>Feature sequence001 1377 238 gene locus_tag LOCUS_00010 1377 238 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528052.1 protein_id gnl|my_center|LOCUS_00010 2527 1352 gene locus_tag LOCUS_00020 gene metK 2527 1352 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533374.1 protein_id gnl|my_center|LOCUS_00020 3922 2585 gene locus_tag LOCUS_00030 3922 2585 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533373.1 protein_id gnl|my_center|LOCUS_00030 4023 4223 gene locus_tag LOCUS_00040 4023 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4797 4537 gene locus_tag LOCUS_00050 4797 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7172 5361 gene locus_tag LOCUS_00060 gene nopX 7172 5361 CDS product type II secretion system effector nodulation protein NopX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857555.1 protein_id gnl|my_center|LOCUS_00060 8136 7600 gene locus_tag LOCUS_00070 gene nolW 8136 7600 CDS product nodulation protein NolW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032490256.1 protein_id gnl|my_center|LOCUS_00070 8485 8994 gene locus_tag LOCUS_00080 gene nolB 8485 8994 CDS product nodulation protein NolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857557.1 protein_id gnl|my_center|LOCUS_00080 9004 9867 gene locus_tag LOCUS_00090 gene nolT 9004 9867 CDS product nodulation protein NolT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857558.1 protein_id gnl|my_center|LOCUS_00090 10333 10112 gene locus_tag LOCUS_00100 10333 10112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10504 11127 gene locus_tag LOCUS_00110 gene nolV 10504 11127 CDS product nodulation protein NolV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857560.1 protein_id gnl|my_center|LOCUS_00110 11124 12482 gene locus_tag LOCUS_00120 gene sctN 11124 12482 CDS product type III secretion system ATPase SctN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015633405.1 protein_id gnl|my_center|LOCUS_00120 12458 12970 gene locus_tag LOCUS_00130 12458 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857562.1 protein_id gnl|my_center|LOCUS_00130 13060 14088 gene locus_tag LOCUS_00140 gene sctQ 13060 14088 CDS product type III secretion system cytoplasmic ring protein SctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859390.1 protein_id gnl|my_center|LOCUS_00140 14000 14746 gene locus_tag LOCUS_00150 gene sctR 14000 14746 CDS product type III secretion system export apparatus subunit SctR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857564.1 protein_id gnl|my_center|LOCUS_00150 14800 15024 gene locus_tag LOCUS_00160 14800 15024 CDS product EscS/YscS/HrcS family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857565.1 protein_id gnl|my_center|LOCUS_00160 15033 15851 gene locus_tag LOCUS_00170 gene sctT 15033 15851 CDS product type III secretion system export apparatus subunit SctT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859387.1 protein_id gnl|my_center|LOCUS_00170 15848 16885 gene locus_tag LOCUS_00180 15848 16885 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857567.1 protein_id gnl|my_center|LOCUS_00180 17728 18042 gene locus_tag LOCUS_00190 17728 18042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20699 18585 gene locus_tag LOCUS_00200 20699 18585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084516.1 protein_id gnl|my_center|LOCUS_00200 22046 22375 gene locus_tag LOCUS_00210 22046 22375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22442 22690 gene locus_tag LOCUS_00220 22442 22690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22807 23697 gene locus_tag LOCUS_00230 22807 23697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857572.1 protein_id gnl|my_center|LOCUS_00230 23930 25993 gene locus_tag LOCUS_00240 gene sctV 23930 25993 CDS product type III secretion system export apparatus subunit SctV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857573.1 protein_id gnl|my_center|LOCUS_00240 26529 26101 gene locus_tag LOCUS_00250 26529 26101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 27047 27517 gene locus_tag LOCUS_00260 27047 27517 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533377.1 protein_id gnl|my_center|LOCUS_00260 27952 27740 gene locus_tag LOCUS_00270 27952 27740 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008874821.1 protein_id gnl|my_center|LOCUS_00270 29257 29015 gene locus_tag LOCUS_00280 29257 29015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 29642 31654 gene locus_tag LOCUS_00290 29642 31654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 31806 33281 gene locus_tag LOCUS_00300 31806 33281 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533394.1 protein_id gnl|my_center|LOCUS_00300 34583 34068 gene locus_tag LOCUS_00310 34583 34068 CDS product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533396.1 protein_id gnl|my_center|LOCUS_00310 35400 35846 gene locus_tag LOCUS_00320 35400 35846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 36045 36752 gene locus_tag LOCUS_00330 36045 36752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 37076 37252 gene locus_tag LOCUS_00340 37076 37252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 37847 37215 gene locus_tag LOCUS_00350 37847 37215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 38328 37744 gene locus_tag LOCUS_00360 38328 37744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 39026 38328 gene locus_tag LOCUS_00370 39026 38328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00370 