719) product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529438.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(42008..44740) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529439.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene secA CDS 44992..45909 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529440.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(46092..46688) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529441.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(46716..46946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 46921..48117 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529442.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene argJ CDS 48126..48896 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529443.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 48893..49315 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529444.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene mutT CDS 49421..49729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529445.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 49836..50024 product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529446.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(50043..50915) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529447.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 50982..51770 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529448.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 51838..52107 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529449.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene grxC CDS 52110..52970 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529450.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 52967..53392 product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529451.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(53406..53825) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529453.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 53993..54907 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529454.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(54936..55493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 note possible pseudo, frameshifted assembly_gap 55425..55434 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(55700..55981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 assembly_gap 55817..55838 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 56202..57455 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529459.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 57537..59054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 note possible pseudo, frameshifted assembly_gap 58956..58965 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 58970..59803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 note possible pseudo, frameshifted CDS 59943..61022 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529461.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene prfA sequence018 source 1..60508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525335.1:SMC-Scp complex subunit ScpB locus_tag LOCUS_14530 CDS complement(1508..1726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 2492..4561 product TerB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003681.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 4660..5880 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003683.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 5861..8119 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338082.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(8239..8481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 8680..11676 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544913.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(11982..12263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 12294..13238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 13235..16669 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390981.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 assembly_gap 14182..14208 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17108..17326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 17980..18276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445478.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 18266..18856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390698.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 18853..20232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(20870..21535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 22216..25122 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020677315.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 25224..27026 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031064.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 27125..30220 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931302.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 30222..31124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 31165..33267 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036269.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(33264..35090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 35436..35699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 35796..35978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(36179..37591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(37581..38441) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106663661.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(38448..40580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(41355..41852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 42055..42651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(42796..43581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(43571..44281) product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073963.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 44553..45338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 46161..46370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 46463..46612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 46847..47134 product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314414.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 47144..48880 product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966061.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 48891..49124 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085981.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 49126..49485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 49494..50276 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113102.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 50276..51106 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113103.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(51253..52083) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112653.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(52080..52904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 note possible pseudo, internal stop codon, frameshifted CDS complement(52901..53632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(53744..54835) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206779.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(54864..55793) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112660.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(55865..57226) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269247.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(57359..57916) product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969839.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene msuE CDS 58684..59736 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253048.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 sequence019 source 1..57281 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(199..654) product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531488.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(662..1627) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531487.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene lipA CDS complement(1763..2020) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531486.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(2123..3589) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531485.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene lpdA CDS complement(3608..4246) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531484.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(4243..4668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(4682..5581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 note possible pseudo, frameshifted CDS complement(5655..6053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 note possible pseudo, frameshifted assembly_gap 5685..5694 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6057..6344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(6357..7337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 note possible pseudo, frameshifted assembly_gap 7356..7365 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7772..8812) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531481.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene pdhA CDS complement(9009..9332) product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531480.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(9489..10763) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531479.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene eno CDS complement(11152..11517) product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531477.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(11588..11794) product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(11895..12737) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531475.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene kdsA CDS complement(12734..13612) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531474.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 14074..15366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 15363..16340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 16333..17346 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086149.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 17343..18308 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529382.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(18281..18568) product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531473.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(18668..18802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 19063..20319 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531472.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(20384..22357) product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531470.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(22499..23764) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531469.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 23939..24598 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531468.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(24605..25078) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531467.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 25237..26352 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531466.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene ald CDS complement(26716..27183) product DUF1203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531464.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(27462..28019) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531463.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 28206..28616 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088400.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(28629..29192) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531462.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(29198..30049) product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531461.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene sseA CDS complement(30083..30826) product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531460.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(30826..31860) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531459.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 32076..32918 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531458.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 32987..33964 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531457.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(34064..35485) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531456.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 35892..37424 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531455.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 37430..38500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(38549..38944) product DUF6165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036195.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 39097..40125 product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088670.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene waaF CDS complement(40131..42041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531454.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(42038..43573) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531453.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 43932..44270 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205430.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 44331..45740 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531452.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene glnA CDS complement(45936..46976) product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531450.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 47285..47482 product DUF2735 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531449.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(47560..49446) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531448.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(49631..50422) product ATP12 family chaperone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531447.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(50434..51351) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505073.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(51348..51554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(51580..52560) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531445.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(52599..52973) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531444.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene crcB CDS complement(53005..53370) product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329121.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(53435..54952) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087552.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(55095..55877) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165113428.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(56309..57139) product aspartyl/asparaginyl beta-hydroxylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063168068.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 sequence020 source 1..57070 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 286..1182 product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532109.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(1201..2238) product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532108.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 2351..2854 product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532107.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(2904..3068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532106.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 3441..3908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532105.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 4026..5093 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532104.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 5133..6398 product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532103.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(6545..7504) product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532102.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 note possible pseudo, frameshifted assembly_gap 6663..6672 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7501..8007) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532101.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(8095..9024) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532100.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(9039..10421) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532099.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(10423..12060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532098.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 12211..12459 product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532091.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 12549..13502 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532089.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 13681..14076 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532088.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 14348..14560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532087.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(14616..15527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 15753..16847 product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532084.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 17034..17576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(17643..18557) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528412.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene gcvA CDS 18665..18832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 18872..19480 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532083.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(19741..20091) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967717.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(20165..21235) product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028369.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(21441..21701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(21883..25656) product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532020.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 26233..27750 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531892.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene gltX CDS complement(27668..28888) product DUF2865 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531891.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(29020..31344) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531890.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(31593..32372) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531889.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 32493..33314 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531888.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 33442..34656 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531887.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(34627..35610) product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531886.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 35687..36874 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531885.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 36876..37685 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531884.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 37700..39073 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531883.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 39167..39736 product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531882.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 note possible pseudo, frameshifted assembly_gap 39204..39213 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(39844..45924) product kinesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531880.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 46213..46581 product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531879.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 46771..47091 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531878.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 47181..48209 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531877.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(48218..49699) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531876.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(49937..50554) product DUF922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920055.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 assembly_gap 50819..50828 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 50849..51481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 note possible pseudo, frameshifted CDS 51485..51844 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531873.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene folB CDS 51828..52340 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531872.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene folK CDS complement(52374..52922) product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531871.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(52927..54765) product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531870.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 55007..55273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531867.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(55342..55896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531866.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(55986..57068) product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531865.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 sequence021 source 1..56400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1265..1723 product phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530255.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 tRNA 2082..2158 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 2429..3115 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313652.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 3576..4463 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186540.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 4734..5726 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434654.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 5875..6762 product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527334.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 6755..7795 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384672.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 7946..8857 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973459.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 8850..10367 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973458.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 10364..11695 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973457.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 11747..12745 product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973452.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 12898..13908 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391989.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(14224..14442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530154.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(14601..14825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(14729..15499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 note possible pseudo, frameshifted assembly_gap 14849..14858 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15827..16594 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331278.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 16602..17366 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331279.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 17624..19177 product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331276.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 19326..20288 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314316.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(20361..21359) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395757.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 21500..23497 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395834.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 23643..25295 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532331.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 25566..25835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 25997..26647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 26644..27489 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968114.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 27486..28145 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968106.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 28147..29487 product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 assembly_gap 29468..29477 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 29487..30554 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 30557..32080 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112630.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 32077..33177 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 33174..34085 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529891.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 34501..34755 product DUF768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530335.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(34805..35929) product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530336.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(36040..37602) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530337.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene xseA CDS 37725..39947 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525318.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(39973..40929) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530338.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 41108..41398 product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530339.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(41547..42539) product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530340.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(42643..44067) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530341.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(44202..44936) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530342.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(44968..45615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530343.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 45691..46389 product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530344.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 46811..46951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162034344.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(46998..47771) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530346.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(47831..48967) product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530347.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(48990..49787) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530348.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 49995..51299 product DUF3422 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530349.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 assembly_gap 50794..50803 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 51416..51425 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 51594..53090 product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530350.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 53274..54455 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530351.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 54452..54841 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327476.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 54851..56176 product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530352.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene glcF sequence022 source 1..55611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(206..535) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529964.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene clpS CDS complement(627..941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529963.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(1120..1362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(1403..1705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504541.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(1665..1856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 1945..2661 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529960.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 2658..4067 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529959.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 4164..4544 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529744.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(4587..4823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 5048..7003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(7085..7903) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040487.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(7891..9372) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528609.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(9464..10549) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528610.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene cysK CDS 10719..12791 product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528611.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(12828..13865) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083827.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(14025..15206) product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529958.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene choV CDS complement(15203..16057) product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529957.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene choW CDS complement(16278..17213) product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529956.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 17448..18059 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529955.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 18123..19136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 assembly_gap 19040..19049 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 19338..19721 product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529954.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(19694..19906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 20022..21110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529953.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 21144..22289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529952.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 22314..24224 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529951.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 24212..24643 product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066524.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 24762..26084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529950.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 assembly_gap 25490..25499 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 26100..27224 product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529949.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 27542..29221 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529948.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(29294..29941) product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529947.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 30067..31104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 assembly_gap 30761..30770 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(31091..31648) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529945.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 31780..32241 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529944.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 32238..33614 product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529943.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 33716..34771 product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529941.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 35016..37217 product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529939.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 37223..38170 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529938.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(38335..39417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529936.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 39583..40020 product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529935.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 40091..40864 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529934.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 40913..41221 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529933.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 41335..42387 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529931.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(42475..43251) product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(43255..44421) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 44856..46532 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529924.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene leuA CDS 46720..48492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529923.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 48625..49419 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529922.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 49496..50113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529921.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(50103..51038) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529920.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 51107..51610 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529919.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(51613..52602) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529918.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 52878..53414 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529917.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 53529..54290 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529916.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 54296..55468 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529915.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 sequence023 source 1..53975 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(716..1087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 assembly_gap 740..749 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 992..1456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 note possible pseudo, frameshifted CDS 1453..1962 product tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531123.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(1973..2776) product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(2833..3216) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531125.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 3568..4578 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531126.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 4581..5405 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531127.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 5392..6243 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 6440..7738 product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 7741..9138 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 9349..9930 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173711.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 9930..10517 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531132.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(10565..13027) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531133.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(13024..14205) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531134.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(14205..14471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(14459..14923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 assembly_gap 14541..14550 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14920..17373) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531136.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(17389..17976) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210333952.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 18212..18916 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173710.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(18942..20279) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531139.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 20278..20433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(20505..21095) product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531140.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 assembly_gap 20755..20764 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21088..22305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(22248..24074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 note possible pseudo, frameshifted assembly_gap 22573..22582 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24071..24367) product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531142.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(24380..25639) product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531143.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 25796..28348 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531144.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 28493..28777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023812335.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 28983..30422 product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531146.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 30419..31777 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531147.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 31897..32331 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531148.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 32328..33335 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531149.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 33366..34835 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109667839.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 34844..36085 product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531151.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 36082..36834 product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531152.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 36991..39552 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531153.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 39585..40481 product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172389.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 40579..40926 product peptidase inhibitor family I36 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531155.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 41022..41246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(41257..42222) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531159.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 assembly_gap 42486..42495 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(42547..42693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531161.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(43040..43225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531162.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 43445..44344 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531163.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 44344..44694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116963198.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(44613..45593) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531164.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(45831..46016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531165.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(46202..48289) product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531166.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 assembly_gap 46329..46338 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(48300..49274) product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531167.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(49355..50446) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531168.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(50443..51042) product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531169.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(51035..51337) product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531170.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(51474..52244) product formyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531171.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(52390..52968) product DUF4893 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531172.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(52994..53623) product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531173.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 53688..53828 product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531174.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 sequence024 source 1..49732 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1099 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393521.1:xylulokinase locus_tag LOCUS_17690 CDS 1166..1759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(1749..2711) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529318.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 3024..4034 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246911.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 4169..5107 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971941.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 5134..6654 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103981.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 assembly_gap 5472..5481 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6786..7553 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532887.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 7562..8347 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067339.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 8766..9707 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 9783..10862 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 10859..12838 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 12876..13253 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532891.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(13281..14639) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532892.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 14855..15619 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532893.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(15687..16727) product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532894.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(16737..17702) product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532895.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(17699..18295) product dimethylamine monooxygenase subunit DmmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532896.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(18397..19503) product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532897.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 19817..20104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532898.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 20110..20487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532899.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 20503..20664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532900.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 20679..22091 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532901.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 22127..22816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171620.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 22813..23142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532903.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 23228..24124 product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532904.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 24129..24860 product GXGXG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532905.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 24867..26195 product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010914750.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 26218..27564 product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532906.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene glnT CDS 27659..28912 product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532907.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 28923..29198 product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532908.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 29198..32182 product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532909.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 32175..32798 product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532910.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 33068..35437 product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532911.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 35699..37399 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532912.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(37469..37588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(37688..40834) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532913.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(41069..42217) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532914.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(42271..42876) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532915.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(43249..44889) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532916.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 45092..46057 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532917.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 46149..48203 product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532918.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 48468..49538 product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965983.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 sequence025 source 1..49498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..577 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528701.1:GlxA family transcriptional regulator locus_tag LOCUS_18110 CDS 754..2049 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528700.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 2330..3007 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528699.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 3018..4097 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528698.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 4325..5965 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528697.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 6092..7777 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104548.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 7859..8692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531957.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 8860..8997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 note possible pseudo, frameshifted CDS complement(9055..9408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(9351..9836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 10008..10616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265569.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 10613..11809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918452.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 11796..12752 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918453.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 12749..14053 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918454.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 14050..15069 product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013896057.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 15056..15922 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640008.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(16186..16872) product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532294.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 17027..18085 product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173644.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(18194..18997) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532296.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(19233..21002) product glucan ABC transporter ATP-binding protein/ permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532297.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(21356..29962) product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532298.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 assembly_gap 23740..23749 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(30233..30820) product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532299.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(30825..32498) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532300.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(32524..33342) product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532301.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene hutG CDS complement(33342..34883) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532302.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene hutH CDS complement(34880..36049) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532303.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene hutI CDS 36212..37567 product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532304.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 37592..38338 product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532305.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene hutC CDS complement(38385..38729) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532306.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 38936..39796 product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532307.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene aztA CDS 39796..41565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 assembly_gap 40558..40567 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 41735..42073 product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532310.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(42124..42591) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532311.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 42729..43130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 note possible pseudo, frameshifted assembly_gap 42987..42996 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 43016..43861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 note possible pseudo, frameshifted CDS complement(43882..44418) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973277.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(44415..44708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532315.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(44713..44853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 note possible pseudo, frameshifted CDS complement(44850..45752) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532316.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 note possible pseudo, frameshifted assembly_gap 44914..44923 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(45749..46702) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173642.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(46699..48012) product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532318.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene hmgA CDS 48139..48615 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532319.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 48631..49272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 sequence026 source 1..49385 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(299..961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(1014..2399) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528229.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(2553..3893) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528228.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 assembly_gap 2636..2645 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4004..4456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528227.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(4463..5437) product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528226.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 5339..5599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(5786..6829) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528225.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 6965..7696 product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528224.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 7916..8386 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528223.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(8584..9492) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528222.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 9539..9949 product DUF2000 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528221.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 10144..11028 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081296127.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 11030..12118 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081714208.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 12115..13098 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528218.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 13255..13638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501916.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(13651..14424) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528216.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 14717..15826 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528215.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(16083..17111) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170440.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(17131..18927) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299056.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 assembly_gap 17203..17212 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(18924..19529) product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528212.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(19774..20679) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528211.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 20832..21227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 21233..22180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(22196..22405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 22286..22993 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528184.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(23218..24915) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528183.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene rpsA CDS complement(25119..25769) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528182.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene cmk CDS complement(25766..26092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(26092..27450) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528181.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene aroA CDS 27655..28047 product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528180.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 tRNA 28223..28298 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(28446..29135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 29669..30205 product DUF5706 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021572.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 30202..31065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 31154..31792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(31955..32125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(32273..32617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(32614..35523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(35760..36140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(36205..37281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(37340..37960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(37938..38696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(38900..39100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140250.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(39204..40097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(40084..41424) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240716.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 41788..42123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 42186..42929 product DUF2161 domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531642.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 43440..44171 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531928.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 44168..45370 product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531927.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 45384..46676 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531926.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 46866..47789 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531925.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 47789..48637 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531924.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 sequence027 source 1..49093 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..909 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530675.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 906..2684 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530674.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(2741..3484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 note possible pseudo, frameshifted CDS 3543..4208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 assembly_gap 3594..3603 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4503..4775) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530672.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene minE CDS complement(4772..5587) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530671.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene minD CDS complement(5691..6449) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530670.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene minC CDS 6727..7182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(7241..7702) product phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530255.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(8485..8910) product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 8967..9344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 9286..9753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(9890..10039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007609497.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(10087..10371) product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531539.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(10483..10677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(10808..11131) product DUF2934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530664.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 11270..12673 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530415.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 13007..13459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(13533..14225) product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530663.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(14368..15486) product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530659.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 15912..16121 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003508146.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 16237..16473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 16570..17505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530658.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(18064..19161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(19244..20611) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530657.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(20710..21114) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530567.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 21235..21933 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640466.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 22112..23641 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 note possible pseudo, frameshifted CDS 23581..23772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 note possible pseudo, frameshifted CDS 23894..24760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 24994..27588 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827646.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(27599..29221) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530640.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(29503..30246) product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530732.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(30373..30897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(30912..31334) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391608.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(31371..31820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(31882..33372) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920258.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(33454..34278) product p-hydroxycinnamoyl CoA hydratase/lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920259.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 34383..34835 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807341.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(34974..36506) product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193177.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(36672..36899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 36844..37962 product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191662.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 38067..38729 product phytochelatin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067197.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 38902..39123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(39133..39720) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530731.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 39824..40240 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530730.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 40368..41102 product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530745.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 assembly_gap 41076..41085 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(41119..41520) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532891.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(41636..42628) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270038.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 42787..43179 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114392.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(43210..44718) product winged helix-turn-helix domain-containing tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095517487.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 44861..45103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(45123..46181) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530748.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(46276..47061) product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312095.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 47363..48118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 misc_feature complement(48260..>49093) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530032.1:DUF2778 domain-containing protein locus_tag LOCUS_19600 sequence028 source 1..46669 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1..564) product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529627.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(669..1298) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529626.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene upp CDS complement(1436..2410) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529625.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 2545..3321 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529624.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene ubiE CDS 3350..4924 product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529623.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene ubiB CDS 5005..5256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 5347..6819 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529620.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene coaBC CDS complement(6841..8166) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969977.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 8263..9105 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969978.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(9136..10602) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529649.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(10776..11324) product DUF992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529650.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(11332..11808) product DUF992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529651.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(12043..12897) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529652.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(13033..13296) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529653.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene rpsU CDS complement(13475..13861) product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529654.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(14129..14725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 note possible pseudo, frameshifted CDS 14849..16246 product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529656.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 16310..16606 product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529658.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 16603..19596 product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529659.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 19589..20167 product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529660.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 20228..20449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529661.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(20520..20765) product DUF680 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529664.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(20985..21629) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529665.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(21777..22553) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206876.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(22572..23606) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529667.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(23603..24127) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529668.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(24128..24943) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529669.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 25074..26315 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529670.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 26384..27403 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529671.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(27589..30720) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529677.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(30717..31880) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529678.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(32051..32878) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529679.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 33027..33845 product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529680.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 33865..35421 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529681.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 35509..36879 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529682.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 36948..37460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 37450..37869 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651037.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 37886..39271 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529683.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 39292..40464 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529684.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 40709..41815 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529685.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 41877..42791 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097572960.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 42788..43579 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529687.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 43605..44669 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529688.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 44824..46374 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529689.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 sequence029 source 1..46655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1277..2101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 assembly_gap 2327..2336 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2343..2537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(2558..4435) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532466.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 4572..4709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(4832..5278) product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532467.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(5447..5650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532468.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(5643..6305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(6239..6691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 assembly_gap 6374..6383 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6699..7532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504290.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 7643..8611 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532472.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(8936..9100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531552.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 9241..9411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 9489..11567 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532458.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 11663..11854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 11972..12268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 12336..12515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 12765..13067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(13169..13957) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532435.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(14195..14770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525013.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(14996..15508) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532473.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 15781..16416 product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391283.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene bluB CDS complement(16513..16764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 16899..17321 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531616.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene ndk CDS 17829..18026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(18086..18349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 18587..19717 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077380485.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 20006..20677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(20846..21490) product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532477.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 note possible pseudo, internal stop codon, frameshifted CDS complement(21569..22051) product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532478.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(22053..22310) product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532479.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene moaD CDS complement(22312..22908) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532480.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene pgsA CDS complement(23012..25087) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532481.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene uvrC CDS complement(25084..25848) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532482.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 26264..26908 product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532483.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(27242..27424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(27505..27888) product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130493709.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(27979..28695) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532484.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(28847..29230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(29862..30389) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705212.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 30454..31077 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966328.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(31084..31536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532490.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(31720..32568) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532491.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(32576..33199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532492.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(33216..33872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 33996..34469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 35396..36451 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532493.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 36448..37587 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532494.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene galE CDS complement(37816..38199) product DUF995 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032808990.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 38739..39665 product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532498.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 39662..40705 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136620024.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(41101..43482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 assembly_gap 43579..43588 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(43904..44623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(44791..45309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 sequence030 source 1..46298 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(476..1330) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530007.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene lgt CDS 1462..1764 product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530008.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 2081..2581 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530009.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 2600..2959 product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530010.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(3115..4137) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530012.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(4358..5773) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530013.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(5823..6542) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530014.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(6529..7062) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505623.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 7295..8188 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530016.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 8336..8644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530017.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 8763..9404 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530018.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(9625..10053) product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530019.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(10248..10460) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530020.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(10811..11023) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006202520.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 11537..11938 product Kazal-type serine protease inhibitor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530021.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 12166..13800 product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172931.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(14025..14378) product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530023.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(14389..14817) product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530024.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(14941..15129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(15235..16824) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530028.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(17965..21114) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064980587.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene uvrB assembly_gap 20120..20129 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21225..22475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530033.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 22586..23596 product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530034.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 assembly_gap 23571..23580 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23693..24664 product DUF3137 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530035.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(24668..25150) product DUF2314 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530036.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(25204..25461) product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931770.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(25585..26145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530041.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 27233..28171 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(28264..29187) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530045.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 assembly_gap 28796..28805 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(29184..30395) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(30392..32008) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530047.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 32216..33157 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032931383.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 33261..33653 product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530049.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 33757..34017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(34118..34486) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504168.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 34580..35185 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530052.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(35922..37223) product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327635.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 37394..38320 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530053.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(38330..39238) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530054.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 39352..39942 product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530055.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(39945..41255) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530058.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(41303..42238) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530059.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 42366..43388 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530060.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(43404..44042) product LssY C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530061.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(44185..45051) product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530062.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(45165..45752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 sequence031 source 1..44987 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 91..846 product IS21-like element ISRel16 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007539334.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene istB CDS complement(1239..2432) product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331284.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(2519..3490) product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390230.