39390 39019 gene locus_tag LOCUS_00380 39390 39019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00380 39868 39311 gene locus_tag LOCUS_00390 39868 39311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00390 40516 40241 gene locus_tag LOCUS_00400 40516 40241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 41102 40827 gene locus_tag LOCUS_00410 41102 40827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 42767 41133 gene locus_tag LOCUS_00420 42767 41133 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167540391.1 protein_id gnl|my_center|LOCUS_00420 43157 42813 gene locus_tag LOCUS_00430 gene tnpB 43157 42813 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210315586.1 protein_id gnl|my_center|LOCUS_00430 43549 43154 gene locus_tag LOCUS_00440 43549 43154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 45105 43789 gene locus_tag LOCUS_00450 45105 43789 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533388.1 protein_id gnl|my_center|LOCUS_00450 45433 45095 gene locus_tag LOCUS_00460 45433 45095 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533389.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00460 45864 46022 gene locus_tag LOCUS_00470 45864 46022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 46091 46237 gene locus_tag LOCUS_00480 46091 46237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 46957 46739 gene locus_tag LOCUS_00490 46957 46739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 46898 47239 gene locus_tag LOCUS_00500 46898 47239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 47547 47170 gene locus_tag LOCUS_00510 47547 47170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 47864 47598 gene locus_tag LOCUS_00520 47864 47598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 48087 47836 gene locus_tag LOCUS_00530 48087 47836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 49171 48167 gene locus_tag LOCUS_00540 49171 48167 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397358.1 protein_id gnl|my_center|LOCUS_00540 49161 49367 gene locus_tag LOCUS_00550 49161 49367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00550 50053 50238 gene locus_tag LOCUS_00560 50053 50238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00560 50589 51215 gene locus_tag LOCUS_00570 50589 51215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00570 51485 51751 gene locus_tag LOCUS_00580 51485 51751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00580 52082 52492 gene locus_tag LOCUS_00590 52082 52492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00590 52844 53077 gene locus_tag LOCUS_00600 52844 53077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 53179 54687 gene locus_tag LOCUS_00610 53179 54687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 53405 53414 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 54965 55462 gene locus_tag LOCUS_00620 54965 55462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 56328 56477 gene locus_tag LOCUS_00630 56328 56477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00630 57263 57628 gene locus_tag LOCUS_00640 57263 57628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00640 57876 57625 gene locus_tag LOCUS_00650 57876 57625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00650 58662 59855 gene locus_tag LOCUS_00660 58662 59855 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533480.1 protein_id gnl|my_center|LOCUS_00660 61491 60601 gene locus_tag LOCUS_00670 61491 60601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 62937 62191 gene locus_tag LOCUS_00680 62937 62191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 63471 63677 gene locus_tag LOCUS_00690 63471 63677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 63759 64574 gene locus_tag LOCUS_00700 63759 64574 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208514.1 protein_id gnl|my_center|LOCUS_00700 64718 64939 gene locus_tag LOCUS_00710 64718 64939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 65692 65153 gene locus_tag LOCUS_00720 65692 65153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 66303 65689 gene locus_tag LOCUS_00730 66303 65689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 67948 67193 gene locus_tag LOCUS_00740 67948 67193 CDS product delta 1-pyrroline-5-carboxylate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061123.1 protein_id gnl|my_center|LOCUS_00740 68308 67967 gene locus_tag LOCUS_00750 68308 67967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 68771 69031 gene locus_tag LOCUS_00760 68771 69031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 70999 70280 gene locus_tag LOCUS_00770 70999 70280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 71236 71069 gene locus_tag LOCUS_00780 71236 71069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00780 71802 71233 gene locus_tag LOCUS_00790 71802 71233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00790 72147 73301 gene locus_tag LOCUS_00800 72147 73301 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970928.1 protein_id gnl|my_center|LOCUS_00800 73585 73406 gene locus_tag LOCUS_00810 73585 73406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 75560 74865 gene locus_tag LOCUS_00820 75560 74865 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337984.1 protein_id gnl|my_center|LOCUS_00820 76339 75557 gene locus_tag LOCUS_00830 76339 75557 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086914.1 