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene proX CDS complement(3522..4454) product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764515.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene proW assembly_gap 4720..4816 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5403..6098 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969994.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 6659..7669 product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390046.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 7666..8649 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 8636..8881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 8973..9740 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 9867..10937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(11411..11692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 11751..11942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 note possible pseudo, internal stop codon CDS 12936..13709 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337431.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 13958..14323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 14368..15339 product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390230.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene proX CDS 15539..17566 product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533008.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 17850..19424 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533003.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 19455..20378 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533004.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 20380..21273 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533005.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 21312..22283 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533006.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 22280..23290 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533007.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 23374..24180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 note possible pseudo, frameshifted CDS 24089..24598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 note possible pseudo, frameshifted CDS complement(24676..24933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 25279..25500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(25814..25993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(26082..27680) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533003.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(27795..29375) product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532332.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(29716..31047) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 31174..31356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(31317..31766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 32834..33583 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331279.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 33694..35022 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706800.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene gabT CDS 35338..35574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(35711..35959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 36890..38542 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533329.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 38893..39405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 note possible pseudo, frameshifted CDS 39731..40021 product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243280.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 40240..40437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 40784..41980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 42089..42730 product IS21-like element IS21 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544830.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene istB note possible pseudo, frameshifted CDS 42831..43175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 sequence032 source 1..44874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 284..2488 product adenylate cyclase CyaD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969598.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene cyaD2 CDS complement(2650..3522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(3829..3999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(4328..4618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 tRNA complement(4919..4993) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(5185..6363) product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827387.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(6651..8486) product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531993.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene phaC CDS 8584..8991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531992.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 9037..10254 product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531991.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 assembly_gap 10398..10407 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10434..11630 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531990.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 assembly_gap 11766..11775 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11867..12850 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531987.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene glpX CDS 12898..14730 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531985.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene recJ assembly_gap 14306..14315 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14738..15712) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173662.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(15795..16253) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531983.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene hisI CDS complement(16290..16925) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531982.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene folE CDS 17168..17614 product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531981.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(17623..18528) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531980.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 18848..19222 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531978.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene yidD CDS 19369..20187 product class D beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531977.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene blaOXA CDS 20341..22317 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531976.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene thrS CDS 22403..23341 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531975.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(23354..24319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531974.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(24312..24596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 24484..25068 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531973.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 25070..25678 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531972.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 25724..26398 product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531970.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(26432..27313) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(27313..27765) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531968.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 27918..28364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 note possible pseudo, frameshifted assembly_gap 28285..28294 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 28325..29023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 note possible pseudo, frameshifted CDS complement(29074..30111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 assembly_gap 30126..30135 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 30245..30739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(31077..33134) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531965.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene parE CDS 33367..34299 product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531964.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene cpaB CDS 34327..35769 product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531963.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 35774..36049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 36078..37292 product CpaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531961.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 37289..38710 product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531960.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 38714..39679 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531959.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 39681..40649 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531958.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 40834..41262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531956.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 41664..42836 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531955.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(42850..44868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 sequence033 source 1..44228 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(405..779) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529829.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(891..1982) product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529828.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 2169..2468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(2405..3340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(3477..4361) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529827.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(4365..6776) product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529826.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(6783..10142) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529825.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(10249..11439) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529824.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 11547..12458 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529823.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(12459..14780) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529820.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(14905..16083) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529819.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(16117..17313) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529818.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(17380..18414) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529817.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(18438..19235) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529816.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(19228..20148) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529815.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(20148..21242) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529814.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(21361..22287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 note possible pseudo, frameshifted CDS complement(22185..23009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 note possible pseudo, frameshifted assembly_gap 22366..22375 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23271..23924 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529812.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 23948..24979 product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529811.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(25023..26216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 26748..27377 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529810.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 27374..28144 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529809.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(28263..28697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529808.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(28694..29776) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529807.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene flhB CDS complement(29798..30814) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529806.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(30858..31247) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529805.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene fliN CDS complement(31281..32219) product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529804.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(32254..33129) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529803.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene motA CDS 33308..34084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 34092..34814 product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529801.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene flgF CDS 34819..36225 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529800.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene fliI CDS 36206..37051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529799.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 37155..37535 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529798.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene flgB CDS 37538..37957 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529797.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene flgC CDS 37954..38286 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529796.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 38296..39084 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529795.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene flgG CDS 39091..39639 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529794.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene flgA CDS 39639..40877 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529793.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 40881..41459 product MotE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032808152.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 41456..42160 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529791.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene flgH CDS 42187..42681 product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529790.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 42678..43409 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529789.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene fliP sequence034 source 1..43946 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 902..1789 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528030.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 1786..4227 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528031.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(4232..4864) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170453.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 4981..5877 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528033.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(5896..6819) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528034.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(6902..8182) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528035.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 8357..10111 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528036.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 10196..10636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(10647..11687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 note possible pseudo, frameshifted assembly_gap 11869..11878 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12293..12556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 12811..13278 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528038.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(13426..14958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(14955..16565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(16643..17407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(17598..19190) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528039.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(19295..19537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(19623..20159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564969.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(20173..20454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 20650..22467 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729746.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 22523..23605 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528042.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(23602..24975) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403192.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(25109..25615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 note possible pseudo, internal stop codon CDS complement(25760..25903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 note possible pseudo, internal stop codon CDS complement(26088..26888) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241590.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(26904..27155) product DUF6356 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528043.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 27304..27741 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528044.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 27827..28312 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528045.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene dut CDS 28312..28971 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528046.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 29149..29973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528047.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 30052..30855 product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528048.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(30865..31560) product sulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528050.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(31625..32527) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528051.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 32804..33796 product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528052.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 34087..34803 product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528053.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 35180..36322 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532601.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 36583..36756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(36852..37952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(38079..40358) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528054.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(40505..41695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 assembly_gap 42412..42421 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 42430..42924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 note possible pseudo, frameshifted assembly_gap 42865..42874 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence035 source 1..43361 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1017..1382 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910112.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 1373..1954 product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531090.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 1959..2561 product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531091.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 2596..2928 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 3035..4225 product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531092.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 4226..5503 product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531093.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 5514..6818 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531094.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene nuoF CDS 6893..7588 product NADH-ubiquinone dehydrogenase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531095.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 7663..9744 product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531096.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene nuoG CDS 9747..10790 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531097.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene nuoH CDS 10790..11281 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531098.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene nuoI CDS 11411..12031 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531099.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 12033..12341 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910101.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene nuoK CDS 12352..14325 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531100.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene nuoL CDS 14325..15830 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531101.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 15849..17285 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531102.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene nuoN CDS 17302..18111 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531103.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 18147..19817 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531104.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 19945..20349 product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531105.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene mce CDS 20346..20630 product DUF1467 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531106.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 21162..22490 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531107.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 assembly_gap 22567..22576 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22618..23802 product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531108.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 23802..24482 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160544.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 24994..26244 product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531110.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(26264..27007) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531111.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene lipB tRNA 27245..27329 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(27474..30158) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933304.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(30230..30922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 note possible pseudo, frameshifted CDS complement(30916..31173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 note possible pseudo, frameshifted assembly_gap 30931..30940 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(31262..32161) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329405.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene sucD CDS complement(32176..33363) product malate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329404.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(33382..34338) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163160.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(34351..35541) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243814.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(35663..36280) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329401.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 36724..38142 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531112.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene mgtE CDS 38268..38654 product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531113.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(38676..39152) product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531114.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(39149..40150) product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531115.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(40367..41545) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929288.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 41693..42370 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397451.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 42666..42845 product CbtB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531117.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 sequence036 source 1..43005 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(133..489) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530112.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(1052..1363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 assembly_gap 1398..1407 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1420..1881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 note possible pseudo, frameshifted CDS complement(1913..2377) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530114.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 2570..3364 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530115.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(3376..3975) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530116.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 4072..5256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 assembly_gap 4916..4925 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5166..5816) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530118.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(5865..6773) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173776.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 assembly_gap 5986..5995 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6935..8296) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530120.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 8549..9004 product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504117.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene mntR CDS 9102..9290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530122.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(9313..11361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 11567..12478 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530123.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 12640..13908 product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530124.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(14057..15262) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530125.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene carA CDS 15520..15969 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530126.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(16003..16569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 note possible pseudo, frameshifted CDS complement(16554..16988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 note possible pseudo, frameshifted CDS 17109..17666 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530142.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(17760..18941) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530145.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(18973..19281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(19399..21063) product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530146.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 21451..21618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 note possible pseudo, internal stop codon, frameshifted CDS 21956..23899 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530148.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene dnaG CDS 24266..26296 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530149.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene rpoD CDS 26514..26807 product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530150.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 26990..27370 product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530151.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(27423..27680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 27951..28619 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530152.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(28712..28972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(29026..29535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 note possible pseudo, frameshifted CDS 29832..30491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 30559..30852 product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530153.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(30864..31607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 note possible pseudo, frameshifted CDS complement(31640..33439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 note possible pseudo, frameshifted CDS complement(33436..34818) product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172865.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(34987..35628) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530163.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 35738..36694 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530164.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(36627..37253) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530165.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 37320..37745 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530166.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 38037..40892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(40941..41891) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530167.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 42060..42932 product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530168.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 sequence037 source 1..42215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(248..1243) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528379.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(1306..2850) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528380.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(2965..3777) product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528381.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 note possible pseudo, frameshifted assembly_gap 3835..3844 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4533..5648 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502024.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 5720..6025 product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038219.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 6049..6561 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038220.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 6655..7455 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526186.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 8071..9546 product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920255.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 9569..10336 product coniferyl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401012.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 tRNA complement(10388..10464) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(10657..11604) product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528385.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 assembly_gap 11179..11188 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11959..12846) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528386.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(13651..14262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23660 assembly_gap 14023..14032 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14293..14841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 note possible pseudo, frameshifted assembly_gap 14796..14805 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14841..15317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 note possible pseudo, frameshifted CDS 15643..16749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528388.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 16832..17452 product nucleoside triphosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528389.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 17552..17872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(17902..18606) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528391.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(18757..19965) product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528392.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(19970..20224) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528393.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 20752..21273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 note possible pseudo, frameshifted assembly_gap 20765..20774 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21302..21604 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528395.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 21615..21869 product DUF1272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528396.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 21907..22512 product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528397.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 22509..22814 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528398.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(22859..23350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528399.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(23480..23851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS 24019..25749 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170136789.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene ureC assembly_gap 25426..25435 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 26214..26444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23830 note possible pseudo, internal stop codon CDS 26523..26807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 note possible pseudo, internal stop codon CDS 26868..27473 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969342.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 27470..28069 product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528404.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene ureE CDS 28062..28727 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173514.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 28724..29164 product DUF3995 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528406.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 29161..29793 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528407.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene ureG CDS 29871..30638 product class II aldolase and adducin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528408.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(30721..31353) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528409.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 assembly_gap 31716..31725 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 31743..32528 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528410.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 note possible pseudo, frameshifted CDS 32845..33753 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528412.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene gcvA CDS 33949..35259 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528413.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 35400..36272 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528414.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 36284..37108 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528415.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 37161..38165 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528416.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 assembly_gap 38222..38231 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 38269..38946 product L-iditol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528417.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 39120..40598 product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528418.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 40619..41302 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528419.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 sequence038 source 1..41931 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..643 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530715.1:ATP-binding protein locus_tag LOCUS_24010 CDS complement(702..1688) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528455.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(1768..2841) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530576.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(2841..4358) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976197.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(4355..5359) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028064.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(5522..6748) product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532433.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(6924..7169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530767.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 7438..7698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(7739..9133) product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530540.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 9378..9716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530794.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 9847..10014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531988.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 10089..10346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530770.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 10472..10930 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530776.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 11396..11941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(11950..12219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 12388..12582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(12944..13462) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530793.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene msrA CDS complement(13587..14486) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525230.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(14598..14921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531611.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(14921..15115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530788.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(15100..15339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(15443..15646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(15643..16725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(16941..17174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 17253..18107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(18196..18885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(18830..19192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(19185..19643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 19954..20460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 20547..20852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 20874..21623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918147.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 21720..22025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530780.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(22125..22547) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530779.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(22853..23608) product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035685.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 23764..24240 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930202.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(24230..24700) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421494.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 24811..25365 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836254.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(25481..26845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(26969..27127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(27443..27799) product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525746.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 28141..28296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(28329..29300) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531569.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 29595..29912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 29919..30200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(30204..30923) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339467.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 31205..31726 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530428.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 31906..32280 product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530978.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 32489..33388 product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531673.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(33441..33737) product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530721.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(33747..34046) product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531722.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 34508..34693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 34933..35148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 35161..35361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(35388..35678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS 36462..36683 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167484192.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 36899..37243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(37251..37622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(37632..37829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 38233..38727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533214.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 38888..39118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 39156..39638 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531555.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 39662..39970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(40019..40477) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530158.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 40667..41413 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530159.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 41410..41709 product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530160.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 sequence039 source 1..41684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 572..1354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 1441..2085 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(2376..3626) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244177.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(3630..4370) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524793.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(4446..4667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 4698..5111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(5147..5755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(6085..6423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311963.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(6442..7002) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393195.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(7006..9372) product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393193.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(9369..10547) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393192.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(10544..11065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975309.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(11195..12937) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975308.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(13242..14384) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254833.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 14621..14923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 15037..15267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(15344..15946) product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525272.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(15979..16749) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258646.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 16657..16947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(17059..18444) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416624.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 18675..18980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530714.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(19150..19464) product MocE family 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968075.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(19529..20476) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528361.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(20645..21652) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968074.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(21676..22467) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393072.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(22751..23689) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097615290.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 23937..24209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(24238..24579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 24732..26846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 26993..27805 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970863.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(27896..28726) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564977.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 28962..29171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525120.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(29192..29824) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530706.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 30196..30696 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530702.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 30765..31541 product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530701.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 assembly_gap 31357..31366 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 31538..33832 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530700.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(33924..34934) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404431.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 35032..35964 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113398.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(35981..36739) product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087714.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(36736..38106) product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087715.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 38422..38817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173730.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(38845..39390) product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680960.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 39592..39885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(39921..41459) product winged helix-turn-helix domain-containing tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402524.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 sequence040 source 1..41571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(319..900) product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531317.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(897..2015) product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531316.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 2247..2387 product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531315.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 2439..2579 product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531314.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 2994..4403 product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531313.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene trmFO CDS complement(4404..5354) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564975.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(5354..5782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531309.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(5864..6712) product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172317.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(6714..7103) product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531307.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(7114..9669) product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene secDF CDS complement(9722..10060) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531305.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene yajC CDS 10337..11212 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531304.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(11309..12526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 12679..13212 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529308.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 13349..14950 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529309.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(15213..16373) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529310.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(16366..17154) product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529311.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 17379..18167 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529312.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 18327..19145 product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528003.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 19142..20530 product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528002.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene chrA CDS 20734..22128 product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530218.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 22325..23221 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531798.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 assembly_gap 23121..23130 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23241..23900 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531799.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 23963..25300 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531800.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 25300..26238 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531801.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 26240..27061 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531802.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS 27098..28156 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531803.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene ugpC CDS 28420..29349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(29527..30489) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969507.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 30946..31986 product trans-3-hydroxy-L-proline dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975160.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 tRNA complement(32135..32211) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(32368..33531) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529349.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 33747..34919 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529350.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 34924..36048 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529351.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(36067..36357) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503732.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(36369..37658) product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529353.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(38276..39256) product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529354.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(39327..40238) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529355.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(40249..40401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529356.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 40654..41265 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529357.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 sequence041 source 1..41557 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529738.1:DUF882 domain-containing protein locus_tag LOCUS_25490 tRNA 898..971 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(1127..1765) product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529740.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(1851..2063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 1972..2874 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529741.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 2995..3738 product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529742.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 3955..4716 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529743.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(4746..5930) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529745.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 6014..6700 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529746.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS 6714..7703 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529747.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 7703..7885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 note possible pseudo, internal stop codon assembly_gap 7892..7901 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7956..8933 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529749.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(8941..10128) product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529750.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(10137..10781) product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529751.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(10893..11792) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529752.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(11796..12638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25630 note possible pseudo, frameshifted CDS complement(12557..13012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25640 note possible pseudo, frameshifted assembly_gap 12653..12662 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13553..14686 product ornithine/lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529754.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene odc2 CDS 14786..15493 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529755.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(15599..15883) product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(16055..16576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529757.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(16605..17021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529758.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(17030..17584) product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529759.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 17750..18019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(18016..18405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529767.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(18410..19162) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529768.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene fliR CDS complement(19159..21246) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529769.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene flhA CDS 21386..21685 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529770.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 21832..22935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 note possible pseudo, frameshifted assembly_gap 22920..22929 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22932..23561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 note possible pseudo, frameshifted CDS 23708..24367 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530470.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 24444..25484 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530469.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 25507..26379 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160916.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 26379..27176 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530467.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 27173..27673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25820 note possible pseudo, frameshifted assembly_gap 27656..27665 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 27673..28296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 note possible pseudo, frameshifted CDS 28334..29719 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530465.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 29780..30148 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530464.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(30185..31828) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529772.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(32016..33890) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027075.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene asnB CDS complement(34040..34306) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529773.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene fliQ CDS complement(34329..34736) product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529774.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene flgD CDS complement(34736..35179) product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529775.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene flbT CDS complement(35176..35523) product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529776.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 gene flaF CDS complement(35555..36604) product flagellar hook-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529777.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(36608..36895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 note possible pseudo, frameshifted assembly_gap 36900..36909 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 37057..37302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 37948..38130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(38058..39311) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529779.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(39409..40077) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529780.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(40311..40901) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050596211.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 misc_feature complement(40831..>41557) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011974483.1:flagellar hook-length control protein FliK locus_tag LOCUS_25990 sequence042 source 1..40815 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(567..800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 1285..2796 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254000.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(2898..4826) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967293.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(4984..5538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(5538..5795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26040 assembly_gap 5566..5575 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5805..6665) product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170199.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 6989..8905 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564967.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 8954..10918 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564967.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 11240..11872 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532366.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 12045..13268 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163217.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(13320..14024) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114283.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 14176..14487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 14559..15074 product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032899511.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(15082..17859) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974776.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(18132..19664) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532370.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(19996..21219) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532371.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(21242..21703) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532372.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 22148..22612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 note possible pseudo, frameshifted assembly_gap 22952..22961 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22979..23260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 note possible pseudo, frameshifted CDS 23257..24831 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203086395.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 24951..28052 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266339.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 28128..28538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058776.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 assembly_gap 28711..28719 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 28737..28880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(28895..30394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 30544..31377 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532382.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(31374..32309) product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085299.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(32491..33624) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171838.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(33621..34901) product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532384.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(34915..36096) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532385.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 36225..36851 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171837.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(36856..37734) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530651.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 37860..38621 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275285.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(38618..39442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532387.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 39506..40300 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532388.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 sequence043 source 1..40684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(248..952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531598.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS complement(952..1611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531599.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(1651..1857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(1919..2410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531601.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(2423..3247) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531602.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(4796..7165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531609.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(7273..7458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(7430..8035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(8095..8730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(8799..9119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531611.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(9119..9307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(9286..9543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(9545..9757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(9760..10431) product glycosyl hydrolase 108 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531615.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS complement(10441..11832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 11954..12337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(12412..13836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531618.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(13811..14074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(14071..14349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(15031..15873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26530 assembly_gap 15078..15087 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15870..17459) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913116.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(17456..17806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(17803..18684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(18681..18866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(18863..19072) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165815993.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 19192..19662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 19659..20864 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531626.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 tRNA 20938..21027 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(21631..21918) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532019.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 22074..22463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(22863..24881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 25142..25957 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 25954..26913 product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 26876..27556 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065795.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 27553..28746 product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122758.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 28746..29684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 29686..30666 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546066.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(30723..31433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 31389..31706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 32110..33555 product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525276.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(33570..34094) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525282.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS 34263..34670 product DUF930 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032808257.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 34861..35520 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531644.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 35641..36954 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531645.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene rimO CDS complement(37022..38089) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531647.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(38142..39062) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531648.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(39062..40171) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531649.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 misc_feature complement(40171..>40684) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063172149.1:ABC transporter ATP-binding protein locus_tag LOCUS_26800 sequence044 source 1..40648 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 293..1180 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531403.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 tRNA complement(1252..1325) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(1415..1499) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 1709..2563 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531400.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene rlmB CDS 2577..2990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(3128..4045) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531399.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(4153..4950) product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531398.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene hyi CDS complement(4977..6770) product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531397.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene gcl assembly_gap 6115..6124 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6926..7726 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531396.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 note possible pseudo, frameshifted assembly_gap 7629..7638 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7642..7863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26880 note possible pseudo, frameshifted CDS 7937..8395 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532225.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(8396..8752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531395.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(8937..9254) product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531394.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(9434..9601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531392.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 tRNA 9881..9956 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(9992..10432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS complement(10419..11027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(11024..11761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 12102..12302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 12586..12987 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038770.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(13052..13225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 13303..13503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 13629..13904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 14143..14322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(14709..15005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(14980..15441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(15531..16352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(16459..17025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(17313..19685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS complement(20319..20513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(20510..21787) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240716.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(21925..22152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(22174..22833) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531378.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(22994..23728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 note possible pseudo, frameshifted assembly_gap 23733..23742 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23885..24034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(24504..25538) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531376.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 25811..26014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 26694..27467 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531374.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 27693..29213 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172295.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(29281..29877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531372.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS complement(30127..30735) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531371.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(30891..31277) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531370.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(31409..31780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531369.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(32079..32507) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531368.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS complement(32570..33538) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531367.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene prfB CDS complement(33830..36286) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531366.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS complement(36498..37679) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531365.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 sequence045 source 1..40035 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 426..920 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532245.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene ribH CDS 917..1417 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532244.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene nusB CDS 1414..2640 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532243.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(3081..3314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27280 assembly_gap 3501..3510 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3578..4642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 note possible pseudo, frameshifted assembly_gap 4553..4562 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4594..5043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27300 note possible pseudo, frameshifted CDS complement(5111..8479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(8484..8855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS complement(9149..9697) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532236.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 assembly_gap 9180..9189 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9814..10350 product ubiquinol-cytochrome C chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532235.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 10361..10909 product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532234.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 11059..12105 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504675.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene plsX CDS 12115..13086 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532232.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 13189..13512 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532231.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 13644..14186 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532230.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(14306..14581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 16084..16353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27410 tRNA 16478..16554 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(16641..17903) product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532223.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(17900..19435) product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532222.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(19588..20718) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532221.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(20727..21245) product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532220.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 21551..23725 product exopolysaccharide transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532219.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS complement(23785..25011) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532217.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 25102..26160 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532216.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(26327..26725) product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089492.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(26777..27229) product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329997.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(27230..27451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329187.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(27484..27876) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531183.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(27940..28350) product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531186.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(28347..28670) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531187.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(28781..28996) product DUF2842 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532215.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 29149..30240 product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532214.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(30453..31385) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532212.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene argC CDS complement(31416..32417) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532211.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene speB CDS 32542..33804 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532210.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 33837..34895 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532209.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(34947..35819) product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532208.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 35914..36825 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532207.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(36886..37362) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532206.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene rpsI CDS complement(37362..37826) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532205.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene rplM CDS complement(38054..38518) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532204.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 38703..39524 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532203.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 39550..39972 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532202.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 sequence046 source 1..36508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1068 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532629.1:bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase locus_tag LOCUS_27680 CDS 1215..1685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(1791..4112) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532627.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(4281..6926) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532626.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene pepN CDS 7081..7260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 7257..8228 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532624.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 assembly_gap 8023..8032 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8269..9081) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532623.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(9167..10084) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171746.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS complement(10134..10685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532621.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 10973..12652 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532620.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 12794..13393 product DUF922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532619.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(13413..14423) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532618.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(14561..16063) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505273.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS complement(16202..16396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532616.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS complement(16429..16581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(16762..17103) product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532615.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 17538..17804 product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532614.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 17893..18072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 18122..19243 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532613.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(19290..21266) product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532612.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(21316..21645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532609.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(21805..22344) product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(22346..23953) product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532608.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 24201..24593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(24611..25774) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532607.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(25827..26456) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532606.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(26510..26794) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402696.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(26914..28026) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532603.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(28122..28445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967309.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(28704..29678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 30026..31525 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442740.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 31565..32518 product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966354.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(32725..33522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026616082.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 34035..35606 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532602.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 35631..35819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 sequence047 source 1..35742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..968 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028173732.1:HlyD family type I secretion periplasmic adaptor subunit locus_tag LOCUS_28030 CDS 1200..2105 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027134.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 2138..2872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 2940..3668 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812168.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS 3748..5127 product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532193.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 5322..6596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(6668..8350) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066541.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 gene ade CDS 9092..10159 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976242.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 10304..10747 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530517.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(11065..11460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28120 note possible pseudo, frameshifted CDS complement(11463..12251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28130 note possible pseudo, frameshifted assembly_gap 11496..11505 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12516..12752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533630.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 12878..14128 product pilus assembly protein TadG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531999.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 14133..14573 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531998.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 14563..14970 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531997.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 15268..16119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528937.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(16242..16487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 16368..16775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311637.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(16860..17183) product exopolysaccharide production repressor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530628.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(17417..17713) product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082959.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(17952..18953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(19127..19846) product DUF1236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013894153.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 20048..20347 product DUF1236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530625.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 20546..20767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532436.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(20858..21181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530627.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 21340..21696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530773.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 assembly_gap 21628..21637 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21684..22013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 assembly_gap 22331..22340 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22591..22800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 22898..23152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS 23609..23809 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061019.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 24041..24403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS 24400..24585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109672801.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(24690..24935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS complement(24975..25277) product DUF1236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531386.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(25274..25612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(25966..26166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(26340..26558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(26627..26836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(27184..27393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 27784..28095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 28335..28970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267784.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(29019..29363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(29465..30553) product GSU2403 family nucleotidyltransferase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081162719.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(31162..32211) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018642169.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(32333..32944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 33046..33339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 33412..33684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 assembly_gap 33457..33466 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 33761..34618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530585.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 34710..35369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 35290..35595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 sequence048 source 1..35637 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1778..2188 product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533653.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(2341..3156) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533652.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 3447..4178 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533651.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 4277..4915 product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533650.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 4928..5677 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533649.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(5826..6725) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533648.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene ppk2 CDS 6886..8151 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171201.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 8263..8988 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533646.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 gene phoU CDS 9080..10090 product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533645.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(10210..10728) product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533644.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 11085..12284 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533643.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS 12302..13213 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533642.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 gene argF CDS 13316..14323 product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533641.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(14438..15247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(15351..15743) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533640.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene apaG CDS 15969..17105 product ceramide glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533639.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 assembly_gap 16969..16978 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17128..18315) product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533638.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 18534..19628 product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533637.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 19726..20499 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533636.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(20672..21664) product GguC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533635.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene gguC CDS complement(21966..23258) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533634.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene gguB CDS complement(23255..24790) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533633.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene gguA CDS complement(24980..26047) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533632.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene chvE CDS 26341..27330 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533631.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 27842..28294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(28530..28733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 tRNA complement(29275..29348) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 29526..30479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 30493..31251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 31356..31619 product DUF6460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533620.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(31623..32525) product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533619.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 32686..33966 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173551.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(34035..34517) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529453.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 34625..35023 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089793.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 misc_feature complement(35087..>35637) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533617.1:quinone-dependent dihydroorotate dehydrogenase locus_tag LOCUS_28860 sequence049 source 1..34940 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 691..1245 product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530932.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene tsaA CDS 1245..1559 product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530931.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 1673..2632 product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530929.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 2766..3674 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530928.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 assembly_gap 3041..3047 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3727..4341) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530927.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 4537..5103 product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530926.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(5149..6270) product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530925.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(6383..6718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(6833..7609) product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530924.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene tam assembly_gap 7104..7113 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7762..9411) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530923.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene ettA CDS 9673..10932 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240324.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(10970..11980) product ribonuclease T(2) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530922.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 12170..13102 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530921.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS 13186..14361 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530920.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 14358..16007 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530919.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(16075..16515) product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530918.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(16660..17943) product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534205.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 18067..18525 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530917.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(18566..19537) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530916.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(19701..20750) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530915.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 assembly_gap 19738..19747 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(20747..21625) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530914.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(21788..22579) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530913.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 22710..23114 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530912.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(23195..23572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172509.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(23575..25026) product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530910.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene hydA CDS complement(25091..26341) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530909.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(26411..27739) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530907.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 27982..28623 product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530906.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS complement(28638..29510) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530905.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 29599..30462 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530904.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 30455..31177 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530903.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(31216..31710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(31805..32182) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530897.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(32246..32704) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530896.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS complement(32710..33261) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530895.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(33357..34670) product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530894.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene preA sequence050 source 1..34365 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..892 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530369.1:RsmB/NOP family class I SAM-dependent RNA methyltransferase locus_tag LOCUS_29230 CDS 988..1446 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530371.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 1450..2106 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530372.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 2162..3724 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530373.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 gene guaA CDS 4735..5772 product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533354.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 6619..7335 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397232.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(8023..8559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(8756..9067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530766.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 9649..9846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS 9895..10116 product DUF768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525056.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 10117..10398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095203224.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 10563..10775 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167484192.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 11259..11681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS 12686..12853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(12909..13937) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530876.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(14062..14205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(14330..14503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(14500..14772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 note possible pseudo, frameshifted CDS 14915..15415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(15729..15989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 16237..16902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS 17000..18271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29440 assembly_gap 18246..18255 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 18363..19964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 19978..20472 product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(20548..20802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 20695..21546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(22238..22480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(22542..22904) product DUF3088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265530.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(23100..24905) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530492.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 25089..26459 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530493.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 26472..27245 product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530494.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 27300..28943 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530495.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 28981..29940 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530496.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS 29937..30824 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530497.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS complement(31061..32401) product FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528704.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 33010..34023 product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528706.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene tauA sequence051 source 1..34197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 317..392 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(515..2083) product indolepyruvate oxidoreductase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527965.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(2076..4229) product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527966.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(4279..4761) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527967.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(4761..6332) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527968.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(6622..7413) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527969.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 7533..8486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29640 note possible pseudo, frameshifted assembly_gap 8324..8333 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8483..9121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29650 note possible pseudo, frameshifted CDS 9234..10760 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527971.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 10831..11838 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527972.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 11831..12679 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527973.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS 12676..13566 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527974.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS 13559..14389 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527975.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 14565..16859 product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527977.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 16856..17629 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527978.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 17623..18093 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527979.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 18090..18902 product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527980.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 18984..20132 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527981.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS 20182..20577 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS 20781..21509 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817039.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS 21675..22700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29780 assembly_gap 22491..22500 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22642..22833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS 22934..23719 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527986.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS 23835..24512 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527987.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 24553..25833 product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527988.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(25858..26688) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527989.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(26685..27548) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527990.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(27548..28459) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527991.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(28460..29467) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527992.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(29513..31111) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527124.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 31851..33554 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527994.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 sequence052 source 1..34148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..817 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011971095.1:type IV secretion system protein VirB10 locus_tag LOCUS_29890 CDS 798..1814 product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971096.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene virB11 CDS 1811..3949 product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971097.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 4040..4204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(4228..4701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS 5150..5788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 5778..6230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(6620..6829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 6962..7801 product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531673.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(8086..8319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 8723..8995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184871738.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(8992..9282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525247.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(9317..9784) product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528917.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(10778..10984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971104.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(10991..13450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971105.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(13454..13855) product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971106.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene mobC CDS 14496..15209 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971107.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 15202..15642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234939659.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS 15673..16038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 16309..16818 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036588671.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 17788..18198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 18352..18843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 18740..18946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(19001..19192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 19784..20806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 20914..22824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 22828..24789 product DUF2357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876141.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 24925..27234 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537646.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 assembly_gap 25476..25485 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 28174..28473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 28821..29351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 29348..29527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(29636..30145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(30379..30972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30210 note possible pseudo, frameshifted CDS complement(30948..31535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30220 note possible pseudo, frameshifted assembly_gap 30993..31002 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 31742..32926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 32972..33925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30240 sequence053 source 1..34006 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..532 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011971082.1:thermonuclease family protein locus_tag LOCUS_30250 CDS 640..1179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971080.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 1179..1607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971079.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 1586..1804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS 2633..2884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 3173..3457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS 3474..3893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS 3962..4351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895392.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(4710..5072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS 6811..7818 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971076.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 7989..8195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(8357..9574) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090709.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(9578..11941) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090710.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(11947..12741) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090711.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS 12938..13564 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067207.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 13588..14949 product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327635.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(15170..15616) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525374.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(15680..16963) product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(16972..19428) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021360.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(19478..20983) product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831569.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(20996..21664) product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966090.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(21667..21978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(21998..22390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(22467..22745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(22758..23510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(23557..23967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS 24437..26860 product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965926.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 26912..28132 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391721.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS 28134..29417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS 30090..31355 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967584.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 31509..32036 product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945460.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene hemG CDS 32307..32669 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967601.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 32747..33277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30570 note possible pseudo, frameshifted CDS 33288..33500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325697.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 sequence054 source 1..33716 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 479..1033 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532836.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene moaB CDS complement(1055..2029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532837.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(2236..2739) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532838.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 2889..4043 product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023808673.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 4191..4886 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532840.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(5126..5617) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532841.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(5628..6224) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532842.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(6288..6512) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006206606.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(6580..7338) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532843.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(7402..7794) product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532844.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(8061..9245) product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532845.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(9376..10536) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532846.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 10475..10690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS 10716..11669 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532847.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(11763..13190) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532848.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene der CDS complement(13194..13859) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532849.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 14063..15070 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532850.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(15093..16352) product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532851.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene sbmA CDS complement(16474..17589) product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532852.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(17725..17931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 18027..18941 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532854.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 19164..20420 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532855.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 20443..20799 product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532856.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS complement(21006..21359) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532857.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 21517..21870 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808563.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 21867..22346 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126727.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(22432..22785) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532858.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(22952..23866) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528521.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 assembly_gap 23819..23828 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(23866..25365) product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528520.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 assembly_gap 24946..24955 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(25437..27023) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528519.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene ggt CDS complement(27046..27846) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528518.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(27843..28760) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528517.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS complement(28760..29362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 note possible pseudo, frameshifted assembly_gap 29399..29408 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(29886..30893) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528515.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS 31160..31861 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050596197.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(31871..32926) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532860.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 assembly_gap 32500..32509 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(32916..33524) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532861.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 sequence055 source 1..33274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..701 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530963.1:cell division protein FtsZ locus_tag LOCUS_30960 CDS 1012..1986 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530964.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene lpxC CDS 2204..3073 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530965.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS 3082..4755 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530966.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 gene recN CDS 5039..7246 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530967.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene ligA CDS 7246..7932 product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530968.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS 8049..8777 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530969.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS 8774..9070 product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530970.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS complement(9323..9949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31040 note possible pseudo, frameshifted CDS complement(9835..11175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31050 note possible pseudo, frameshifted assembly_gap 10166..10175 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11260..12132) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530972.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS complement(12142..12720) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530973.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 12932..13429 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310780.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 13490..13978 product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530974.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS 14100..14741 product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530975.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS 14996..15427 product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530978.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(15527..16186) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530979.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 note possible pseudo, frameshifted CDS complement(16093..16401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31130 note possible pseudo, frameshifted assembly_gap 16246..16255 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16533..16814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530980.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(16821..17396) product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 assembly_gap 17570..17579 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17620..18753 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530983.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(18757..20229) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063168296.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(20387..20635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(20632..21180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845917.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 21285..22199 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968210.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 22431..23222 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532670.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(23282..24748) product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530985.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 24957..25271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530988.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(25302..26327) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530989.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS 26525..27553 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530990.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 27550..28458 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530991.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 28575..29588 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530992.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 29678..30475 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530993.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS 30472..31518 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530994.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 misc_feature complement(31525..>33274) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530996.1:UvrD-helicase domain-containing protein locus_tag LOCUS_31300 sequence056 source 1..32181 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(117..1001) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089657.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(1061..1381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089658.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 1526..1891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 1936..2805 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226536.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS complement(2858..4513) product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528300.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(4553..5539) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528301.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(5808..6413) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528302.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(6453..7025) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528303.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(7167..8057) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528304.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS 8154..9149 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528305.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(9389..9991) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528306.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS complement(10032..12440) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528307.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene pheT CDS complement(12437..12859) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528308.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(12856..13941) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528309.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene pheS CDS complement(14037..14438) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528310.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene rplT CDS complement(14476..14679) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006201248.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 gene rpmI CDS complement(14918..15568) product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528311.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS complement(15777..16181) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528312.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene infC CDS 16533..17303 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528313.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 17306..18490 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528314.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS complement(18454..18663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 18635..19039 product DUF2852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528315.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS 19139..19897 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528316.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(19925..20143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528317.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS 20255..20914 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528318.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS 20941..22161 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528319.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene trpB CDS 22164..23003 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528320.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene trpA CDS 23043..23969 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528321.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene accD CDS complement(24349..24624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31590 assembly_gap 24359..24368 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 24604..25434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31600 note possible pseudo, frameshifted CDS 25491..25910 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901099.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(25932..26213) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528325.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS complement(26346..26669) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528326.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene trxA CDS complement(26744..30256) product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528327.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene addA misc_feature complement(30253..>32181) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528328.1:double-strand break repair protein AddB locus_tag LOCUS_31650 sequence057 source 1..31921 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 19..960 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529592.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 assembly_gap 991..1000 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1074..1340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31670 note possible pseudo, frameshifted CDS complement(1794..3245) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529596.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(3254..4153) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529597.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(4244..4684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027161333.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(4701..5240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529599.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(5207..5599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529600.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(5623..6093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529601.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(6335..7240) product bifunctional helix-turn-helix domain-containing protein/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529602.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(7386..7880) product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529603.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS 7903..8709 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529604.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene nth CDS complement(8761..9216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 9427..9963 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529609.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(9971..12448) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114236.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(12778..13530) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529610.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 13734..14699 product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529611.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 14832..15365 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529612.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 15370..16893 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529613.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS 16909..18093 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529614.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS 18090..18938 product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529615.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(18941..19393) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529616.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(19552..19812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS 20091..20489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 note possible pseudo, frameshifted CDS 20473..20637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 note possible pseudo, frameshifted CDS complement(20727..21419) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529648.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(21416..24148) product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529647.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(24220..24789) product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529646.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene kdpC CDS complement(24801..25721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 note possible pseudo, frameshifted CDS complement(25673..26911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 note possible pseudo, frameshifted assembly_gap 25725..25734 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(26908..27123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529644.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(27146..28849) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529643.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene kdpA CDS 29398..31188 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528754.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 misc_feature complement(31344..>31921) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528753.1:amidohydrolase/deacetylase family metallohydrolase locus_tag LOCUS_31980 sequence058 source 1..31911 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 270..1367 product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532575.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 1373..2836 product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532574.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 2960..3232 product DUF3303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532573.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 3332..3970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(3976..4914) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532572.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS 4981..5916 product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532571.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(5927..8065) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532570.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(8220..8828) product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967222.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(8966..10009) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705178.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(10020..10850) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(10976..11614) product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532569.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(11614..12474) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532568.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS 12559..13890 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145923747.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 13972..14553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(14566..15456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171775.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(15467..15745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008874920.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(16073..16450) product TIGR02301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532565.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(16524..16952) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532564.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 17068..17832 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532563.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(17912..18067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532562.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 18459..19892 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532561.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 gene cysS CDS 20071..20478 product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971377.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 20475..20861 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532560.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS 20868..21359 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532559.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 21356..21832 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532558.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS 21829..22797 product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532557.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 gene pip CDS 22985..24601 product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564965.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene cimA CDS 24606..25133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 25255..26175 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532555.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene rarD CDS 26242..26928 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532554.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS complement(26900..27532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS complement(27641..28639) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173629.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 28979..29203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS 29278..30138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(30226..30837) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532550.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 sequence059 source 1..31581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(961..2268) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530962.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene ftsA CDS complement(2265..3194) product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530961.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(3191..4117) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530960.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(4485..5450) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530959.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 gene murB CDS complement(5447..6853) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530958.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 gene murC CDS complement(6850..7977) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530957.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 gene murG CDS complement(7979..9130) product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530956.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 gene ftsW CDS complement(9130..10530) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530955.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 gene murD CDS complement(10539..11621) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530954.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene mraY CDS complement(11648..13081) product UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-diaminopimelate--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530953.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(13115..14551) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530952.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 assembly_gap 14083..14092 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14606..16333) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530951.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(16330..16725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530950.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(16730..17746) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530949.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 gene rsmH CDS complement(17743..18231) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530948.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 gene mraZ CDS 18618..19733 product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530947.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS complement(20279..20992) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530946.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS complement(21178..21945) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530945.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(21942..22661) product DnaJ family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530944.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS complement(22819..23022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS 23212..26826 product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530942.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS 26858..28150 product DUF3419 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530941.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS 28150..28815 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530940.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(28816..30195) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530939.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS 30509..31303 product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530938.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 sequence060 source 1..31462 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(546..2057) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532526.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 gene radA CDS complement(2171..3661) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532525.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(3881..4849) product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532524.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(4967..5287) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532523.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(5379..6668) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532522.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(6945..7529) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532521.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 gene rplI CDS complement(7745..7993) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203718.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene rpsR CDS complement(7993..8484) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532520.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene rpsF CDS complement(8787..10712) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532518.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 10967..11509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 note possible pseudo, frameshifted assembly_gap 11352..11361 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11398..11940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 note possible pseudo, frameshifted CDS 11998..12735 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532516.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene fabG CDS 12948..13184 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203723.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 13219..14502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32720 assembly_gap 14187..14196 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14499..15734 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532514.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 gene mltG CDS 15980..16870 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532513.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 16876..17550 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532512.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 gene gmk CDS 17803..18903 product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525053.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 18857..20905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32770 note possible pseudo, frameshifted assembly_gap 20734..20743 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21090..22475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS 22472..22846 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038081.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS complement(22886..23716) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532511.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene rsmA CDS complement(23742..24770) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532510.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene pdxA CDS complement(24860..25783) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504313.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS complement(25969..28395) product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171795.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(28395..29477) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299091.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 gene lptG CDS complement(29480..30676) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532506.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 gene lptF sequence061 source 1..31216 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 244..1176 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527946.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS 1274..1648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527945.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(1653..2594) product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527944.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS complement(2643..4271) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527943.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(4268..5407) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527942.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(5407..6504) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527941.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(6535..8397) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527940.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(8397..10274) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527939.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(10431..11066) product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527938.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS 11261..11989 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527937.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 12000..12863 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527936.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS complement(12874..13716) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971007.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS 13804..14790 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456725.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(14842..15144) product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527935.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(15166..16107) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527934.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 gene nudC CDS complement(16140..16559) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527933.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS 16962..18776 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527932.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 18853..19176 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527931.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS 19391..20395 product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527929.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 20491..21096 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527928.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 gene recR CDS 21274..22551 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527927.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS 22811..24448 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527926.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS 24467..25534 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527925.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS 25531..26451 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527924.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS 26448..27302 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527923.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS 27299..28045 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527922.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(28052..31141) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527921.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 sequence062 source 1..30579 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 285..1016 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532980.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS 1013..1504 product DUF3830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532979.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS 1497..1850 product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532978.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS 1847..2902 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS 2908..3336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532976.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 3386..4645 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532975.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(5024..6061) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192249737.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(6069..6518) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007537427.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene aroQ CDS complement(6553..6921) product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886723.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(6936..7793) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165918514.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(7812..8573) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007537433.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS complement(8594..9418) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441052.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS complement(9459..10109) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173513672.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS complement(10119..10784) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244575.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(10831..11652) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244574.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(11652..12389) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441056.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS 12645..13538 product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877177.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS 13563..14345 product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018237596.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS 14354..15148 product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027999571.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 gene hpaI CDS 15132..15815 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859589.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS complement(16039..16242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 16821..18554 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171602985.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS complement(18672..18968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(19042..20733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(22076..22294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 22809..23915 product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066875295.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS 23921..24259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS 24256..26367 product large subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063786.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(26297..26893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS 26804..26998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33420 assembly_gap 30318..30327 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence063 source 1..30537 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 855..1946 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975503.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 gene ltrA CDS 2153..2665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS complement(2735..3619) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243246.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene purU CDS complement(3827..4393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(4386..7316) product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532909.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(7313..7618) product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112308747.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(7629..8882) product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536326.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 8979..9992 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973658.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(10791..11765) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530232.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(11893..13239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS 13878..14087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS 14855..16111 product glycine-betaine demethylase subunit GbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244552.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 gene gbcA CDS 16119..17390 product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392670.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 18832..19770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS 20898..21119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS 21541..21993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(22897..23115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33590 note possible pseudo, frameshifted CDS 23544..25208 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532880.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 25314..26228 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095091852.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS 26225..27094 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532882.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS 27087..29204 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532883.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(29929..30435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33640 sequence064 source 1..30522 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(692..1741) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525214.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(1747..3534) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183463334.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS complement(3527..4114) product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525212.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS 4351..5028 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525211.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(5095..5400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530594.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(5614..6645) product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530601.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS 6769..7827 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969874.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS 7834..8892 product D-allose transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046187.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 gene alsB CDS 9034..10020 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707231.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS 10017..10793 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530724.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS 10798..11652 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969271.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(11686..12063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(12104..13549) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085473.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(13591..14376) product coniferyl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401012.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS complement(14379..15440) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533092.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(15437..16333) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533093.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS complement(16330..16713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33810 note possible pseudo, frameshifted CDS 16688..17071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS complement(17047..17787) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089146.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(17813..19129) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110400007.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(19313..20230) product pca operon transcription factor PcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532965.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 gene pcaQ CDS 20323..21132 product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532964.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene pcaD CDS 21125..21529 product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532963.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene pcaC CDS 21522..22274 product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532962.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 gene pcaH CDS 22274..22888 product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532961.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 gene pcaG CDS 22900..23952 product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532960.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS 23952..25124 product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532959.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 gene pobA CDS complement(25103..26362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33920 assembly_gap 25483..25492 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(26363..27166) product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528953.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS complement(27163..28020) product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528952.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS 28112..28894 product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528951.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS 29077..29802 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530802.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 sequence065 source 1..30493 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 479..1816 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533171.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS complement(1862..2284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33980 note possible pseudo, internal stop codon, frameshifted CDS complement(2418..3308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33990 note possible pseudo, internal stop codon, frameshifted assembly_gap 2476..2485 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3677..6526) product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525311.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 gene tssH assembly_gap 5145..5154 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6861..8036 product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525310.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene tssA CDS 8043..8582 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525309.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene tssB CDS 8586..10094 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504477.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 gene tssC CDS 10143..10598 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525307.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS 10585..11340 product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525306.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 gene tssE CDS 11342..13216 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525305.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene tssF CDS 13180..14247 product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525304.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene tssG CDS 14244..15629 product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525303.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 gene tagH CDS 15633..16085 product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525302.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 gene tssJ CDS 16135..17469 product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525301.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 gene tssK CDS 17474..18805 product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525300.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 gene icmH CDS 18807..22343 product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525299.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 gene tssM CDS 22325..22867 product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107648622.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene tagF CDS 22867..23964 product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123798.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS 23961..24980 product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115088.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 24980..25951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS 25961..26872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(26873..27214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(27214..27636) product DUF6484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525291.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS complement(27650..29977) product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525290.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 gene tssI sequence066 source 1..30430 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(62..2314) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532278.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene parC CDS 2707..3897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532279.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 assembly_gap 3958..3967 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4149..5942) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027038352.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 gene aspS CDS complement(6366..7124) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577770.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS 7245..8465 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104266.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 assembly_gap 8386..8395 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8528..9523) product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS 9655..10116 product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329579.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS 10304..11548 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532282.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS 11622..12773 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532283.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 gene rnd CDS complement(12966..13385) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532284.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS complement(13382..13876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532285.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS complement(14001..15503) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532286.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene guaB CDS 15560..15859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS 16017..17438 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532287.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS complement(17598..18290) product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532288.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS complement(18290..19318) product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532289.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 note possible pseudo, frameshifted assembly_gap 19334..19343 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 19858..20790 product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532290.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 tRNA 20938..21011 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 21057..21560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34380 assembly_gap 21239..21248 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21550..21753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS complement(21862..22173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS complement(22729..25098) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725056.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS complement(25111..26316) product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS 26432..26893 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265920.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS 26926..27537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS complement(27619..29448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS complement(29596..30123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34460 sequence067 source 1..30364 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1451 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256716.1:ATP-dependent RecD-like DNA helicase locus_tag LOCUS_34470 CDS 1945..2703 product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531909.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS complement(2655..4763) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531908.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene recG CDS 4775..5143 product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531907.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 5157..6818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34510 note possible pseudo, frameshifted assembly_gap 6758..6767 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6836..8590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34520 note possible pseudo, frameshifted CDS 8912..10297 product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531905.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS 10400..11182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530791.