protein_id gnl|my_center|LOCUS_00830 77644 76913 gene locus_tag LOCUS_00840 77644 76913 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083618.1 protein_id gnl|my_center|LOCUS_00840 78450 77641 gene locus_tag LOCUS_00850 78450 77641 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970866.1 protein_id gnl|my_center|LOCUS_00850 79762 78512 gene locus_tag LOCUS_00860 79762 78512 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310644.1 protein_id gnl|my_center|LOCUS_00860 80639 79806 gene locus_tag LOCUS_00870 80639 79806 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310642.1 protein_id gnl|my_center|LOCUS_00870 81589 80639 gene locus_tag LOCUS_00880 81589 80639 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970865.1 protein_id gnl|my_center|LOCUS_00880 82739 81591 gene locus_tag LOCUS_00890 82739 81591 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992208.1 protein_id gnl|my_center|LOCUS_00890 83638 82814 gene locus_tag LOCUS_00900 83638 82814 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289254.1 protein_id gnl|my_center|LOCUS_00900 85212 83788 gene locus_tag LOCUS_00910 85212 83788 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766268.1 protein_id gnl|my_center|LOCUS_00910 86647 85346 gene locus_tag LOCUS_00920 86647 85346 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133415011.1 protein_id gnl|my_center|LOCUS_00920 87496 86672 gene locus_tag LOCUS_00930 87496 86672 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174730.1 protein_id gnl|my_center|LOCUS_00930 88460 87582 gene locus_tag LOCUS_00940 88460 87582 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331879.1 protein_id gnl|my_center|LOCUS_00940 89626 88829 gene locus_tag LOCUS_00950 89626 88829 CDS product glucosamine--fructose-6-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336747.1 protein_id gnl|my_center|LOCUS_00950 89540 89830 gene locus_tag LOCUS_00960 89540 89830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 90783 89839 gene locus_tag LOCUS_00970 90783 89839 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336746.1 protein_id gnl|my_center|LOCUS_00970 90923 91147 gene locus_tag LOCUS_00980 90923 91147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 91074 91901 gene locus_tag LOCUS_00990 91074 91901 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114712.1 protein_id gnl|my_center|LOCUS_00990 92716 91898 gene locus_tag LOCUS_01000 92716 91898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 93689 93555 gene locus_tag LOCUS_01010 93689 93555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 94114 93896 gene locus_tag LOCUS_01020 94114 93896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 94099 94764 gene locus_tag LOCUS_01030 94099 94764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 95221 94919 gene locus_tag LOCUS_01040 95221 94919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 95359 98280 gene locus_tag LOCUS_01050 95359 98280 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014855724.1 protein_id gnl|my_center|LOCUS_01050 98580 98801 gene locus_tag LOCUS_01060 98580 98801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 98804 99337 gene locus_tag LOCUS_01070 98804 99337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 99590 99874 gene locus_tag LOCUS_01080 99590 99874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 99921 100190 gene locus_tag LOCUS_01090 99921 100190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 100168 100461 gene locus_tag LOCUS_01100 100168 100461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 100873 101241 gene locus_tag LOCUS_01110 100873 101241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01110 101256 101639 gene locus_tag LOCUS_01120 101256 101639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01120 101733 102767 gene locus_tag LOCUS_01130 101733 102767 CDS product IS110-like element ISRhru3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388434.1 protein_id gnl|my_center|LOCUS_01130 102998 103006 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 104006 103548 gene locus_tag LOCUS_01140 104006 103548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 104435 104932 gene locus_tag LOCUS_01150 104435 104932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01150 104967 105998 gene locus_tag LOCUS_01160 104967 105998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01160 106389 106099 gene locus_tag LOCUS_01170 106389 106099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 107313 109475 gene locus_tag LOCUS_01180 107313 109475 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533399.1 protein_id gnl|my_center|LOCUS_01180 109514 110212 gene locus_tag LOCUS_01190 109514 110212 CDS product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972835.1 protein_id gnl|my_center|LOCUS_01190 110724 110521 gene locus_tag LOCUS_01200 110724 110521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 111510 110869 gene locus_tag LOCUS_01210 111510 110869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01210 112253 111675 gene locus_tag LOCUS_01220 112253 111675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01220 112823 112680 gene locus_tag LOCUS_01230 112823 112680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 113113 112865 gene locus_tag LOCUS_01240 113113 112865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01240 113301 113074 gene locus_tag LOCUS_01250 113301 113074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01250 115506 113524 gene locus_tag LOCUS_01260 115506 113524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 116447 115503 gene locus_tag LOCUS_01270 116447 115503 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098364.1 protein_id gnl|my_center|LOCUS_01270 116686 116955 gene locus_tag LOCUS_01280 116686 116955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 117324 117106 gene locus_tag LOCUS_01290 117324 117106 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533400.1 protein_id gnl|my_center|LOCUS_01290 117434 117700 gene locus_tag LOCUS_01300 117434 117700 CDS product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533401.1 protein_id gnl|my_center|LOCUS_01300 118415 118182 gene locus_tag LOCUS_01310 118415 118182 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266521.1 protein_id gnl|my_center|LOCUS_01310 118685 118813 gene locus_tag LOCUS_01320 118685 118813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 119602 119775 gene locus_tag LOCUS_01330 119602 119775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 122433 121027 gene locus_tag LOCUS_01340 122433 121027 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533403.1 protein_id gnl|my_center|LOCUS_01340 124057 123551 gene locus_tag LOCUS_01350 124057 123551 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970310.1 protein_id gnl|my_center|LOCUS_01350 124648 124067 gene locus_tag LOCUS_01360 124648 124067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 125449 124946 gene locus_tag LOCUS_01370 125449 124946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 126465 125968 gene locus_tag LOCUS_01380 126465 125968 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533407.1 protein_id gnl|my_center|LOCUS_01380 128320 126956 gene locus_tag LOCUS_01390 128320 126956 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533408.1 protein_id gnl|my_center|LOCUS_01390 129940 128507 gene locus_tag LOCUS_01400 129940 128507 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533409.1 protein_id gnl|my_center|LOCUS_01400 131060 130134 gene locus_tag LOCUS_01410 131060 130134 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533410.1 protein_id gnl|my_center|LOCUS_01410 132336 131434 gene locus_tag LOCUS_01420 132336 131434 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533411.1 protein_id gnl|my_center|LOCUS_01420 133649 132468 gene locus_tag LOCUS_01430 133649 132468 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172832172.1 protein_id gnl|my_center|LOCUS_01430 134886 133639 gene locus_tag LOCUS_01440 134886 133639 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533413.1 protein_id gnl|my_center|LOCUS_01440 135966 134929 gene locus_tag LOCUS_01450 135966 134929 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533429.1 protein_id gnl|my_center|LOCUS_01450 136177 136611 gene locus_tag LOCUS_01460 136177 136611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 137034 138188 gene locus_tag LOCUS_01470 gene doeA 137034 138188 CDS product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974131.1 protein_id gnl|my_center|LOCUS_01470 >Feature sequence002 1037 102 gene locus_tag LOCUS_01480 1037 102 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529089.1 protein_id gnl|my_center|LOCUS_01480 1139 1798 gene locus_tag LOCUS_01490 1139 1798 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173266.1 protein_id gnl|my_center|LOCUS_01490 2131 1811 gene locus_tag LOCUS_01500 2131 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028054075.1 protein_id gnl|my_center|LOCUS_01500 2676 2371 gene locus_tag LOCUS_01510 2676 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529087.1 protein_id gnl|my_center|LOCUS_01510 4481 2985 gene locus_tag LOCUS_01520 4481 2985 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529086.1 protein_id gnl|my_center|LOCUS_01520 4704 5585 gene locus_tag LOCUS_01530 4704 5585 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529085.1 protein_id gnl|my_center|LOCUS_01530 5690 6130 gene locus_tag LOCUS_01540 5690 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529084.1 protein_id gnl|my_center|LOCUS_01540 6236 7822 gene locus_tag LOCUS_01550 6236 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01550 6259 6268 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7819 8301 gene locus_tag LOCUS_01560 7819 8301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01560 9625 8369 gene locus_tag LOCUS_01570 9625 8369 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529082.1 protein_id gnl|my_center|LOCUS_01570 10975 9806 gene locus_tag LOCUS_01580 gene alr 10975 9806 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529079.1 protein_id gnl|my_center|LOCUS_01580 11549 11034 gene locus_tag LOCUS_01590 11549 11034 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529078.1 protein_id gnl|my_center|LOCUS_01590 12404 11808 gene locus_tag LOCUS_01600 12404 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01600 13027 12401 gene locus_tag LOCUS_01610 13027 12401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01610 12424 12433 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14478 13156 gene locus_tag LOCUS_01620 14478 13156 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529076.1 protein_id gnl|my_center|LOCUS_01620 15778 14483 gene locus_tag LOCUS_01630 15778 14483 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529075.1 protein_id gnl|my_center|LOCUS_01630 16463 15954 gene locus_tag LOCUS_01640 