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS complement(11195..11887) product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531904.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(11919..12302) product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531903.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(12404..13474) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531902.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS 13795..14223 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531901.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS 14334..14693 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531900.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS 14734..15333 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531899.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS complement(15337..15948) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531898.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS complement(15948..16508) product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531897.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS 16598..17311 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531896.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS 17439..19115 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531895.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS complement(19688..19960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 20257..21363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34660 note possible pseudo, frameshifted assembly_gap 20278..20287 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21434..21745) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532019.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(21851..22249) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532018.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS complement(22549..23049) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532017.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 gene gpt CDS complement(23199..24032) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532016.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS complement(24114..24857) product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532015.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS 24994..25650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34720 note possible pseudo, frameshifted CDS 25647..25961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34730 note possible pseudo, frameshifted CDS complement(26416..26655) product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532013.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS complement(26687..26965) product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532012.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS 27204..27761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929871.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 27906..28277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34770 note possible pseudo, frameshifted CDS 28274..28483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34780 note possible pseudo, frameshifted tRNA 28577..28662 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 28941..29837 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525230.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 sequence068 source 1..29803 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(393..1139) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528582.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(1415..2092) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528583.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 gene rpe CDS complement(2299..4257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS complement(4386..8150) product DUF11 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528584.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(8162..10096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032808071.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(10506..11447) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528299.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(11665..12447) product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528298.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS complement(12440..14524) product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528297.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(14583..15746) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528296.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS complement(15751..16863) product carnitine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528295.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(16860..17489) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528294.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS complement(17504..18421) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528293.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS 18498..19478 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528292.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS complement(19480..19689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528291.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS complement(19876..21201) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528289.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 gene xylA CDS 21316..21678 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528288.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS complement(21876..23330) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528287.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 gene xylB CDS complement(23413..24738) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS complement(24845..25468) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528284.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 25690..26460 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528282.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS 26582..27748 product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528281.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS 27748..28134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS 28131..28376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS 28501..29112 product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528278.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 sequence069 source 1..29194 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(445..987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35040 note possible pseudo, frameshifted assembly_gap 487..496 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1041..1340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35050 note possible pseudo, frameshifted CDS complement(1476..2753) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532170.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS complement(2895..3362) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532169.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS 3459..6845 product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532168.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS complement(6855..8108) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532167.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 gene tyrS CDS 8342..9985 product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532166.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS 10029..10883 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532165.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS complement(10890..11564) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532163.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS 11814..12974 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532162.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS 13158..14675 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532161.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 gene sufB CDS 14907..15662 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532160.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 gene sufC CDS 15688..16962 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532159.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 gene sufD CDS 17059..18300 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532158.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS 18297..18698 product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532157.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS 18707..19195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS 19292..19678 product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532156.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 gene sufA CDS 19689..20207 product DUF2199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222121.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS complement(20215..20712) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532155.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 20802..21125 product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532154.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS complement(21129..22046) product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532153.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS complement(22087..23070) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532152.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS 23314..23514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35260 note possible pseudo, frameshifted assembly_gap 23498..23507 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23619..24449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35270 note possible pseudo, frameshifted CDS 24688..27345 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532150.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 gene alaS assembly_gap 27157..27166 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 27396..28190 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092159.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS complement(28257..29042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35300 sequence070 source 1..28361 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(250..1479) product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531491.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS complement(1665..1973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS 1863..2735 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531492.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene dusB CDS 2732..3874 product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531493.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS 3871..5331 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531494.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 gene ntrC CDS complement(5377..6267) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503852.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(6302..6925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS 7388..9697 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505196.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS 9687..11048 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531496.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS 11148..12011 product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531497.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS 12156..12401 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006202172.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 gene hfq CDS 12402..13787 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531499.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 gene hflX CDS complement(13794..14618) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531500.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 gene mazG CDS complement(14702..15886) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531501.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS 16083..16601 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827403.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS 16598..17368 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531511.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS 17387..18106 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531512.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS 18275..18562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35480 note possible pseudo, frameshifted CDS 18646..19152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35490 note possible pseudo, frameshifted CDS complement(19169..20080) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531517.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS complement(20827..21033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS complement(21115..21879) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705555.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS complement(21911..22729) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531573.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS complement(22733..23527) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS complement(23527..25077) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531575.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 gene metG CDS complement(25161..26216) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531576.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS complement(26213..26887) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173682.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 gene tmk CDS complement(26951..28108) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173681.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 sequence071 source 1..28349 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 4576..5625 product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529717.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS 5650..6540 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577538.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS complement(6544..7296) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651594.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS complement(7445..7912) product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529716.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS 8368..9324 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529715.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS complement(9404..10177) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529714.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 gene hisN CDS complement(10495..11412) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210328225.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS 11636..11962 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006199474.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 tRNA 12075..12149 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(12253..12462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529712.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS complement(12755..13717) product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388007.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS complement(13714..14799) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388006.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 gene gmd CDS complement(14899..16053) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529707.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 16292..17332 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529706.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS 17329..18345 product 1,5-anhydro-D-fructose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535887.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 18342..19943 product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173052.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS 19936..20712 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529703.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS 20722..21624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35750 note possible pseudo, frameshifted assembly_gap 21363..21372 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21533..22252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35760 note possible pseudo, frameshifted CDS 22313..23566 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529701.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS 23688..24647 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529700.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS 24644..25588 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529699.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS 25593..26708 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529698.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS 26777..28279 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529696.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 sequence072 source 1..27945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..534 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528936.1:glucose 1-dehydrogenase locus_tag LOCUS_35820 CDS complement(558..2066) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528938.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS complement(2088..2432) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528939.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS complement(2461..2802) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528940.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(2817..3167) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528941.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(3164..4438) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528942.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(4453..5373) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528943.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 assembly_gap 5391..5400 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5498..6289) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528944.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS complement(6477..7358) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530845.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS complement(7366..8370) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530846.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS complement(8372..9739) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160700.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS complement(9753..10235) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530848.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS complement(10350..11144) product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530849.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS complement(11160..11603) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530850.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS complement(11727..12554) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530851.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS complement(12716..13714) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530853.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS complement(13770..14513) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530854.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS 14963..15952 product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530855.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS 16213..16911 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530859.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS complement(16930..17868) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530857.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS 18003..18884 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530858.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS 18987..19763 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530859.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS complement(19784..20071) product DUF3175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160693.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS 20242..21474 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530861.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS 21623..22651 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530862.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 tRNA 22070..22155 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 22960..24084 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530863.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS 24165..25700 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530864.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 assembly_gap 25009..25018 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 25714..26694 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530865.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS 26691..27677 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530866.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 sequence073 source 1..27662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 437..1540 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529993.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 gene ychF CDS 1707..2681 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529992.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 gene corA CDS 2797..3267 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529991.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS 3264..3734 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529990.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS complement(3839..4384) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529989.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS complement(4481..5335) product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529986.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS complement(5356..6660) product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529985.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS complement(6677..7237) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529984.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 gene petA CDS 7488..7895 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529983.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS complement(7937..8251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529982.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS complement(8260..10143) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529980.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS complement(10140..12020) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529979.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS 12924..13382 product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529977.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS 13534..13977 product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529976.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene soxR CDS complement(14001..14258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529975.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS 14367..15281 product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529974.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 gene hemF CDS 15528..15788 product DUF1344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529973.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS 16025..16210 product DUF1059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529972.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS 16470..17060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225996736.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS 17075..18124 product S8/S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234888302.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(18132..19400) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529971.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(19397..20029) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529970.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS complement(20029..20664) product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529969.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS 20804..21808 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529968.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS 21808..22812 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529967.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS 22809..25628 product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529966.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 sequence074 source 1..27467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 693..1370 product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530368.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS complement(1449..3644) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530141.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 gene katG CDS 3785..4693 product hydrogen peroxide-inducible genes activator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401206.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 gene oxyR CDS complement(4656..5615) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459274.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS complement(6096..6737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS 6751..7890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36420 note possible pseudo, frameshifted CDS 8169..10718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS 10784..11629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS 11644..12414 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS 12641..13459 product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018209695.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS 13456..15324 product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397828.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS 15337..16383 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973597.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS complement(16654..17610) product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530361.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS 17597..17728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS complement(17820..18473) product poly-gamma-glutamate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244789.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS complement(18484..20250) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530360.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 assembly_gap 20396..20405 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(20428..21129) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530359.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 gene hisG CDS complement(21126..22265) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530358.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 assembly_gap 21724..21733 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(22444..23949) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530357.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 gene hisS CDS 24148..24396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530356.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(24470..25108) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS 25334..26062 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530354.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS 26354..27274 product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530353.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 sequence075 source 1..26635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1155 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222062.1:MFS transporter locus_tag LOCUS_36600 CDS complement(1189..2349) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266227.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS 2460..3365 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527033.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS 3456..5534 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926970.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS 5539..7524 product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064681.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS 7521..7823 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028094393.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS 7820..9187 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266228.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(9227..10552) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970441.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS 10776..11252 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970442.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(11148..12620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS complement(12641..12994) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240974.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS complement(13006..13698) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399913.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS complement(13700..14389) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240975.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS complement(14472..15200) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240976.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS complement(15328..16104) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877446.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS complement(16567..17046) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877448.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS complement(17125..18780) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967984.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS complement(18777..19622) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153436039.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS complement(19625..20575) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967982.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS complement(20664..22274) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967981.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS complement(22339..23061) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169993.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS complement(23302..24675) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967979.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS complement(24686..25135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36820 note possible pseudo, frameshifted CDS complement(25132..25542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36830 note possible pseudo, frameshifted assembly_gap 25199..25208 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 25856..26524 product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243598.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 sequence076 source 1..26060 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 348..950 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528858.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 gene rimM CDS 947..1642 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528859.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene trmD CDS complement(1716..2468) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528860.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS 2782..3318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS 3489..3923 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528862.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS 3920..4423 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528863.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS 4601..5398 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528864.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS 5659..6474 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528865.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS 6533..7168 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528866.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS 7225..7485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS 7552..8961 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528868.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 gene leuC CDS 9135..10331 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528870.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS 10413..11615 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528871.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS complement(11599..11958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528872.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS 12218..12658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528873.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS 12983..13315 product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528874.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 gene sdhC CDS 13318..13713 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 gene sdhD CDS 13718..15550 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528876.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 gene sdhA CDS 15553..15987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129903.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS 15987..16766 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528877.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS 17006..17638 product DUF480 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163303.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS complement(17908..18333) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528883.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS 18749..19105 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528885.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS complement(19121..20728) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969248.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS complement(20725..22248) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973394.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS complement(22241..23083) product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973395.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS complement(22995..24803) product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973396.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS complement(24867..25841) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255513.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 assembly_gap 25754..25763 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence077 source 1..25831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1430..2326 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235611.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS complement(2356..2544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501638.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS 2900..5275 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142384.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 5275..5838 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199702189.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS 6017..6493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS 6545..7081 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640141.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS 7097..7393 product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729587.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS complement(7474..8130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS complement(8265..9473) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969494.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 9767..10186 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530756.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS complement(10211..11104) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530746.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 gene gcvA CDS 11225..11929 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530747.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(12003..12896) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529760.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS complement(12898..13836) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529761.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS complement(13946..15271) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529762.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS complement(15310..16401) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529763.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 gene ugpC assembly_gap 15671..15680 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16832..17443) product DUF922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530749.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS complement(17521..19053) product winged helix-turn-helix domain-containing tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967955.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS complement(19118..19360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS complement(19515..19736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS 19705..19908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS 19978..21423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS complement(21916..22065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS 22188..22355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37360 note possible pseudo, frameshifted CDS 22608..23708 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532464.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS 23705..24160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 24223..24852 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142691.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS 24983..25225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969104.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 misc_feature complement(25264..>25831) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972812.1:D-tagatose-bisphosphate aldolase, class II, non-catalytic subunit locus_tag LOCUS_37410 sequence078 source 1..25422 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 279..288 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1087..1659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37420 assembly_gap 1589..1598 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1652..2305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37430 note possible pseudo, frameshifted CDS 2470..3471 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532293.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS complement(3531..3803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525317.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS complement(3800..4042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS 4231..5586 product selenium-binding family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977998.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS 5583..5954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS 5951..6409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 6591..7481 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525230.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS complement(7540..8721) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815690.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(8814..9371) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943415.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS 9630..10952 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867639.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS 11008..12123 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529097.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS 12179..12868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37550 assembly_gap 12545..12554 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12771..13424) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505017.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 assembly_gap 13800..13809 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13873..14418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37570 note possible pseudo, frameshifted CDS complement(14364..14678) product cupredoxin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532430.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS complement(14675..15199) product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532429.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS complement(15286..15975) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532428.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS complement(16071..17150) product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532427.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS complement(17364..18530) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532426.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS 18844..19479 product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532425.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS 19486..20340 product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532424.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 20778..21806 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532423.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS 21870..23057 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532422.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 23062..24219 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532421.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS 24295..25098 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532420.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS complement(25193..25396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37690 sequence079 source 1..25385 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(885..1019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS complement(1249..2043) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528365.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS complement(2075..3067) product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528364.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene iolG CDS complement(3148..3918) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528363.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS complement(3921..4997) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528362.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS complement(5113..6054) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528361.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS complement(6366..7397) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528360.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS 7584..8681 product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528359.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS 8725..9039 product MocE family 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528358.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 assembly_gap 9149..9158 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9369..9971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37790 assembly_gap 9599..9608 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9907..10281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37800 note possible pseudo, frameshifted assembly_gap 9914..9923 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10330..11136 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393072.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS complement(11157..12068) product DUF1402 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170435.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS complement(12442..13752) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528355.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 gene hslU CDS complement(13757..14356) product DUF2585 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528354.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(14362..14925) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528352.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS complement(14937..15488) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528351.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 gene hslV CDS 15731..16330 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528350.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 gene hisB CDS 16334..16810 product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528349.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS 16812..17471 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528348.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene hisH assembly_gap 17158..17167 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17472..17762 product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528347.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS 17765..18511 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528346.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 gene hisA CDS 18508..19347 product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528345.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS 19347..20138 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501998.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 gene hisF CDS 20148..20471 product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528343.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS 20496..21455 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528342.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 gene coaA CDS complement(21506..22591) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482300.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS complement(22864..23988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS complement(24212..24832) product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528341.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 sequence080 source 1..25131 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(82..912) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398188.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS complement(917..1933) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529526.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS complement(2004..2969) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529527.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS complement(2966..4519) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529528.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS complement(4665..5660) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529529.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS complement(5975..6973) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529530.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS complement(7024..8529) product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529531.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS 8776..9678 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529532.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS complement(9765..10118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS 10378..10821 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529534.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS 10854..11375 product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529535.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS 11495..13024 product copper resistance CopC/CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529536.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 assembly_gap 12690..12699 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13222..13782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(13849..14286) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968167.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS 14477..15901 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529537.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 gene gndA CDS complement(16264..17301) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529538.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS 17709..18947 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529539.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS 19049..19942 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504415.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS 19935..20870 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504414.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS 20873..21967 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529542.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 gene ugpC CDS 22015..22761 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529543.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS 22773..23915 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529544.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS 24050..25096 product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529545.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 gene mgrA sequence081 source 1..25113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(120..959) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528253.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS complement(1024..2679) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528251.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS complement(2679..3503) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528250.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS complement(3514..4473) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528249.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS complement(4490..6076) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528248.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS complement(6230..8215) product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528247.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS complement(8287..8880) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528246.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS complement(8900..9391) product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528245.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS complement(9388..10251) product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528244.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS complement(10320..11744) product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528243.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 gene puuE CDS 11939..12313 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528242.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 gene uraH CDS 12317..13798 product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528241.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 gene xdhA CDS complement(13783..13971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38340 assembly_gap 14145..14154 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14225..16156 product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528240.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 gene xdhB note possible pseudo, frameshifted CDS 16153..17121 product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528239.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 gene xdhC CDS 17257..18093 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268384.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS complement(18090..19358) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528238.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS complement(19355..20302) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528237.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(20380..21300) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528236.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS 21497..22714 product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528235.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS 22716..24029 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528234.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 gene guaD CDS 24095..24598 product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528233.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 sequence082 source 1..24723 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528112.1:glycosyltransferase locus_tag LOCUS_38440 CDS 872..1309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528111.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS 1539..2330 product family 16 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528110.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS 2479..2691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38470 note possible pseudo, frameshifted assembly_gap 2671..2680 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2688..3779 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528109.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 note possible pseudo, frameshifted CDS 3812..4891 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528106.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS 5031..6113 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392042.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS 6110..7576 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982280.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS 7628..8617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS 8621..8923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS 9168..10277 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528103.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS 10293..11276 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173531.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS 11276..12220 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528101.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS 12210..13172 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528100.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS 13233..14129 product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528099.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS 14297..16681 product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528098.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS complement(16773..17867) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082510.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS 17866..18858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS complement(18882..19589) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528097.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS complement(19737..19910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS complement(19921..21828) product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528095.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS 21910..22287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS 22827..23114 product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528093.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS 23111..23545 product lasso peptide biosynthesis B2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528092.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS 23542..24507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528091.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 assembly_gap 24476..24485 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24535..24696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38690 sequence083 source 1..24395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(248..745) product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528772.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 tRNA 955..1029 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 1465..3108 product heme peroxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929330.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS 3121..3615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS complement(3629..6091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS 6064..7419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS complement(7567..7905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38750 note possible pseudo, frameshifted assembly_gap 7573..7581 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8097..8969 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533362.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 gene rocF CDS 8972..10030 product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530320.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 assembly_gap 10153..10162 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10214..11215) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521613.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS complement(11408..12424) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400585.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS complement(12421..13923) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400583.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS complement(14071..15042) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708271.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS complement(15220..16086) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504770.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS 16193..17461 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530183.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS 17620..18480 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530184.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS 18477..19313 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530185.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS complement(19274..19684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38860 assembly_gap 19671..19679 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 19686..20327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38870 note possible pseudo, frameshifted CDS 20540..22573 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530187.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS complement(22640..23068) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528746.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS 23226..24347 product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528745.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 sequence084 source 1..24351 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(825..2102) product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532712.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS complement(2587..2907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38920 assembly_gap 2992..3001 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3063..3473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38930 note possible pseudo, frameshifted CDS 3488..5413 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503688.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 gene cysN CDS 5424..6212 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503689.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 gene cysQ CDS complement(6356..7498) product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532708.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS complement(7802..8725) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532707.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(8722..9168) product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532706.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS complement(9169..10395) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532705.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS 10607..11641 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503693.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS 11802..12866 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532703.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS 12869..13651 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027035860.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS 13793..16255 product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532701.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS 16380..18617 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532700.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 gene glgB CDS 18653..19918 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532699.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 gene glgC CDS 19937..20908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39060 note possible pseudo, frameshifted assembly_gap 20858..20867 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21003..21365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39070 note possible pseudo, frameshifted CDS 21369..22997 product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532697.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 sequence085 source 1..23959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 241..1011 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532178.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 tRNA complement(1075..1150) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 1369..1445 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(1580..1807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS complement(2280..3206) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532180.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 gene rbsK CDS complement(3211..3663) product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532181.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS complement(3694..4755) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532182.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 gene ugpC CDS 5030..6694 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532183.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS 6796..7917 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532184.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS 7930..8847 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532185.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS complement(9006..9749) product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532186.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS complement(9754..10320) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532187.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS 10509..11531 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532188.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS complement(11604..11786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39200 note possible pseudo, frameshifted assembly_gap 11850..11859 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12080..14491) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532189.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 gene lon CDS complement(14765..16039) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532190.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 gene clpX CDS complement(16334..16963) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532191.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 gene clpP CDS 17297..17890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532192.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS complement(17887..18990) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532194.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS 19096..20349 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532195.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS 20375..21082 product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530327.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 gene ehuB CDS complement(21099..21449) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532197.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS complement(21449..22729) product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532198.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS complement(22890..23411) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532199.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 misc_feature complement(23408..>23959) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532201.1:AAA family ATPase locus_tag LOCUS_39310 sequence086 source 1..23737 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39320 assembly_gap 217..226 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 562..1278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39330 note possible pseudo, frameshifted assembly_gap 1218..1227 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1257..1595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39340 note possible pseudo, frameshifted CDS 1609..2706 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253048.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS complement(2780..3115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39360 note possible pseudo, frameshifted CDS complement(3082..3810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39370 note possible pseudo, frameshifted assembly_gap 3146..3155 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3859..4893) product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402582.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS complement(4907..5854) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402612.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS 5933..6688 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973552.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS 6702..7193 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243734.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS 7190..8071 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243735.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS 8068..8409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388253.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS complement(8769..9662) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061386.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS 9870..10265 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973783.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS 10296..11312 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089272.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS complement(11324..11851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS 11960..14296 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529222.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS complement(14318..14572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS complement(14598..15329) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529219.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 assembly_gap 14909..14918 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15335..16585) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502967.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 gene ispG CDS complement(16921..17100) product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529217.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS 17342..17545 product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529216.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS complement(17576..18367) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975583.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS 18483..19364 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396234.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS 19462..20127 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104187.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS 20129..20779 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061481.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS 20781..21578 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332090.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS 21672..22133 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS 22160..23350 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 sequence087 source 1..23662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4..1287) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528840.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 gene mtaB CDS complement(1287..2171) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528841.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 gene dapF CDS complement(2365..2526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS complement(2607..3617) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528843.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS 3775..5199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS 5248..5685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS 5902..6441 product protease inhibitor Inh/omp19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528844.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS 6551..7753 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528845.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 gene zapE CDS 8084..9052 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528846.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 gene mdh CDS 9082..10275 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528847.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 gene sucC CDS 10280..10837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS 10881..11252 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528848.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS 11256..11753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS 11832..12128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS 12055..12471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS 12499..13404 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528849.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 gene sucD CDS 13551..16538 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528850.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 assembly_gap 16793..16802 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16813..17820 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528851.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 gene odhB note possible pseudo, frameshifted CDS 17838..18623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS 18623..19132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528852.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS 19129..19884 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528853.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS 19908..21314 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528854.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 gene lpdA CDS complement(21418..21708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS complement(21988..23052) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528856.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 sequence088 source 1..23660 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(725..1696) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530250.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS complement(1706..2845) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530249.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS complement(3140..4237) product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530248.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS complement(4598..5482) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530247.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS complement(5732..6634) product DUF2167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035601.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS complement(6845..8245) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530246.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 assembly_gap 6936..6945 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8496..9785 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530245.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 gene aceA CDS 9851..10093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006202762.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS 10315..10794 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162284.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 CDS complement(10833..11546) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS 11795..13144 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027035719.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS 13299..13541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39960 note possible pseudo, frameshifted CDS 13605..14891 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530240.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS 15223..16041 product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173772.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS complement(16025..17341) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS complement(17437..18198) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS 18505..19974 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530236.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 gene zwf CDS 19971..20669 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530235.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 gene pgl CDS 20736..22559 product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530234.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 gene edd misc_feature complement(22633..>23660) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530233.1:VWA domain-containing protein locus_tag LOCUS_40040 sequence089 source 1..23449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(118..1251) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528113.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS 1754..1906 product lasso peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010913078.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS 2121..2420 product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528114.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS 2404..2820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40080 note possible pseudo, internal stop codon CDS 2824..4740 product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS 4737..5729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528117.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS 5738..7588 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528118.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS complement(7624..7971) product exopolysaccharide production repressor ExoX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528119.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS 8505..9182 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528120.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 CDS 9158..10576 product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170136761.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS 10691..11773 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784109.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS complement(11803..13053) product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528122.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS 13539..13991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS 14024..15337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS complement(15435..16418) product glycosyltransferase family 10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203562.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS complement(16518..17108) product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528144.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 assembly_gap 16707..16716 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17150..18589) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528145.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS complement(18763..19248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528152.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS complement(19372..20265) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529342.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS complement(20282..21664) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529338.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS complement(21661..22443) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529337.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 sequence090 source 1..23441 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(423..746) product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081705261.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS complement(1012..2238) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532418.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS complement(2252..2497) product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532417.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS 2750..4945 product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532416.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS 4942..6477 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532415.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 gene ppx CDS complement(6482..6904) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532414.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS complement(7117..7539) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532413.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS complement(7653..8225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40330 note possible pseudo, frameshifted CDS complement(8276..9067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40340 note possible pseudo, frameshifted assembly_gap 8287..8296 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9330..10106) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532409.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS complement(10195..10809) product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532408.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 gene betI CDS 10920..11858 product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532407.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 gene choX CDS 11870..12376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40380 note possible pseudo, frameshifted CDS 12258..12713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40390 note possible pseudo, frameshifted assembly_gap 12268..12277 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12714..13352) product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532405.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 assembly_gap 12807..12816 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13483..14166 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532404.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS complement(14331..15530) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577599.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS complement(15910..16497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532403.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS 16674..17753 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173636.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 CDS 17853..18512 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171830.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS 18598..18903 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226515.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS 18918..19697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40470 CDS 19991..20245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532399.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS 20245..20652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532398.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 CDS 20654..20812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS 20818..21294 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532396.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 CDS 21291..21902 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532395.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS complement(21899..22183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40530 note possible pseudo, frameshifted CDS complement(22210..22419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40540 note possible pseudo, frameshifted CDS complement(22762..23439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40550 sequence091 source 1..23383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(170..892) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532941.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 CDS complement(889..1707) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532942.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS complement(1707..2525) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532943.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS complement(2525..3601) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532944.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS complement(3606..4478) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532945.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS complement(4490..5332) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532946.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS complement(5338..6234) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532947.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS complement(6367..7668) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532948.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 CDS complement(7726..8871) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532949.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS complement(8852..9811) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532950.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 CDS complement(9815..10597) product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532951.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS 10796..12535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40670 assembly_gap 12356..12365 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12496..12936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40680 note possible pseudo, frameshifted CDS complement(12964..13980) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532955.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS complement(14240..14779) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532925.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 CDS 14858..16018 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532926.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS 16080..16508 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532936.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS complement(16427..17578) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532935.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 assembly_gap 16656..16665 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17803..18618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40740 assembly_gap 18396..18405 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 18750..19601 product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528557.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS 19685..20776 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528558.