gene rlmH 16463 15954 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529074.1 protein_id gnl|my_center|LOCUS_01640 16877 16500 gene locus_tag LOCUS_01650 gene rsfS 16877 16500 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529073.1 protein_id gnl|my_center|LOCUS_01650 17118 17978 gene locus_tag LOCUS_01660 17118 17978 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529072.1 protein_id gnl|my_center|LOCUS_01660 19283 17994 gene locus_tag LOCUS_01670 19283 17994 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529071.1 protein_id gnl|my_center|LOCUS_01670 20069 19359 gene locus_tag LOCUS_01680 20069 19359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 20736 20005 gene locus_tag LOCUS_01690 20736 20005 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529070.1 protein_id gnl|my_center|LOCUS_01690 20134 20143 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21631 20759 gene locus_tag LOCUS_01700 21631 20759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01700 22005 21628 gene locus_tag LOCUS_01710 22005 21628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01710 21636 21645 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22123 22614 gene locus_tag LOCUS_01720 22123 22614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 23750 22629 gene locus_tag LOCUS_01730 gene proB 23750 22629 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529068.1 protein_id gnl|my_center|LOCUS_01730 24781 23753 gene locus_tag LOCUS_01740 gene obgE 24781 23753 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529067.1 protein_id gnl|my_center|LOCUS_01740 25076 25939 gene locus_tag LOCUS_01750 25076 25939 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529066.1 protein_id gnl|my_center|LOCUS_01750 26705 26118 gene locus_tag LOCUS_01760 26705 26118 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173273.1 protein_id gnl|my_center|LOCUS_01760 27095 26826 gene locus_tag LOCUS_01770 gene rpmA 27095 26826 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529063.1 protein_id gnl|my_center|LOCUS_01770 27880 27197 gene locus_tag LOCUS_01780 27880 27197 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529062.1 protein_id gnl|my_center|LOCUS_01780 28275 28364 gene locus_tag LOCUS_t00010 28275 28364 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 28479 29801 gene locus_tag LOCUS_01790 28479 29801 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339202.1 protein_id gnl|my_center|LOCUS_01790 30114 29779 gene locus_tag LOCUS_01800 30114 29779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 31846 31256 gene locus_tag LOCUS_01810 31846 31256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01810 33078 31915 gene locus_tag LOCUS_01820 33078 31915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01820 34793 33333 gene locus_tag LOCUS_01830 gene ubiM 34793 33333 CDS product 5-demethoxyubiquinol-8 5-hydroxylase UbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533249.1 protein_id gnl|my_center|LOCUS_01830 35031 34795 gene locus_tag LOCUS_01840 35031 34795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 38186 35913 gene locus_tag LOCUS_01850 38186 35913 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524996.1 protein_id gnl|my_center|LOCUS_01850 38680 38183 gene locus_tag LOCUS_01860 38680 38183 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524997.1 protein_id gnl|my_center|LOCUS_01860 40236 38677 gene locus_tag LOCUS_01870 gene ccoG 40236 38677 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533254.1 protein_id gnl|my_center|LOCUS_01870 41266 40403 gene locus_tag LOCUS_01880 gene ccoP 41266 40403 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524999.1 protein_id gnl|my_center|LOCUS_01880 41418 41269 gene locus_tag LOCUS_01890 41418 41269 CDS product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525000.1 protein_id gnl|my_center|LOCUS_01890 42161 41430 gene locus_tag LOCUS_01900 gene ccoO 42161 41430 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533257.1 protein_id gnl|my_center|LOCUS_01900 43780 42161 gene locus_tag LOCUS_01910 gene ccoN 43780 42161 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525002.1 protein_id gnl|my_center|LOCUS_01910 44870 44277 gene locus_tag LOCUS_01920 44870 44277 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533259.1 protein_id gnl|my_center|LOCUS_01920 45173 46522 gene locus_tag LOCUS_01930 gene hemN 45173 46522 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525005.1 protein_id gnl|my_center|LOCUS_01930 47000 46758 gene locus_tag LOCUS_01940 47000 46758 CDS product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533261.1 protein_id gnl|my_center|LOCUS_01940 48227 47013 gene locus_tag LOCUS_01950 48227 47013 CDS product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533262.1 protein_id gnl|my_center|LOCUS_01950 49261 48224 gene locus_tag LOCUS_01960 gene trbG 49261 48224 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533263.1 protein_id gnl|my_center|LOCUS_01960 49982 49251 gene locus_tag LOCUS_01970 gene trbF 49982 49251 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533264.1 protein_id gnl|my_center|LOCUS_01970 51305 49983 gene locus_tag LOCUS_01980 gene trbL 51305 49983 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533265.1 protein_id gnl|my_center|LOCUS_01980 52064 51339 gene locus_tag LOCUS_01990 gene trbJ 52064 51339 CDS product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533266.1 protein_id gnl|my_center|LOCUS_01990 54511 52061 gene locus_tag LOCUS_02000 gene trbE 54511 52061 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533267.1 protein_id gnl|my_center|LOCUS_02000 54777 54505 gene locus_tag LOCUS_02010 54777 54505 CDS product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533268.1 protein_id gnl|my_center|LOCUS_02010 55085 54777 gene locus_tag LOCUS_02020 55085 54777 CDS product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533269.1 protein_id gnl|my_center|LOCUS_02020 56066 55098 gene locus_tag LOCUS_02030 gene trbB 56066 55098 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533270.1 protein_id gnl|my_center|LOCUS_02030 56476 56063 gene locus_tag LOCUS_02040 56476 56063 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533271.1 protein_id gnl|my_center|LOCUS_02040 58524 56593 gene locus_tag LOCUS_02050 58524 56593 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 protein_id gnl|my_center|LOCUS_02050 61921 58970 gene locus_tag LOCUS_02060 61921 58970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 59021 59029 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 65298 62992 gene locus_tag LOCUS_02070 65298 62992 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533398.1 protein_id gnl|my_center|LOCUS_02070 67061 65727 gene locus_tag LOCUS_02080 67061 65727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 67277 67573 gene locus_tag LOCUS_02090 67277 67573 CDS product DUF2604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514686.1 protein_id gnl|my_center|LOCUS_02090 67566 68183 gene locus_tag LOCUS_02100 67566 68183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875328.1 protein_id gnl|my_center|LOCUS_02100 68282 68668 gene locus_tag LOCUS_02110 68282 68668 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026616817.1 protein_id gnl|my_center|LOCUS_02110 68672 70201 gene locus_tag LOCUS_02120 68672 70201 CDS product E2 ligase fold family C protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081162412.1 protein_id gnl|my_center|LOCUS_02120 71932 70523 gene locus_tag LOCUS_02130 71932 70523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02130 70679 70688 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 72904 72002 gene locus_tag LOCUS_02140 72904 72002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02140 73908 72922 gene locus_tag LOCUS_02150 73908 72922 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045231753.1 protein_id gnl|my_center|LOCUS_02150 76015 74264 gene locus_tag LOCUS_02160 gene rlxS 76015 74264 CDS product relaxase/mobilization nuclease RlxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533275.1 protein_id gnl|my_center|LOCUS_02160 77096 76413 gene locus_tag LOCUS_02170 77096 76413 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533276.1 protein_id gnl|my_center|LOCUS_02170 77632 77084 gene locus_tag LOCUS_02180 77632 77084 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533277.1 protein_id gnl|my_center|LOCUS_02180 77898 77629 gene locus_tag LOCUS_02190 77898 77629 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533278.1 protein_id gnl|my_center|LOCUS_02190 78403 78080 gene locus_tag LOCUS_02200 78403 78080 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533279.1 protein_id gnl|my_center|LOCUS_02200 79414 79761 gene locus_tag LOCUS_02210 79414 79761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 79824 80180 gene locus_tag LOCUS_02220 gene groES 79824 80180 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203049.1 protein_id gnl|my_center|LOCUS_02220 80183 81838 gene locus_tag LOCUS_02230 gene groL 80183 81838 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532389.1 protein_id gnl|my_center|LOCUS_02230 82997 81996 gene locus_tag LOCUS_02240 82997 81996 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533282.1 protein_id gnl|my_center|LOCUS_02240 83609 84178 gene locus_tag LOCUS_02250 83609 84178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 85387 84185 gene locus_tag LOCUS_02260 85387 84185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 86092 86481 gene locus_tag LOCUS_02270 86092 86481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533308.1 protein_id gnl|my_center|LOCUS_02270 86916 86671 gene locus_tag LOCUS_02280 86916 86671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 87282 87091 gene locus_tag LOCUS_02290 87282 87091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 87688 87218 gene locus_tag LOCUS_02300 87688 87218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02300 88335 88535 gene locus_tag LOCUS_02310 88335 88535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 89534 88902 gene locus_tag LOCUS_02320 89534 88902 CDS product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533316.1 protein_id gnl|my_center|LOCUS_02320 90346 89627 gene locus_tag LOCUS_02330 90346 89627 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533317.1 protein_id gnl|my_center|LOCUS_02330 91354 90446 gene locus_tag LOCUS_02340 gene panC 91354 90446 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533318.1 protein_id gnl|my_center|LOCUS_02340 91977 91351 gene locus_tag LOCUS_02350 91977 91351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02350 92422 93321 gene locus_tag LOCUS_02360 92422 93321 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533320.1 protein_id gnl|my_center|LOCUS_02360 93402 94358 gene locus_tag LOCUS_02370 gene nadA 93402 94358 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533321.1 protein_id