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS complement(20699..21058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40770 assembly_gap 21209..21218 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21274..21474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40780 note possible pseudo, internal stop codon, frameshifted CDS 21633..22649 product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530313.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 misc_feature complement(22862..>23383) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528547.1:2-oxo-hepta-3-ene-1,7-dioic acid hydratase locus_tag LOCUS_40800 sequence092 source 1..23205 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 390..1052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS 1108..1281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS complement(1791..2066) product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120709219.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS complement(2197..3201) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242607.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS 3309..3671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40850 note possible pseudo, frameshifted CDS 3728..4267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40860 note possible pseudo, frameshifted CDS complement(4285..4626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS complement(4874..5137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS complement(5141..5932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS complement(5929..6336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS complement(6333..7415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS 7341..7715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40920 assembly_gap 7654..7663 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7726..8763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS complement(9521..10060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS 10295..13756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS complement(13875..14522) product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020479965.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS 15059..15502 product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528917.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS 16014..16613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS 17016..19139 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491196.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS 19136..20686 product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 assembly_gap 20500..20509 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 20652..20840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS 20837..22081 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384502.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS 22116..23156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41030 sequence093 source 1..23070 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(146..505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS complement(1015..2427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS complement(2437..3213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS complement(3465..3797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS complement(3956..4744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS complement(4741..5793) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037025.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS 6156..8171 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101804821.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 CDS 8353..10236 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101804821.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS complement(10257..12287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS complement(12288..13547) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957839.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS complement(13682..14440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS 14812..16494 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403374.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS complement(16491..17330) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS complement(17327..18457) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061500.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 CDS 18694..19971 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 CDS 20112..21023 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS 21074..21868 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 sequence094 source 1..22965 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 347..841 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531271.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS 918..1406 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391513.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS complement(1476..2270) product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531267.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS complement(2285..4636) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531266.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 CDS complement(4761..5261) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531265.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 CDS 5476..6711 product FIST signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050580471.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS 6727..8070 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531263.1 transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS 8085..8339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41280 CDS 8353..8781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS complement(8872..9555) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503826.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS 9879..10577 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531256.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS 10582..11232 product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531255.1 transl_table 11 codon_start 1 locus_tag LOCUS_41320 gene maiA CDS 11268..11462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41330 note possible pseudo, frameshifted assembly_gap 11428..11437 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11459..12283 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531254.1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 note possible pseudo, frameshifted CDS complement(12299..13192) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531253.1 transl_table 11 codon_start 1 locus_tag LOCUS_41350 assembly_gap 13496..13505 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13559..14713 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531252.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 note possible pseudo, frameshifted CDS complement(14719..15660) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531250.1 transl_table 11 codon_start 1 locus_tag LOCUS_41370 CDS 15759..17201 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531249.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS complement(17198..17638) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531248.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 CDS complement(17915..18343) product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531247.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS complement(18411..19706) product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531246.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 CDS 19908..20369 product iron-responsive transcriptional regulator RirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531245.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 gene rirA CDS complement(20383..21171) product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531244.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS complement(21179..21433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41440 note possible pseudo, frameshifted CDS 21399..21554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41450 assembly_gap 21459..21468 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21753..21974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41460 misc_feature complement(22271..>22965) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531242.1:hemin ABC transporter substrate-binding protein locus_tag LOCUS_41470 sequence095 source 1..22637 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 411..1985 product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS 2075..2764 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531177.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 CDS 2869..3600 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531180.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS 3784..4335 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531188.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 CDS 4338..4820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41520 assembly_gap 4695..4704 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4736..6127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41530 assembly_gap 6219..6228 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6511..6798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS complement(6817..7833) product betaine--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173709.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 gene bmt CDS complement(8012..8854) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531192.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS 9143..10093 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160493.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS 10121..10987 product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531194.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS complement(10976..12328) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 CDS complement(12348..13868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41600 CDS complement(13952..16522) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531196.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 CDS complement(16609..18186) product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 CDS 18390..20297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS 20325..20576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS 20599..21759 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531199.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 sequence096 source 1..22137 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 707..1054 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529502.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS complement(1062..1970) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328848.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS 2052..2654 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397132.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS complement(2675..3889) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969796.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 CDS 4062..5039 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109658674.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 CDS 5145..5576 product DUF4437 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529500.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS complement(5630..6712) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529499.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS complement(6712..7818) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529498.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 CDS complement(7815..8036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529497.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS complement(8033..8989) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970662.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS complement(8991..9896) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970661.1 transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS complement(9962..11278) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967707.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS complement(11547..11756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS complement(11639..12226) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529493.1 transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS 12423..13619 product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529492.1 transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS 13631..14497 product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529491.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS 14502..14918 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529490.1 transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS complement(15092..16279) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529489.1 transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS 16664..18274 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529488.1 transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS 18530..19471 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529487.1 transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS 19513..20343 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529486.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 CDS 20340..21347 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167391096.1 transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS 21344..22123 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529483.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 sequence097 source 1..22082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(588..1547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41890 assembly_gap 664..673 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1558..2637) product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356447.1 transl_table 11 codon_start 1 locus_tag LOCUS_41900 CDS complement(2793..3449) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532271.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS 3652..4824 product OpgC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532270.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS complement(4831..5907) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532269.1 transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS 6085..6228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532268.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS 6287..6436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS complement(6446..6820) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532266.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS complement(6879..7259) product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975151.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS complement(7291..8544) product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532265.1 transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS 8660..9340 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532264.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 assembly_gap 9233..9242 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9487..10458 product glycosyl transferase family 90 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108791.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS complement(10473..11516) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532261.1 transl_table 11 codon_start 1 locus_tag LOCUS_42010 CDS 11760..12680 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532260.1 transl_table 11 codon_start 1 locus_tag LOCUS_42020 gene ppk2 CDS complement(12868..13515) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532259.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS complement(13643..14620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42040 CDS complement(14627..15658) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532258.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 gene hemB CDS complement(15776..16573) product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532257.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS 16738..17286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS 17405..18448 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532256.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS 18445..18867 product DUF6163 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532255.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 CDS 19105..19620 product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008875359.1 transl_table 11 codon_start 1 locus_tag LOCUS_42100 CDS complement(19608..19796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42110 CDS 19830..20228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42120 CDS 20615..21868 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532254.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 sequence098 source 1..21865 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1148 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528581.1:malonyl-CoA synthase locus_tag LOCUS_42140 CDS complement(1376..2533) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528579.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 gene nagA CDS complement(2530..3237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42160 note possible pseudo, frameshifted assembly_gap 3300..3309 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3575..4354) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528577.1 transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS complement(4351..5232) product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528576.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 CDS 5433..6341 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528575.1 transl_table 11 codon_start 1 locus_tag LOCUS_42190 CDS 6394..7653 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528574.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 CDS 7897..8826 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528573.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 CDS 8835..9674 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528572.1 transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS 9671..10732 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528570.1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 CDS 10959..11957 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173499.1 transl_table 11 codon_start 1 locus_tag LOCUS_42240 CDS complement(12157..13002) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528568.1 transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS complement(13197..13928) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528567.1 transl_table 11 codon_start 1 locus_tag LOCUS_42260 CDS complement(14111..16486) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528566.1 transl_table 11 codon_start 1 locus_tag LOCUS_42270 CDS complement(16539..17600) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528565.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 gene deoC CDS complement(17806..18633) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528564.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS 18854..20230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42300 note possible pseudo, frameshifted assembly_gap 19925..19934 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 20118..20900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42310 note possible pseudo, frameshifted sequence099 source 1..21602 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 162..1205 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528740.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 gene holA CDS complement(1219..2019) product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528739.1 transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS complement(2029..2439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS complement(3075..3959) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528737.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS complement(4005..4802) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528736.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 CDS complement(4820..5251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42370 CDS 5132..5413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42380 CDS complement(5458..7332) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528734.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 gene mnmG CDS complement(7501..8712) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528733.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 gene mnmE CDS 8765..10918 product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 assembly_gap 10963..10972 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11174..12430) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528732.1 transl_table 11 codon_start 1 locus_tag LOCUS_42420 gene rho CDS complement(12608..13138) product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528731.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 gene hemJ CDS complement(13138..14151) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528730.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 gene hemE CDS 14572..15393 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528729.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 CDS 15681..16280 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528728.1 transl_table 11 codon_start 1 locus_tag LOCUS_42460 CDS 16273..17112 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528727.1 transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS 17126..17731 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528726.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 gene coaE CDS 17806..18528 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528725.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 gene dnaQ CDS complement(18602..19108) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528724.1 transl_table 11 codon_start 1 locus_tag LOCUS_42500 gene secB assembly_gap 18710..18719 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19283..19780) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528723.1 transl_table 11 codon_start 1 locus_tag LOCUS_42510 gene fxsA CDS 19932..20690 product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528722.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 sequence100 source 1..21452 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1180..1629 product host attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529560.1 transl_table 11 codon_start 1 locus_tag LOCUS_42530 CDS 1807..3615 product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529559.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 gene ybaL CDS complement(3644..4450) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529558.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 CDS 4589..5509 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529557.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 CDS complement(5534..6283) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529556.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 CDS complement(6348..6731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42580 note possible pseudo, frameshifted CDS complement(6685..8523) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529554.1 transl_table 11 codon_start 1 locus_tag LOCUS_42590 note possible pseudo, frameshifted assembly_gap 6747..6756 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8408..8614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS complement(8836..9525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42610 CDS complement(9488..10432) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139584.1 transl_table 11 codon_start 1 locus_tag LOCUS_42620 CDS complement(10436..10813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42630 CDS complement(10816..12099) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082330.1 transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS complement(12668..12988) product protamine-2 (modular protein) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109666726.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 CDS complement(13194..13340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529552.1 transl_table 11 codon_start 1 locus_tag LOCUS_42660 CDS complement(13473..13727) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529551.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 CDS complement(14011..14211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529550.1 transl_table 11 codon_start 1 locus_tag LOCUS_42680 CDS complement(14229..14849) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529549.1 transl_table 11 codon_start 1 locus_tag LOCUS_42690 CDS complement(14937..16322) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529548.1 transl_table 11 codon_start 1 locus_tag LOCUS_42700 CDS 16768..19731 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173101.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 gene polA CDS 19733..20362 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919879.1 transl_table 11 codon_start 1 locus_tag LOCUS_42720 CDS complement(20512..20916) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529546.1 transl_table 11 codon_start 1 locus_tag LOCUS_42730 sequence101 source 1..21296 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(595..1317) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390306.1 transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS 1550..2038 product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531406.1 transl_table 11 codon_start 1 locus_tag LOCUS_42750 CDS 2143..2589 product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531407.1 transl_table 11 codon_start 1 locus_tag LOCUS_42760 tRNA 2661..2736 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 3106..3309 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531408.1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 gene secE CDS 3337..3864 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531409.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 gene nusG CDS 4061..4489 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531410.1 transl_table 11 codon_start 1 locus_tag LOCUS_42790 gene rplK CDS 4495..5193 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531411.1 transl_table 11 codon_start 1 locus_tag LOCUS_42800 gene rplA CDS 5591..6109 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531412.1 transl_table 11 codon_start 1 locus_tag LOCUS_42810 gene rplJ CDS 6158..6544 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531413.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 gene rplL assembly_gap 6548..6557 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6772..10908 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531414.1 transl_table 11 codon_start 1 locus_tag LOCUS_42830 gene rpoB CDS 10999..15234 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531415.1 transl_table 11 codon_start 1 locus_tag LOCUS_42840 gene rpoC CDS 15306..15974 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705602.1 transl_table 11 codon_start 1 locus_tag LOCUS_42850 CDS 15988..16143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42860 CDS complement(16385..17320) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531419.1 transl_table 11 codon_start 1 locus_tag LOCUS_42870 CDS complement(17394..17675) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531420.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 CDS 17592..17900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42890 CDS 18150..18521 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006333356.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 gene rpsL CDS 18586..19056 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008875664.1 transl_table 11 codon_start 1 locus_tag LOCUS_42910 gene rpsG CDS 19086..21176 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531421.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 gene fusA sequence102 source 1..21295 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1284..1991) product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528275.1 transl_table 11 codon_start 1 locus_tag LOCUS_42930 assembly_gap 1600..1609 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1991..2725) product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528274.1 transl_table 11 codon_start 1 locus_tag LOCUS_42940 CDS complement(2740..3846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528272.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 CDS complement(3843..4274) product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528271.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 CDS complement(4417..5526) product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528270.1 transl_table 11 codon_start 1 locus_tag LOCUS_42970 CDS complement(5595..6842) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528269.1 transl_table 11 codon_start 1 locus_tag LOCUS_42980 CDS 7666..7875 product DUF680 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528268.1 transl_table 11 codon_start 1 locus_tag LOCUS_42990 CDS 7957..8196 product DUF680 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528266.1 transl_table 11 codon_start 1 locus_tag LOCUS_43000 CDS complement(8292..9404) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528265.1 transl_table 11 codon_start 1 locus_tag LOCUS_43010 gene ugpC CDS complement(9437..11101) product alpha glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528264.1 transl_table 11 codon_start 1 locus_tag LOCUS_43020 CDS complement(11106..12260) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528263.1 transl_table 11 codon_start 1 locus_tag LOCUS_43030 CDS complement(12262..13275) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528262.1 transl_table 11 codon_start 1 locus_tag LOCUS_43040 CDS complement(13567..14922) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528261.1 transl_table 11 codon_start 1 locus_tag LOCUS_43050 assembly_gap 15681..15690 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15696..16322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43060 note possible pseudo, frameshifted CDS complement(16536..16724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43070 CDS complement(16721..16948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43080 CDS complement(17171..18229) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528524.1 transl_table 11 codon_start 1 locus_tag LOCUS_43090 CDS complement(18575..19900) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528256.1 transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS complement(19890..20558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528255.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 CDS complement(20555..21121) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528254.1 transl_table 11 codon_start 1 locus_tag LOCUS_43120 sequence103 source 1..21246 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(643..1623) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257467.1 transl_table 11 codon_start 1 locus_tag LOCUS_43130 CDS 1934..3253 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257469.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS 3444..4214 product galactitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972809.1 transl_table 11 codon_start 1 locus_tag LOCUS_43150 CDS 4239..5252 product D-altritol 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972808.1 transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS 5376..6404 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532415.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 CDS complement(6412..7419) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530761.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS 7642..7911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43190 note possible pseudo, frameshifted CDS complement(8780..9277) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438748.1 transl_table 11 codon_start 1 locus_tag LOCUS_43200 CDS 9606..10868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43210 note possible pseudo, frameshifted assembly_gap 10648..10657 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10837..11217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43220 note possible pseudo, frameshifted CDS 11328..11552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530613.1 transl_table 11 codon_start 1 locus_tag LOCUS_43230 CDS 11800..14301 product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530614.1 transl_table 11 codon_start 1 locus_tag LOCUS_43240 gene ligD CDS 14931..15839 product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530615.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 CDS 15836..16969 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530616.1 transl_table 11 codon_start 1 locus_tag LOCUS_43260 assembly_gap 17041..17050 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17152..17805 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530617.1 transl_table 11 codon_start 1 locus_tag LOCUS_43270 CDS 17979..18755 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530618.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 CDS 18843..19559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43290 note possible pseudo, frameshifted CDS 19487..20023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43300 note possible pseudo, frameshifted sequence104 source 1..21077 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 211..220 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(554..841) product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528591.1 transl_table 11 codon_start 1 locus_tag LOCUS_43310 CDS complement(864..1571) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528590.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 gene pyrF CDS complement(1568..2164) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 transl_table 11 codon_start 1 locus_tag LOCUS_43330 CDS complement(2324..2929) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528588.1 transl_table 11 codon_start 1 locus_tag LOCUS_43340 CDS complement(3056..4186) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528587.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 gene dnaJ CDS complement(4377..6293) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502156.1 transl_table 11 codon_start 1 locus_tag LOCUS_43360 gene dnaK CDS complement(6281..7378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43370 CDS complement(7462..8460) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528459.1 transl_table 11 codon_start 1 locus_tag LOCUS_43380 CDS complement(8464..9291) product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640272.1 transl_table 11 codon_start 1 locus_tag LOCUS_43390 CDS complement(9375..10547) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528460.1 transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS complement(10667..11722) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 transl_table 11 codon_start 1 locus_tag LOCUS_43410 CDS 11955..12389 product DUF6481 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528462.1 transl_table 11 codon_start 1 locus_tag LOCUS_43420 CDS complement(12463..12777) product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528463.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 gene sugE CDS complement(13006..13131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS 13408..14838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43450 assembly_gap 14347..14356 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14846..16096) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528468.1 transl_table 11 codon_start 1 locus_tag LOCUS_43460 gene rmuC CDS 16200..16730 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528469.1 transl_table 11 codon_start 1 locus_tag LOCUS_43470 gene def CDS 16796..17077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528470.1 transl_table 11 codon_start 1 locus_tag LOCUS_43480 CDS 17074..17499 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051418.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 CDS 17530..18465 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528471.1 transl_table 11 codon_start 1 locus_tag LOCUS_43500 gene fmt CDS 18462..18968 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528472.1 transl_table 11 codon_start 1 locus_tag LOCUS_43510 CDS 18988..19743 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528473.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 gene truA CDS complement(19740..20345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528474.1 transl_table 11 codon_start 1 locus_tag LOCUS_43530 misc_feature complement(20332..>21077) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528475.1:succinyl-diaminopimelate desuccinylase locus_tag LOCUS_43540 sequence105 source 1..21010 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(138..2606) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531774.1 transl_table 11 codon_start 1 locus_tag LOCUS_43550 gene clpA CDS complement(2613..2996) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023812950.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 gene clpS CDS complement(3208..3537) product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531776.1 transl_table 11 codon_start 1 locus_tag LOCUS_43570 CDS 3826..5226 product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531777.1 transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS complement(5269..5967) product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531778.1 transl_table 11 codon_start 1 locus_tag LOCUS_43590 CDS complement(5967..6734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173673.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 CDS complement(6806..7243) product DUF1489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531780.1 transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS complement(7319..8722) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531781.1 transl_table 11 codon_start 1 locus_tag LOCUS_43620 CDS 9396..9602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43630 CDS 9645..10382 product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531782.1 transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS complement(10337..11128) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531783.1 transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS complement(11258..12067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43660 note possible pseudo, frameshifted CDS complement(11997..12836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43670 note possible pseudo, frameshifted assembly_gap 12140..12149 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12836..13294) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531786.1 transl_table 11 codon_start 1 locus_tag LOCUS_43680 CDS complement(13302..13589) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531787.1 transl_table 11 codon_start 1 locus_tag LOCUS_43690 gene gatC CDS complement(13677..14093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827391.1 transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS complement(14146..14853) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531789.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS 15026..15463 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531790.1 transl_table 11 codon_start 1 locus_tag LOCUS_43720 gene ruvX CDS complement(15396..15722) product DUF6105 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531791.1 transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS complement(15722..16282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531792.1 transl_table 11 codon_start 1 locus_tag LOCUS_43740 CDS complement(16434..18062) product DNA alkylation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531793.1 transl_table 11 codon_start 1 locus_tag LOCUS_43750 CDS 18221..19186 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531794.1 transl_table 11 codon_start 1 locus_tag LOCUS_43760 CDS 19183..20469 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531795.1 transl_table 11 codon_start 1 locus_tag LOCUS_43770 sequence106 source 1..20908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..681 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529914.1:HugZ family protein locus_tag LOCUS_43780 CDS 841..1179 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529913.1 transl_table 11 codon_start 1 locus_tag LOCUS_43790 CDS 1291..2088 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529912.1 transl_table 11 codon_start 1 locus_tag LOCUS_43800 CDS complement(2036..2365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS complement(2407..3444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529911.1 transl_table 11 codon_start 1 locus_tag LOCUS_43820 assembly_gap 3468..3477 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3641..4222) product DUF1134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529910.1 transl_table 11 codon_start 1 locus_tag LOCUS_43830 CDS 4585..5214 product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529909.1 transl_table 11 codon_start 1 locus_tag LOCUS_43840 CDS 5403..5831 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529908.1 transl_table 11 codon_start 1 locus_tag LOCUS_43850 CDS complement(5916..6611) product cell cycle two-component system response regulator CtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203583.1 transl_table 11 codon_start 1 locus_tag LOCUS_43860 gene ctrA CDS 7061..7438 product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529907.1 transl_table 11 codon_start 1 locus_tag LOCUS_43870 CDS complement(7506..7910) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529906.1 transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS 8000..8926 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529905.1 transl_table 11 codon_start 1 locus_tag LOCUS_43890 CDS complement(8995..9270) product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529904.1 transl_table 11 codon_start 1 locus_tag LOCUS_43900 CDS complement(9505..9693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43910 CDS 9705..10739 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529903.1 transl_table 11 codon_start 1 locus_tag LOCUS_43920 gene mnmA assembly_gap 9712..9721 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10782..11747) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529902.1 transl_table 11 codon_start 1 locus_tag LOCUS_43930 tRNA 11988..12064 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(12485..12787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43940 CDS complement(13184..13372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43950 assembly_gap 13404..13413 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13470..14222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43960 note possible pseudo, frameshifted CDS complement(14285..15163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43970 CDS 15296..20116 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123147513.1 transl_table 11 codon_start 1 locus_tag LOCUS_43980 misc_feature complement(20165..>20908) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061606.1:NAD-dependent succinate-semialdehyde dehydrogenase locus_tag LOCUS_43990 sequence107 source 1..20907 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(481..1287) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529629.1 transl_table 11 codon_start 1 locus_tag LOCUS_44000 CDS complement(1287..1679) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529630.1 transl_table 11 codon_start 1 locus_tag LOCUS_44010 gene cdd CDS complement(1735..2706) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529631.1 transl_table 11 codon_start 1 locus_tag LOCUS_44020 CDS complement(2708..3847) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529632.1 transl_table 11 codon_start 1 locus_tag LOCUS_44030 CDS complement(3844..5376) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529633.1 transl_table 11 codon_start 1 locus_tag LOCUS_44040 CDS 5583..5792 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529634.1 transl_table 11 codon_start 1 locus_tag LOCUS_44050 CDS 5809..6297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44060 assembly_gap 6086..6095 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6311..7300) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529637.1 transl_table 11 codon_start 1 locus_tag LOCUS_44070 CDS complement(7540..7836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44080 assembly_gap 7552..7561 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7952..8671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173080.1 transl_table 11 codon_start 1 locus_tag LOCUS_44090 assembly_gap 8054..8063 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 9021..9110 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 9531..11279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44100 CDS 11727..13445 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095484220.1 transl_table 11 codon_start 1 locus_tag LOCUS_44110 CDS complement(13749..14678) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532410.1 transl_table 11 codon_start 1 locus_tag LOCUS_44120 CDS 14795..15253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44130 CDS 15714..16733 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168991739.1 transl_table 11 codon_start 1 locus_tag LOCUS_44140 CDS complement(16765..17202) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061352.1 transl_table 11 codon_start 1 locus_tag LOCUS_44150 CDS 17416..17796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531523.1 transl_table 11 codon_start 1 locus_tag LOCUS_44160 CDS complement(17942..18406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531527.1 transl_table 11 codon_start 1 locus_tag LOCUS_44170 CDS 18615..18830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44180 CDS 18940..19170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44190 CDS 19289..19477 product DUF3606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526775.1 transl_table 11 codon_start 1 locus_tag LOCUS_44200 CDS complement(19500..19985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528751.1 transl_table 11 codon_start 1 locus_tag LOCUS_44210 CDS 20174..20539 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528752.1 transl_table 11 codon_start 1 locus_tag LOCUS_44220 sequence108 source 1..20729 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(13..2730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44230 CDS complement(2735..3064) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530461.1 transl_table 11 codon_start 1 locus_tag LOCUS_44240 gene nirD CDS complement(3303..5753) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530460.1 transl_table 11 codon_start 1 locus_tag LOCUS_44250 gene nirB CDS complement(5774..7015) product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525898.1 transl_table 11 codon_start 1 locus_tag LOCUS_44260 CDS complement(7126..7323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44270 CDS complement(7726..8523) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530459.1 transl_table 11 codon_start 1 locus_tag LOCUS_44280 CDS complement(8534..9121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44290 note possible pseudo, frameshifted CDS complement(9115..9354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44300 note possible pseudo, frameshifted assembly_gap 9149..9158 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9487..10803) product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530457.1 transl_table 11 codon_start 1 locus_tag LOCUS_44310 CDS complement(11381..12274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44320 CDS complement(12379..13620) product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160926.1 transl_table 11 codon_start 1 locus_tag LOCUS_44330 CDS complement(13623..14225) product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530455.1 transl_table 11 codon_start 1 locus_tag LOCUS_44340 CDS complement(15015..15791) product type-2 restriction enzyme DpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418960.1 transl_table 11 codon_start 1 locus_tag LOCUS_44350 CDS 15873..16154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44360 CDS complement(16257..17690) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530546.1 transl_table 11 codon_start 1 locus_tag LOCUS_44370 CDS 17988..18629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44380 note possible pseudo, frameshifted assembly_gap 18420..18429 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 18547..19038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44390 note possible pseudo, frameshifted CDS complement(19089..19586) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530535.1 transl_table 11 codon_start 1 locus_tag LOCUS_44400 CDS complement(19691..20299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44410 sequence109 source 1..20685 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1493 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000446981.1:glycosyltransferase family 2 protein locus_tag LOCUS_44420 CDS 1720..2007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44430 CDS complement(2043..3047) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984085.1 transl_table 11 codon_start 1 locus_tag LOCUS_44440 CDS 3189..4592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44450 assembly_gap 4476..4485 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4486..6483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44460 CDS 6567..7343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44470 CDS complement(7395..8609) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337698.1 transl_table 11 codon_start 1 locus_tag LOCUS_44480 CDS complement(8606..9856) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007445862.1 transl_table 11 codon_start 1 locus_tag LOCUS_44490 assembly_gap 9437..9446 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9905..10225) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530552.1 transl_table 11 codon_start 1 locus_tag LOCUS_44500 CDS 10364..10966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085872.1 transl_table 11 codon_start 1 locus_tag LOCUS_44510 CDS complement(10992..11414) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530551.1 transl_table 11 codon_start 1 locus_tag LOCUS_44520 gene arsC CDS complement(11411..12094) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398893.1 transl_table 11 codon_start 1 locus_tag LOCUS_44530 CDS complement(12120..12452) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530549.1 transl_table 11 codon_start 1 locus_tag LOCUS_44540 CDS complement(12463..13143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44550 CDS complement(13248..13616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44560 CDS 13712..14188 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095485158.1 transl_table 11 codon_start 1 locus_tag LOCUS_44570 CDS 14432..15544 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 transl_table 11 codon_start 1 locus_tag LOCUS_44580 CDS complement(15590..16606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44590 CDS complement(16603..17748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957428.1 transl_table 11 codon_start 1 locus_tag LOCUS_44600 CDS complement(17745..18299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44610 note possible pseudo, internal stop codon assembly_gap 18397..18406 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(18420..18986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44620 note possible pseudo, internal stop codon CDS complement(18983..19819) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037580.1 transl_table 11 codon_start 1 locus_tag LOCUS_44630 misc_feature complement(19816..>20685) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011837707.1:NAD(P)-dependent oxidoreductase locus_tag LOCUS_44640 sequence110 source 1..20451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 215..224 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(962..2080) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976291.1 transl_table 11 codon_start 1 locus_tag LOCUS_44650 CDS complement(2086..2943) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331590.1 transl_table 11 codon_start 1 locus_tag LOCUS_44660 CDS complement(2953..3873) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976293.1 transl_table 11 codon_start 1 locus_tag LOCUS_44670 CDS complement(4026..5468) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254855.1 transl_table 11 codon_start 1 locus_tag LOCUS_44680 CDS complement(5514..6488) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393170.1 transl_table 11 codon_start 1 locus_tag LOCUS_44690 CDS 6692..7417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44700 CDS complement(7446..8447) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467385.1 transl_table 11 codon_start 1 locus_tag LOCUS_44710 CDS complement(8375..10678) product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029876.1 transl_table 11 codon_start 1 locus_tag LOCUS_44720 CDS complement(10682..11557) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 transl_table 11 codon_start 1 locus_tag LOCUS_44730 note possible pseudo, frameshifted CDS complement(11446..11775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44740 note possible pseudo, frameshifted assembly_gap 11561..11570 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11795..13222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44750 assembly_gap 13084..13093 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13219..14619) product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850841.1 transl_table 11 codon_start 1 locus_tag LOCUS_44760 CDS complement(14763..16154) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113030.1 transl_table 11 codon_start 1 locus_tag LOCUS_44770 CDS 16305..17057 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528553.1 transl_table 11 codon_start 1 locus_tag LOCUS_44780 CDS 17338..17505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44790 CDS 17601..18710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44800 assembly_gap 18674..18683 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence111 source 1..20307 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2736..3461) product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529183.1 transl_table 11 codon_start 1 locus_tag LOCUS_44810 gene phbB CDS complement(3580..4764) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529184.1 transl_table 11 codon_start 1 locus_tag LOCUS_44820 CDS 5066..5677 product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529185.1 transl_table 11 codon_start 1 locus_tag LOCUS_44830 gene phaR CDS complement(5777..6931) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529186.1 transl_table 11 codon_start 1 locus_tag LOCUS_44840 CDS 7029..8132 product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529187.1 transl_table 11 codon_start 1 locus_tag LOCUS_44850 CDS 8341..9471 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529189.1 transl_table 11 codon_start 1 locus_tag LOCUS_44860 CDS complement(9499..10221) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529190.1 transl_table 11 codon_start 1 locus_tag LOCUS_44870 CDS 10220..10681 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529191.1 transl_table 11 codon_start 1 locus_tag LOCUS_44880 CDS 10684..12957 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529192.1 transl_table 11 codon_start 1 locus_tag LOCUS_44890 CDS 12972..13562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529193.1 transl_table 11 codon_start 1 locus_tag LOCUS_44900 CDS 13808..14896 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529194.1 transl_table 11 codon_start 1 locus_tag LOCUS_44910 CDS 14970..18140 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529195.1 transl_table 11 codon_start 1 locus_tag LOCUS_44920 CDS 18238..18396 product DUF3309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529196.1 transl_table 11 codon_start 1 locus_tag LOCUS_44930 CDS complement(18445..19404) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529197.1 transl_table 11 codon_start 1 locus_tag LOCUS_44940 assembly_gap 19070..19079 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence112 source 1..20276 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1122..2048 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528681.1 transl_table 11 codon_start 1 locus_tag LOCUS_44950 CDS 2045..2806 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528680.1 transl_table 11 codon_start 1 locus_tag LOCUS_44960 CDS complement(2815..3852) product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528679.1 transl_table 11 codon_start 1 locus_tag LOCUS_44970 CDS 4117..4608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44980 CDS 4605..5285 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967556.1 transl_table 11 codon_start 1 locus_tag LOCUS_44990 CDS complement(5413..5637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528677.1 transl_table 11 codon_start 1 locus_tag LOCUS_45000 CDS complement(5783..7786) product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528676.1 transl_table 11 codon_start 1 locus_tag LOCUS_45010 CDS 8133..8471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528672.1 transl_table 11 codon_start 1 locus_tag LOCUS_45020 CDS 8488..9189 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528671.1 transl_table 11 codon_start 1 locus_tag LOCUS_45030 CDS 9281..9550 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528670.1 transl_table 11 codon_start 1 locus_tag LOCUS_45040 CDS 9680..11383 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528669.1 transl_table 11 codon_start 1 locus_tag LOCUS_45050 CDS complement(11428..12087) product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528668.1 transl_table 11 codon_start 1 locus_tag LOCUS_45060 note possible pseudo, internal stop codon CDS 12400..13197 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528667.1 transl_table 11 codon_start 1 locus_tag LOCUS_45070 CDS complement(13199..13999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 transl_table 11 codon_start 1 locus_tag LOCUS_45080 CDS complement(14049..14990) product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528660.1 transl_table 11 codon_start 1 locus_tag LOCUS_45090 CDS complement(14987..15460) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528659.1 transl_table 11 codon_start 1 locus_tag LOCUS_45100 CDS 15552..16295 product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528658.1 transl_table 11 codon_start 1 locus_tag LOCUS_45110 CDS 16292..17245 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528657.1 transl_table 11 codon_start 1 locus_tag LOCUS_45120 CDS 17242..18162 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528656.1 transl_table 11 codon_start 1 locus_tag LOCUS_45130 CDS 18171..19307 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528655.1 transl_table 11 codon_start 1 locus_tag LOCUS_45140 sequence113 source 1..20224 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(449..685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45150 CDS 859..1842 product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528652.1 transl_table 11 codon_start 1 locus_tag LOCUS_45160 CDS complement(1852..2196) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528651.1 transl_table 11 codon_start 1 locus_tag LOCUS_45170 CDS complement(2193..2561) product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528650.1 transl_table 11 codon_start 1 locus_tag LOCUS_45180 CDS 2734..3408 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528648.1 transl_table 11 codon_start 1 locus_tag LOCUS_45190 CDS complement(3423..4955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45200 note possible pseudo, frameshifted CDS complement(4891..5949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45210 note possible pseudo, frameshifted assembly_gap 5116..5125 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5962..6825) product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528646.1 transl_table 11 codon_start 1 locus_tag LOCUS_45220 CDS 7189..7335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528645.1 transl_table 11 codon_start 1 locus_tag LOCUS_45230 CDS 7515..7967 product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528644.1 transl_table 11 codon_start 1 locus_tag LOCUS_45240 CDS 8183..8542 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528640.1 transl_table 11 codon_start 1 locus_tag LOCUS_45250 CDS 8550..9581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45260 note possible pseudo, frameshifted CDS 9544..9804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45270 note possible pseudo, frameshifted CDS complement(9964..10584) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528638.1 transl_table 11 codon_start 1 locus_tag LOCUS_45280 CDS complement(10717..11697) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528637.1 transl_table 11 codon_start 1 locus_tag LOCUS_45290 gene cysK CDS complement(11889..12506) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528636.1 transl_table 11 codon_start 1 locus_tag LOCUS_45300 CDS complement(12643..13983) product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528635.1 transl_table 11 codon_start 1 locus_tag LOCUS_45310 CDS complement(14106..14303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528634.1 transl_table 11 codon_start 1 locus_tag LOCUS_45320 CDS complement(14450..15532) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528633.1 transl_table 11 codon_start 1 locus_tag LOCUS_45330 gene hrcA CDS 15675..16391 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528632.1 transl_table 11 codon_start 1 locus_tag LOCUS_45340 gene rph CDS 16575..16985 product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528631.1 transl_table 11 codon_start 1 locus_tag LOCUS_45350 CDS 16985..17632 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528630.1 transl_table 11 codon_start 1 locus_tag LOCUS_45360 gene rdgB CDS 17634..18791 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528629.1 transl_table 11 codon_start 1 locus_tag LOCUS_45370 gene hemW CDS 18844..19164 product low molecular weight protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528628.1 transl_table 11 codon_start 1 locus_tag LOCUS_45380 CDS complement(19219..19407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45390 CDS complement(19415..19609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45400 sequence114 source 1..19779 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(197..2158) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173803.1 transl_table 11 codon_start 1 locus_tag LOCUS_45410 assembly_gap 2554..2653 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3263..3529 product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529470.1 transl_table 11 codon_start 1 locus_tag LOCUS_45420 CDS 3561..3848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45430 rRNA 4456..5937 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 6260..6336 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 6382..6457 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 rRNA 6876..9667 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 9858..9967 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 tRNA 10122..10198 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 10344..10985 product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067164.1 transl_table 11 codon_start 1 locus_tag LOCUS_45440 CDS complement(11192..11542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969816.1 transl_table 11 codon_start 1 locus_tag LOCUS_45450 CDS complement(12000..12470) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173672.1 transl_table 11 codon_start 1 locus_tag LOCUS_45460 CDS complement(12619..13974) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532930.1 transl_table 11 codon_start 1 locus_tag LOCUS_45470 CDS complement(14229..14927) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114140.1 transl_table 11 codon_start 1 locus_tag LOCUS_45480 CDS complement(15087..15869) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530311.1 transl_table 11 codon_start 1 locus_tag LOCUS_45490 CDS 16045..17229 product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530312.1 transl_table 11 codon_start 1 locus_tag LOCUS_45500 gene uxuA CDS complement(17278..19110) product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243176.1 transl_table 11 codon_start 1 locus_tag LOCUS_45510 gene atzF assembly_gap 17338..17347 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19107..19457) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243177.1 transl_table 11 codon_start 1 locus_tag LOCUS_45520 sequence115 source 1..19661 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 258..926 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532377.1 transl_table 11 codon_start 1 locus_tag LOCUS_45530 CDS 953..1873 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532378.1 transl_table 11 codon_start 1 locus_tag LOCUS_45540 CDS complement(2375..2584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45550 CDS 2865..3059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45560 CDS complement(3119..3316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530624.1 transl_table 11 codon_start 1 locus_tag LOCUS_45570 CDS complement(3394..3693) product DUF1236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525105.1 transl_table 11 codon_start 1 locus_tag LOCUS_45580 CDS 4178..4471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531582.1 transl_table 11 codon_start 1 locus_tag LOCUS_45590 CDS 4614..4823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45600 CDS complement(4908..5846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45610 CDS 6165..6404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45620 CDS 6434..6667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45630 CDS complement(6687..8693) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530759.1 transl_table 11 codon_start 1 locus_tag LOCUS_45640 CDS complement(8856..9398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457970.1 transl_table 11 codon_start 1 locus_tag LOCUS_45650 CDS complement(9603..9956) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529346.1 transl_table 11 codon_start 1 locus_tag LOCUS_45660 CDS 10335..12311 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530593.1 transl_table 11 codon_start 1 locus_tag LOCUS_45670 CDS complement(12413..13087) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967809.1 transl_table 11 codon_start 1 locus_tag LOCUS_45680 CDS 13457..14995 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965761.1 transl_table 11 codon_start 1 locus_tag LOCUS_45690 CDS 15274..15588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45700 CDS 15941..16318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45710 CDS 16589..17332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45720 note possible pseudo, frameshifted assembly_gap 17249..17258 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17268..17882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45730 note possible pseudo, frameshifted CDS 18057..18602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45740 note possible pseudo, frameshifted CDS 18568..18855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45750 CDS complement(18965..19561) product DUF6456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530588.1 transl_table 11 codon_start 1 locus_tag LOCUS_45760 sequence116 source 1..19522 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 442..1335 product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529359.1 transl_table 11 codon_start 1 locus_tag LOCUS_45770 CDS complement(1377..2927) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529360.1 transl_table 11 codon_start 1 locus_tag LOCUS_45780 CDS complement(2939..4252) product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529361.1 transl_table 11 codon_start 1 locus_tag LOCUS_45790 CDS complement(4270..6219) product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529362.1 transl_table 11 codon_start 1 locus_tag LOCUS_45800 CDS 6136..6390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45810 CDS 6583..7395 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529363.1 transl_table 11 codon_start 1 locus_tag LOCUS_45820 CDS 7552..9105 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529364.1 transl_table 11 codon_start 1 locus_tag LOCUS_45830 CDS complement(9129..9431) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529365.1 transl_table 11 codon_start 1 locus_tag LOCUS_45840 CDS 9611..10240 product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529366.1 transl_table 11 codon_start 1 locus_tag LOCUS_45850 CDS 10364..11350 product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529367.1 transl_table 11 codon_start 1 locus_tag LOCUS_45860 gene cobS CDS 11361..11831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109671609.1 transl_table 11 codon_start 1 locus_tag LOCUS_45870 CDS 11841..13739 product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529369.1 transl_table 11 codon_start 1 locus_tag LOCUS_45880 gene cobT CDS 13745..14758 product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529370.1 transl_table 11 codon_start 1 locus_tag LOCUS_45890 CDS complement(14768..15379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529371.1 transl_table 11 codon_start 1 locus_tag LOCUS_45900 CDS complement(15499..16179) product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529372.1 transl_table 11 codon_start 1 locus_tag LOCUS_45910 CDS complement(16320..16616) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529373.1 transl_table 11 codon_start 1 locus_tag LOCUS_45920 gene rpmB CDS 16867..17673 product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529374.1 transl_table 11 codon_start 1 locus_tag LOCUS_45930 CDS 17702..18589 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529375.1 transl_table 11 codon_start 1 locus_tag LOCUS_45940 CDS 18586..19257 product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529376.1 transl_table 11 codon_start 1 locus_tag LOCUS_45950 CDS complement(19254..19520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45960 sequence117 source 1..19355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 335..344 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 362..994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45970 note possible pseudo, frameshifted CDS 1096..2418 product ActS/PrrB/RegB family redox-sensitive histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528073.1 transl_table 11 codon_start 1 locus_tag LOCUS_45980 CDS 2565..3101 product ActR/PrrA/RegA family redox response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528072.1 transl_table 11 codon_start 1 locus_tag LOCUS_45990 CDS 3450..4637 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528071.1 transl_table 11 codon_start 1 locus_tag LOCUS_46000 gene nhaA CDS complement(4634..5668) product RNA polymerase subunit sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203909262.1 transl_table 11 codon_start 1 locus_tag LOCUS_46010 CDS complement(5711..6457) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141228.1 transl_table 11 codon_start 1 locus_tag LOCUS_46020 CDS complement(6897..7409) product MmcB family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050596417.1 transl_table 11 codon_start 1 locus_tag LOCUS_46030 tRNA complement(7460..7533) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 8372..8590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46040 CDS complement(8629..8895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46050 note possible pseudo, frameshifted CDS complement(9315..9731) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 transl_table 11 codon_start 1 locus_tag LOCUS_46060 gene cueR CDS 9959..10576 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528066.1 transl_table 11 codon_start 1 locus_tag LOCUS_46070 CDS complement(10738..11307) product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528064.1 transl_table 11 codon_start 1 locus_tag LOCUS_46080 CDS complement(11584..12075) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528063.1 transl_table 11 codon_start 1 locus_tag LOCUS_46090 CDS complement(12178..12621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46100 note possible pseudo, frameshifted CDS complement(12618..13238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46110 note possible pseudo, frameshifted assembly_gap 12626..12635 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13622..15220) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528061.1 transl_table 11 codon_start 1 locus_tag LOCUS_46120 gene murJ CDS complement(15261..18062) product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528060.1 transl_table 11 codon_start 1 locus_tag LOCUS_46130 sequence118 source 1..19272 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(324..764) product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529580.1 transl_table 11 codon_start 1 locus_tag LOCUS_46140 CDS complement(761..1141) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529579.1 transl_table 11 codon_start 1 locus_tag LOCUS_46150 CDS complement(1234..1932) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529578.1 transl_table 11 codon_start 1 locus_tag LOCUS_46160 CDS complement(2046..2663) product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107793.1 transl_table 11 codon_start 1 locus_tag LOCUS_46170 gene prfH CDS complement(2650..3873) product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074621948.1 transl_table 11 codon_start 1 locus_tag LOCUS_46180 CDS 4156..5241 product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529577.1 transl_table 11 codon_start 1 locus_tag LOCUS_46190 CDS 5242..6090 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529576.1 transl_table 11 codon_start 1 locus_tag LOCUS_46200 CDS 6159..6641 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529575.1 transl_table 11 codon_start 1 locus_tag LOCUS_46210 gene lspA CDS 6696..7685 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529574.1 transl_table 11 codon_start 1 locus_tag LOCUS_46220 CDS 7761..10064 product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529573.1 transl_table 11 codon_start 1 locus_tag LOCUS_46230 CDS 10247..11134 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529572.1 transl_table 11 codon_start 1 locus_tag LOCUS_46240 CDS complement(11214..11846) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529571.1 transl_table 11 codon_start 1 locus_tag LOCUS_46250 CDS complement(11951..12586) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529570.1 transl_table 11 codon_start 1 locus_tag LOCUS_46260 gene grpE CDS 12815..13015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529569.1 transl_table 11 codon_start 1 locus_tag LOCUS_46270 CDS complement(13176..13796) product DJ-1/PfpI/YhbO family deglycase/protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535280.1 transl_table 11 codon_start 1 locus_tag LOCUS_46280 CDS complement(13987..15594) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 transl_table 11 codon_start 1 locus_tag LOCUS_46290 CDS complement(15683..16216) product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529565.1 transl_table 11 codon_start 1 locus_tag LOCUS_46300 CDS complement(16361..17125) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529564.1 transl_table 11 codon_start 1 locus_tag LOCUS_46310 CDS complement(17100..18770) product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529563.1 transl_table 11 codon_start 1 locus_tag LOCUS_46320 CDS complement(18814..19119) product DUF2849 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529562.1 transl_table 11 codon_start 1 locus_tag LOCUS_46330 sequence119 source 1..19082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(373..1893) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531714.1 transl_table 11 codon_start 1 locus_tag LOCUS_46340 CDS 1969..2592 product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063167987.1 transl_table 11 codon_start 1 locus_tag LOCUS_46350 CDS 2623..3234 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 transl_table 11 codon_start 1 locus_tag LOCUS_46360 CDS 3242..3859 product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531711.1 transl_table 11 codon_start 1 locus_tag LOCUS_46370 CDS 4005..4496 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205209.1 transl_table 11 codon_start 1 locus_tag LOCUS_46380 CDS complement(4549..5118) product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531710.1 transl_table 11 codon_start 1 locus_tag LOCUS_46390 CDS complement(5165..5551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46400 CDS complement(5703..6407) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531709.1 transl_table 11 codon_start 1 locus_tag LOCUS_46410 CDS complement(6415..7284) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531708.1 transl_table 11 codon_start 1 locus_tag LOCUS_46420 CDS complement(7398..8228) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531707.1 transl_table 11 codon_start 1 locus_tag LOCUS_46430 CDS complement(8225..8938) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531706.1 transl_table 11 codon_start 1 locus_tag LOCUS_46440 assembly_gap 9017..9026 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9050..9832) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531705.1 transl_table 11 codon_start 1 locus_tag LOCUS_46450 CDS complement(10044..10553) product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531704.1 transl_table 11 codon_start 1 locus_tag LOCUS_46460 gene mobB CDS complement(10550..11176) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531703.1 transl_table 11 codon_start 1 locus_tag LOCUS_46470 gene mobA CDS complement(11233..12162) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531702.1 transl_table 11 codon_start 1 locus_tag LOCUS_46480 CDS complement(12274..12630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531701.1 transl_table 11 codon_start 1 locus_tag LOCUS_46490 CDS complement(12752..13225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531700.1 transl_table 11 codon_start 1 locus_tag LOCUS_46500 CDS complement(13280..14275) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531699.1 transl_table 11 codon_start 1 locus_tag LOCUS_46510 gene moaA CDS 14486..14839 product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531698.1 transl_table 11 codon_start 1 locus_tag LOCUS_46520 CDS 14913..15524 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531697.1 transl_table 11 codon_start 1 locus_tag LOCUS_46530 CDS complement(15659..16111) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531696.1 transl_table 11 codon_start 1 locus_tag LOCUS_46540 CDS 16159..17070 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531695.1 transl_table 11 codon_start 1 locus_tag LOCUS_46550 CDS complement(17078..17425) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531694.1 transl_table 11 codon_start 1 locus_tag LOCUS_46560 assembly_gap 17427..17436 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence120 source 1..18933 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(267..1124) product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532833.1 transl_table 11 codon_start 1 locus_tag LOCUS_46570 CDS 1174..2037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46580 assembly_gap 1352..1361 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2046..2270) product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532831.1 transl_table 11 codon_start 1 locus_tag LOCUS_46590 CDS 2423..3448 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532830.1 transl_table 11 codon_start 1 locus_tag LOCUS_46600 CDS 3751..5523 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532826.1 transl_table 11 codon_start 1 locus_tag LOCUS_46610 CDS complement(5575..6036) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532825.1 transl_table 11 codon_start 1 locus_tag LOCUS_46620 CDS 6186..7130 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038645360.1 transl_table 11 codon_start 1 locus_tag LOCUS_46630 CDS 7675..8712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46640 assembly_gap 8671..8680 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8685..9728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46650 CDS 9895..10191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46660 CDS complement(10283..10672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502648.1 transl_table 11 codon_start 1 locus_tag LOCUS_46670 CDS complement(10807..11301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532820.1 transl_table 11 codon_start 1 locus_tag LOCUS_46680 CDS 11466..12449 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171643.1 transl_table 11 codon_start 1 locus_tag LOCUS_46690 assembly_gap 11952..11961 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12470..13912 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532818.1 transl_table 11 codon_start 1 locus_tag LOCUS_46700 CDS 14097..14663 product DUF6101 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532817.1 transl_table 11 codon_start 1 locus_tag LOCUS_46710 CDS complement(14880..15863) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173619.1 transl_table 11 codon_start 1 locus_tag LOCUS_46720 gene ubiA CDS 16153..17451 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532813.1 transl_table 11 codon_start 1 locus_tag LOCUS_46730 gene purD CDS complement(17448..18818) product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530194.1 transl_table 11 codon_start 1 locus_tag LOCUS_46740 sequence121 source 1..18915 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(429..1313) product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528990.1 transl_table 11 codon_start 1 locus_tag LOCUS_46750 gene pdxY CDS complement(1326..1577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528991.1 transl_table 11 codon_start 1 locus_tag LOCUS_46760 CDS 1742..2380 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528992.1 transl_table 11 codon_start 1 locus_tag LOCUS_46770 CDS 2607..3395 product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528993.1 transl_table 11 codon_start 1 locus_tag LOCUS_46780 CDS 3401..4039 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528995.1 transl_table 11 codon_start 1 locus_tag LOCUS_46790 CDS 4159..4665 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528996.1 transl_table 11 codon_start 1 locus_tag LOCUS_46800 CDS 4770..5312 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528997.1 transl_table 11 codon_start 1 locus_tag LOCUS_46810 gene ppa CDS complement(5320..5952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528998.1 transl_table 11 codon_start 1 locus_tag LOCUS_46820 CDS complement(5956..6573) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528999.1 transl_table 11 codon_start 1 locus_tag LOCUS_46830 CDS 6651..7952 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504198.1 transl_table 11 codon_start 1 locus_tag LOCUS_46840 assembly_gap 7699..7708 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8179..9789 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529001.1 transl_table 11 codon_start 1 locus_tag LOCUS_46850 CDS complement(9960..10238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173302.1 transl_table 11 codon_start 1 locus_tag LOCUS_46860 CDS 10371..12269 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529003.1 