gnl|my_center|LOCUS_02370 94355 95896 gene locus_tag LOCUS_02380 94355 95896 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533322.1 protein_id gnl|my_center|LOCUS_02380 95898 96779 gene locus_tag LOCUS_02390 gene nadC 95898 96779 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533323.1 protein_id gnl|my_center|LOCUS_02390 96957 97955 gene locus_tag LOCUS_02400 gene bioB 96957 97955 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533324.1 protein_id gnl|my_center|LOCUS_02400 97952 99091 gene locus_tag LOCUS_02410 97952 99091 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533325.1 protein_id gnl|my_center|LOCUS_02410 99088 99723 gene locus_tag LOCUS_02420 gene bioD 99088 99723 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533326.1 protein_id gnl|my_center|LOCUS_02420 99723 100988 gene locus_tag LOCUS_02430 99723 100988 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533327.1 protein_id gnl|my_center|LOCUS_02430 100985 101626 gene locus_tag LOCUS_02440 100985 101626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02440 101623 101967 gene locus_tag LOCUS_02450 101623 101967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02450 102141 103784 gene locus_tag LOCUS_02460 102141 103784 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533329.1 protein_id gnl|my_center|LOCUS_02460 105073 104015 gene locus_tag LOCUS_02470 105073 104015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02470 105342 105040 gene locus_tag LOCUS_02480 105342 105040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02480 106194 105838 gene locus_tag LOCUS_02490 106194 105838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531395.1 protein_id gnl|my_center|LOCUS_02490 106877 108016 gene locus_tag LOCUS_02500 106877 108016 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532601.1 protein_id gnl|my_center|LOCUS_02500 110377 108506 gene locus_tag LOCUS_02510 110377 108506 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533629.1 protein_id gnl|my_center|LOCUS_02510 110929 110462 gene locus_tag LOCUS_02520 110929 110462 CDS product CpaD family pilus assembly lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857545.1 protein_id gnl|my_center|LOCUS_02520 112501 111035 gene locus_tag LOCUS_02530 112501 111035 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859716.1 protein_id gnl|my_center|LOCUS_02530 113214 112528 gene locus_tag LOCUS_02540 113214 112528 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857543.1 protein_id gnl|my_center|LOCUS_02540 114099 113980 gene locus_tag LOCUS_02550 114099 113980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02550 115925 114891 gene locus_tag LOCUS_02560 gene tdh 115925 114891 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532321.1 protein_id gnl|my_center|LOCUS_02560 117158 115971 gene locus_tag LOCUS_02570 117158 115971 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532322.1 protein_id gnl|my_center|LOCUS_02570 117460 119529 gene locus_tag LOCUS_02580 117460 119529 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532323.1 protein_id gnl|my_center|LOCUS_02580 119466 119642 gene locus_tag LOCUS_02590 119466 119642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 120056 119658 gene locus_tag LOCUS_02600 120056 119658 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532326.1 protein_id gnl|my_center|LOCUS_02600 120198 120605 gene locus_tag LOCUS_02610 120198 120605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532327.1 protein_id gnl|my_center|LOCUS_02610 121566 120829 gene locus_tag LOCUS_02620 121566 120829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532325.1 protein_id gnl|my_center|LOCUS_02620 121950 122411 gene locus_tag LOCUS_02630 gene queF 121950 122411 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010915503.1 protein_id gnl|my_center|LOCUS_02630 122844 122431 gene locus_tag LOCUS_02640 122844 122431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02640 122817 122826 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 123500 123021 gene locus_tag LOCUS_02650 123500 123021 CDS product DUF3828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532330.1 protein_id gnl|my_center|LOCUS_02650 125649 123613 gene locus_tag LOCUS_02660 125649 123613 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325081.1 protein_id gnl|my_center|LOCUS_02660 125794 126423 gene locus_tag LOCUS_02670 125794 126423 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018009470.1 protein_id gnl|my_center|LOCUS_02670 126591 127226 gene locus_tag LOCUS_02680 126591 127226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02680 127276 127791 gene locus_tag LOCUS_02690 127276 127791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 128971 127862 gene locus_tag LOCUS_02700 128971 127862 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331277.1 protein_id gnl|my_center|LOCUS_02700 >Feature sequence003 1335 1024 gene locus_tag LOCUS_02710 1335 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 1751 1353 gene locus_tag LOCUS_02720 1751 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 2791 1790 gene locus_tag LOCUS_02730 2791 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 3098 2913 gene locus_tag LOCUS_02740 3098 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 3295 4167 gene locus_tag LOCUS_02750 3295 4167 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975164.1 protein_id gnl|my_center|LOCUS_02750 4245 15290 gene locus_tag LOCUS_02760 4245 