transl_table 11 codon_start 1 locus_tag LOCUS_46870 gene typA CDS complement(12326..12952) product DUF1062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529004.1 transl_table 11 codon_start 1 locus_tag LOCUS_46880 CDS 13370..13984 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529005.1 transl_table 11 codon_start 1 locus_tag LOCUS_46890 CDS complement(13989..14312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529006.1 transl_table 11 codon_start 1 locus_tag LOCUS_46900 CDS complement(14461..15048) product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529007.1 transl_table 11 codon_start 1 locus_tag LOCUS_46910 sequence122 source 1..18806 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(485..1774) product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391726.1 transl_table 11 codon_start 1 locus_tag LOCUS_46920 assembly_gap 1391..1400 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1956..2762 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529089.1 transl_table 11 codon_start 1 locus_tag LOCUS_46930 CDS 3039..3905 product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090306.1 transl_table 11 codon_start 1 locus_tag LOCUS_46940 CDS 3902..5128 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965997.1 transl_table 11 codon_start 1 locus_tag LOCUS_46950 CDS complement(5209..6366) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086149.1 transl_table 11 codon_start 1 locus_tag LOCUS_46960 CDS 6661..7023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46970 assembly_gap 7002..7011 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7020..8141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46980 CDS complement(8127..9221) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086145.1 transl_table 11 codon_start 1 locus_tag LOCUS_46990 CDS complement(9218..10645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47000 CDS 10868..13021 product GumC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086146.1 transl_table 11 codon_start 1 locus_tag LOCUS_47010 CDS 13025..14161 product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965991.1 transl_table 11 codon_start 1 locus_tag LOCUS_47020 CDS 14222..15751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47030 CDS complement(15818..16696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083777.1 transl_table 11 codon_start 1 locus_tag LOCUS_47040 CDS complement(16964..18067) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063665.1 transl_table 11 codon_start 1 locus_tag LOCUS_47050 assembly_gap 18399..18408 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence123 source 1..18763 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 280..289 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1362..2408) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975043.1 transl_table 11 codon_start 1 locus_tag LOCUS_47060 CDS complement(2424..3251) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543285.1 transl_table 11 codon_start 1 locus_tag LOCUS_47070 CDS complement(3248..4114) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197717.1 transl_table 11 codon_start 1 locus_tag LOCUS_47080 CDS complement(4222..4746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47090 note possible pseudo, frameshifted CDS 4646..5431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47100 assembly_gap 4721..4730 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5732..6649) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432420.1 transl_table 11 codon_start 1 locus_tag LOCUS_47110 CDS 6858..8261 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528421.1 transl_table 11 codon_start 1 locus_tag LOCUS_47120 CDS complement(8305..9108) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525654.1 transl_table 11 codon_start 1 locus_tag LOCUS_47130 CDS complement(9105..9959) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066630.1 transl_table 11 codon_start 1 locus_tag LOCUS_47140 CDS complement(9956..10993) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329326.1 transl_table 11 codon_start 1 locus_tag LOCUS_47150 CDS complement(11069..12157) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969978.1 transl_table 11 codon_start 1 locus_tag LOCUS_47160 CDS complement(12228..12875) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528435.1 transl_table 11 codon_start 1 locus_tag LOCUS_47170 CDS complement(12872..13540) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528436.1 transl_table 11 codon_start 1 locus_tag LOCUS_47180 CDS complement(13649..14452) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528437.1 transl_table 11 codon_start 1 locus_tag LOCUS_47190 CDS complement(14532..15650) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528438.1 transl_table 11 codon_start 1 locus_tag LOCUS_47200 gene speB CDS 15801..16775 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528439.1 transl_table 11 codon_start 1 locus_tag LOCUS_47210 gene gcvA CDS 16952..18256 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528440.1 transl_table 11 codon_start 1 locus_tag LOCUS_47220 gene pncB CDS 18350..18574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47230 note possible pseudo, frameshifted sequence124 source 1..18531 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2915 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531051.1:efflux RND transporter permease subunit locus_tag LOCUS_47240 CDS 2986..3591 product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531052.1 transl_table 11 codon_start 1 locus_tag LOCUS_47250 gene nthA CDS 3605..4264 product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531053.1 transl_table 11 codon_start 1 locus_tag LOCUS_47260 gene nthB CDS 4251..4604 product nitrile hydratase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531054.1 transl_table 11 codon_start 1 locus_tag LOCUS_47270 CDS 4613..5506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47280 CDS 5625..6800 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531055.1 transl_table 11 codon_start 1 locus_tag LOCUS_47290 CDS complement(6810..7214) product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531056.1 transl_table 11 codon_start 1 locus_tag LOCUS_47300 CDS 7296..8069 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531057.1 transl_table 11 codon_start 1 locus_tag LOCUS_47310 CDS 8173..8985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47320 note possible pseudo, frameshifted assembly_gap 8949..8958 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8979..10052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47330 note possible pseudo, frameshifted CDS complement(10111..10455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47340 note possible pseudo, frameshifted CDS complement(10346..10969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47350 note possible pseudo, frameshifted CDS 11107..11517 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531060.1 transl_table 11 codon_start 1 locus_tag LOCUS_47360 CDS complement(11777..12682) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531062.1 transl_table 11 codon_start 1 locus_tag LOCUS_47370 CDS complement(12684..12989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47380 CDS 13088..13546 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531063.1 transl_table 11 codon_start 1 locus_tag LOCUS_47390 CDS 13700..14362 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173714.1 transl_table 11 codon_start 1 locus_tag LOCUS_47400 CDS 14493..15512 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531065.1 transl_table 11 codon_start 1 locus_tag LOCUS_47410 gene ilvC CDS complement(15831..16115) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532019.1 transl_table 11 codon_start 1 locus_tag LOCUS_47420 CDS complement(16277..16852) product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531066.1 transl_table 11 codon_start 1 locus_tag LOCUS_47430 CDS 17020..18132 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531067.1 transl_table 11 codon_start 1 locus_tag LOCUS_47440 sequence125 source 1..18437 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 179..1231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47450 CDS 1274..1939 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528838.1 transl_table 11 codon_start 1 locus_tag LOCUS_47460 CDS 2009..2629 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528837.1 transl_table 11 codon_start 1 locus_tag LOCUS_47470 CDS 2623..3195 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528836.1 transl_table 11 codon_start 1 locus_tag LOCUS_47480 CDS complement(3215..3334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47490 note possible pseudo, frameshifted CDS complement(3349..3771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47500 note possible pseudo, frameshifted assembly_gap 3459..3468 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3839..4141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47510 note possible pseudo, frameshifted assembly_gap 3847..3856 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4428..4595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528833.1 transl_table 11 codon_start 1 locus_tag LOCUS_47520 CDS complement(4756..5340) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528832.1 transl_table 11 codon_start 1 locus_tag LOCUS_47530 CDS complement(5337..5552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47540 CDS complement(5647..6312) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528830.1 transl_table 11 codon_start 1 locus_tag LOCUS_47550 gene ccmB CDS complement(6524..7180) product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528829.1 transl_table 11 codon_start 1 locus_tag LOCUS_47560 gene ccmA CDS 7417..10107 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528828.1 transl_table 11 codon_start 1 locus_tag LOCUS_47570 gene acnA CDS complement(10146..10874) product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528827.1 transl_table 11 codon_start 1 locus_tag LOCUS_47580 CDS 11060..11833 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528826.1 transl_table 11 codon_start 1 locus_tag LOCUS_47590 CDS 12223..12612 product DUF2794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528825.1 transl_table 11 codon_start 1 locus_tag LOCUS_47600 CDS complement(12774..13352) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528824.1 transl_table 11 codon_start 1 locus_tag LOCUS_47610 CDS complement(13458..14237) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528823.1 transl_table 11 codon_start 1 locus_tag LOCUS_47620 CDS complement(14468..17527) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528822.1 transl_table 11 codon_start 1 locus_tag LOCUS_47630 assembly_gap 17030..17039 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17658..18302 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528820.1 transl_table 11 codon_start 1 locus_tag LOCUS_47640 sequence126 source 1..18323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..646 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530111.1:metallophosphoesterase family protein locus_tag LOCUS_47650 CDS 855..1691 product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173777.1 transl_table 11 codon_start 1 locus_tag LOCUS_47660 CDS 1930..5433 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530109.1 transl_table 11 codon_start 1 locus_tag LOCUS_47670 gene carB CDS complement(5484..5876) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530107.1 transl_table 11 codon_start 1 locus_tag LOCUS_47680 CDS complement(5964..6428) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086784.1 transl_table 11 codon_start 1 locus_tag LOCUS_47690 CDS complement(6690..7241) product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530103.1 transl_table 11 codon_start 1 locus_tag LOCUS_47700 CDS 7385..7723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530101.1 transl_table 11 codon_start 1 locus_tag LOCUS_47710 CDS complement(7968..8450) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530097.1 transl_table 11 codon_start 1 locus_tag LOCUS_47720 CDS complement(8456..9376) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530096.1 transl_table 11 codon_start 1 locus_tag LOCUS_47730 CDS 9552..10121 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530095.1 transl_table 11 codon_start 1 locus_tag LOCUS_47740 CDS complement(10135..10575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530641.1 transl_table 11 codon_start 1 locus_tag LOCUS_47750 CDS complement(10734..11060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530090.1 transl_table 11 codon_start 1 locus_tag LOCUS_47760 CDS 11353..11565 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910991.1 transl_table 11 codon_start 1 locus_tag LOCUS_47770 CDS complement(11911..12519) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530087.1 transl_table 11 codon_start 1 locus_tag LOCUS_47780 CDS complement(12595..13455) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530086.1 transl_table 11 codon_start 1 locus_tag LOCUS_47790 CDS complement(13452..14351) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530085.1 transl_table 11 codon_start 1 locus_tag LOCUS_47800 CDS 14564..15766 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530084.1 transl_table 11 codon_start 1 locus_tag LOCUS_47810 CDS complement(15809..16204) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530082.1 transl_table 11 codon_start 1 locus_tag LOCUS_47820 CDS complement(16366..16917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47830 CDS 17066..17926 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530214.1 transl_table 11 codon_start 1 locus_tag LOCUS_47840 sequence127 source 1..18010 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528556.1:aldehyde dehydrogenase locus_tag LOCUS_47850 CDS complement(668..1234) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530512.1 transl_table 11 codon_start 1 locus_tag LOCUS_47860 CDS complement(1267..1485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47870 CDS 1367..2152 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530513.1 transl_table 11 codon_start 1 locus_tag LOCUS_47880 CDS 2219..3220 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530514.1 transl_table 11 codon_start 1 locus_tag LOCUS_47890 CDS complement(3305..4453) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530516.1 transl_table 11 codon_start 1 locus_tag LOCUS_47900 CDS complement(4546..5001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47910 CDS 5270..6130 product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530648.1 transl_table 11 codon_start 1 locus_tag LOCUS_47920 CDS 6130..6606 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 transl_table 11 codon_start 1 locus_tag LOCUS_47930 CDS 6608..8872 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 transl_table 11 codon_start 1 locus_tag LOCUS_47940 CDS 8938..9183 product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530645.1 transl_table 11 codon_start 1 locus_tag LOCUS_47950 CDS complement(9310..9900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47960 CDS complement(10754..11170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47970 CDS complement(11359..12249) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530665.1 transl_table 11 codon_start 1 locus_tag LOCUS_47980 CDS 12650..13009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530642.1 transl_table 11 codon_start 1 locus_tag LOCUS_47990 CDS 13142..13996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48000 CDS 14007..14915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48010 CDS complement(14943..16145) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966466.1 transl_table 11 codon_start 1 locus_tag LOCUS_48020 CDS complement(16165..16782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48030 CDS 16938..17939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48040 sequence128 source 1..17917 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 94..513 product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528202.1 transl_table 11 codon_start 1 locus_tag LOCUS_48050 CDS 515..1912 product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528201.1 transl_table 11 codon_start 1 locus_tag LOCUS_48060 CDS complement(1991..2452) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528454.1 transl_table 11 codon_start 1 locus_tag LOCUS_48070 CDS complement(2449..3033) product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528453.1 transl_table 11 codon_start 1 locus_tag LOCUS_48080 CDS complement(3026..3907) product thiamine biosynthesis protein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528452.1 transl_table 11 codon_start 1 locus_tag LOCUS_48090 CDS complement(3907..5448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528451.1 transl_table 11 codon_start 1 locus_tag LOCUS_48100 CDS complement(5445..8240) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528450.1 transl_table 11 codon_start 1 locus_tag LOCUS_48110 CDS complement(8237..9097) product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528449.1 transl_table 11 codon_start 1 locus_tag LOCUS_48120 CDS 9348..9962 product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528448.1 transl_table 11 codon_start 1 locus_tag LOCUS_48130 gene pncA CDS 10096..11421 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528447.1 transl_table 11 codon_start 1 locus_tag LOCUS_48140 CDS 11511..12113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48150 note possible pseudo, frameshifted CDS 12188..12466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48160 CDS complement(12472..13191) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528446.1 transl_table 11 codon_start 1 locus_tag LOCUS_48170 CDS complement(13184..13912) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528445.1 transl_table 11 codon_start 1 locus_tag LOCUS_48180 CDS complement(13909..14871) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528444.1 transl_table 11 codon_start 1 locus_tag LOCUS_48190 CDS complement(14868..15749) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528443.1 transl_table 11 codon_start 1 locus_tag LOCUS_48200 CDS complement(15964..17268) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528442.1 transl_table 11 codon_start 1 locus_tag LOCUS_48210 sequence129 source 1..17788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 155..1186 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528476.1 transl_table 11 codon_start 1 locus_tag LOCUS_48220 CDS complement(1161..1862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528477.1 transl_table 11 codon_start 1 locus_tag LOCUS_48230 CDS complement(1832..2281) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109667275.1 transl_table 11 codon_start 1 locus_tag LOCUS_48240 assembly_gap 1905..1914 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2259..2621) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528479.1 transl_table 11 codon_start 1 locus_tag LOCUS_48250 CDS complement(2694..3548) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528480.1 transl_table 11 codon_start 1 locus_tag LOCUS_48260 gene dapD CDS 3799..4629 product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528481.1 transl_table 11 codon_start 1 locus_tag LOCUS_48270 CDS complement(4780..5421) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 transl_table 11 codon_start 1 locus_tag LOCUS_48280 CDS complement(5453..5635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48290 CDS complement(5751..6431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48300 CDS 6723..7139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48310 repeat_region 7518..7700 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcggcgccttcaacggcaac CDS 7814..8227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48320 CDS complement(8284..8991) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528482.1 transl_table 11 codon_start 1 locus_tag LOCUS_48330 CDS 9152..9913 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528483.1 transl_table 11 codon_start 1 locus_tag LOCUS_48340 CDS 10108..10263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528484.1 transl_table 11 codon_start 1 locus_tag LOCUS_48350 CDS 10260..11699 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528485.1 transl_table 11 codon_start 1 locus_tag LOCUS_48360 CDS complement(11840..12007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48370 CDS 12142..12594 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230886.1 transl_table 11 codon_start 1 locus_tag LOCUS_48380 CDS complement(12816..13649) product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528486.1 transl_table 11 codon_start 1 locus_tag LOCUS_48390 gene phhA CDS 13792..14268 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528487.1 transl_table 11 codon_start 1 locus_tag LOCUS_48400 CDS 14381..15940 product magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528488.1 transl_table 11 codon_start 1 locus_tag LOCUS_48410 gene bchE CDS complement(15984..16877) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528489.1 transl_table 11 codon_start 1 locus_tag LOCUS_48420 gene argB misc_feature complement(16980..>17788) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017586463.1:amidase locus_tag LOCUS_48430 sequence130 source 1..17507 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..519 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531937.1:DNA polymerase IV locus_tag LOCUS_48440 CDS complement(540..1043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531938.1 transl_table 11 codon_start 1 locus_tag LOCUS_48450 CDS complement(1143..1361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48460 CDS 1261..2103 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531939.1 transl_table 11 codon_start 1 locus_tag LOCUS_48470 CDS complement(2157..3131) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 transl_table 11 codon_start 1 locus_tag LOCUS_48480 CDS complement(3208..6735) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531941.1 transl_table 11 codon_start 1 locus_tag LOCUS_48490 gene dnaE CDS complement(6828..8840) product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531942.1 transl_table 11 codon_start 1 locus_tag LOCUS_48500 CDS 9102..10229 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531943.1 transl_table 11 codon_start 1 locus_tag LOCUS_48510 tRNA 9957..10040 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 10293..10862 product S-(hydroxymethyl)glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034856926.1 transl_table 11 codon_start 1 locus_tag LOCUS_48520 gene gfa CDS 10927..11394 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531944.1 transl_table 11 codon_start 1 locus_tag LOCUS_48530 CDS 11420..12097 product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531945.1 transl_table 11 codon_start 1 locus_tag LOCUS_48540 CDS 12185..13063 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531946.1 transl_table 11 codon_start 1 locus_tag LOCUS_48550 CDS 13065..13856 product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531947.1 transl_table 11 codon_start 1 locus_tag LOCUS_48560 CDS complement(14049..15050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531951.1 transl_table 11 codon_start 1 locus_tag LOCUS_48570 CDS 15476..16576 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531952.1 transl_table 11 codon_start 1 locus_tag LOCUS_48580 gene gcvT CDS 16583..16951 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531953.1 transl_table 11 codon_start 1 locus_tag LOCUS_48590 gene gcvH sequence131 source 1..17395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(931..1602) product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027164300.1 transl_table 11 codon_start 1 locus_tag LOCUS_48600 CDS complement(1572..2444) product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 transl_table 11 codon_start 1 locus_tag LOCUS_48610 CDS 2653..3471 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528188.1 transl_table 11 codon_start 1 locus_tag LOCUS_48620 CDS 3529..4323 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528189.1 transl_table 11 codon_start 1 locus_tag LOCUS_48630 CDS 4491..5201 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199489663.1 transl_table 11 codon_start 1 locus_tag LOCUS_48640 CDS 5201..6010 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528191.1 transl_table 11 codon_start 1 locus_tag LOCUS_48650 CDS 6122..7126 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501902.1 transl_table 11 codon_start 1 locus_tag LOCUS_48660 CDS 7530..7982 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528194.1 transl_table 11 codon_start 1 locus_tag LOCUS_48670 CDS 8007..9077 product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528195.1 transl_table 11 codon_start 1 locus_tag LOCUS_48680 CDS complement(9098..10471) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528196.1 transl_table 11 codon_start 1 locus_tag LOCUS_48690 assembly_gap 10790..10799 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10914..11216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48700 note possible pseudo, frameshifted CDS 11302..12378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48710 assembly_gap 12353..12362 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12539..13912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48720 CDS 14074..16545 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528198.1 transl_table 11 codon_start 1 locus_tag LOCUS_48730 gene gyrB misc_feature complement(16660..>17395) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528562.1:hydantoinase B/oxoprolinase family protein locus_tag LOCUS_48740 sequence132 source 1..17356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(313..747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531661.1 transl_table 11 codon_start 1 locus_tag LOCUS_48750 CDS 1336..3222 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172144.1 transl_table 11 codon_start 1 locus_tag LOCUS_48760 CDS 3517..4881 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531663.1 transl_table 11 codon_start 1 locus_tag LOCUS_48770 gene mgtE CDS complement(4925..6313) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531664.1 transl_table 11 codon_start 1 locus_tag LOCUS_48780 gene gor CDS complement(6433..7035) product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531665.1 transl_table 11 codon_start 1 locus_tag LOCUS_48790 CDS complement(7022..7753) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531666.1 transl_table 11 codon_start 1 locus_tag LOCUS_48800 gene rpiA CDS 7926..8606 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531667.1 transl_table 11 codon_start 1 locus_tag LOCUS_48810 tRNA 8737..8811 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(8867..9094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48820 CDS 8975..9661 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088801.1 transl_table 11 codon_start 1 locus_tag LOCUS_48830 CDS complement(9783..13913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48840 assembly_gap 10233..10242 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14042..15856) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171602985.1 transl_table 11 codon_start 1 locus_tag LOCUS_48850 CDS 16241..16507 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531689.1 transl_table 11 codon_start 1 locus_tag LOCUS_48860 CDS 16698..17132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063167997.1 transl_table 11 codon_start 1 locus_tag LOCUS_48870 sequence133 source 1..17082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2..265) product glycine zipper domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528799.1 transl_table 11 codon_start 1 locus_tag LOCUS_48880 CDS complement(395..919) product K(+)-transporting ATPase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089904.1 transl_table 11 codon_start 1 locus_tag LOCUS_48890 gene kdpF CDS complement(939..1349) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528798.1 transl_table 11 codon_start 1 locus_tag LOCUS_48900 CDS complement(1495..1986) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993326.1 transl_table 11 codon_start 1 locus_tag LOCUS_48910 CDS complement(2040..2384) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529430.1 transl_table 11 codon_start 1 locus_tag LOCUS_48920 CDS complement(2524..3429) product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528797.1 transl_table 11 codon_start 1 locus_tag LOCUS_48930 CDS 3619..4026 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528796.1 transl_table 11 codon_start 1 locus_tag LOCUS_48940 assembly_gap 4112..4121 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4225..5259) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528795.1 transl_table 11 codon_start 1 locus_tag LOCUS_48950 CDS 5839..7863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48960 assembly_gap 7113..7122 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8056..8766 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528793.1 transl_table 11 codon_start 1 locus_tag LOCUS_48970 CDS complement(8768..8956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48980 CDS complement(9105..10208) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528791.1 transl_table 11 codon_start 1 locus_tag LOCUS_48990 gene leuB CDS complement(10288..10641) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528790.1 transl_table 11 codon_start 1 locus_tag LOCUS_49000 CDS complement(10694..11077) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528789.1 transl_table 11 codon_start 1 locus_tag LOCUS_49010 CDS complement(11373..12308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528788.1 transl_table 11 codon_start 1 locus_tag LOCUS_49020 CDS complement(12382..12600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49030 note possible pseudo, frameshifted assembly_gap 12739..12748 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13084..13572 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528786.1 transl_table 11 codon_start 1 locus_tag LOCUS_49040 CDS 13672..13986 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090094.1 transl_table 11 codon_start 1 locus_tag LOCUS_49050 CDS 13983..14435 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090095.1 transl_table 11 codon_start 1 locus_tag LOCUS_49060 CDS 14471..14980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49070 CDS complement(14991..16157) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528785.1 transl_table 11 codon_start 1 locus_tag LOCUS_49080 misc_feature complement(16188..>17082) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528784.1:ATP-binding protein locus_tag LOCUS_49090 sequence134 source 1..16934 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(668..1099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49100 note possible pseudo, frameshifted CDS complement(1087..1851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49110 note possible pseudo, frameshifted assembly_gap 1130..1139 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2022..3020 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530225.1 transl_table 11 codon_start 1 locus_tag LOCUS_49120 CDS 2989..4308 product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530224.1 transl_table 11 codon_start 1 locus_tag LOCUS_49130 CDS 4381..5196 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530223.1 transl_table 11 codon_start 1 locus_tag LOCUS_49140 gene proC CDS complement(5203..6513) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530222.1 transl_table 11 codon_start 1 locus_tag LOCUS_49150 CDS 7283..8740 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529844.1 transl_table 11 codon_start 1 locus_tag LOCUS_49160 CDS 8769..10901 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529845.1 transl_table 11 codon_start 1 locus_tag LOCUS_49170 CDS 10916..12205 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529846.1 transl_table 11 codon_start 1 locus_tag LOCUS_49180 CDS 12195..12836 product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502654.1 transl_table 11 codon_start 1 locus_tag LOCUS_49190 CDS complement(12860..13849) product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529848.1 transl_table 11 codon_start 1 locus_tag LOCUS_49200 sequence135 source 1..16876 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 315..740 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531833.1 transl_table 11 codon_start 1 locus_tag LOCUS_49210 CDS complement(758..1387) product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531832.1 transl_table 11 codon_start 1 locus_tag LOCUS_49220 CDS complement(1482..1859) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086574.1 transl_table 11 codon_start 1 locus_tag LOCUS_49230 CDS complement(1898..2422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531831.1 transl_table 11 codon_start 1 locus_tag LOCUS_49240 CDS 2482..3354 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531830.1 transl_table 11 codon_start 1 locus_tag LOCUS_49250 assembly_gap 2884..2893 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3599..6385 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531829.1 transl_table 11 codon_start 1 locus_tag LOCUS_49260 gene gyrA CDS complement(6457..6600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531828.1 transl_table 11 codon_start 1 locus_tag LOCUS_49270 CDS 6792..7292 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531827.1 transl_table 11 codon_start 1 locus_tag LOCUS_49280 gene coaD CDS 7309..7896 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027161524.1 transl_table 11 codon_start 1 locus_tag LOCUS_49290 CDS 7925..8437 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531825.1 transl_table 11 codon_start 1 locus_tag LOCUS_49300 CDS 8452..8901 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531824.1 transl_table 11 codon_start 1 locus_tag LOCUS_49310 CDS 8901..9992 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531823.1 transl_table 11 codon_start 1 locus_tag LOCUS_49320 gene queA CDS 9982..10251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531822.1 transl_table 11 codon_start 1 locus_tag LOCUS_49330 CDS 10244..11374 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531821.1 transl_table 11 codon_start 1 locus_tag LOCUS_49340 gene tgt CDS complement(11380..11799) product DUF4864 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531820.1 transl_table 11 codon_start 1 locus_tag LOCUS_49350 CDS 12020..12256 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909609.1 transl_table 11 codon_start 1 locus_tag LOCUS_49360 CDS 12447..13841 product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503502.1 transl_table 11 codon_start 1 locus_tag LOCUS_49370 CDS 13933..14874 product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531818.1 transl_table 11 codon_start 1 locus_tag LOCUS_49380 CDS 14905..15699 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531817.1 transl_table 11 codon_start 1 locus_tag LOCUS_49390 CDS 15730..16461 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531816.1 transl_table 11 codon_start 1 locus_tag LOCUS_49400 sequence136 source 1..16735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence137 source 1..16524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(810..1829) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171096.1 transl_table 11 codon_start 1 locus_tag LOCUS_49410 CDS complement(1954..2940) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528089.1 transl_table 11 codon_start 1 locus_tag LOCUS_49420 gene dhaK CDS complement(3023..3445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528088.1 transl_table 11 codon_start 1 locus_tag LOCUS_49430 CDS complement(3460..5064) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528087.1 transl_table 11 codon_start 1 locus_tag LOCUS_49440 gene ptsP CDS complement(5076..5402) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528086.1 transl_table 11 codon_start 1 locus_tag LOCUS_49450 CDS complement(5399..5788) product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528085.1 transl_table 11 codon_start 1 locus_tag LOCUS_49460 gene dhaM CDS complement(5788..6387) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528084.1 transl_table 11 codon_start 1 locus_tag LOCUS_49470 gene dhaL CDS complement(6398..6523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49480 assembly_gap 6550..6559 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6647..7888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49490 note possible pseudo, frameshifted assembly_gap 6950..6959 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7948..8961) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528082.1 transl_table 11 codon_start 1 locus_tag LOCUS_49500 CDS complement(8954..10060) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528081.1 transl_table 11 codon_start 1 locus_tag LOCUS_49510 CDS complement(10065..10268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528080.1 transl_table 11 codon_start 1 locus_tag LOCUS_49520 CDS complement(10459..11409) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528079.1 transl_table 11 codon_start 1 locus_tag LOCUS_49530 CDS complement(11406..12353) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528078.1 transl_table 11 codon_start 1 locus_tag LOCUS_49540 CDS complement(12461..13792) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528077.1 transl_table 11 codon_start 1 locus_tag LOCUS_49550 CDS complement(14026..14715) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528076.1 transl_table 11 codon_start 1 locus_tag LOCUS_49560 CDS 14751..15641 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528075.1 transl_table 11 codon_start 1 locus_tag LOCUS_49570 sequence138 source 1..16354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525215.1:aldehyde dehydrogenase locus_tag LOCUS_49580 CDS 627..1631 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525216.1 transl_table 11 codon_start 1 locus_tag LOCUS_49590 assembly_gap 1659..1668 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1741..2568 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525217.1 transl_table 11 codon_start 1 locus_tag LOCUS_49600 CDS 2568..3368 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525218.1 transl_table 11 codon_start 1 locus_tag LOCUS_49610 CDS 3365..4441 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525219.1 transl_table 11 codon_start 1 locus_tag LOCUS_49620 CDS complement(4591..5385) product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032898633.1 transl_table 11 codon_start 1 locus_tag LOCUS_49630 gene otsB CDS complement(5382..7046) product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530900.1 transl_table 11 codon_start 1 locus_tag LOCUS_49640 CDS complement(7384..9546) product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530899.1 transl_table 11 codon_start 1 locus_tag LOCUS_49650 CDS complement(9593..10654) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530898.1 transl_table 11 codon_start 1 locus_tag LOCUS_49660 CDS complement(10722..11906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537581.1 transl_table 11 codon_start 1 locus_tag LOCUS_49670 CDS complement(11940..12950) product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086752.1 transl_table 11 codon_start 1 locus_tag LOCUS_49680 CDS complement(12960..13304) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086753.1 transl_table 11 codon_start 1 locus_tag LOCUS_49690 CDS complement(13341..14087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49700 note possible pseudo, frameshifted CDS complement(14014..14616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49710 note possible pseudo, frameshifted assembly_gap 14154..14163 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14682..15623 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113699.1 transl_table 11 codon_start 1 locus_tag LOCUS_49720 misc_feature complement(15597..>16354) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974943.1:ABC transporter permease locus_tag LOCUS_49730 sequence139 source 1..16275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1109..1966 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165691322.1 transl_table 11 codon_start 1 locus_tag LOCUS_49740 CDS 2245..2607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531688.1 transl_table 11 codon_start 1 locus_tag LOCUS_49750 CDS complement(2820..2993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720023.1 transl_table 11 codon_start 1 locus_tag LOCUS_49760 CDS complement(3027..4154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337806.1 transl_table 11 codon_start 1 locus_tag LOCUS_49770 CDS complement(4169..4477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49780 CDS complement(4489..4857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337805.1 transl_table 11 codon_start 1 locus_tag LOCUS_49790 CDS 4759..5025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49800 CDS complement(5234..5419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49810 CDS 5520..7187 product aromatic/alkene/methane monooxygenase hydroxylase/oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920568.1 transl_table 11 codon_start 1 locus_tag LOCUS_49820 CDS 7238..7432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49830 CDS 7429..8487 product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337803.1 transl_table 11 codon_start 1 locus_tag LOCUS_49840 CDS 8540..9598 product aromatic/alkene monooxygenase hydroxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720017.1 transl_table 11 codon_start 1 locus_tag LOCUS_49850 CDS 9616..9984 product MmoB/DmpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720016.1 transl_table 11 codon_start 1 locus_tag LOCUS_49860 CDS 10070..11092 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337802.1 transl_table 11 codon_start 1 locus_tag LOCUS_49870 CDS 11098..11895 product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337801.1 transl_table 11 codon_start 1 locus_tag LOCUS_49880 CDS 11972..13603 product molecular chaperone GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337800.1 transl_table 11 codon_start 1 locus_tag LOCUS_49890 CDS 13642..14685 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337799.1 transl_table 11 codon_start 1 locus_tag LOCUS_49900 CDS 14756..15445 product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719935.1 transl_table 11 codon_start 1 locus_tag LOCUS_49910 misc_feature complement(15527..>16275) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337798.1:sigma-54-dependent Fis family transcriptional regulator locus_tag LOCUS_49920 sequence140 source 1..15912 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 293..679 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529181.1 transl_table 11 codon_start 1 locus_tag LOCUS_49930 CDS 828..1166 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529180.1 transl_table 11 codon_start 1 locus_tag LOCUS_49940 CDS 1597..2178 product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529179.1 transl_table 11 codon_start 1 locus_tag LOCUS_49950 CDS complement(2240..3010) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529175.1 transl_table 11 codon_start 1 locus_tag LOCUS_49960 CDS complement(3007..3687) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529174.1 transl_table 11 codon_start 1 locus_tag LOCUS_49970 CDS complement(3854..4627) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529173.1 transl_table 11 codon_start 1 locus_tag LOCUS_49980 CDS 4965..5468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49990 note possible pseudo, frameshifted assembly_gap 5393..5402 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5468..5833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50000 note possible pseudo, frameshifted CDS complement(5851..7419) product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502938.1 transl_table 11 codon_start 1 locus_tag LOCUS_50010 CDS complement(7600..8358) product thiamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529170.1 transl_table 11 codon_start 1 locus_tag LOCUS_50020 gene thiQ CDS complement(8355..9965) product thiamine/thiamine pyrophosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529169.1 transl_table 11 codon_start 1 locus_tag LOCUS_50030 gene thiP CDS complement(10196..11200) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529168.1 transl_table 11 codon_start 1 locus_tag LOCUS_50040 gene thiB CDS 11460..12104 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529167.1 transl_table 11 codon_start 1 locus_tag LOCUS_50050 CDS 12106..13890 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529166.1 transl_table 11 codon_start 1 locus_tag LOCUS_50060 assembly_gap 13124..13133 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13913..14851) product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391305.1 transl_table 11 codon_start 1 locus_tag LOCUS_50070 CDS 14995..15177 product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529165.1 transl_table 11 codon_start 1 locus_tag LOCUS_50080 sequence141 source 1..15903 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 263..1192 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530525.1 transl_table 11 codon_start 1 locus_tag LOCUS_50090 CDS 1192..2049 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530524.1 transl_table 11 codon_start 1 locus_tag LOCUS_50100 CDS 2093..4072 product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530523.1 transl_table 11 codon_start 1 locus_tag LOCUS_50110 CDS complement(4082..4879) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529834.1 transl_table 11 codon_start 1 locus_tag LOCUS_50120 CDS complement(4904..6364) product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529835.1 transl_table 11 codon_start 1 locus_tag LOCUS_50130 CDS complement(6640..9540) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967298.1 transl_table 11 codon_start 1 locus_tag LOCUS_50140 CDS complement(9551..10645) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967297.1 transl_table 11 codon_start 1 locus_tag LOCUS_50150 CDS complement(10982..11224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50160 assembly_gap 11260..11269 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11306..12055) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530710.1 transl_table 11 codon_start 1 locus_tag LOCUS_50170 CDS 12166..13386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241289.1 transl_table 11 codon_start 1 locus_tag LOCUS_50180 CDS 13468..14124 product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974561.1 transl_table 11 codon_start 1 locus_tag LOCUS_50190 CDS complement(14251..14820) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532351.1 transl_table 11 codon_start 1 locus_tag LOCUS_50200 gene efp sequence142 source 1..15784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..609 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531036.1:tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA locus_tag LOCUS_50210 CDS 713..1528 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531037.1 transl_table 11 codon_start 1 locus_tag LOCUS_50220 CDS complement(1710..3539) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531038.1 transl_table 11 codon_start 1 locus_tag LOCUS_50230 CDS 3756..4259 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531039.1 transl_table 11 codon_start 1 locus_tag LOCUS_50240 CDS 4410..4571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50250 note possible pseudo, frameshifted CDS 4938..5177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50260 note possible pseudo, frameshifted CDS complement(5148..6011) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531042.1 transl_table 11 codon_start 1 locus_tag LOCUS_50270 CDS 6130..7296 product gamma-butyrobetaine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531043.1 transl_table 11 codon_start 1 locus_tag LOCUS_50280 CDS 7293..7883 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531044.1 transl_table 11 codon_start 1 locus_tag LOCUS_50290 CDS 8173..9318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50300 CDS 9479..10618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531046.1 transl_table 11 codon_start 1 locus_tag LOCUS_50310 CDS 10891..12672 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827432.1 transl_table 11 codon_start 1 locus_tag LOCUS_50320 CDS 12757..13329 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531048.1 transl_table 11 codon_start 1 locus_tag LOCUS_50330 gene ilvN CDS 13476..14072 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531049.1 transl_table 11 codon_start 1 locus_tag LOCUS_50340 CDS 14403..15677 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531050.1 transl_table 11 codon_start 1 locus_tag LOCUS_50350 sequence143 source 1..15769 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..762 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965178.1:EAL domain-containing protein locus_tag LOCUS_50360 CDS 920..2971 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530081.1 transl_table 11 codon_start 1 locus_tag LOCUS_50370 CDS 3643..4140 product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530080.1 transl_table 11 codon_start 1 locus_tag LOCUS_50380 CDS complement(4195..5091) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530079.1 transl_table 11 codon_start 1 locus_tag LOCUS_50390 CDS complement(5166..6140) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530078.1 transl_table 11 codon_start 1 locus_tag LOCUS_50400 gene trxB CDS 6388..6858 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530077.1 transl_table 11 codon_start 1 locus_tag LOCUS_50410 CDS complement(6830..7504) product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530075.1 transl_table 11 codon_start 1 locus_tag LOCUS_50420 CDS complement(7497..8069) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530074.1 transl_table 11 codon_start 1 locus_tag LOCUS_50430 CDS complement(8077..9561) product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530073.1 transl_table 11 codon_start 1 locus_tag LOCUS_50440 gene rfaE1 CDS complement(9713..10348) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530072.1 transl_table 11 codon_start 1 locus_tag LOCUS_50450 CDS complement(10375..10773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50460 CDS 10896..11846 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530069.1 transl_table 11 codon_start 1 locus_tag LOCUS_50470 gene rfaD CDS 11870..12826 product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530068.1 transl_table 11 codon_start 1 locus_tag LOCUS_50480 gene waaF CDS 12823..13671 product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530067.1 transl_table 11 codon_start 1 locus_tag LOCUS_50490 gene waaC assembly_gap 13616..13625 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13872..14345) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530066.1 transl_table 11 codon_start 1 locus_tag LOCUS_50500 gene greA CDS complement(14629..15162) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530065.1 transl_table 11 codon_start 1 locus_tag LOCUS_50510 sequence144 source 1..15747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(482..1231) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532585.1 transl_table 11 codon_start 1 locus_tag LOCUS_50520 gene lepB CDS complement(1308..1721) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532586.1 transl_table 11 codon_start 1 locus_tag LOCUS_50530 gene acpS CDS complement(1718..2311) product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532587.1 transl_table 11 codon_start 1 locus_tag LOCUS_50540 CDS complement(2620..3204) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532589.1 transl_table 11 codon_start 1 locus_tag LOCUS_50550 gene pyrE assembly_gap 2693..2702 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3310..5538) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532590.1 transl_table 11 codon_start 1 locus_tag LOCUS_50560 CDS complement(5662..6063) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532591.1 transl_table 11 codon_start 1 locus_tag LOCUS_50570 gene rpoZ CDS 6368..6949 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010915096.1 transl_table 11 codon_start 1 locus_tag LOCUS_50580 CDS 6946..7617 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532592.1 transl_table 11 codon_start 1 locus_tag LOCUS_50590 CDS complement(7586..8332) product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532593.1 transl_table 11 codon_start 1 locus_tag LOCUS_50600 CDS complement(8414..8893) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532594.1 transl_table 11 codon_start 1 locus_tag LOCUS_50610 gene smpB CDS complement(9026..9889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50620 assembly_gap 9259..9268 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10181..11611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50630 note possible pseudo, frameshifted assembly_gap 11343..11352 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11608..12243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50640 note possible pseudo, frameshifted CDS 12359..13249 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532597.1 transl_table 11 codon_start 1 locus_tag LOCUS_50650 CDS complement(13407..14453) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532598.1 transl_table 11 codon_start 1 locus_tag LOCUS_50660 misc_feature complement(14724..>15747) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532599.1:porin locus_tag LOCUS_50670 sequence145 source 1..15627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 407..817 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531932.1 transl_table 11 codon_start 1 locus_tag LOCUS_50680 CDS 845..2218 product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531931.1 transl_table 11 codon_start 1 locus_tag LOCUS_50690 CDS complement(2635..2802) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006201775.1 transl_table 11 codon_start 1 locus_tag LOCUS_50700 gene rpmG CDS complement(2989..3447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531921.1 transl_table 11 codon_start 1 locus_tag LOCUS_50710 CDS complement(3526..4701) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531920.1 transl_table 11 codon_start 1 locus_tag LOCUS_50720 CDS complement(4718..5470) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531919.1 transl_table 11 codon_start 1 locus_tag LOCUS_50730 CDS complement(5630..6082) product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503574.1 transl_table 11 codon_start 1 locus_tag LOCUS_50740 CDS complement(6082..6798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50750 CDS complement(6743..8398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50760 note possible pseudo, frameshifted assembly_gap 7071..7080 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8404..10971) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531916.1 transl_table 11 codon_start 1 locus_tag LOCUS_50770 gene topA CDS complement(11313..11690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531915.1 transl_table 11 codon_start 1 locus_tag LOCUS_50780 CDS 11873..12619 product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531914.1 transl_table 11 codon_start 1 locus_tag LOCUS_50790 CDS complement(12736..14568) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090391.1 transl_table 11 codon_start 1 locus_tag LOCUS_50800 sequence146 source 1..15617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 377..1990 product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456393.1 transl_table 11 codon_start 1 locus_tag LOCUS_50810 CDS 1987..2523 product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148745001.1 transl_table 11 codon_start 1 locus_tag LOCUS_50820 CDS 3345..4478 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391834.1 transl_table 11 codon_start 1 locus_tag LOCUS_50830 CDS 4456..6693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50840 CDS complement(6699..7253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50850 CDS complement(7250..7594) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224021.1 transl_table 11 codon_start 1 locus_tag LOCUS_50860 CDS 7724..7993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50870 CDS 8010..9140 product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459849.1 transl_table 11 codon_start 1 locus_tag LOCUS_50880 CDS 9137..9559 product DUF6527 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105776.1 transl_table 11 codon_start 1 locus_tag LOCUS_50890 CDS complement(9600..10211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963497.1 transl_table 11 codon_start 1 locus_tag LOCUS_50900 CDS complement(10422..11888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50910 CDS complement(11896..12132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50920 CDS complement(12123..12281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50930 CDS 12453..12638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50940 CDS complement(12659..12943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50950 CDS 13040..13231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50960 CDS 13238..13651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50970 CDS complement(13984..14379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50980 CDS complement(14376..14636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50990 misc_feature complement(14905..>15617) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525335.1:SMC-Scp complex subunit ScpB locus_tag LOCUS_51000 sequence147 source 1..15492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 222..1262 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393144.1 transl_table 11 codon_start 1 locus_tag LOCUS_51010 CDS 1297..2805 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533070.1 transl_table 11 codon_start 1 locus_tag LOCUS_51020 CDS 2775..3878 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529336.1 transl_table 11 codon_start 1 locus_tag LOCUS_51030 CDS 3959..4900 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533069.1 transl_table 11 codon_start 1 locus_tag LOCUS_51040 CDS complement(4953..6017) product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532928.1 transl_table 11 codon_start 1 locus_tag LOCUS_51050 gene fba CDS 6285..7055 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969785.1 transl_table 11 codon_start 1 locus_tag LOCUS_51060 CDS 7060..7827 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533068.1 transl_table 11 codon_start 1 locus_tag LOCUS_51070 CDS 7856..8296 product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976279.1 transl_table 11 codon_start 1 locus_tag LOCUS_51080 CDS complement(8293..8931) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533066.1 transl_table 11 codon_start 1 locus_tag LOCUS_51090 gene dhaL CDS complement(8942..9955) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533065.1 transl_table 11 codon_start 1 locus_tag LOCUS_51100 CDS complement(10024..10497) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532927.1 transl_table 11 codon_start 1 locus_tag LOCUS_51110 CDS complement(10796..11590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51120 note possible pseudo, internal stop codon, frameshifted assembly_gap 11556..11565 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11590..11964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51130 note possible pseudo, frameshifted CDS complement(11961..13235) product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532923.1 transl_table 11 codon_start 1 locus_tag LOCUS_51140 gene mtnK CDS 13372..14892 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532922.1 transl_table 11 codon_start 1 locus_tag LOCUS_51150 assembly_gap 14289..14298 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence148 source 1..15487 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 132..1058 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528908.1 transl_table 11 codon_start 1 locus_tag LOCUS_51160 gene hemC CDS 1060..1776 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528909.1 transl_table 11 codon_start 1 locus_tag LOCUS_51170 CDS 1985..3436 product COG4223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528910.1 transl_table 11 codon_start 1 locus_tag LOCUS_51180 CDS 3447..5021 product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528911.1 transl_table 11 codon_start 1 locus_tag LOCUS_51190 CDS 5058..5537 product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528912.1 transl_table 11 codon_start 1 locus_tag LOCUS_51200 CDS 5611..6288 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528913.1 transl_table 11 codon_start 1 locus_tag LOCUS_51210 CDS complement(6321..6995) product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088698.1 transl_table 11 codon_start 1 locus_tag LOCUS_51220 CDS 7397..7627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528523.1 transl_table 11 codon_start 1 locus_tag LOCUS_51230 CDS complement(7962..8234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51240 CDS 8430..8684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51250 CDS complement(8725..9963) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528915.1 transl_table 11 codon_start 1 locus_tag LOCUS_51260 CDS complement(10123..11208) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528916.1 transl_table 11 codon_start 1 locus_tag LOCUS_51270 CDS 11465..11809 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141437.1 transl_table 11 codon_start 1 locus_tag LOCUS_51280 CDS 11809..12327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51290 CDS complement(12471..12929) product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528917.1 transl_table 11 codon_start 1 locus_tag LOCUS_51300 CDS complement(13047..13751) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 transl_table 11 codon_start 1 locus_tag LOCUS_51310 CDS complement(13770..15146) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 transl_table 11 codon_start 1 locus_tag LOCUS_51320 gene zwf sequence149 source 1..15443 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(232..1011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51330 note possible pseudo, frameshifted assembly_gap 284..293 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1121..1594 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328737.1 transl_table 11 codon_start 1 locus_tag LOCUS_51340 CDS complement(1605..2312) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 transl_table 11 codon_start 1 locus_tag LOCUS_51350 CDS 2605..2907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51360 CDS complement(3118..3810) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090881.1 transl_table 11 codon_start 1 locus_tag LOCUS_51370 gene modA CDS complement(3931..4527) product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530637.1 transl_table 11 codon_start 1 locus_tag LOCUS_51380 CDS complement(4601..5503) product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530631.1 transl_table 11 codon_start 1 locus_tag LOCUS_51390 CDS 5729..6598 product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530630.1 transl_table 11 codon_start 1 locus_tag LOCUS_51400 gene yghU CDS complement(6641..7189) product Raf kinase inhibitor-like protein YbcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313946.1 transl_table 11 codon_start 1 locus_tag LOCUS_51410 gene ybcL CDS complement(7334..7597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51420 CDS complement(7702..8907) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172575.1 transl_table 11 codon_start 1 locus_tag LOCUS_51430 CDS 9329..9643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51440 CDS 9667..9963 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329228.1 transl_table 11 codon_start 1 locus_tag LOCUS_51450 CDS 10787..11170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51460 CDS complement(11068..11556) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969632.1 transl_table 11 codon_start 1 locus_tag LOCUS_51470 CDS complement(11608..12150) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530623.1 transl_table 11 codon_start 1 locus_tag LOCUS_51480 CDS complement(12277..14295) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530502.1 transl_table 11 codon_start 1 locus_tag LOCUS_51490 misc_feature complement(14401..>15443) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_168992253.1:WD40 repeat domain-containing protein locus_tag LOCUS_51500 sequence150 source 1..15182 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 301..310 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(547..984) product DUF3085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974881.1 transl_table 11 codon_start 1 locus_tag LOCUS_51510 assembly_gap 622..631 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(995..1597) product DUF1419 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974880.1 transl_table 11 codon_start 1 locus_tag LOCUS_51520 CDS complement(1777..2691) product DUF3991 and toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974798.1 transl_table 11 codon_start 1 locus_tag LOCUS_51530 note possible pseudo, frameshifted CDS 2951..3199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51540 CDS complement(3695..3934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51550 CDS complement(4177..4506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51560 CDS 4841..5302 product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533377.1 transl_table 11 codon_start 1 locus_tag LOCUS_51570 CDS 5324..5503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51580 CDS 5885..7846 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085181.1 transl_table 11 codon_start 1 locus_tag LOCUS_51590 CDS complement(9354..9557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51600 CDS 9448..10200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51610 note possible pseudo, frameshifted CDS 10477..10731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51620 CDS 11190..11633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51630 CDS complement(11704..11898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51640 CDS 12482..12694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51650 CDS complement(13098..13472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51660 CDS complement(14099..14638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51670 sequence151 source 1..15115 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(510..1334) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720158.1 transl_table 11 codon_start 1 locus_tag LOCUS_51680 CDS complement(1331..2248) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565322.1 transl_table 11 codon_start 1 locus_tag LOCUS_51690 CDS 2558..3976 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339390.1 transl_table 11 codon_start 1 locus_tag LOCUS_51700 CDS complement(4136..5338) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920958.1 transl_table 11 codon_start 1 locus_tag LOCUS_51710 CDS 5837..6256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529299.1 transl_table 11 codon_start 1 locus_tag LOCUS_51720 CDS complement(6461..8521) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173187.1 transl_table 11 codon_start 1 locus_tag LOCUS_51730 CDS complement(8773..9552) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299078.1 transl_table 11 codon_start 1 locus_tag LOCUS_51740 CDS 9599..10285 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529302.1 transl_table 11 codon_start 1 locus_tag LOCUS_51750 CDS complement(10350..10517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529303.1 transl_table 11 codon_start 1 locus_tag LOCUS_51760 CDS complement(10549..10881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529304.1 transl_table 11 codon_start 1 locus_tag LOCUS_51770 CDS 11232..11690 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529305.1 transl_table 11 codon_start 1 locus_tag LOCUS_51780 CDS complement(11842..14925) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529306.1 transl_table 11 codon_start 1 locus_tag LOCUS_51790 sequence152 source 1..15113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..1147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51800 note possible pseudo, frameshifted CDS complement(1190..1564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51810 note possible pseudo, frameshifted CDS complement(1758..1943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51820 CDS complement(2084..2251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51830 note possible pseudo, frameshifted CDS 2529..2738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51840 CDS complement(2648..5110) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531133.1 transl_table 11 codon_start 1 locus_tag LOCUS_51850 CDS complement(5107..5364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51860 CDS complement(5466..6080) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082103.1 transl_table 11 codon_start 1 locus_tag LOCUS_51870 CDS complement(6107..6988) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919078.1 transl_table 11 codon_start 1 locus_tag LOCUS_51880 gene dapA CDS complement(7007..8197) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 transl_table 11 codon_start 1 locus_tag LOCUS_51890 CDS 8498..9406 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844087.1 transl_table 11 codon_start 1 locus_tag LOCUS_51900 CDS 9803..10495 product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531175.1 transl_table 11 codon_start 1 locus_tag LOCUS_51910 CDS complement(10748..11131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51920 CDS complement(12012..12440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51930 CDS complement(12777..14360) product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095694375.1 transl_table 11 codon_start 1 locus_tag LOCUS_51940 CDS complement(14491..14736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51950 sequence153 source 1..14691 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 76..690 product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529516.1 transl_table 11 codon_start 1 locus_tag LOCUS_51960 CDS 795..1505 product DUF1868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970661.1 transl_table 11 codon_start 1 locus_tag LOCUS_51970 CDS 1688..2545 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529515.1 transl_table 11 codon_start 1 locus_tag LOCUS_51980 gene phnC CDS 2709..3617 product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529514.1 transl_table 11 codon_start 1 locus_tag LOCUS_51990 gene phnD CDS 3660..4628 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529513.1 transl_table 11 codon_start 1 locus_tag LOCUS_52000 gene phnE CDS 4694..6061 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529512.1 transl_table 11 codon_start 1 locus_tag LOCUS_52010 gene phnE CDS complement(6293..7144) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529511.1 transl_table 11 codon_start 1 locus_tag LOCUS_52020 CDS complement(7211..8398) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529510.1 transl_table 11 codon_start 1 locus_tag LOCUS_52030 CDS complement(8546..9601) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529509.1 transl_table 11 codon_start 1 locus_tag LOCUS_52040 CDS 10002..10889 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529508.1 transl_table 11 codon_start 1 locus_tag LOCUS_52050 CDS 10944..12113 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529507.1 transl_table 11 codon_start 1 locus_tag LOCUS_52060 CDS 12116..12832 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529506.1 transl_table 11 codon_start 1 locus_tag LOCUS_52070 CDS 12898..13878 product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529505.1 transl_table 11 codon_start 1 locus_tag LOCUS_52080 CDS 13880..14299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529504.1 transl_table 11 codon_start 1 locus_tag LOCUS_52090 sequence154 source 1..14549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529246.1:fructose-bisphosphate aldolase class I locus_tag LOCUS_52100 CDS 711..1451 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529245.1 transl_table 11 codon_start 1 locus_tag LOCUS_52110 CDS 1507..2235 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529244.1 transl_table 11 codon_start 1 locus_tag LOCUS_52120 CDS complement(2264..2443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529243.1 transl_table 11 codon_start 1 locus_tag LOCUS_52130 CDS 2626..2793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529241.1 transl_table 11 codon_start 1 locus_tag LOCUS_52140 CDS 3008..3418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529239.1 transl_table 11 codon_start 1 locus_tag LOCUS_52150 CDS 3493..4212 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529238.1 transl_table 11 codon_start 1 locus_tag LOCUS_52160 CDS complement(4276..4971) product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529237.1 transl_table 11 codon_start 1 locus_tag LOCUS_52170 CDS complement(5246..5437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52180 CDS complement(5765..6775) product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529235.1 transl_table 11 codon_start 1 locus_tag LOCUS_52190 CDS 6887..7081 product DUF1192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529234.1 transl_table 11 codon_start 1 locus_tag LOCUS_52200 CDS 7165..8412 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529233.1 transl_table 11 codon_start 1 locus_tag LOCUS_52210 CDS 8444..8719 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529232.1 transl_table 11 codon_start 1 locus_tag LOCUS_52220 CDS 8801..9190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52230 CDS complement(9248..9904) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529231.1 transl_table 11 codon_start 1 locus_tag LOCUS_52240 CDS complement(9983..10846) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529230.1 transl_table 11 codon_start 1 locus_tag LOCUS_52250 CDS 10945..11457 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529229.1 transl_table 11 codon_start 1 locus_tag LOCUS_52260 CDS 11564..11995 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529227.1 transl_table 11 codon_start 1 locus_tag LOCUS_52270 CDS complement(12041..12442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529226.1 transl_table 11 codon_start 1 locus_tag LOCUS_52280 CDS complement(12717..12899) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008834724.1 transl_table 11 codon_start 1 locus_tag LOCUS_52290 gene rpmF CDS complement(13054..13761) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529225.1 transl_table 11 codon_start 1 locus_tag LOCUS_52300 sequence155 source 1..14399 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(480..713) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909092.1 transl_table 11 codon_start 1 locus_tag LOCUS_52310 CDS complement(810..3032) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532135.1 transl_table 11 codon_start 1 locus_tag LOCUS_52320 gene purL assembly_gap 1206..1215 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3174..4583) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532134.1 transl_table 11 codon_start 1 locus_tag LOCUS_52330 CDS 4675..4923 product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532133.1 transl_table 11 codon_start 1 locus_tag LOCUS_52340 CDS complement(4960..5589) product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532132.1 transl_table 11 codon_start 1 locus_tag LOCUS_52350 CDS complement(5594..6004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532131.1 transl_table 11 codon_start 1 locus_tag LOCUS_52360 CDS complement(6050..6718) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532129.1 transl_table 11 codon_start 1 locus_tag LOCUS_52370 gene purQ CDS complement(6719..6958) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532128.1 transl_table 11 codon_start 1 locus_tag LOCUS_52380 gene purS CDS complement(7026..7820) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532127.1 transl_table 11 codon_start 1 locus_tag LOCUS_52390 CDS 8098..8418 product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 transl_table 11 codon_start 1 locus_tag LOCUS_52400 CDS 8576..9349 product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532125.1 transl_table 11 codon_start 1 locus_tag LOCUS_52410 CDS complement(9371..9937) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532123.1 transl_table 11 codon_start 1 locus_tag LOCUS_52420 CDS 10170..10982 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532122.1 transl_table 11 codon_start 1 locus_tag LOCUS_52430 CDS complement(11181..12488) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532121.1 transl_table 11 codon_start 1 locus_tag LOCUS_52440 gene purB CDS complement(12549..13073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532120.1 transl_table 11 codon_start 1 locus_tag LOCUS_52450 CDS complement(13070..13795) product DUF2259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532119.1 transl_table 11 codon_start 1 locus_tag LOCUS_52460 CDS 13928..14182 product DUF2171 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532118.1 transl_table 11 codon_start 1 locus_tag LOCUS_52470 sequence156 source 1..14045 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 858..1448 product NodA family N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533527.1 transl_table 11 codon_start 1 locus_tag LOCUS_52480 CDS 1445..2104 product chitooligosaccharide deacetylase NodB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875356.1 transl_table 11 codon_start 1 locus_tag LOCUS_52490 gene nodB CDS 2120..3445 product chitooligosaccharide synthase NodC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533535.1 transl_table 11 codon_start 1 locus_tag LOCUS_52500 gene nodC CDS 3706..4620 product nodulation factor ABC transporter ATP-binding protein NodI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533536.1 transl_table 11 codon_start 1 locus_tag LOCUS_52510 gene nodI CDS 4624..5412 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533537.1 transl_table 11 codon_start 1 locus_tag LOCUS_52520 CDS 5700..6461 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970900.1 transl_table 11 codon_start 1 locus_tag LOCUS_52530 CDS 6847..8133 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049802419.1 transl_table 11 codon_start 1 locus_tag LOCUS_52540 CDS complement(8349..8633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52550 CDS 8715..9473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52560 CDS 9638..10441 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533525.1 transl_table 11 codon_start 1 locus_tag LOCUS_52570 CDS complement(10490..11407) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533526.1 transl_table 11 codon_start 1 locus_tag LOCUS_52580 CDS 12080..13609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52590 sequence157 source 1..13851 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 625..1425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52600 CDS complement(1435..1704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530503.1 transl_table 11 codon_start 1 locus_tag LOCUS_52610 CDS complement(1810..2628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52620 CDS complement(2946..3860) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529480.1 transl_table 11 codon_start 1 locus_tag LOCUS_52630 CDS 3973..4611 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529481.1 transl_table 11 codon_start 1 locus_tag LOCUS_52640 CDS 4649..5257 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529482.1 transl_table 11 codon_start 1 locus_tag LOCUS_52650 CDS 5487..6125 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529878.1 transl_table 11 codon_start 1 locus_tag LOCUS_52660 CDS 6487..9468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52670 CDS 9597..11360 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529876.1 transl_table 11 codon_start 1 locus_tag LOCUS_52680 CDS 11464..12795 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529875.1 transl_table 11 codon_start 1 locus_tag LOCUS_52690 sequence158 source 1..13848 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 157..834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52700 note possible pseudo, internal stop codon, frameshifted CDS 831..2153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52710 CDS 2170..2307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52720 CDS 2317..2544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52730 CDS 2582..4093 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192488.1 transl_table 11 codon_start 1 locus_tag LOCUS_52740 CDS 4199..5470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52750 note possible pseudo, frameshifted assembly_gap 4326..4335 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5446..5829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52760 note possible pseudo, frameshifted CDS 5829..6953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122840.1 transl_table 11 codon_start 1 locus_tag LOCUS_52770 CDS 6953..7333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52780 CDS complement(7825..8532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52790 CDS complement(8755..9552) product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173829.1 transl_table 11 codon_start 1 locus_tag LOCUS_52800 CDS complement(9910..11436) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089709.1 transl_table 11 codon_start 1 locus_tag LOCUS_52810 CDS complement(11440..13155) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478308.1 transl_table 11 codon_start 1 locus_tag LOCUS_52820 sequence159 source 1..13837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 550..626 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 726..1214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52830 CDS complement(1413..1835) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160608.1 transl_table 11 codon_start 1 locus_tag LOCUS_52840 CDS complement(1832..2086) product Arc family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974671.1 transl_table 11 codon_start 1 locus_tag LOCUS_52850 CDS complement(2167..2871) product DnaA regulatory inactivator HdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532442.1 transl_table 11 codon_start 1 locus_tag LOCUS_52860 gene hdaA CDS complement(2878..4080) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532443.1 transl_table 11 codon_start 1 locus_tag LOCUS_52870 CDS complement(4052..4609) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 transl_table 11 codon_start 1 locus_tag LOCUS_52880 CDS 4860..5087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52890 note possible pseudo, frameshifted CDS 4993..5952 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532445.1 transl_table 11 codon_start 1 locus_tag LOCUS_52900 gene purM note possible pseudo, frameshifted assembly_gap 5053..5062 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5949..6656 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532446.1 transl_table 11 codon_start 1 locus_tag LOCUS_52910 gene purN CDS 6672..7187 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 transl_table 11 codon_start 1 locus_tag LOCUS_52920 CDS complement(7387..7614) product DUF680 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532448.1 transl_table 11 codon_start 1 locus_tag LOCUS_52930 CDS complement(8051..8314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52940 CDS 8225..8848 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532452.1 transl_table 11 codon_start 1 locus_tag LOCUS_52950 CDS 8838..10190 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532453.1 transl_table 11 codon_start 1 locus_tag LOCUS_52960 CDS complement(10202..11080) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532454.1 transl_table 11 codon_start 1 locus_tag LOCUS_52970 CDS complement(11178..12032) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532455.1 transl_table 11 codon_start 1 locus_tag LOCUS_52980 CDS complement(12197..13210) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532456.1 transl_table 11 codon_start 1 locus_tag LOCUS_52990 sequence160 source 1..13831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53000 CDS complement(618..1040) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531210.1 transl_table 11 codon_start 1 locus_tag LOCUS_53010 CDS complement(1132..1896) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531211.1 transl_table 11 codon_start 1 locus_tag LOCUS_53020 CDS complement(2060..2248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531212.1 transl_table 11 codon_start 1 locus_tag LOCUS_53030 CDS complement(2282..3067) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531213.1 transl_table 11 codon_start 1 locus_tag LOCUS_53040 CDS 3182..3613 product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531214.1 transl_table 11 codon_start 1 locus_tag LOCUS_53050 CDS complement(3647..5269) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531215.1 transl_table 11 codon_start 1 locus_tag LOCUS_53060 CDS complement(5266..6135) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531216.1 transl_table 11 codon_start 1 locus_tag LOCUS_53070 CDS complement(6132..6533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53080 note possible pseudo, frameshifted assembly_gap 6514..6523 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7352..8830) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 transl_table 11 codon_start 1 locus_tag LOCUS_53090 CDS complement(8960..10240) product acetylornithine deacetylase/succinyl-diaminopimelate desuccinylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531219.1 transl_table 11 codon_start 1 locus_tag LOCUS_53100 CDS 10481..10894 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531220.1 transl_table 11 codon_start 1 locus_tag LOCUS_53110 CDS 11053..11892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53120 CDS complement(12030..13019) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531221.1 transl_table 11 codon_start 1 locus_tag LOCUS_53130 misc_feature complement(13025..>13831) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531222.1:zinc-binding dehydrogenase locus_tag LOCUS_53140 sequence161 source 1..13706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(97..447) product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173552.1 transl_table 11 codon_start 1 locus_tag LOCUS_53150 CDS 616..1053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533615.1 transl_table 11 codon_start 1 locus_tag LOCUS_53160 CDS 1154..1813 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533614.1 transl_table 11 codon_start 1 locus_tag LOCUS_53170 CDS complement(1859..2515) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082920.1 transl_table 11 codon_start 1 locus_tag LOCUS_53180 CDS 2609..3241 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112419.1 transl_table 11 codon_start 1 locus_tag LOCUS_53190 CDS complement(3396..6713) product PAS-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173555.1 transl_table 11 codon_start 1 locus_tag LOCUS_53200 assembly_gap 3414..3423 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6958..7380 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533610.1 transl_table 11 codon_start 1 locus_tag LOCUS_53210 gene mscL CDS 7488..8654 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533609.1 transl_table 11 codon_start 1 locus_tag LOCUS_53220 CDS complement(8948..10225) product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533608.1 transl_table 11 codon_start 1 locus_tag LOCUS_53230 gene hemA CDS 10500..11495 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533607.1 transl_table 11 codon_start 1 locus_tag LOCUS_53240 gene galE assembly_gap 11648..11657 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11672..12910 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533606.1 transl_table 11 codon_start 1 locus_tag LOCUS_53250 sequence162 source 1..13552 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(41..556) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191763.1 transl_table 11 codon_start 1 locus_tag LOCUS_53260 CDS complement(1198..1677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53270 CDS complement(2427..3215) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222556.1 transl_table 11 codon_start 1 locus_tag LOCUS_53280 CDS complement(3253..4062) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930042.1 transl_table 11 codon_start 1 locus_tag LOCUS_53290 CDS complement(4184..5467) product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 transl_table 11 codon_start 1 locus_tag LOCUS_53300 CDS complement(5485..7674) product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528128.1 transl_table 11 codon_start 1 locus_tag LOCUS_53310 CDS complement(7692..8447) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086233.1 transl_table 11 codon_start 1 locus_tag LOCUS_53320 CDS complement(8459..9241) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918744.1 transl_table 11 codon_start 1 locus_tag LOCUS_53330 gene fabG CDS complement(9838..10566) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812272.1 transl_table 11 codon_start 1 locus_tag LOCUS_53340 CDS complement(10762..11877) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139584.1 transl_table 11 codon_start 1 locus_tag LOCUS_53350 CDS complement(11932..12915) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664522.1 transl_table 11 codon_start 1 locus_tag LOCUS_53360 gene rbsC misc_feature complement(12912..>13552) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528166.1:sugar ABC transporter ATP-binding protein locus_tag LOCUS_53370 sequence163 source 1..13418 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 116..2050 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490278.1 transl_table 11 codon_start 1 locus_tag LOCUS_53380 CDS 2773..4011 product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252962.1 transl_table 11 codon_start 1 locus_tag LOCUS_53390 gene repC CDS 4011..4526 product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162991803.1 transl_table 11 codon_start 1 locus_tag LOCUS_53400 CDS 4923..5255 product DUF736 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095689859.1 transl_table 11 codon_start 1 locus_tag LOCUS_53410 CDS 5376..5582 product antitoxin VbhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969888.1 transl_table 11 codon_start 1 locus_tag LOCUS_53420 CDS 5637..6224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53430 note possible pseudo, frameshifted CDS 6152..6706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53440 note possible pseudo, frameshifted CDS 6936..7823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53450 CDS 8091..9284 product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969718.1 transl_table 11 codon_start 1 locus_tag LOCUS_53460 gene repA CDS 9284..10300 product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243826.1 transl_table 11 codon_start 1 locus_tag LOCUS_53470 gene repB CDS 10499..11662 product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525330.1 transl_table 11 codon_start 1 locus_tag LOCUS_53480 gene repC CDS 11749..12180 product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145161531.1 transl_table 11 codon_start 1 locus_tag LOCUS_53490 CDS 12177..12659 product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145161534.1 transl_table 11 codon_start 1 locus_tag LOCUS_53500 sequence164 source 1..13379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(562..1098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53510 CDS complement(1250..2308) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171909.1 transl_table 11 codon_start 1 locus_tag LOCUS_53520 CDS 3483..5246 product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 transl_table 11 codon_start 1 locus_tag LOCUS_53530 CDS 5573..5941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53540 note possible pseudo, frameshifted CDS complement(6293..6739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53550 CDS 7069..7458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53560 CDS 7458..8276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53570 CDS 8367..9602 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764772.1 transl_table 11 codon_start 1 locus_tag LOCUS_53580 CDS 9599..10543 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764770.1 transl_table 11 codon_start 1 locus_tag LOCUS_53590 CDS 10540..10752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53600 note possible pseudo, frameshifted CDS 11015..11533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53610 CDS 11878..12882 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108412.1 transl_table 11 codon_start 1 locus_tag LOCUS_53620 sequence165 source 1..13298 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1583 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531594.1:phage tail tip lysozyme locus_tag LOCUS_53630 CDS 1583..3703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531593.1 transl_table 11 codon_start 1 locus_tag LOCUS_53640 CDS complement(3638..3886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143747802.1 transl_table 11 codon_start 1 locus_tag LOCUS_53650 CDS complement(4213..4476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53660 CDS 4766..5134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53670 CDS complement(5189..5491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532437.1 transl_table 11 codon_start 1 locus_tag LOCUS_53680 CDS 5853..6122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53690 CDS complement(6104..6244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53700 CDS complement(6244..6555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53710 CDS complement(6563..6775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53720 CDS complement(6807..7031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53730 CDS complement(7168..8019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53740 CDS complement(8138..8629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53750 CDS complement(8626..8865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53760 CDS 8988..9680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183464203.1 transl_table 11 codon_start 1 locus_tag LOCUS_53770 CDS 9683..10132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53780 CDS 10132..10419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53790 CDS 12522..13274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53800 sequence166 source 1..13255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(41..325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53810 CDS complement(589..945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53820 note possible pseudo, frameshifted CDS complement(1080..1286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53830 note possible pseudo, frameshifted CDS complement(1565..2545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53840 CDS 2984..3961 product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195013.1 transl_table 11 codon_start 1 locus_tag LOCUS_53850 CDS 4055..4537 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230138.1 transl_table 11 codon_start 1 locus_tag LOCUS_53860 CDS complement(4709..5965) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133034483.1 transl_table 11 codon_start 1 locus_tag LOCUS_53870 CDS complement(5962..7323) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532099.1 transl_table 11 codon_start 1 locus_tag LOCUS_53880 CDS complement(7401..8624) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 transl_table 11 codon_start 1 locus_tag LOCUS_53890 CDS complement(9645..10382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53900 note possible pseudo, frameshifted CDS complement(10375..11121) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967496.1 transl_table 11 codon_start 1 locus_tag LOCUS_53910 CDS 11120..11260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53920 CDS complement(11286..12401) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394854.1 transl_table 11 codon_start 1 locus_tag LOCUS_53930 sequence167 source 1..12890 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 184..1266 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531811.1 transl_table 11 codon_start 1 locus_tag LOCUS_53940 CDS 1267..2133 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531810.1 transl_table 11 codon_start 1 locus_tag LOCUS_53950 CDS 2135..3049 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531809.1 transl_table 11 codon_start 1 locus_tag LOCUS_53960 CDS 3052..3339 product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503495.1 transl_table 11 codon_start 1 locus_tag LOCUS_53970 CDS 3416..5143 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531807.1 transl_table 11 codon_start 1 locus_tag LOCUS_53980 CDS 5238..6731 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531806.1 transl_table 11 codon_start 1 locus_tag LOCUS_53990 gene glpK CDS 6764..7240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240467.1 transl_table 11 codon_start 1 locus_tag LOCUS_54000 CDS complement(7333..7788) product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531805.1 transl_table 11 codon_start 1 locus_tag LOCUS_54010 tRNA 8084..8159 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(8788..9084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54020 CDS 9414..9953 product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528603.1 transl_table 11 codon_start 1 locus_tag LOCUS_54030 CDS 10058..10273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530769.1 transl_table 11 codon_start 1 locus_tag LOCUS_54040 CDS 10372..11514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530290.1 transl_table 11 codon_start 1 locus_tag LOCUS_54050 CDS complement(11511..12389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54060 sequence168 source 1..12870 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1432 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037398965.1:sensor histidine kinase locus_tag LOCUS_54070 CDS 1434..2789 product C4-dicarboxylate transport transcriptional regulatory protein DctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529421.1 transl_table 11 codon_start 1 locus_tag LOCUS_54080 gene dctD CDS 2958..3305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235983998.1 transl_table 11 codon_start 1 locus_tag LOCUS_54090 CDS complement(3239..3406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54100 CDS complement(3406..4128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54110 CDS complement(4689..5981) product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533596.1 transl_table 11 codon_start 1 locus_tag LOCUS_54120 gene rhaI CDS complement(6068..8170) product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533597.1 transl_table 11 codon_start 1 locus_tag LOCUS_54130 CDS 8335..9165 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533598.1 transl_table 11 codon_start 1 locus_tag LOCUS_54140 CDS 9214..10209 product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533599.1 transl_table 11 codon_start 1 locus_tag LOCUS_54150 gene rhaS CDS 10294..11850 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533600.1 transl_table 11 codon_start 1 locus_tag LOCUS_54160 CDS 11847..12824 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533601.1 transl_table 11 codon_start 1 locus_tag LOCUS_54170 sequence169 source 1..12785 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..538 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532006.1:DNA repair protein RadC locus_tag LOCUS_54180 CDS 678..1499 product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392177.1 transl_table 11 codon_start 1 locus_tag LOCUS_54190 assembly_gap 1266..1275 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1594..2466 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969990.1 transl_table 11 codon_start 1 locus_tag LOCUS_54200 CDS 2488..4257 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577418.1 transl_table 11 codon_start 1 locus_tag LOCUS_54210 gene ctaD CDS 4254..4958 product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086564.1 transl_table 11 codon_start 1 locus_tag LOCUS_54220 CDS 4969..5691 product heme-copper oxidase subunit III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086563.1 transl_table 11 codon_start 1 locus_tag LOCUS_54230 CDS 5718..6116 product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966245.1 transl_table 11 codon_start 1 locus_tag LOCUS_54240 CDS 6251..6724 product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327119.1 transl_table 11 codon_start 1 locus_tag LOCUS_54250 CDS complement(6869..7687) product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532367.1 transl_table 11 codon_start 1 locus_tag LOCUS_54260 CDS complement(8054..8983) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532778.1 transl_table 11 codon_start 1 locus_tag LOCUS_54270 CDS complement(9018..9398) product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532062.1 transl_table 11 codon_start 1 locus_tag LOCUS_54280 CDS complement(9584..10108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532008.1 transl_table 11 codon_start 1 locus_tag LOCUS_54290 CDS complement(10288..11802) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532009.1 transl_table 11 codon_start 1 locus_tag LOCUS_54300 gene tig tRNA 12122..12204 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 misc_feature complement(12236..>12785) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531318.1:aromatic amino acid lyase locus_tag LOCUS_54310 sequence170 source 1..12751 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 416..664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54320 CDS 1030..2094 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525333.1 transl_table 11 codon_start 1 locus_tag LOCUS_54330 CDS 2494..2736 product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034522604.1 transl_table 11 codon_start 1 locus_tag LOCUS_54340 CDS 2736..3152 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971025.1 transl_table 11 codon_start 1 locus_tag LOCUS_54350 CDS 3142..4311 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970303.1 transl_table 11 codon_start 1 locus_tag LOCUS_54360 CDS complement(4345..5637) product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974840.1 transl_table 11 codon_start 1 locus_tag LOCUS_54370 gene repC CDS complement(5848..6717) product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525329.1 transl_table 11 codon_start 1 locus_tag LOCUS_54380 gene repB CDS complement(6910..8115) product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858029.1 transl_table 11 codon_start 1 locus_tag LOCUS_54390 gene repA CDS 8639..8962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54400 CDS 9234..9470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54410 CDS complement(9617..10768) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525333.1 transl_table 11 codon_start 1 locus_tag LOCUS_54420 CDS 11239..11511 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971026.1 transl_table 11 codon_start 1 locus_tag LOCUS_54430 CDS 11498..11941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54440 sequence171 source 1..12557 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..935 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532871.1:LacI family DNA-binding transcriptional regulator locus_tag LOCUS_54450 CDS complement(1275..2123) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494169.1 transl_table 11 codon_start 1 locus_tag LOCUS_54460 CDS complement(2123..2707) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532873.1 transl_table 11 codon_start 1 locus_tag LOCUS_54470 CDS 2950..3207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532874.1 transl_table 11 codon_start 1 locus_tag LOCUS_54480 CDS 3201..6383 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532875.1 transl_table 11 codon_start 1 locus_tag LOCUS_54490 CDS 6419..7573 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532876.1 transl_table 11 codon_start 1 locus_tag LOCUS_54500 CDS 8139..8831 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532877.1 transl_table 11 codon_start 1 locus_tag LOCUS_54510 CDS 8859..9965 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 transl_table 11 codon_start 1 locus_tag LOCUS_54520 CDS 10086..10601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54530 CDS 10958..12280 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530222.1 transl_table 11 codon_start 1 locus_tag LOCUS_54540 sequence172 source 1..12379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(185..673) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240736.1 transl_table 11 codon_start 1 locus_tag LOCUS_54550 CDS complement(678..2177) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531347.1 transl_table 11 codon_start 1 locus_tag LOCUS_54560 gene gatB CDS complement(2344..2775) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531344.1 transl_table 11 codon_start 1 locus_tag LOCUS_54570 CDS complement(2881..3612) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531343.1 transl_table 11 codon_start 1 locus_tag LOCUS_54580 CDS 4083..5615 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164830060.1 transl_table 11 codon_start 1 locus_tag LOCUS_54590 CDS 5612..6625 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970689.1 transl_table 11 codon_start 1 locus_tag LOCUS_54600 CDS 6790..7869 product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 transl_table 11 codon_start 1 locus_tag LOCUS_54610 CDS 7878..8171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54620 CDS complement(8342..9385) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532920.1 transl_table 11 codon_start 1 locus_tag LOCUS_54630 CDS 10040..10678 product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531342.1 transl_table 11 codon_start 1 locus_tag LOCUS_54640 CDS 10807..11424 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531341.1 transl_table 11 codon_start 1 locus_tag LOCUS_54650 CDS 11689..12294 product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531340.1 transl_table 11 codon_start 1 locus_tag LOCUS_54660 sequence173 source 1..12267 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(211..1089) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528596.1 transl_table 11 codon_start 1 locus_tag LOCUS_54670 CDS complement(1089..1727) product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528597.1 transl_table 11 codon_start 1 locus_tag LOCUS_54680 CDS complement(1724..2659) product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063169669.1 transl_table 11 codon_start 1 locus_tag LOCUS_54690 CDS complement(2656..3423) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528599.1 transl_table 11 codon_start 1 locus_tag LOCUS_54700 CDS complement(3577..4926) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528600.1 transl_table 11 codon_start 1 locus_tag LOCUS_54710 CDS complement(5027..6841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54720 CDS complement(6922..7323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54730 CDS complement(7320..8555) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 transl_table 11 codon_start 1 locus_tag LOCUS_54740 CDS 8772..9713 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528601.1 transl_table 11 codon_start 1 locus_tag LOCUS_54750 gene gshB CDS complement(9770..11053) product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386813.1 transl_table 11 codon_start 1 locus_tag LOCUS_54760 assembly_gap 10077..10086 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence174 source 1..12122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 251..259 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(440..2617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54770 assembly_gap 731..740 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3116..3580 product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533661.1 transl_table 11 codon_start 1 locus_tag LOCUS_54780 CDS 3819..5615 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533660.1 transl_table 11 codon_start 1 locus_tag LOCUS_54790 CDS 5735..6178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54800 CDS 6175..7344 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533659.1 transl_table 11 codon_start 1 locus_tag LOCUS_54810 CDS 7378..8586 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533658.1 transl_table 11 codon_start 1 locus_tag LOCUS_54820 CDS 8601..10820 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533657.1 transl_table 11 codon_start 1 locus_tag LOCUS_54830 CDS 10833..11375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54840 CDS 11471..12115 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533656.1 transl_table 11 codon_start 1 locus_tag LOCUS_54850 sequence175 source 1..12080 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 11..757 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531846.1 transl_table 11 codon_start 1 locus_tag LOCUS_54860 gene urtD CDS 828..1523 product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531845.1 transl_table 11 codon_start 1 locus_tag LOCUS_54870 gene urtE CDS 1948..2121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531844.1 transl_table 11 codon_start 1 locus_tag LOCUS_54880 CDS complement(2141..3292) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531843.1 transl_table 11 codon_start 1 locus_tag LOCUS_54890 CDS complement(3406..4212) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531842.1 transl_table 11 codon_start 1 locus_tag LOCUS_54900 CDS complement(4241..4705) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531841.1 transl_table 11 codon_start 1 locus_tag LOCUS_54910 CDS complement(4740..7661) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531840.1 transl_table 11 codon_start 1 locus_tag LOCUS_54920 gene uvrA CDS 8514..9227 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092159.1 transl_table 11 codon_start 1 locus_tag LOCUS_54930 CDS complement(9290..9646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531839.1 transl_table 11 codon_start 1 locus_tag LOCUS_54940 CDS complement(9643..10248) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531838.1 transl_table 11 codon_start 1 locus_tag LOCUS_54950 CDS complement(10273..10755) product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531837.1 transl_table 11 codon_start 1 locus_tag LOCUS_54960 CDS complement(10752..11066) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531836.1 transl_table 11 codon_start 1 locus_tag LOCUS_54970 CDS complement(11110..11511) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111546447.1 transl_table 11 codon_start 1 locus_tag LOCUS_54980 sequence176 source 1..11578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(122..499) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528007.1 transl_table 11 codon_start 1 locus_tag LOCUS_54990 CDS 724..2103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55000 assembly_gap 1680..1689 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2477..4282 product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528004.1 transl_table 11 codon_start 1 locus_tag LOCUS_55010 CDS complement(4371..4790) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529433.1 transl_table 11 codon_start 1 locus_tag LOCUS_55020 CDS 4957..5355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528001.1 transl_table 11 codon_start 1 locus_tag LOCUS_55030 CDS complement(5371..6879) product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527999.1 transl_table 11 codon_start 1 locus_tag LOCUS_55040 CDS complement(7179..8672) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 transl_table 11 codon_start 1 locus_tag LOCUS_55050 CDS complement(8753..8917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55060 CDS 9115..10776 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527997.1 transl_table 11 codon_start 1 locus_tag LOCUS_55070 gene pgi assembly_gap 9448..9457 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10782..11504 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527996.1 transl_table 11 codon_start 1 locus_tag LOCUS_55080 sequence177 source 1..11465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1170..3005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55090 CDS 3008..5155 product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 transl_table 11 codon_start 1 locus_tag LOCUS_55100 CDS 5347..6195 product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 transl_table 11 codon_start 1 locus_tag LOCUS_55110 CDS 6241..8229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55120 CDS 8279..9082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55130 CDS complement(9263..10303) product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253027.1 transl_table 11 codon_start 1 locus_tag LOCUS_55140 misc_feature complement(10316..>11465) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117635.1:SctV family type III secretion system export apparatus subunit LcrD locus_tag LOCUS_55150 sequence178 source 1..11317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1026..1301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528891.1 transl_table 11 codon_start 1 locus_tag LOCUS_55160 CDS complement(1630..2976) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163308.1 transl_table 11 codon_start 1 locus_tag LOCUS_55170 CDS complement(3008..3346) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528889.1 transl_table 11 codon_start 1 locus_tag LOCUS_55180 CDS complement(3604..4467) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528888.1 transl_table 11 codon_start 1 locus_tag LOCUS_55190 gene tesB CDS 4633..5895 product ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163307.1 transl_table 11 codon_start 1 locus_tag LOCUS_55200 CDS complement(6117..6647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528886.1 transl_table 11 codon_start 1 locus_tag LOCUS_55210 CDS 7003..8022 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312895.1 transl_table 11 codon_start 1 locus_tag LOCUS_55220 CDS 8092..9618 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973400.1 transl_table 11 codon_start 1 locus_tag LOCUS_55230 CDS 9615..10631 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973399.1 transl_table 11 codon_start 1 locus_tag LOCUS_55240 assembly_gap 10439..10448 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10633..11316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55250 sequence179 source 1..11196 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(450..668) product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531295.1 transl_table 11 codon_start 1 locus_tag LOCUS_55260 CDS complement(849..1604) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531294.1 transl_table 11 codon_start 1 locus_tag LOCUS_55270 gene scpB CDS complement(1601..2443) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531293.1 transl_table 11 codon_start 1 locus_tag LOCUS_55280 CDS complement(2465..3484) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531292.1 transl_table 11 codon_start 1 locus_tag LOCUS_55290 gene nagZ CDS complement(3612..7148) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531291.1 transl_table 11 codon_start 1 locus_tag LOCUS_55300 CDS complement(7252..9060) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531290.1 transl_table 11 codon_start 1 locus_tag LOCUS_55310 gene argS CDS complement(9074..10303) product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531289.1 transl_table 11 codon_start 1 locus_tag LOCUS_55320 CDS 10374..10721 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531288.1 transl_table 11 codon_start 1 locus_tag LOCUS_55330 gene erpA CDS 10732..11136 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531287.1 transl_table 11 codon_start 1 locus_tag LOCUS_55340 sequence180 source 1..10951 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 923..2179 product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531325.1 transl_table 11 codon_start 1 locus_tag LOCUS_55350 gene ilvA CDS 2176..2733 product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531326.1 transl_table 11 codon_start 1 locus_tag LOCUS_55360 CDS complement(2745..3035) product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531327.1 transl_table 11 codon_start 1 locus_tag LOCUS_55370 CDS complement(3167..3607) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531328.1 transl_table 11 codon_start 1 locus_tag LOCUS_55380 gene gloA CDS 3906..4502 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531329.1 transl_table 11 codon_start 1 locus_tag LOCUS_55390 CDS 4527..5090 product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531330.1 transl_table 11 codon_start 1 locus_tag LOCUS_55400 CDS 5110..5877 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172307.1 transl_table 11 codon_start 1 locus_tag LOCUS_55410 CDS 5897..6397 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969353.1 transl_table 11 codon_start 1 locus_tag LOCUS_55420 CDS complement(6465..7064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531332.1 transl_table 11 codon_start 1 locus_tag LOCUS_55430 CDS 7188..8036 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531333.1 transl_table 11 codon_start 1 locus_tag LOCUS_55440 gene cysE CDS 8177..8380 product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531334.1 transl_table 11 codon_start 1 locus_tag LOCUS_55450 CDS complement(8458..9189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531335.1 transl_table 11 codon_start 1 locus_tag LOCUS_55460 CDS 9317..9661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531336.1 transl_table 11 codon_start 1 locus_tag LOCUS_55470 CDS 9681..10208 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531337.1 transl_table 11 codon_start 1 locus_tag LOCUS_55480 CDS complement(10240..10803) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531338.1 transl_table 11 codon_start 1 locus_tag LOCUS_55490 sequence181 source 1..10884 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(300..935) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528367.1 transl_table 11 codon_start 1 locus_tag LOCUS_55500 CDS 1062..1763 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528368.1 transl_table 11 codon_start 1 locus_tag LOCUS_55510 CDS complement(2132..3241) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528369.1 transl_table 11 codon_start 1 locus_tag LOCUS_55520 CDS 3471..4337 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502014.1 transl_table 11 codon_start 1 locus_tag LOCUS_55530 CDS 4494..6422 product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528371.1 transl_table 11 codon_start 1 locus_tag LOCUS_55540 gene iolC CDS 6459..8303 product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528372.1 transl_table 11 codon_start 1 locus_tag LOCUS_55550 gene iolD CDS 8345..9259 product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528373.1 transl_table 11 codon_start 1 locus_tag LOCUS_55560 gene iolE CDS 9325..9537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528374.1 transl_table 11 codon_start 1 locus_tag LOCUS_55570 CDS 9552..10364 product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528375.1 transl_table 11 codon_start 1 locus_tag LOCUS_55580 gene iolB sequence182 source 1..10796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530998.1:glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase locus_tag LOCUS_55590 CDS complement(1585..1734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55600 CDS complement(1868..2662) product 27-O-demethylrifamycin SV methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222580.1 transl_table 11 codon_start 1 locus_tag LOCUS_55610 CDS complement(2673..4097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55620 CDS complement(4274..5209) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531004.1 transl_table 11 codon_start 1 locus_tag LOCUS_55630 CDS 5324..5785 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531005.1 transl_table 11 codon_start 1 locus_tag LOCUS_55640 CDS complement(5885..6082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531006.1 transl_table 11 codon_start 1 locus_tag LOCUS_55650 CDS complement(6229..6714) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531007.1 transl_table 11 codon_start 1 locus_tag LOCUS_55660 CDS complement(6743..7435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55670 CDS 7651..9069 product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531008.1 transl_table 11 codon_start 1 locus_tag LOCUS_55680 CDS 9072..9569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141565.1 transl_table 11 codon_start 1 locus_tag LOCUS_55690 sequence183 source 1..10573 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 141..668 product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528720.1 transl_table 11 codon_start 1 locus_tag LOCUS_55700 CDS 693..1061 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528719.1 transl_table 11 codon_start 1 locus_tag LOCUS_55710 CDS complement(1148..1483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55720 CDS complement(1580..2197) product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528717.1 transl_table 11 codon_start 1 locus_tag LOCUS_55730 CDS complement(2380..3657) product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528715.1 transl_table 11 codon_start 1 locus_tag LOCUS_55740 CDS complement(3891..4250) product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528714.1 transl_table 11 codon_start 1 locus_tag LOCUS_55750 CDS 4560..4745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230646.1 transl_table 11 codon_start 1 locus_tag LOCUS_55760 CDS 4961..6403 product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528703.1 transl_table 11 codon_start 1 locus_tag LOCUS_55770 CDS 6400..7575 product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528702.1 transl_table 11 codon_start 1 locus_tag LOCUS_55780 CDS 7714..8823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55790 CDS 8981..10222 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531949.1 transl_table 11 codon_start 1 locus_tag LOCUS_55800 assembly_gap 10232..10241 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence184 source 1..10510 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1287 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531860.1:ATP-binding protein locus_tag LOCUS_55810 CDS 1487..2233 product DeoD-type purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531859.1 transl_table 11 codon_start 1 locus_tag LOCUS_55820 CDS complement(2332..2637) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531854.1 transl_table 11 codon_start 1 locus_tag LOCUS_55830 CDS 2916..3290 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531853.1 transl_table 11 codon_start 1 locus_tag LOCUS_55840 CDS 3371..3901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531852.1 transl_table 11 codon_start 1 locus_tag LOCUS_55850 assembly_gap 4079..4088 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4174..5523 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531851.1 transl_table 11 codon_start 1 locus_tag LOCUS_55860 CDS complement(5588..5983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531850.1 transl_table 11 codon_start 1 locus_tag LOCUS_55870 CDS 6318..7595 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531849.1 transl_table 11 codon_start 1 locus_tag LOCUS_55880 gene urtA CDS 7716..9329 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531848.1 transl_table 11 codon_start 1 locus_tag LOCUS_55890 gene urtB sequence185 source 1..10507 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(390..1196) product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971094.1 transl_table 11 codon_start 1 locus_tag LOCUS_55900 gene virB9 CDS complement(1196..1888) product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971093.1 transl_table 11 codon_start 1 locus_tag LOCUS_55910 CDS complement(1927..2958) product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971092.1 transl_table 11 codon_start 1 locus_tag LOCUS_55920 CDS complement(2974..3198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971091.1 transl_table 11 codon_start 1 locus_tag LOCUS_55930 CDS complement(3188..3892) product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971090.1 transl_table 11 codon_start 1 locus_tag LOCUS_55940 CDS complement(3904..4989) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971089.1 transl_table 11 codon_start 1 locus_tag LOCUS_55950 CDS complement(4986..7397) product VirB4 family type IV secretion/conjugal transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971088.1 transl_table 11 codon_start 1 locus_tag LOCUS_55960 CDS complement(7401..7700) product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971087.1 transl_table 11 codon_start 1 locus_tag LOCUS_55970 CDS complement(7703..8047) product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971086.1 transl_table 11 codon_start 1 locus_tag LOCUS_55980 CDS complement(8060..8941) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160470.1 transl_table 11 codon_start 1 locus_tag LOCUS_55990 CDS 9139..9774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971084.1 transl_table 11 codon_start 1 locus_tag LOCUS_56000 CDS 9771..10313 product succinoglycan biosynthesis protein exoi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971083.1 transl_table 11 codon_start 1 locus_tag LOCUS_56010 sequence186 source 1..10450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(294..1223) product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531363.1 transl_table 11 codon_start 1 locus_tag LOCUS_56020 CDS complement(1234..2382) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531362.1 transl_table 11 codon_start 1 locus_tag LOCUS_56030 CDS 2589..3926 product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531361.1 transl_table 11 codon_start 1 locus_tag LOCUS_56040 CDS 3987..4793 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531360.1 transl_table 11 codon_start 1 locus_tag LOCUS_56050 CDS 4939..5373 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531359.1 transl_table 11 codon_start 1 locus_tag LOCUS_56060 gene aroQ CDS 5400..5864 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531358.1 transl_table 11 codon_start 1 locus_tag LOCUS_56070 gene accB CDS 5873..7216 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531357.1 transl_table 11 codon_start 1 locus_tag LOCUS_56080 gene accC CDS 7245..7862 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531356.1 transl_table 11 codon_start 1 locus_tag LOCUS_56090 gene aat CDS complement(7874..8281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531355.1 transl_table 11 codon_start 1 locus_tag LOCUS_56100 CDS complement(8347..8859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56110 CDS 8762..9037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56120 CDS complement(9010..9408) product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531353.1 transl_table 11 codon_start 1 locus_tag LOCUS_56130 sequence187 source 1..10330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 180..476 product YciI-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528905.1 transl_table 11 codon_start 1 locus_tag LOCUS_56140 CDS 586..1011 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528904.1 transl_table 11 codon_start 1 locus_tag LOCUS_56150 CDS 1008..1664 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564970.1 transl_table 11 codon_start 1 locus_tag LOCUS_56160 CDS 1746..2162 product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528902.1 transl_table 11 codon_start 1 locus_tag LOCUS_56170 CDS complement(2301..3221) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528901.1 transl_table 11 codon_start 1 locus_tag LOCUS_56180 gene gcvA CDS 3352..3627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528900.1 transl_table 11 codon_start 1 locus_tag LOCUS_56190 CDS complement(3665..4180) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083833212.1 transl_table 11 codon_start 1 locus_tag LOCUS_56200 CDS 4346..5029 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528898.1 transl_table 11 codon_start 1 locus_tag LOCUS_56210 CDS 5254..5709 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528897.1 transl_table 11 codon_start 1 locus_tag LOCUS_56220 CDS 5795..6889 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528896.1 transl_table 11 codon_start 1 locus_tag LOCUS_56230 CDS complement(6955..7761) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528894.1 transl_table 11 codon_start 1 locus_tag LOCUS_56240 CDS complement(8049..8714) product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528893.1 transl_table 11 codon_start 1 locus_tag LOCUS_56250 misc_feature complement(8860..>10330) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528892.1:DNA translocase FtsK locus_tag LOCUS_56260 sequence188 source 1..10032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56270 CDS 644..2158 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529831.1 transl_table 11 codon_start 1 locus_tag LOCUS_56280 CDS complement(2298..3164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502664.1 transl_table 11 codon_start 1 locus_tag LOCUS_56290 CDS 3308..3517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56300 CDS complement(3477..4190) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972919.1 transl_table 11 codon_start 1 locus_tag LOCUS_56310 CDS 4452..5366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56320 note possible pseudo, frameshifted CDS 5285..5515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56330 note possible pseudo, frameshifted CDS 5549..6838 product PotD/PotF family extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242231.1 transl_table 11 codon_start 1 locus_tag LOCUS_56340 CDS 6910..7821 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972745.1 transl_table 11 codon_start 1 locus_tag LOCUS_56350 CDS 7826..8644 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972744.1 transl_table 11 codon_start 1 locus_tag LOCUS_56360 CDS 8656..9402 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972743.1 transl_table 11 codon_start 1 locus_tag LOCUS_56370 sequence189 source 1..9801 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..831 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966765.1:HlyD family type I secretion periplasmic adaptor subunit locus_tag LOCUS_56380 CDS 1331..3637 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532683.1 transl_table 11 codon_start 1 locus_tag LOCUS_56390 CDS complement(4422..5798) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086907.1 transl_table 11 codon_start 1 locus_tag LOCUS_56400 CDS 6027..7187 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197192.1 transl_table 11 codon_start 1 locus_tag LOCUS_56410 CDS 7344..9056 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531566.1 transl_table 11 codon_start 1 locus_tag LOCUS_56420 misc_feature complement(9084..>9801) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532753.1:chromosome segregation protein SMC locus_tag LOCUS_56430 sequence190 source 1..9784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 806..1711 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445527.1 transl_table 11 codon_start 1 locus_tag LOCUS_56440 CDS complement(1908..2717) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972999.1 transl_table 11 codon_start 1 locus_tag LOCUS_56450 CDS 2856..3965 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527856.1 transl_table 11 codon_start 1 locus_tag LOCUS_56460 CDS 3955..5034 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061357.1 transl_table 11 codon_start 1 locus_tag LOCUS_56470 CDS 5028..5867 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396373.1 transl_table 11 codon_start 1 locus_tag LOCUS_56480 CDS complement(5934..7589) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146502312.1 transl_table 11 codon_start 1 locus_tag LOCUS_56490 CDS complement(7779..8138) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062370183.1 transl_table 11 codon_start 1 locus_tag LOCUS_56500 CDS 8372..9094 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 transl_table 11 codon_start 1 locus_tag LOCUS_56510 sequence191 source 1..9676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1107 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530885.1:ABC transporter ATP-binding protein locus_tag LOCUS_56520 CDS complement(1141..1698) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530886.1 transl_table 11 codon_start 1 locus_tag LOCUS_56530 CDS 1945..3492 product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501515.1 transl_table 11 codon_start 1 locus_tag LOCUS_56540 CDS 3730..6156 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 transl_table 11 codon_start 1 locus_tag LOCUS_56550 CDS complement(6182..6574) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530889.1 transl_table 11 codon_start 1 locus_tag LOCUS_56560 CDS 6886..7278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56570 note possible pseudo, frameshifted assembly_gap 6917..6926 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7288..8067) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530891.1 transl_table 11 codon_start 1 locus_tag LOCUS_56580 CDS 8242..8976 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530892.1 transl_table 11 codon_start 1 locus_tag LOCUS_56590 sequence192 source 1..9607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 88..1599 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528956.1 transl_table 11 codon_start 1 locus_tag LOCUS_56600 CDS 1603..1842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56610 CDS 1842..2891 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528957.1 transl_table 11 codon_start 1 locus_tag LOCUS_56620 CDS 2888..3832 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 transl_table 11 codon_start 1 locus_tag LOCUS_56630 CDS complement(3901..4668) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528959.1 transl_table 11 codon_start 1 locus_tag LOCUS_56640 CDS 4950..5099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528960.1 transl_table 11 codon_start 1 locus_tag LOCUS_56650 CDS 5231..6172 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528961.1 transl_table 11 codon_start 1 locus_tag LOCUS_56660 CDS complement(6181..6855) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528962.1 transl_table 11 codon_start 1 locus_tag LOCUS_56670 CDS 7083..7901 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173821.1 transl_table 11 codon_start 1 locus_tag LOCUS_56680 CDS 7919..8863 product tonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528968.1 transl_table 11 codon_start 1 locus_tag LOCUS_56690 gene exbB CDS 8870..9370 product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528969.1 transl_table 11 codon_start 1 locus_tag LOCUS_56700 gene exbD sequence193 source 1..9578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 227..236 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 423..1220 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528807.1 transl_table 11 codon_start 1 locus_tag LOCUS_56710 CDS complement(1323..1790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56720 CDS complement(2021..2599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56730 CDS complement(2789..4012) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528809.1 transl_table 11 codon_start 1 locus_tag LOCUS_56740 CDS complement(4190..4666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528811.1 transl_table 11 codon_start 1 locus_tag LOCUS_56750 CDS complement(4663..5898) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528813.1 transl_table 11 codon_start 1 locus_tag LOCUS_56760 gene rlmN CDS complement(5882..6190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56770 CDS 6165..6536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56780 CDS 6637..7152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56790 CDS complement(7154..7402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56800 CDS complement(7416..7919) product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528815.1 transl_table 11 codon_start 1 locus_tag LOCUS_56810 CDS complement(8169..8531) product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528816.1 transl_table 11 codon_start 1 locus_tag LOCUS_56820 CDS complement(8617..8913) product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528817.1 transl_table 11 codon_start 1 locus_tag LOCUS_56830 CDS 8998..9540 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528818.1 transl_table 11 codon_start 1 locus_tag LOCUS_56840 sequence194 source 1..9424 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(198..2018) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531659.1 transl_table 11 codon_start 1 locus_tag LOCUS_56850 CDS 2298..2924 product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531658.1 transl_table 11 codon_start 1 locus_tag LOCUS_56860 CDS complement(2994..3317) product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027161605.1 transl_table 11 codon_start 1 locus_tag LOCUS_56870 gene hspQ CDS complement(3540..4826) product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531655.1 transl_table 11 codon_start 1 locus_tag LOCUS_56880 CDS 4854..5750 product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531654.1 transl_table 11 codon_start 1 locus_tag LOCUS_56890 CDS 5766..6380 product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531653.1 transl_table 11 codon_start 1 locus_tag LOCUS_56900 CDS 6377..7207 product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503276.1 transl_table 11 codon_start 1 locus_tag LOCUS_56910 CDS 7260..8237 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531651.1 transl_table 11 codon_start 1 locus_tag LOCUS_56920 sequence195 source 1..9405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 117..596 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528017.1 transl_table 11 codon_start 1 locus_tag LOCUS_56930 CDS 681..1043 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528018.1 transl_table 11 codon_start 1 locus_tag LOCUS_56940 CDS 1176..1490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528019.1 transl_table 11 codon_start 1 locus_tag LOCUS_56950 CDS complement(1559..2260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56960 CDS complement(2454..3881) product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528020.1 transl_table 11 codon_start 1 locus_tag LOCUS_56970 CDS complement(3988..4803) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528021.1 transl_table 11 codon_start 1 locus_tag LOCUS_56980 CDS complement(4793..5761) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210183137.1 transl_table 11 codon_start 1 locus_tag LOCUS_56990 CDS complement(5758..6756) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528023.1 transl_table 11 codon_start 1 locus_tag LOCUS_57000 CDS complement(6961..8115) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528024.1 transl_table 11 codon_start 1 locus_tag LOCUS_57010 CDS complement(8338..9249) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528025.1 transl_table 11 codon_start 1 locus_tag LOCUS_57020 sequence196 source 1..9390 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(63..1133) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532862.1 transl_table 11 codon_start 1 locus_tag LOCUS_57030 CDS complement(1164..1997) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532863.1 transl_table 11 codon_start 1 locus_tag LOCUS_57040 CDS complement(1994..2815) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532864.1 transl_table 11 codon_start 1 locus_tag LOCUS_57050 CDS complement(2980..4260) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532865.1 transl_table 11 codon_start 1 locus_tag LOCUS_57060 CDS 4457..5614 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532866.1 transl_table 11 codon_start 1 locus_tag LOCUS_57070 CDS 5665..6141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57080 CDS 6315..7247 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532868.1 transl_table 11 codon_start 1 locus_tag LOCUS_57090 CDS 7453..8439 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532869.1 transl_table 11 codon_start 1 locus_tag LOCUS_57100 CDS 8443..9237 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532870.1 transl_table 11 codon_start 1 locus_tag LOCUS_57110 sequence197 source 1..9353 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(46..1011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57120 CDS complement(1008..2507) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530864.1 transl_table 11 codon_start 1 locus_tag LOCUS_57130 CDS complement(2535..3587) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969741.1 transl_table 11 codon_start 1 locus_tag LOCUS_57140 CDS 3823..4620 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018012046.1 transl_table 11 codon_start 1 locus_tag LOCUS_57150 CDS 5306..8053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57160 assembly_gap 6230..6326 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence198 source 1..9272 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 735..1322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57170 CDS complement(1460..2107) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528674.1 transl_table 11 codon_start 1 locus_tag LOCUS_57180 CDS complement(2104..3477) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528673.1 transl_table 11 codon_start 1 locus_tag LOCUS_57190 CDS complement(3589..4299) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969688.1 transl_table 11 codon_start 1 locus_tag LOCUS_57200 CDS 5052..7856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57210 sequence199 source 1..9189 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(449..1087) product dimethylsulfonioproprionate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531208.1 transl_table 11 codon_start 1 locus_tag LOCUS_57220 CDS 1202..2368 product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531207.1 transl_table 11 codon_start 1 locus_tag LOCUS_57230 CDS 2394..3278 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531206.1 transl_table 11 codon_start 1 locus_tag LOCUS_57240 gene mmsB CDS complement(3652..6090) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531205.1 transl_table 11 codon_start 1 locus_tag LOCUS_57250 CDS complement(6281..7660) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531202.1 transl_table 11 codon_start 1 locus_tag LOCUS_57260 misc_feature complement(7902..>9189) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531200.1:prolyl oligopeptidase family protein locus_tag LOCUS_57270 sequence200 source 1..9052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 286..1080 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531023.1 transl_table 11 codon_start 1 locus_tag LOCUS_57280 gene modA CDS 1097..1801 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531024.1 transl_table 11 codon_start 1 locus_tag LOCUS_57290 gene modB CDS 1798..2910 product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531025.1 transl_table 11 codon_start 1 locus_tag LOCUS_57300 gene modC CDS 2990..3331 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531026.1 transl_table 11 codon_start 1 locus_tag LOCUS_57310 CDS complement(3356..4129) product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531027.1 transl_table 11 codon_start 1 locus_tag LOCUS_57320 gene cobF CDS 4385..5413 product DUF4424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531028.1 transl_table 11 codon_start 1 locus_tag LOCUS_57330 CDS 5413..5931 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531029.1 transl_table 11 codon_start 1 locus_tag LOCUS_57340 CDS 6101..7216 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531030.1 transl_table 11 codon_start 1 locus_tag LOCUS_57350 gene hflK CDS 7216..8157 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531031.1 transl_table 11 codon_start 1 locus_tag LOCUS_57360 CDS 8164..8349 product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531032.1 transl_table 11 codon_start 1 locus_tag LOCUS_57370 sequence201 source 1..9028 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 6..410 product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531079.1 transl_table 11 codon_start 1 locus_tag LOCUS_57380 CDS 407..1171 product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531078.1 transl_table 11 codon_start 1 locus_tag LOCUS_57390 gene cobM CDS 1168..1983 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531077.1 transl_table 11 codon_start 1 locus_tag LOCUS_57400 gene cobA CDS 1980..3314 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531076.1 transl_table 11 codon_start 1 locus_tag LOCUS_57410 assembly_gap 2475..2484 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3318..4094 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531075.1 transl_table 11 codon_start 1 locus_tag LOCUS_57420 gene cobS CDS 4119..5129 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531074.1 transl_table 11 codon_start 1 locus_tag LOCUS_57430 gene cobT CDS 5154..5894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57440 tRNA complement(5966..6041) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(6238..7143) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531073.1 transl_table 11 codon_start 1 locus_tag LOCUS_57450 CDS 7245..8531 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531072.1 transl_table 11 codon_start 1 locus_tag LOCUS_57460 sequence202 source 1..8958 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(110..607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57470 assembly_gap 209..218 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(604..1017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57480 CDS complement(1014..1442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815731.1 transl_table 11 codon_start 1 locus_tag LOCUS_57490 CDS complement(1442..3295) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815730.1 transl_table 11 codon_start 1 locus_tag LOCUS_57500 assembly_gap 3333..3342 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3525..4685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57510 CDS complement(4939..6294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57520 CDS complement(6542..8263) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531911.1 transl_table 11 codon_start 1 locus_tag LOCUS_57530 gene glmS assembly_gap 8233..8242 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8561..8893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975153.1 transl_table 11 codon_start 1 locus_tag LOCUS_57540 sequence203 source 1..8863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1642..2103 product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531233.1 transl_table 11 codon_start 1 locus_tag LOCUS_57550 CDS complement(2105..3313) product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531232.1 transl_table 11 codon_start 1 locus_tag LOCUS_57560 CDS complement(3321..3764) product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503807.1 transl_table 11 codon_start 1 locus_tag LOCUS_57570 CDS 3973..4893 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531230.1 transl_table 11 codon_start 1 locus_tag LOCUS_57580 CDS complement(5062..6090) product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531229.1 transl_table 11 codon_start 1 locus_tag LOCUS_57590 CDS complement(6187..7644) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531228.1 transl_table 11 codon_start 1 locus_tag LOCUS_57600 CDS complement(7820..8770) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531227.1 transl_table 11 codon_start 1 locus_tag LOCUS_57610 sequence204 source 1..8804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..691 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529462.1:peptide chain release factor N(5)-glutamine methyltransferase locus_tag LOCUS_57620 CDS 1021..1968 product DUF4167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529463.1 transl_table 11 codon_start 1 locus_tag LOCUS_57630 CDS 2191..4797 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529464.1 transl_table 11 codon_start 1 locus_tag LOCUS_57640 gene clpB CDS 4868..5224 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529465.1 transl_table 11 codon_start 1 locus_tag LOCUS_57650 CDS 5358..6845 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529466.1 transl_table 11 codon_start 1 locus_tag LOCUS_57660 CDS complement(7078..7344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57670 note possible pseudo, internal stop codon, frameshifted sequence205 source 1..8776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 289..1308 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528618.1 transl_table 11 codon_start 1 locus_tag LOCUS_57680 CDS 1434..3290 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528617.1 transl_table 11 codon_start 1 locus_tag LOCUS_57690 CDS 3444..4112 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528616.1 transl_table 11 codon_start 1 locus_tag LOCUS_57700 gene dapB note possible pseudo, frameshifted assembly_gap 3449..3458 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4152..4772 product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528615.1 transl_table 11 codon_start 1 locus_tag LOCUS_57710 tRNA 5019..5103 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 5215..5634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57720 CDS complement(5834..6364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57730 assembly_gap 6617..6626 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6630..7454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57740 note possible pseudo, frameshifted CDS 7454..7759 product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528614.1 transl_table 11 codon_start 1 locus_tag LOCUS_57750 CDS complement(8035..8208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528612.1 transl_table 11 codon_start 1 locus_tag LOCUS_57760 sequence206 source 1..8683 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..742 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528336.1:sensor histidine kinase locus_tag LOCUS_57770 CDS 757..1218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528335.1 transl_table 11 codon_start 1 locus_tag LOCUS_57780 CDS 1383..1784 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010912939.1 transl_table 11 codon_start 1 locus_tag LOCUS_57790 CDS 1781..2077 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528333.1 transl_table 11 codon_start 1 locus_tag LOCUS_57800 CDS 2369..3769 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528332.1 transl_table 11 codon_start 1 locus_tag LOCUS_57810 gene ahcY CDS 3959..6520 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528331.1 transl_table 11 codon_start 1 locus_tag LOCUS_57820 CDS 6529..8034 product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528330.1 transl_table 11 codon_start 1 locus_tag LOCUS_57830 sequence207 source 1..8577 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(47..922) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528546.1 transl_table 11 codon_start 1 locus_tag LOCUS_57840 CDS complement(1164..2144) product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528545.1 transl_table 11 codon_start 1 locus_tag LOCUS_57850 gene hpaD CDS complement(2159..3676) product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392284.1 transl_table 11 codon_start 1 locus_tag LOCUS_57860 gene hpaE CDS complement(3704..4081) product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528543.1 transl_table 11 codon_start 1 locus_tag LOCUS_57870 CDS 4334..4711 product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528542.1 transl_table 11 codon_start 1 locus_tag LOCUS_57880 gene hpaR CDS complement(4884..5393) product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528541.1 transl_table 11 codon_start 1 locus_tag LOCUS_57890 CDS complement(5405..6949) product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392289.1 transl_table 11 codon_start 1 locus_tag LOCUS_57900 CDS 7002..7913 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528539.1 transl_table 11 codon_start 1 locus_tag LOCUS_57910 CDS complement(8000..8242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57920 note possible pseudo, frameshifted assembly_gap 8311..8320 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence208 source 1..8523 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 605..1543 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173806.1 transl_table 11 codon_start 1 locus_tag LOCUS_57930 CDS complement(1617..2000) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503765.1 transl_table 11 codon_start 1 locus_tag LOCUS_57940 CDS complement(2083..2625) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529401.1 transl_table 11 codon_start 1 locus_tag LOCUS_57950 gene hpt CDS complement(2730..3371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529400.1 transl_table 11 codon_start 1 locus_tag LOCUS_57960 CDS 3567..4226 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010911739.1 transl_table 11 codon_start 1 locus_tag LOCUS_57970 gene ftsE CDS 4219..5208 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529399.1 transl_table 11 codon_start 1 locus_tag LOCUS_57980 CDS 5346..6098 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529398.1 transl_table 11 codon_start 1 locus_tag LOCUS_57990 CDS complement(6088..6711) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529397.1 transl_table 11 codon_start 1 locus_tag LOCUS_58000 CDS 6817..7722 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529395.1 transl_table 11 codon_start 1 locus_tag LOCUS_58010 sequence209 source 1..8448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 264..3203 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142489.1 transl_table 11 codon_start 1 locus_tag LOCUS_58020 CDS 3125..3376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58030 note possible pseudo, frameshifted CDS 3474..4940 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 transl_table 11 codon_start 1 locus_tag LOCUS_58040 CDS 5037..5723 product aspartyl/asparaginyl beta-hydroxylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194984.1 transl_table 11 codon_start 1 locus_tag LOCUS_58050 CDS 5774..6133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328250.1 transl_table 11 codon_start 1 locus_tag LOCUS_58060 CDS complement(6161..6457) product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532001.1 transl_table 11 codon_start 1 locus_tag LOCUS_58070 CDS complement(6779..7066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58080 assembly_gap 6991..7000 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7365..8192 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532002.1 transl_table 11 codon_start 1 locus_tag LOCUS_58090 gene map sequence210 source 1..8398 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1362..1706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58100 CDS complement(1703..3439) product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965811.1 transl_table 11 codon_start 1 locus_tag LOCUS_58110 assembly_gap 2742..2751 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3690..4358 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174804.1 transl_table 11 codon_start 1 locus_tag LOCUS_58120 CDS complement(4367..5524) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395362.1 transl_table 11 codon_start 1 locus_tag LOCUS_58130 CDS complement(5662..6858) product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969965.1 transl_table 11 codon_start 1 locus_tag LOCUS_58140 CDS complement(7011..8207) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 transl_table 11 codon_start 1 locus_tag LOCUS_58150 assembly_gap 7189..7198 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence211 source 1..8374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 168..2390 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532541.1 transl_table 11 codon_start 1 locus_tag LOCUS_58160 CDS complement(2395..3213) product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532542.1 transl_table 11 codon_start 1 locus_tag LOCUS_58170 CDS complement(3217..3915) product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532543.1 transl_table 11 codon_start 1 locus_tag LOCUS_58180 CDS 4103..4996 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 transl_table 11 codon_start 1 locus_tag LOCUS_58190 CDS complement(4975..5316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532546.1 transl_table 11 codon_start 1 locus_tag LOCUS_58200 CDS complement(5546..7426) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532547.1 transl_table 11 codon_start 1 locus_tag LOCUS_58210 CDS complement(7445..7789) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532548.1 transl_table 11 codon_start 1 locus_tag LOCUS_58220 sequence212 source 1..8261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525289.1:type VI secretion system-associated FHA domain protein TagH locus_tag LOCUS_58230 CDS 1098..2603 product type VI secretion system protein TssL, long form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525288.1 transl_table 11 codon_start 1 locus_tag LOCUS_58240 gene tssL CDS 2626..6156 product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525287.1 transl_table 11 codon_start 1 locus_tag LOCUS_58250 gene tssM CDS 6316..7098 product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525286.1 transl_table 11 codon_start 1 locus_tag LOCUS_58260 sequence213 source 1..8173 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..708 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063173723.1:M15 family metallopeptidase locus_tag LOCUS_58270 CDS 938..1966 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530876.1 transl_table 11 codon_start 1 locus_tag LOCUS_58280 CDS 2042..2893 product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530875.1 transl_table 11 codon_start 1 locus_tag LOCUS_58290 gene cysT CDS 2886..3770 product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530874.1 transl_table 11 codon_start 1 locus_tag LOCUS_58300 gene cysW CDS 3838..4896 product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530873.1 transl_table 11 codon_start 1 locus_tag LOCUS_58310 CDS 5046..6032 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530872.1 transl_table 11 codon_start 1 locus_tag LOCUS_58320 CDS 6295..6744 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530871.1 transl_table 11 codon_start 1 locus_tag LOCUS_58330 CDS 6881..8029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530868.1 transl_table 11 codon_start 1 locus_tag LOCUS_58340 sequence214 source 1..8100 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(55..1296) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530526.1 transl_table 11 codon_start 1 locus_tag LOCUS_58350 CDS complement(1355..2395) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530527.1 transl_table 11 codon_start 1 locus_tag LOCUS_58360 CDS 2651..3829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58370 CDS 3826..4647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58380 CDS complement(4701..5135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58390 CDS complement(5314..5793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58400 CDS complement(6546..7742) product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533246.1 transl_table 11 codon_start 1 locus_tag LOCUS_58410 sequence215 source 1..7960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(573..1784) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532148.1 transl_table 11 codon_start 1 locus_tag LOCUS_58420 CDS 1991..2905 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532146.1 transl_table 11 codon_start 1 locus_tag LOCUS_58430 CDS 2898..3683 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532145.1 transl_table 11 codon_start 1 locus_tag LOCUS_58440 gene murI CDS 3744..3932 product DUF3008 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532144.1 transl_table 11 codon_start 1 locus_tag LOCUS_58450 CDS 4272..4889 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532142.1 transl_table 11 codon_start 1 locus_tag LOCUS_58460 gene rpsD CDS 5050..5907 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532141.1 transl_table 11 codon_start 1 locus_tag LOCUS_58470 gene ttcA CDS 5918..6745 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532140.1 transl_table 11 codon_start 1 locus_tag LOCUS_58480 misc_feature complement(6761..>7960) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532138.1:multidrug effflux MFS transporter locus_tag LOCUS_58490 sequence216 source 1..7942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1331..1639) product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529201.1 transl_table 11 codon_start 1 locus_tag LOCUS_58500 CDS complement(1662..2459) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529202.1 transl_table 11 codon_start 1 locus_tag LOCUS_58510 CDS complement(2601..2831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58520 CDS 2728..3198 product DUF1036 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529203.1 transl_table 11 codon_start 1 locus_tag LOCUS_58530 CDS 3195..4637 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529204.1 transl_table 11 codon_start 1 locus_tag LOCUS_58540 gene pyk CDS complement(4643..5704) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529205.1 transl_table 11 codon_start 1 locus_tag LOCUS_58550 CDS complement(5847..6458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529206.1 transl_table 11 codon_start 1 locus_tag LOCUS_58560 CDS complement(6623..6748) product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203764.1 transl_table 11 codon_start 1 locus_tag LOCUS_58570 gene ykgO CDS 6993..7415 product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529207.1 transl_table 11 codon_start 1 locus_tag LOCUS_58580 sequence217 source 1..7924 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(500..1447) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528929.1 transl_table 11 codon_start 1 locus_tag LOCUS_58590 CDS complement(1451..2332) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168991878.1 transl_table 11 codon_start 1 locus_tag LOCUS_58600 CDS 2298..2456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58610 CDS complement(2436..3950) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528927.1 transl_table 11 codon_start 1 locus_tag LOCUS_58620 CDS complement(3997..5010) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528926.1 transl_table 11 codon_start 1 locus_tag LOCUS_58630 CDS complement(5106..5993) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173824.1 transl_table 11 codon_start 1 locus_tag LOCUS_58640 CDS complement(5993..6187) product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528835.1 transl_table 11 codon_start 1 locus_tag LOCUS_58650 CDS complement(6317..7057) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528923.1 transl_table 11 codon_start 1 locus_tag LOCUS_58660 misc_feature complement(7057..>7924) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528922.1:histidine kinase locus_tag LOCUS_58670 sequence218 source 1..7913 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(815..1129) product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528015.1 transl_table 11 codon_start 1 locus_tag LOCUS_58680 CDS complement(1119..1850) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528014.1 transl_table 11 codon_start 1 locus_tag LOCUS_58690 gene fdhD CDS complement(1946..2164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58700 CDS complement(2252..5164) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528013.1 transl_table 11 codon_start 1 locus_tag LOCUS_58710 gene fdhF CDS complement(5175..6731) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528012.1 transl_table 11 codon_start 1 locus_tag LOCUS_58720 CDS complement(6728..7207) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528011.1 transl_table 11 codon_start 1 locus_tag LOCUS_58730 CDS complement(7401..7913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58740 sequence219 source 1..7899 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(83..1003) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532538.1 transl_table 11 codon_start 1 locus_tag LOCUS_58750 CDS complement(978..1235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58760 CDS 1588..2013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58770 CDS complement(2098..3603) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532536.1 transl_table 11 codon_start 1 locus_tag LOCUS_58780 CDS 3860..4366 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532532.1 transl_table 11 codon_start 1 locus_tag LOCUS_58790 CDS complement(4369..4590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532531.1 transl_table 11 codon_start 1 locus_tag LOCUS_58800 CDS complement(4726..5280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532530.1 transl_table 11 codon_start 1 locus_tag LOCUS_58810 CDS 5206..5433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58820 CDS complement(5491..6246) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532529.1 transl_table 11 codon_start 1 locus_tag LOCUS_58830 CDS complement(6274..6720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58840 note possible pseudo, frameshifted assembly_gap 6801..6810 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7304..7738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58850 sequence220 source 1..7898 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2..499) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529393.1 transl_table 11 codon_start 1 locus_tag LOCUS_58860 CDS complement(606..1553) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529392.1 transl_table 11 codon_start 1 locus_tag LOCUS_58870 CDS complement(1675..2211) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529391.1 transl_table 11 codon_start 1 locus_tag LOCUS_58880 CDS 2327..3325 product DUF2125 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529390.1 transl_table 11 codon_start 1 locus_tag LOCUS_58890 CDS 3414..4325 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529389.1 transl_table 11 codon_start 1 locus_tag LOCUS_58900 CDS complement(4353..5291) product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162911.1 transl_table 11 codon_start 1 locus_tag LOCUS_58910 CDS complement(5297..6406) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529387.1 transl_table 11 codon_start 1 locus_tag LOCUS_58920 gene hisC sequence221 source 1..7783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..927) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532338.1 transl_table 11 codon_start 1 locus_tag LOCUS_58930 CDS 1057..1944 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532339.1 transl_table 11 codon_start 1 locus_tag LOCUS_58940 CDS 2667..2900 product DUF2093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532341.1 transl_table 11 codon_start 1 locus_tag LOCUS_58950 CDS complement(2907..3932) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532342.1 transl_table 11 codon_start 1 locus_tag LOCUS_58960 gene lpxK CDS complement(3934..5250) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532343.1 transl_table 11 codon_start 1 locus_tag LOCUS_58970 gene waaA CDS complement(5247..6029) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532344.1 transl_table 11 codon_start 1 locus_tag LOCUS_58980 CDS complement(6035..6280) product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532345.1 transl_table 11 codon_start 1 locus_tag LOCUS_58990 CDS complement(6355..7161) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532346.1 transl_table 11 codon_start 1 locus_tag LOCUS_59000 CDS complement(7148..7783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59010 sequence222 source 1..7710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 846..1883 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967956.1 transl_table 11 codon_start 1 locus_tag LOCUS_59020 CDS complement(1936..2976) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088245.1 transl_table 11 codon_start 1 locus_tag LOCUS_59030 CDS 3042..3788 product dimethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871852.1 transl_table 11 codon_start 1 locus_tag LOCUS_59040 CDS 3781..4791 product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035278.1 transl_table 11 codon_start 1 locus_tag LOCUS_59050 assembly_gap 4924..4933 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5031..5600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59060 note possible pseudo, frameshifted CDS 5634..6950 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212064.1 transl_table 11 codon_start 1 locus_tag LOCUS_59070 CDS 7032..7418 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084059.1 transl_table 11 codon_start 1 locus_tag LOCUS_59080 sequence223 source 1..7680 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 646..1791 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529734.1 transl_table 11 codon_start 1 locus_tag LOCUS_59090 CDS 1740..2402 product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529733.1 transl_table 11 codon_start 1 locus_tag LOCUS_59100 CDS 2419..2709 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211043.1 transl_table 11 codon_start 1 locus_tag LOCUS_59110 CDS 2706..3632 product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173040.1 transl_table 11 codon_start 1 locus_tag LOCUS_59120 CDS 3764..5209 product homospermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529731.1 transl_table 11 codon_start 1 locus_tag LOCUS_59130 CDS 5491..5865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529730.1 transl_table 11 codon_start 1 locus_tag LOCUS_59140 sequence224 source 1..7665 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1242 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974882.1:lactate dehydrogenase locus_tag LOCUS_59150 CDS 2134..3123 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971076.1 transl_table 11 codon_start 1 locus_tag LOCUS_59160 CDS complement(3196..3606) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085868.1 transl_table 11 codon_start 1 locus_tag LOCUS_59170 gene arsC CDS complement(3603..4247) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398893.1 transl_table 11 codon_start 1 locus_tag LOCUS_59180 assembly_gap 4320..4329 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4362..4712) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398909.1 transl_table 11 codon_start 1 locus_tag LOCUS_59190 CDS 5134..6822 product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974797.1 transl_table 11 codon_start 1 locus_tag LOCUS_59200 CDS 6913..7383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974883.1 transl_table 11 codon_start 1 locus_tag LOCUS_59210 sequence225 source 1..7622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(565..942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59220 CDS 835..1080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59230 CDS 1264..1494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59240 CDS 2340..2564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59250 note possible pseudo, internal stop codon, frameshifted CDS complement(2828..3076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59260 CDS complement(3073..3288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59270 CDS 3938..4669 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330118.1 transl_table 11 codon_start 1 locus_tag LOCUS_59280 CDS 6142..7536 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269247.1 transl_table 11 codon_start 1 locus_tag LOCUS_59290 sequence226 source 1..7602 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 412..1056 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528988.1 transl_table 11 codon_start 1 locus_tag LOCUS_59300 CDS 1065..1478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528987.1 transl_table 11 codon_start 1 locus_tag LOCUS_59310 CDS 1562..3610 product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528986.1 transl_table 11 codon_start 1 locus_tag LOCUS_59320 assembly_gap 3662..3671 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3717..5189) product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528985.1 transl_table 11 codon_start 1 locus_tag LOCUS_59330 CDS 5434..6204 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528981.1 transl_table 11 codon_start 1 locus_tag LOCUS_59340 CDS 6207..6464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59350 CDS 6476..7357 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528979.1 transl_table 11 codon_start 1 locus_tag LOCUS_59360 sequence227 source 1..7540 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 54..1052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59370 note possible pseudo, frameshifted assembly_gap 933..942 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 955..1863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59380 note possible pseudo, frameshifted CDS 1926..2171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59390 CDS 3050..4138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59400 CDS 4230..4736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59410 CDS 4748..5257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59420 CDS 5640..5930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528608.1 transl_table 11 codon_start 1 locus_tag LOCUS_59430 CDS 6229..6600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528607.1 transl_table 11 codon_start 1 locus_tag LOCUS_59440 CDS 6839..7267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59450 note possible pseudo, frameshifted assembly_gap 7204..7213 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence228 source 1..7490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(781..972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59460 CDS complement(1136..1390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59470 note possible pseudo, frameshifted CDS complement(2041..3573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59480 CDS complement(4418..4675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59490 CDS complement(5091..5744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59500 CDS 6305..6553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59510 note possible pseudo, frameshifted CDS 6550..7086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59520 note possible pseudo, internal stop codon, frameshifted sequence229 source 1..7489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 603..908 product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532440.1 transl_table 11 codon_start 1 locus_tag LOCUS_59530 tRNA 964..1040 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(1126..1824) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172604.1 transl_table 11 codon_start 1 locus_tag LOCUS_59540 CDS complement(1996..2241) product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530762.1 transl_table 11 codon_start 1 locus_tag LOCUS_59550 CDS 2668..3039 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529913.1 transl_table 11 codon_start 1 locus_tag LOCUS_59560 CDS complement(3194..3913) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086436.1 transl_table 11 codon_start 1 locus_tag LOCUS_59570 CDS complement(4023..4829) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532643.1 transl_table 11 codon_start 1 locus_tag LOCUS_59580 CDS complement(4834..5667) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532644.1 transl_table 11 codon_start 1 locus_tag LOCUS_59590 CDS complement(5690..6802) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532645.1 transl_table 11 codon_start 1 locus_tag LOCUS_59600 CDS complement(6870..7487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59610 sequence230 source 1..7432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(570..1568) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530232.1 transl_table 11 codon_start 1 locus_tag LOCUS_59620 CDS complement(1585..2484) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530231.1 transl_table 11 codon_start 1 locus_tag LOCUS_59630 gene folD CDS complement(2695..4251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59640 note possible pseudo, frameshifted assembly_gap 4220..4229 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4679..4921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59650 assembly_gap 4833..4842 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5244..6539 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530229.1 transl_table 11 codon_start 1 locus_tag LOCUS_59660 misc_feature complement(6551..>7432) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530228.1:DUF6492 family protein locus_tag LOCUS_59670 sequence231 source 1..7315 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 177..1742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59680 CDS complement(1813..2463) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528497.1 transl_table 11 codon_start 1 locus_tag LOCUS_59690 gene yihA CDS complement(2463..3101) product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027161114.1 transl_table 11 codon_start 1 locus_tag LOCUS_59700 assembly_gap 3191..3200 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3380..5182) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528504.1 transl_table 11 codon_start 1 locus_tag LOCUS_59710 gene yidC assembly_gap 4937..4946 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5196..5549) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528505.1 transl_table 11 codon_start 1 locus_tag LOCUS_59720 gene rnpA CDS complement(5566..5700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59730 sequence232 source 1..7076 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 312..1199 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531035.1 transl_table 11 codon_start 1 locus_tag LOCUS_59740 gene serB CDS 1196..1786 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531034.1 transl_table 11 codon_start 1 locus_tag LOCUS_59750 CDS complement(1815..3410) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531033.1 transl_table 11 codon_start 1 locus_tag LOCUS_59760 CDS complement(3531..3989) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532633.1 transl_table 11 codon_start 1 locus_tag LOCUS_59770 CDS complement(3986..5977) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532634.1 transl_table 11 codon_start 1 locus_tag LOCUS_59780 CDS complement(5977..6420) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532635.1 transl_table 11 codon_start 1 locus_tag LOCUS_59790 gene ccmE misc_feature complement(6424..>7076) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532636.1:c-type cytochrome biogenesis protein CcmI locus_tag LOCUS_59800 sequence233 source 1..6925 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1185 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530844.1:VWA domain-containing protein locus_tag LOCUS_59810 CDS 1185..2072 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173724.1 transl_table 11 codon_start 1 locus_tag LOCUS_59820 CDS complement(2184..3632) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530836.1 transl_table 11 codon_start 1 locus_tag LOCUS_59830 CDS 3745..4746 product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222366.1 transl_table 11 codon_start 1 locus_tag LOCUS_59840 CDS 4818..6224 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530835.1 transl_table 11 codon_start 1 locus_tag LOCUS_59850 misc_feature complement(6300..>6925) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530808.1:ABC transporter ATP-binding protein locus_tag LOCUS_59860 sequence234 source 1..6912 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(861..1592) product DUF2270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530519.1 transl_table 11 codon_start 1 locus_tag LOCUS_59870 CDS complement(1705..2571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59880 note possible pseudo, frameshifted CDS complement(2565..2963) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529998.1 transl_table 11 codon_start 1 locus_tag LOCUS_59890 CDS 3090..3932 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529999.1 transl_table 11 codon_start 1 locus_tag LOCUS_59900 CDS complement(3996..4745) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974643.1 transl_table 11 codon_start 1 locus_tag LOCUS_59910 CDS complement(4959..6203) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170320.1 transl_table 11 codon_start 1 locus_tag LOCUS_59920 sequence235 source 1..6809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(29..1156) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243182.1 transl_table 11 codon_start 1 locus_tag LOCUS_59930 CDS 1447..2148 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162273439.1 transl_table 11 codon_start 1 locus_tag LOCUS_59940 CDS complement(2126..2938) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528931.1 transl_table 11 codon_start 1 locus_tag LOCUS_59950 CDS 3050..4186 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528932.1 transl_table 11 codon_start 1 locus_tag LOCUS_59960 CDS 4167..5330 product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528933.1 transl_table 11 codon_start 1 locus_tag LOCUS_59970 CDS 5327..6271 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528934.1 transl_table 11 codon_start 1 locus_tag LOCUS_59980 sequence236 source 1..6757 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(612..2000) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299062.1 transl_table 11 codon_start 1 locus_tag LOCUS_59990 CDS complement(2184..2858) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531278.1 transl_table 11 codon_start 1 locus_tag LOCUS_60000 tRNA complement(2951..3024) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS complement(3179..3436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503836.1 transl_table 11 codon_start 1 locus_tag LOCUS_60010 tRNA 3653..3727 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 4213..4392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60020 CDS 4541..4708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60030 CDS 4860..5039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60040 CDS 5220..5648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60050 CDS complement(5655..6110) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090535.1 transl_table 11 codon_start 1 locus_tag LOCUS_60060 sequence237 source 1..6701 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 217..226 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 501..1040 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528490.1 transl_table 11 codon_start 1 locus_tag LOCUS_60070 CDS 1037..1741 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528491.1 transl_table 11 codon_start 1 locus_tag LOCUS_60080 CDS 1967..2524 product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528492.1 transl_table 11 codon_start 1 locus_tag LOCUS_60090 CDS 2729..3232 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528493.1 transl_table 11 codon_start 1 locus_tag LOCUS_60100 gene msrB CDS complement(3241..3729) product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920736.1 transl_table 11 codon_start 1 locus_tag LOCUS_60110 CDS complement(3729..5009) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920737.1 transl_table 11 codon_start 1 locus_tag LOCUS_60120 CDS complement(5187..6632) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528494.1 transl_table 11 codon_start 1 locus_tag LOCUS_60130 assembly_gap 6471..6480 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence238 source 1..6671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(700..1725) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 transl_table 11 codon_start 1 locus_tag LOCUS_60140 CDS 4154..4369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60150 note possible pseudo, internal stop codon CDS 4409..5020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60160 note possible pseudo, internal stop codon, frameshifted assembly_gap 5329..5338 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5352..6251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60170 note possible pseudo, frameshifted sequence239 source 1..6654 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 404..1510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60180 CDS complement(1518..2906) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532272.1 transl_table 11 codon_start 1 locus_tag LOCUS_60190 gene sthA CDS 3095..3565 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532273.1 transl_table 11 codon_start 1 locus_tag LOCUS_60200 CDS 3705..4469 product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532274.1 transl_table 11 codon_start 1 locus_tag LOCUS_60210 CDS 4572..5552 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532275.1 transl_table 11 codon_start 1 locus_tag LOCUS_60220 misc_feature complement(5540..>6654) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532277.1:AI-2E family transporter locus_tag LOCUS_60230 sequence240 source 1..6649 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 374..1486 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531324.1 transl_table 11 codon_start 1 locus_tag LOCUS_60240 CDS 1595..2776 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531323.1 transl_table 11 codon_start 1 locus_tag LOCUS_60250 CDS complement(2795..4612) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531322.1 transl_table 11 codon_start 1 locus_tag LOCUS_60260 gene ade CDS 4761..5612 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531321.1 transl_table 11 codon_start 1 locus_tag LOCUS_60270 CDS 5666..5878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60280 CDS 5970..6617 product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531320.1 transl_table 11 codon_start 1 locus_tag LOCUS_60290 sequence241 source 1..6633 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 228..1151 product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970456.1 transl_table 11 codon_start 1 locus_tag LOCUS_60300 CDS 1176..1529 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970455.1 transl_table 11 codon_start 1 locus_tag LOCUS_60310 CDS 1673..2575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60320 note possible pseudo, frameshifted assembly_gap 2436..2445 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2590..3141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60330 note possible pseudo, frameshifted CDS 3224..4195 product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066869097.1 transl_table 11 codon_start 1 locus_tag LOCUS_60340 CDS 4213..5670 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027998733.1 transl_table 11 codon_start 1 locus_tag LOCUS_60350 misc_feature complement(5736..>6633) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064240990.1:FAD-binding oxidoreductase locus_tag LOCUS_60360 sequence242 source 1..6617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 298..615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60370 note possible pseudo, frameshifted CDS 612..944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974796.1 transl_table 11 codon_start 1 locus_tag LOCUS_60380 CDS 1422..2009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974366.1 transl_table 11 codon_start 1 locus_tag LOCUS_60390 CDS complement(2094..2567) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252921.1 transl_table 11 codon_start 1 locus_tag LOCUS_60400 CDS complement(2564..2995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60410 CDS 3083..3295 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167484192.1 transl_table 11 codon_start 1 locus_tag LOCUS_60420 CDS complement(3858..4043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60430 CDS complement(4271..4588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60440 assembly_gap 4804..4813 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4942..5868 product ArdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974367.1 transl_table 11 codon_start 1 locus_tag LOCUS_60450 CDS complement(5885..6061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60460 sequence243 source 1..6534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(198..1316) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532116.1 transl_table 11 codon_start 1 locus_tag LOCUS_60470 CDS 1446..1940 product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532115.1 transl_table 11 codon_start 1 locus_tag LOCUS_60480 CDS 1972..2901 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532114.1 transl_table 11 codon_start 1 locus_tag LOCUS_60490 CDS 2906..4156 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532113.1 transl_table 11 codon_start 1 locus_tag LOCUS_60500 CDS 4226..4621 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031693.1 transl_table 11 codon_start 1 locus_tag LOCUS_60510 CDS 4676..5014 product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532112.1 transl_table 11 codon_start 1 locus_tag LOCUS_60520 CDS 5080..5784 product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532111.1 transl_table 11 codon_start 1 locus_tag LOCUS_60530 sequence244 source 1..6481 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530881.1:translocation/assembly module TamB domain-containing protein note possible pseudo, frameshifted locus_tag LOCUS_60540 assembly_gap 699..708 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 827..967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60550 note possible pseudo, frameshifted CDS 1240..2892 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530882.1 transl_table 11 codon_start 1 locus_tag LOCUS_60560 CDS 3117..4151 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530883.1 transl_table 11 codon_start 1 locus_tag LOCUS_60570 CDS 4164..5321 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530884.1 transl_table 11 codon_start 1 locus_tag LOCUS_60580 sequence245 source 1..6462 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088688.1:caspase family protein locus_tag LOCUS_60590 CDS 3014..3562 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531226.1 transl_table 11 codon_start 1 locus_tag LOCUS_60600 tRNA 3854..3929 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 4286..5428 product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531225.1 transl_table 11 codon_start 1 locus_tag LOCUS_60610 CDS 5605..5886 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909964.1 transl_table 11 codon_start 1 locus_tag LOCUS_60620 sequence246 source 1..6317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 250..1254 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528683.1 transl_table 11 codon_start 1 locus_tag LOCUS_60630 CDS complement(1422..2156) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528688.1 transl_table 11 codon_start 1 locus_tag LOCUS_60640 gene msrA CDS complement(2238..2564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60650 CDS complement(2648..3355) product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528690.1 transl_table 11 codon_start 1 locus_tag LOCUS_60660 CDS complement(3484..4548) product Tad domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525006.1 transl_table 11 codon_start 1 locus_tag LOCUS_60670 CDS 4849..6261 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528744.1 transl_table 11 codon_start 1 locus_tag LOCUS_60680 gene lpdA sequence247 source 1..6279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1774..2025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60690 CDS 2066..2236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60700 CDS complement(2301..3173) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532353.1 transl_table 11 codon_start 1 locus_tag LOCUS_60710 CDS complement(3200..4519) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532354.1 transl_table 11 codon_start 1 locus_tag LOCUS_60720 CDS complement(4597..5952) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532355.1 transl_table 11 codon_start 1 locus_tag LOCUS_60730 sequence248 source 1..6193 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(148..1797) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532331.1 transl_table 11 codon_start 1 locus_tag LOCUS_60740 CDS complement(1839..3389) product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532332.1 transl_table 11 codon_start 1 locus_tag LOCUS_60750 CDS 3481..4383 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532333.1 transl_table 11 codon_start 1 locus_tag LOCUS_60760 sequence249 source 1..6050 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 917..926 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 937..1713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60770 note possible pseudo, frameshifted CDS complement(1744..2028) product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525351.1 transl_table 11 codon_start 1 locus_tag LOCUS_60780 CDS 2198..4309 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528580.1 transl_table 11 codon_start 1 locus_tag LOCUS_60790 CDS 4311..4526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60800 CDS 4556..5203 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528525.1 transl_table 11 codon_start 1 locus_tag LOCUS_60810 sequence250 source 1..5968 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..706 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525274.1:FAD-binding oxidoreductase locus_tag LOCUS_60820 CDS 729..1322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60830 CDS 1307..1612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60840 CDS 1721..2758 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965528.1 transl_table 11 codon_start 1 locus_tag LOCUS_60850 CDS 2854..3669 product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640300.1 transl_table 11 codon_start 1 locus_tag LOCUS_60860 CDS 3682..4293 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209604823.1 transl_table 11 codon_start 1 locus_tag LOCUS_60870 CDS complement(4373..4855) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525198.1 transl_table 11 codon_start 1 locus_tag LOCUS_60880 CDS complement(4855..5103) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173989.1 transl_table 11 codon_start 1 locus_tag LOCUS_60890 tRNA complement(5633..5709) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 sequence251 source 1..5927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..694 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531286.1:exodeoxyribonuclease III locus_tag LOCUS_60900 CDS 774..1067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531285.1 transl_table 11 codon_start 1 locus_tag LOCUS_60910 CDS complement(1099..1842) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531284.1 transl_table 11 codon_start 1 locus_tag LOCUS_60920 CDS complement(1910..3634) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531283.1 transl_table 11 codon_start 1 locus_tag LOCUS_60930 gene ilvD CDS complement(3936..5201) product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531282.1 transl_table 11 codon_start 1 locus_tag LOCUS_60940 sequence252 source 1..5793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(139..771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60950 note possible pseudo, frameshifted assembly_gap 208..217 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(829..2274) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528554.1 transl_table 11 codon_start 1 locus_tag LOCUS_60960 CDS 2450..3214 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528553.1 transl_table 11 codon_start 1 locus_tag LOCUS_60970 CDS 3244..4497 product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528552.1 transl_table 11 codon_start 1 locus_tag LOCUS_60980 CDS 4494..5189 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528551.1 transl_table 11 codon_start 1 locus_tag LOCUS_60990 sequence253 source 1..5678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1379..2557 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019995458.1 transl_table 11 codon_start 1 locus_tag LOCUS_61000 CDS 2554..3609 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188909205.1 transl_table 11 codon_start 1 locus_tag LOCUS_61010 CDS 3618..4904 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626293.1 transl_table 11 codon_start 1 locus_tag LOCUS_61020 assembly_gap 3698..3707 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence254 source 1..5663 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..641 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531011.1:AsmA family protein locus_tag LOCUS_61030 CDS complement(638..868) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531014.1 transl_table 11 codon_start 1 locus_tag LOCUS_61040 CDS complement(878..1075) product DUF4169 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531015.1 transl_table 11 codon_start 1 locus_tag LOCUS_61050 CDS complement(1094..1660) product SspB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531016.1 transl_table 11 codon_start 1 locus_tag LOCUS_61060 CDS complement(1747..2436) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531017.1 transl_table 11 codon_start 1 locus_tag LOCUS_61070 CDS 2621..3826 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531018.1 transl_table 11 codon_start 1 locus_tag LOCUS_61080 CDS 4532..4843 product DUF2853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531020.1 transl_table 11 codon_start 1 locus_tag LOCUS_61090 sequence255 source 1..5608 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..967 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528208.1:indolepyruvate ferredoxin oxidoreductase family protein locus_tag LOCUS_61100 CDS 1060..3375 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528207.1 transl_table 11 codon_start 1 locus_tag LOCUS_61110 CDS 3609..4295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528206.1 transl_table 11 codon_start 1 locus_tag LOCUS_61120 CDS 4356..4616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61130 CDS 4747..4971 product aa3-type cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528204.1 transl_table 11 codon_start 1 locus_tag LOCUS_61140 sequence256 source 1..5467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(636..1358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61150 assembly_gap 1436..1445 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1892..1901 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2270..3088) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529586.1 transl_table 11 codon_start 1 locus_tag LOCUS_61160 gene lptB CDS complement(3088..3672) product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529585.1 transl_table 11 codon_start 1 locus_tag LOCUS_61170 CDS complement(3659..4372) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529584.1 transl_table 11 codon_start 1 locus_tag LOCUS_61180 gene lptC sequence257 source 1..5466 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..1128) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449629.1 transl_table 11 codon_start 1 locus_tag LOCUS_61190 CDS 1513..2619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61200 CDS complement(2708..3415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61210 CDS complement(3412..3786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61220 sequence258 source 1..5451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(748..2586) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173037.1 transl_table 11 codon_start 1 locus_tag LOCUS_61230 CDS 2766..4256 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529737.1 transl_table 11 codon_start 1 locus_tag LOCUS_61240 sequence259 source 1..5396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1046..1672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61250 note possible pseudo, frameshifted CDS complement(1558..1959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61260 note possible pseudo, frameshifted assembly_gap 1750..1759 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1956..3110) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528621.1 transl_table 11 codon_start 1 locus_tag LOCUS_61270 gene queG CDS complement(3091..3849) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528622.1 transl_table 11 codon_start 1 locus_tag LOCUS_61280 CDS 3938..4744 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528623.1 transl_table 11 codon_start 1 locus_tag LOCUS_61290 CDS complement(4750..5127) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210328395.1 transl_table 11 codon_start 1 locus_tag LOCUS_61300 assembly_gap 5145..5154 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence260 source 1..5366 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 329..3607 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528776.1 transl_table 11 codon_start 1 locus_tag LOCUS_61310 CDS complement(3752..3994) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528775.1 transl_table 11 codon_start 1 locus_tag LOCUS_61320 CDS complement(4164..4835) product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528774.1 transl_table 11 codon_start 1 locus_tag LOCUS_61330 sequence261 source 1..5353 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1314 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976308.1:dicarboxylate/amino acid:cation symporter locus_tag LOCUS_61340 CDS 1450..2031 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530566.1 transl_table 11 codon_start 1 locus_tag LOCUS_61350 CDS complement(2196..2954) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530568.1 transl_table 11 codon_start 1 locus_tag LOCUS_61360 CDS 3160..4077 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533593.1 transl_table 11 codon_start 1 locus_tag LOCUS_61370 assembly_gap 4895..4904 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence262 source 1..5312 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1061..2230) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530677.1 transl_table 11 codon_start 1 locus_tag LOCUS_61380 CDS complement(2871..3872) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173331.1 transl_table 11 codon_start 1 locus_tag LOCUS_61390 CDS complement(3872..4132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61400 CDS 4244..4588 product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525103.1 transl_table 11 codon_start 1 locus_tag LOCUS_61410 sequence263 source 1..5278 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 400..852 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532358.1 transl_table 11 codon_start 1 locus_tag LOCUS_61420 CDS complement(934..1704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532359.1 transl_table 11 codon_start 1 locus_tag LOCUS_61430 CDS complement(1858..4833) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532360.1 transl_table 11 codon_start 1 locus_tag LOCUS_61440 gene ileS sequence264 source 1..5263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 40..654 product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 transl_table 11 codon_start 1 locus_tag LOCUS_61450 gene metW CDS 651..1427 product Stf0 family sulphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969658.1 transl_table 11 codon_start 1 locus_tag LOCUS_61460 CDS 1551..2543 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529384.1 transl_table 11 codon_start 1 locus_tag LOCUS_61470 CDS 2721..3656 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529382.1 transl_table 11 codon_start 1 locus_tag LOCUS_61480 CDS complement(3785..4585) product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173807.1 transl_table 11 codon_start 1 locus_tag LOCUS_61490 misc_feature complement(4752..>5263) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529380.1:ABC transporter ATP-binding protein/permease locus_tag LOCUS_61500 sequence265 source 1..5185 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 499..1596 product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528805.1 transl_table 11 codon_start 1 locus_tag LOCUS_61510 CDS 1661..2269 product DUF1236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528804.1 transl_table 11 codon_start 1 locus_tag LOCUS_61520 CDS 2435..3403 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528803.1 transl_table 11 codon_start 1 locus_tag LOCUS_61530 CDS 3403..4344 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759755.1 transl_table 11 codon_start 1 locus_tag LOCUS_61540 sequence266 source 1..5181 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(300..1109) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 transl_table 11 codon_start 1 locus_tag LOCUS_61550 gene speB CDS complement(1200..3320) product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532465.1 transl_table 11 codon_start 1 locus_tag LOCUS_61560 CDS complement(3532..4674) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900904.1 transl_table 11 codon_start 1 locus_tag LOCUS_61570 sequence267 source 1..5061 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1021 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532632.1:Do family serine endopeptidase locus_tag LOCUS_61580 assembly_gap 868..877 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1018..1692 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023812818.1 transl_table 11 codon_start 1 locus_tag LOCUS_61590 CDS 1701..3176 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532630.1 transl_table 11 codon_start 1 locus_tag LOCUS_61600 CDS 3176..4051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61610 note possible pseudo, frameshifted assembly_gap 3996..4005 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence268 source 1..5044 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1035..2273) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653868.1 transl_table 11 codon_start 1 locus_tag LOCUS_61620 CDS complement(2453..3583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61630 assembly_gap 3606..3615 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence269 source 1..5030 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1425..3725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61640 note possible pseudo, frameshifted misc_feature complement(3712..>5030) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530879.1:alpha-2-macroglobulin family protein note possible pseudo, frameshifted locus_tag LOCUS_61650 sequence270 source 1..5012 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 506..1534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61660 CDS complement(1559..1873) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531236.1 transl_table 11 codon_start 1 locus_tag LOCUS_61670 CDS complement(1908..2951) product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173706.1 transl_table 11 codon_start 1 locus_tag LOCUS_61680 CDS complement(2992..3420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531238.1 transl_table 11 codon_start 1 locus_tag LOCUS_61690 misc_feature complement(3426..>5012) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531239.1:TonB-dependent hemoglobin/transferrin/lactoferrin family receptor locus_tag LOCUS_61700 sequence271 source 1..4925 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(348..1574) product DUF459 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529720.1 transl_table 11 codon_start 1 locus_tag LOCUS_61710 CDS complement(1601..2824) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529721.1 transl_table 11 codon_start 1 locus_tag LOCUS_61720 CDS 3035..3940 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529722.1 transl_table 11 codon_start 1 locus_tag LOCUS_61730 gene galU misc_feature complement(3987..>4925) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063173044.1:outer membrane beta-barrel protein locus_tag LOCUS_61740 sequence272 source 1..4894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 124..1188 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529728.1 transl_table 11 codon_start 1 locus_tag LOCUS_61750 gene hemH CDS 1326..2273 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529726.1 transl_table 11 codon_start 1 locus_tag LOCUS_61760 CDS 2565..2780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61770 note possible pseudo, frameshifted CDS complement(2933..3934) product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529724.1 transl_table 11 codon_start 1 locus_tag LOCUS_61780 assembly_gap 4629..4638 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence273 source 1..4757 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2346 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975826.1:adenylate/guanylate cyclase domain-containing protein locus_tag LOCUS_61790 CDS complement(2463..3110) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971750.1 transl_table 11 codon_start 1 locus_tag LOCUS_61800 CDS 3311..4204 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992396.1 transl_table 11 codon_start 1 locus_tag LOCUS_61810 CDS 4360..4647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61820 sequence274 source 1..4715 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530934.1:methylenetetrahydrofolate reductase [NAD(P)H] locus_tag LOCUS_61830 CDS complement(1218..2138) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530935.1 transl_table 11 codon_start 1 locus_tag LOCUS_61840 CDS 2358..3578 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530936.1 transl_table 11 codon_start 1 locus_tag LOCUS_61850 CDS complement(3596..3979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61860 misc_feature complement(4010..>4715) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530937.1:lytic murein transglycosylase locus_tag LOCUS_61870 sequence275 source 1..4660 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(915..1574) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531300.1 transl_table 11 codon_start 1 locus_tag LOCUS_61880 CDS complement(1571..2329) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531299.1 transl_table 11 codon_start 1 locus_tag LOCUS_61890 gene surE CDS complement(2329..3633) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531298.1 transl_table 11 codon_start 1 locus_tag LOCUS_61900 gene serS CDS complement(3730..4605) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531297.1 transl_table 11 codon_start 1 locus_tag LOCUS_61910 gene tatC sequence276 source 1..4658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 259..1572 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532252.1 transl_table 11 codon_start 1 locus_tag LOCUS_61920 CDS 1655..2281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171896.1 transl_table 11 codon_start 1 locus_tag LOCUS_61930 CDS 2303..2632 product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170280.1 transl_table 11 codon_start 1 locus_tag LOCUS_61940 CDS 2718..3197 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532250.1 transl_table 11 codon_start 1 locus_tag LOCUS_61950 gene nrdR CDS 3200..4327 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532249.1 transl_table 11 codon_start 1 locus_tag LOCUS_61960 gene ribD sequence277 source 1..4589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1155..3044) product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529248.1 transl_table 11 codon_start 1 locus_tag LOCUS_61970 CDS complement(3253..4263) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529249.1 transl_table 11 codon_start 1 locus_tag LOCUS_61980 gene gap sequence278 source 1..4549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 64..549 product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530198.1 transl_table 11 codon_start 1 locus_tag LOCUS_61990 CDS 592..1002 product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530197.1 transl_table 11 codon_start 1 locus_tag LOCUS_62000 CDS 1200..1418 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006200926.1 transl_table 11 codon_start 1 locus_tag LOCUS_62010 gene infA CDS 1438..2064 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530196.1 transl_table 11 codon_start 1 locus_tag LOCUS_62020 CDS 2061..2279 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530195.1 transl_table 11 codon_start 1 locus_tag LOCUS_62030 gene yacG tRNA 2453..2528 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS 2590..3141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62040 CDS complement(3234..3440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62050 note possible pseudo, frameshifted CDS 3612..3809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62060 sequence279 source 1..4467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 303..1277 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530804.1 transl_table 11 codon_start 1 locus_tag LOCUS_62070 CDS 1317..2378 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530805.1 transl_table 11 codon_start 1 locus_tag LOCUS_62080 CDS 2408..3277 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530806.1 transl_table 11 codon_start 1 locus_tag LOCUS_62090 CDS 3277..4065 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530807.1 transl_table 11 codon_start 1 locus_tag LOCUS_62100 sequence280 source 1..4427 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1105..1710 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532373.1 transl_table 11 codon_start 1 locus_tag LOCUS_62110 CDS 1707..3518 product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564966.1 transl_table 11 codon_start 1 locus_tag LOCUS_62120 sequence281 source 1..4396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(201..1457) product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533665.1 transl_table 11 codon_start 1 locus_tag LOCUS_62130 CDS complement(1623..2423) product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533664.1 transl_table 11 codon_start 1 locus_tag LOCUS_62140 assembly_gap 2377..2386 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2423..3346) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533663.1 transl_table 11 codon_start 1 locus_tag LOCUS_62150 misc_feature complement(3539..>4396) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533662.1:peptidoglycan-binding protein locus_tag LOCUS_62160 sequence282 source 1..4392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(483..3413) product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171192.1 transl_table 11 codon_start 1 locus_tag LOCUS_62170 sequence283 source 1..4301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 441..1325 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529788.1 transl_table 11 codon_start 1 locus_tag LOCUS_62180 CDS 1458..3269 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529786.1 transl_table 11 codon_start 1 locus_tag LOCUS_62190 gene fliF assembly_gap 2976..2985 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3266..3760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529785.1 transl_table 11 codon_start 1 locus_tag LOCUS_62200 sequence284 source 1..4289 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 823..2781 product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530253.1 transl_table 11 codon_start 1 locus_tag LOCUS_62210 misc_feature complement(3031..>4289) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530254.1:PAS domain S-box protein locus_tag LOCUS_62220 sequence285 source 1..4129 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..826 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064243181.1:ABC transporter permease locus_tag LOCUS_62230 CDS 826..1752 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243444.1 transl_table 11 codon_start 1 locus_tag LOCUS_62240 CDS 1790..2491 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606634.1 transl_table 11 codon_start 1 locus_tag LOCUS_62250 CDS 2502..4034 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243179.1 transl_table 11 codon_start 1 locus_tag LOCUS_62260 sequence286 source 1..4095 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1104..1580) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123150961.1 transl_table 11 codon_start 1 locus_tag LOCUS_62270 sequence287 source 1..4078 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(467..1207) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533369.1 transl_table 11 codon_start 1 locus_tag LOCUS_62280 CDS 2697..3431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62290 note possible pseudo, frameshifted CDS 3454..3897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62300 note possible pseudo, frameshifted sequence288 source 1..4036 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(98..1414) product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528743.1 transl_table 11 codon_start 1 locus_tag LOCUS_62310 CDS complement(1429..2442) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528742.1 transl_table 11 codon_start 1 locus_tag LOCUS_62320 CDS complement(2445..3677) product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528741.1 transl_table 11 codon_start 1 locus_tag LOCUS_62330 sequence289 source 1..3999 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1825..2097 product DUF4164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529251.1 transl_table 11 codon_start 1 locus_tag LOCUS_62340 CDS 2102..2467 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529252.1 transl_table 11 codon_start 1 locus_tag LOCUS_62350 CDS 2640..3299 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529253.1 transl_table 11 codon_start 1 locus_tag LOCUS_62360 CDS 3493..3885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62370 sequence290 source 1..3976 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(16..261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62380 CDS 516..980 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532958.1 transl_table 11 codon_start 1 locus_tag LOCUS_62390 CDS complement(1115..1732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62400 note possible pseudo, frameshifted assembly_gap 1140..1149 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1964..2764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62410 CDS complement(2817..3743) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532583.1 transl_table 11 codon_start 1 locus_tag LOCUS_62420 gene era sequence291 source 1..3861 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3055 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531086.1:cobaltochelatase subunit CobN locus_tag LOCUS_62430 sequence292 source 1..3752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(327..1853) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531813.1 transl_table 11 codon_start 1 locus_tag LOCUS_62440 gene glpD CDS complement(1981..2748) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531814.1 transl_table 11 codon_start 1 locus_tag LOCUS_62450 CDS complement(2871..3473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62460 note possible pseudo, frameshifted assembly_gap 3515..3524 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence293 source 1..3741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(153..1454) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528950.1 transl_table 11 codon_start 1 locus_tag LOCUS_62470 CDS complement(1457..2842) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528949.1 transl_table 11 codon_start 1 locus_tag LOCUS_62480 misc_feature complement(2847..>3741) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528948.1:glycosyltransferase locus_tag LOCUS_62490 sequence294 source 1..3642 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(48..971) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528945.1 transl_table 11 codon_start 1 locus_tag LOCUS_62500 CDS complement(992..2053) product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528946.1 transl_table 11 codon_start 1 locus_tag LOCUS_62510 CDS 2286..3224 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528947.1 transl_table 11 codon_start 1 locus_tag LOCUS_62520 sequence295 source 1..3638 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(502..2259) product YaiO family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525348.1 transl_table 11 codon_start 1 locus_tag LOCUS_62530 CDS complement(2259..2717) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525347.1 transl_table 11 codon_start 1 locus_tag LOCUS_62540 CDS complement(2914..3294) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082826795.1 transl_table 11 codon_start 1 locus_tag LOCUS_62550 sequence296 source 1..3586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(241..1374) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883950.1 transl_table 11 codon_start 1 locus_tag LOCUS_62560 gene menC CDS complement(2629..2751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62570 sequence297 source 1..3577 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..954 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533602.1:ABC transporter permease locus_tag LOCUS_62580 CDS 954..1268 product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533603.1 transl_table 11 codon_start 1 locus_tag LOCUS_62590 gene rhaM CDS 1265..2635 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533604.1 transl_table 11 codon_start 1 locus_tag LOCUS_62600 sequence298 source 1..3567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(129..1232) product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531080.1 transl_table 11 codon_start 1 locus_tag LOCUS_62610 note possible pseudo, frameshifted assembly_gap 267..276 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1234..2001 product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531081.1 transl_table 11 codon_start 1 locus_tag LOCUS_62620 CDS complement(1965..2729) product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531082.1 transl_table 11 codon_start 1 locus_tag LOCUS_62630 CDS complement(2726..3475) product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531083.1 transl_table 11 codon_start 1 locus_tag LOCUS_62640 sequence299 source 1..3544 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 7..2556 product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532578.1 transl_table 11 codon_start 1 locus_tag LOCUS_62650 CDS 2698..3216 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532577.1 transl_table 11 codon_start 1 locus_tag LOCUS_62660 sequence300 source 1..3514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(55..1143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62670 note possible pseudo, frameshifted assembly_gap 1160..1169 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1220..1693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62680 CDS 1766..2173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62690 CDS 2417..2728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62700 misc_feature complement(2825..>3514) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089034.1:heparin lyase I family protein locus_tag LOCUS_62710 sequence301 source 1..3483 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1124..1843) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528337.1 transl_table 11 codon_start 1 locus_tag LOCUS_62720 sequence302 source 1..3472 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(446..649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530681.1 transl_table 11 codon_start 1 locus_tag LOCUS_62730 assembly_gap 855..864 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1657..2379 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530679.1 transl_table 11 codon_start 1 locus_tag LOCUS_62740 sequence303 source 1..3442 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(110..331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62750 CDS complement(328..1101) product IS21-like element ISMac3 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021079.1 transl_table 11 codon_start 1 locus_tag LOCUS_62760 gene istB CDS complement(1094..2170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62770 note possible pseudo, frameshifted CDS complement(2170..2589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62780 sequence304 source 1..3440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1190..1636 product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530173.1 transl_table 11 codon_start 1 locus_tag LOCUS_62790 CDS 1858..2241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530174.1 transl_table 11 codon_start 1 locus_tag LOCUS_62800 CDS complement(2423..3142) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530175.1 transl_table 11 codon_start 1 locus_tag LOCUS_62810 tRNA 3276..3351 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 sequence305 source 1..3379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(772..1707) product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577656.1 transl_table 11 codon_start 1 locus_tag LOCUS_62820 CDS complement(2015..2815) product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532085.1 transl_table 11 codon_start 1 locus_tag LOCUS_62830 CDS 2980..3315 product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532137.1 transl_table 11 codon_start 1 locus_tag LOCUS_62840 gene grxD sequence306 source 1..3351 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 2872..2881 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence307 source 1..3350 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(821..2416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62850 note possible pseudo, frameshifted assembly_gap 1251..1260 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2623..3102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528209.1 transl_table 11 codon_start 1 locus_tag LOCUS_62860 CDS 3124..3285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62870 sequence308 source 1..3322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1066..1674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530003.1 transl_table 11 codon_start 1 locus_tag LOCUS_62880 CDS complement(1729..2880) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530004.1 transl_table 11 codon_start 1 locus_tag LOCUS_62890 sequence309 source 1..3307 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..968 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530172.1:OmpA family protein locus_tag LOCUS_62900 assembly_gap 1162..1171 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1256..1771 product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530171.1 transl_table 11 codon_start 1 locus_tag LOCUS_62910 CDS complement(1790..2656) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530170.1 transl_table 11 codon_start 1 locus_tag LOCUS_62920 sequence310 source 1..3292 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 259..2670 product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528921.1 transl_table 11 codon_start 1 locus_tag LOCUS_62930 sequence311 source 1..3196 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 115..990 product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504050.1 transl_table 11 codon_start 1 locus_tag LOCUS_62940 CDS 1033..1239 product DUF1737 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528780.1 transl_table 11 codon_start 1 locus_tag LOCUS_62950 CDS complement(1329..1760) product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528779.1 transl_table 11 codon_start 1 locus_tag LOCUS_62960 CDS 1898..2530 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400784.1 transl_table 11 codon_start 1 locus_tag LOCUS_62970 sequence312 source 1..3186 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(826..2988) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528604.1 transl_table 11 codon_start 1 locus_tag LOCUS_62980 sequence313 source 1..3150 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 214..223 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(381..1520) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527919.1 transl_table 11 codon_start 1 locus_tag LOCUS_62990 CDS 1771..3060 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527918.1 transl_table 11 codon_start 1 locus_tag LOCUS_63000 sequence314 source 1..3148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 62..1312 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532349.1 transl_table 11 codon_start 1 locus_tag LOCUS_63010 CDS 1450..2019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63020 assembly_gap 1713..1722 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2059..2208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63030 CDS complement(2244..2831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63040 assembly_gap 2875..2884 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence315 source 1..3098 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 538..1230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63050 CDS 1534..1962 product DUF1636 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531088.1 transl_table 11 codon_start 1 locus_tag LOCUS_63060 CDS 1965..2936 product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531087.1 transl_table 11 codon_start 1 locus_tag LOCUS_63070 gene cobW assembly_gap 2838..2847 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence316 source 1..3030 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 313..1860 product DUF4173 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528782.1 transl_table 11 codon_start 1 locus_tag LOCUS_63080 CDS 1864..2556 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528783.1 transl_table 11 codon_start 1 locus_tag LOCUS_63090 sequence317 source 1..3028 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(582..1373) product tail fiber domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531595.1 transl_table 11 codon_start 1 locus_tag LOCUS_63100 CDS complement(1378..1839) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167391323.1 transl_table 11 codon_start 1 locus_tag LOCUS_63110 sequence318 source 1..2971 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(144..368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63120 CDS complement(665..1816) product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532712.1 transl_table 11 codon_start 1 locus_tag LOCUS_63130 misc_feature complement(2160..>2971) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056091.1:asparagine synthase (glutamine-hydrolyzing) locus_tag LOCUS_63140 sequence319 source 1..2962 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1408..2184) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529379.1 transl_table 11 codon_start 1 locus_tag LOCUS_63150 sequence320 source 1..2952 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(386..1231) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528056.1 transl_table 11 codon_start 1 locus_tag LOCUS_63160 CDS complement(1325..1717) product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528057.1 transl_table 11 codon_start 1 locus_tag LOCUS_63170 CDS complement(1762..2877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63180 sequence321 source 1..2856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 482..491 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 532..753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63190 note possible pseudo, frameshifted CDS 755..2356 product cisplatin damage response ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527948.1 transl_table 11 codon_start 1 locus_tag LOCUS_63200 sequence322 source 1..2855 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 631..1218 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531936.1 transl_table 11 codon_start 1 locus_tag LOCUS_63210 CDS 1300..2841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531935.1 transl_table 11 codon_start 1 locus_tag LOCUS_63220 sequence323 source 1..2834 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(993..1643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63230 note possible pseudo, frameshifted CDS complement(1660..2082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63240 note possible pseudo, frameshifted sequence324 source 1..2825 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 49..405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63250 CDS 562..1272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533431.1 transl_table 11 codon_start 1 locus_tag LOCUS_63260 CDS 1640..1960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63270 note possible pseudo, frameshifted CDS 1938..2141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63280 note possible pseudo, frameshifted CDS 2175..2747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63290 note possible pseudo, frameshifted sequence325 source 1..2823 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 587..1726 product acetyl-CoA carboxylase biotin carboxylase subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082908189.1 transl_table 11 codon_start 1 locus_tag LOCUS_63300 CDS 2039..2686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63310 note possible pseudo, frameshifted sequence326 source 1..2738 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_138390505.1:tyrosine-type recombinase/integrase locus_tag LOCUS_63320 CDS 584..1159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63330 note possible pseudo, frameshifted CDS 1156..1644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63340 note possible pseudo, frameshifted CDS 2395..2571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63350 sequence327 source 1..2717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1075..1791 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528496.1 transl_table 11 codon_start 1 locus_tag LOCUS_63360 sequence328 source 1..2703 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence329 source 1..2659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 589..831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531069.1 transl_table 11 codon_start 1 locus_tag LOCUS_63370 CDS complement(859..1332) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971051.1 transl_table 11 codon_start 1 locus_tag LOCUS_63380 CDS 1480..2550 product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971052.1 transl_table 11 codon_start 1 locus_tag LOCUS_63390 sequence330 source 1..2626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(733..1773) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532176.1 transl_table 11 codon_start 1 locus_tag LOCUS_63400 CDS complement(1813..2577) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532175.1 transl_table 11 codon_start 1 locus_tag LOCUS_63410 sequence331 source 1..2545 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1157..1567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63420 note possible pseudo, frameshifted CDS complement(1554..1706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63430 sequence332 source 1..2544 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..899 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528930.1:3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein note possible pseudo, frameshifted locus_tag LOCUS_63440 assembly_gap 773..782 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 829..1278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63450 note possible pseudo, frameshifted CDS 1263..2447 product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528955.1 transl_table 11 codon_start 1 locus_tag LOCUS_63460 sequence333 source 1..2525 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1017..1361) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061711.1 transl_table 11 codon_start 1 locus_tag LOCUS_63470 gene tnpB CDS complement(1358..1600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63480 sequence334 source 1..2426 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence335 source 1..2397 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(145..480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63490 note possible pseudo, frameshifted assembly_gap 286..295 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 727..1230 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531863.1 transl_table 11 codon_start 1 locus_tag LOCUS_63500 assembly_gap 1969..1978 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence336 source 1..2379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..628 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529784.1:MotB family protein locus_tag LOCUS_63510 sequence337 source 1..2373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(181..810) product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170982.1 transl_table 11 codon_start 1 locus_tag LOCUS_63520 gene phnN CDS complement(807..1946) product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528377.1 transl_table 11 codon_start 1 locus_tag LOCUS_63530 sequence338 source 1..2337 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 412..421 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 787..1041 product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531240.1 transl_table 11 codon_start 1 locus_tag LOCUS_63540 gene hemP CDS 1078..2139 product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531241.1 transl_table 11 codon_start 1 locus_tag LOCUS_63550 sequence339 source 1..2323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 444..2072 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529694.1 transl_table 11 codon_start 1 locus_tag LOCUS_63560 sequence340 source 1..2318 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1489 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529406.1:TIGR02302 family protein locus_tag LOCUS_63570 CDS 1518..1892 product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529405.1 transl_table 11 codon_start 1 locus_tag LOCUS_63580 sequence341 source 1..2266 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 419..637 product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530653.1 transl_table 11 codon_start 1 locus_tag LOCUS_63590 CDS complement(760..1683) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528834.1 transl_table 11 codon_start 1 locus_tag LOCUS_63600 sequence342 source 1..2257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..695 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532505.1:leucyl aminopeptidase locus_tag LOCUS_63610 CDS 715..1164 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532504.1 transl_table 11 codon_start 1 locus_tag LOCUS_63620 sequence343 source 1..2214 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(89..382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63630 CDS 494..1360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63640 CDS 1360..2160 product IS21-like element ISSme2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970475.1 transl_table 11 codon_start 1 locus_tag LOCUS_63650 gene istB sequence344 source 1..2063 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1076 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525285.1:serine/threonine-protein kinase locus_tag LOCUS_63660 CDS 1088..1594 product DUF1036 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504491.1 transl_table 11 codon_start 1 locus_tag LOCUS_63670 sequence345 source 1..2028 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1152 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_114715230.1:Xaa-Pro peptidase family protein locus_tag LOCUS_63680 CDS 1211..1966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533431.1 transl_table 11 codon_start 1 locus_tag LOCUS_63690 sequence346 source 1..1921 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(939..1460) product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529160.1 transl_table 11 codon_start 1 locus_tag LOCUS_63700 sequence347 source 1..1889 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(225..1637) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529010.1 transl_table 11 codon_start 1 locus_tag LOCUS_63710 sequence348 source 1..1840 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1080..>1840) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531404.1:elongation factor Tu locus_tag LOCUS_63720 sequence349 source 1..1829 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1028 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528802.1:signal recognition particle protein locus_tag LOCUS_63730 CDS 1036..1362 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528801.1 transl_table 11 codon_start 1 locus_tag LOCUS_63740 CDS 1413..1814 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528800.1 transl_table 11 codon_start 1 locus_tag LOCUS_63750 gene rpsP sequence350 source 1..1764 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence351 source 1..1744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(128..799) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968360.1 transl_table 11 codon_start 1 locus_tag LOCUS_63760 sequence352 source 1..1728 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63770 CDS 264..1031 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532982.1 transl_table 11 codon_start 1 locus_tag LOCUS_63780 sequence353 source 1..1727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(11..349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63790 misc_feature complement(349..>1727) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530880.1:autotransporter assembly complex family protein locus_tag LOCUS_63800 sequence354 source 1..1710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence355 source 1..1691 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 157..1428 product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531223.1 transl_table 11 codon_start 1 locus_tag LOCUS_63810 sequence356 source 1..1682 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63820 CDS 279..743 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529589.1 transl_table 11 codon_start 1 locus_tag LOCUS_63830 gene ptsN CDS complement(814..1071) product DUF1150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529590.1 transl_table 11 codon_start 1 locus_tag LOCUS_63840 CDS complement(1136..1561) product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529591.1 transl_table 11 codon_start 1 locus_tag LOCUS_63850 sequence357 source 1..1649 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 808..1500 product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967409.1 transl_table 11 codon_start 1 locus_tag LOCUS_63860 gene istB sequence358 source 1..1640 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531121.1:adenosylcobinamide-phosphate synthase CbiB locus_tag LOCUS_63870 CDS complement(563..1177) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531120.1 transl_table 11 codon_start 1 locus_tag LOCUS_63880 gene cobO sequence359 source 1..1578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 379..1431 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532920.1 transl_table 11 codon_start 1 locus_tag LOCUS_63890 sequence360 source 1..1533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(144..485) product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528978.1 transl_table 11 codon_start 1 locus_tag LOCUS_63900 CDS complement(482..784) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528977.1 transl_table 11 codon_start 1 locus_tag LOCUS_63910 tRNA 926..1001 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 sequence361 source 1..1443 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(124..651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63920 misc_feature complement(792..>1443) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530743.1:EAL domain-containing protein locus_tag LOCUS_63930 sequence362 source 1..1439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence363 source 1..1396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 694..912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63940 sequence364 source 1..1380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(161..>1380) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941815.1:leukotoxin LktA family filamentous adhesin note possible pseudo, internal stop codon, frameshifted locus_tag LOCUS_63950 assembly_gap 238..247 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence365 source 1..1308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(523..744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63960 sequence366 source 1..1308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(389..1240) product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529334.1 transl_table 11 codon_start 1 locus_tag LOCUS_63970 sequence367 source 1..1305 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 69..1259 product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112131468.1 transl_table 11 codon_start 1 locus_tag LOCUS_63980 sequence368 source 1..1177 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence369 source 1..1159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence370 source 1..1152 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence371 source 1..1129 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(37..966) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095491983.1 transl_table 11 codon_start 1 locus_tag LOCUS_63990 sequence372 source 1..1128 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence373 source 1..1097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970433.1:MFS transporter note possible pseudo, frameshifted locus_tag LOCUS_64000 sequence374 source 1..1046 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..951 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529008.1:NAD-glutamate dehydrogenase locus_tag LOCUS_64010 sequence375 source 1..1006 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 442..849 product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532540.1 transl_table 11 codon_start 1 locus_tag LOCUS_64020 sequence376 source 1..984 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence377 source 1..980 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence378 source 1..974 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence379 source 1..951 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence380 source 1..901 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence381 source 1..878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence382 source 1..859 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(225..>859) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529718.1:glutamate synthase large subunit locus_tag LOCUS_64030 sequence383 source 1..843 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(238..>843) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530006.1:class I SAM-dependent methyltransferase locus_tag LOCUS_64040 sequence384 source 1..830 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(334..675) product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529582.1 transl_table 11 codon_start 1 locus_tag LOCUS_64050 sequence385 source 1..819 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(269..532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64060 note possible pseudo, frameshifted assembly_gap 578..587 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence386 source 1..805 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence387 source 1..774 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 456..546 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 sequence388 source 1..761 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence389 source 1..743 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence390 source 1..737 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence391 source 1..702 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence392 source 1..693 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence393 source 1..679 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence394 source 1..670 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(347..670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64070 sequence395 source 1..610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence396 source 1..571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence397 source 1..520 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence398 source 1..519 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence399 source 1..489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence400 source 1..470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence401 source 1..460 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence402 source 1..456 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence403 source 1..453 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence404 source 1..443 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence405 source 1..433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence406 source 1..420 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence407 source 1..419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence408 source 1..398 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence409 source 1..388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence410 source 1..388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 107..292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64080 note possible pseudo, internal stop codon sequence411 source 1..381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence412 source 1..375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence413 source 1..351 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence414 source 1..342 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence415 source 1..328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence416 source 1..323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence417 source 1..319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence418 source 1..318 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence419 source 1..314 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence420 source 1..303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence421 source 1..301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence422 source 1..299 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence423 source 1..296 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence424 source 1..289 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence425 source 1..280 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence426 source 1..274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence427 source 1..273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence428 source 1..261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence429 source 1..259 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence430 source 1..254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence431 source 1..249 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence432 source 1..249 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence433 source 1..249 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence434 source 1..248 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence435 source 1..243 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence436 source 1..234 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence437 source 1..234 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence438 source 1..231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence439 source 1..228 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence440 source 1..226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence441 source 1..221 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence442 source 1..219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence443 source 1..217 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence444 source 1..213 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence445 source 1..210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence446 source 1..209 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence447 source 1..208 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@