15290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 16240 15314 gene locus_tag LOCUS_02770 16240 15314 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261970.1 protein_id gnl|my_center|LOCUS_02770 16732 16244 gene locus_tag LOCUS_02780 16732 16244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 16969 17613 gene locus_tag LOCUS_02790 16969 17613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 17631 18263 gene locus_tag LOCUS_02800 17631 18263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 18364 19113 gene locus_tag LOCUS_02810 gene sctJ 18364 19113 CDS product type III secretion inner membrane ring lipoprotein SctJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253017.1 protein_id gnl|my_center|LOCUS_02810 19110 19727 gene locus_tag LOCUS_02820 19110 19727 CDS product nodulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084622.1 protein_id gnl|my_center|LOCUS_02820 19732 20349 gene locus_tag LOCUS_02830 19732 20349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 20346 21704 gene locus_tag LOCUS_02840 20346 21704 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253014.1 protein_id gnl|my_center|LOCUS_02840 21691 22179 gene locus_tag LOCUS_02850 21691 22179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 22188 23312 gene locus_tag LOCUS_02860 gene sctQ 22188 23312 CDS product type III secretion system cytoplasmic ring protein SctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066868854.1 protein_id gnl|my_center|LOCUS_02860 23305 23958 gene locus_tag LOCUS_02870 gene sctR 23305 23958 CDS product type III secretion system export apparatus subunit SctR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037381869.1 protein_id gnl|my_center|LOCUS_02870 23977 24246 gene locus_tag LOCUS_02880 23977 24246 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331082.1 protein_id gnl|my_center|LOCUS_02880 24256 25071 gene locus_tag LOCUS_02890 gene sctT 24256 25071 CDS product type III secretion system export apparatus subunit SctT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040116147.1 protein_id gnl|my_center|LOCUS_02890 25241 26068 gene locus_tag LOCUS_02900 25241 26068 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930607.1 protein_id gnl|my_center|LOCUS_02900 26900 26139 gene locus_tag LOCUS_02910 gene thiD 26900 26139 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 protein_id gnl|my_center|LOCUS_02910 27496 26891 gene locus_tag LOCUS_02920 27496 26891 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252920.1 protein_id gnl|my_center|LOCUS_02920 28266 27493 gene locus_tag LOCUS_02930 28266 27493 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614697.1 protein_id gnl|my_center|LOCUS_02930 28466 28269 gene locus_tag LOCUS_02940 gene thiS 28466 28269 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972407.1 protein_id gnl|my_center|LOCUS_02940 29436 28435 gene locus_tag LOCUS_02950 gene thiO 29436 28435 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969800.1 protein_id gnl|my_center|LOCUS_02950 31268 29433 gene locus_tag LOCUS_02960 gene thiC 31268 29433 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976311.1 protein_id gnl|my_center|LOCUS_02960 32562 31579 gene locus_tag LOCUS_02970 32562 31579 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172832176.1 protein_id gnl|my_center|LOCUS_02970 33824 32559 gene locus_tag LOCUS_02980 33824 32559 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533327.1 protein_id gnl|my_center|LOCUS_02980 34459 33824 gene locus_tag LOCUS_02990 gene bioD 34459 33824 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533326.1 protein_id gnl|my_center|LOCUS_02990 35595 34456 gene locus_tag LOCUS_03000 35595 34456 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533325.1 protein_id gnl|my_center|LOCUS_03000 36593 35592 gene locus_tag LOCUS_03010 gene bioB 36593 35592 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533324.1 protein_id gnl|my_center|LOCUS_03010 37510 36656 gene locus_tag LOCUS_03020 gene nadC 37510 36656 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533323.1 protein_id gnl|my_center|LOCUS_03020 39045 37510 gene locus_tag LOCUS_03030 39045 37510 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533322.1 protein_id gnl|my_center|LOCUS_03030 40016 39042 gene locus_tag LOCUS_03040 gene nadA 40016 39042 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533321.1 protein_id gnl|my_center|LOCUS_03040 41050 40085 gene locus_tag LOCUS_03050 41050 40085 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533320.1 protein_id gnl|my_center|LOCUS_03050 41433 42416 gene locus_tag LOCUS_03060 41433 42416 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173331.1 protein_id gnl|my_center|LOCUS_03060 42622 43029 gene locus_tag LOCUS_03070 42622 43029 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531554.1 protein_id gnl|my_center|LOCUS_03070 43117 43725 gene locus_tag LOCUS_03080 43117 43725 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531556.1 protein_id gnl|my_center|LOCUS_03080 45017 43776 gene locus_tag LOCUS_03090 45017 43776 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529727.1 protein_id gnl|my_center|LOCUS_03090 45237 45073 gene locus_tag LOCUS_03100 45237 45073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 46565 45414 gene locus_tag LOCUS_03110 46565 45414 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530321.1 protein_id gnl|my_center|LOCUS_03110 47935 46574 gene locus_tag LOCUS_03120 47935 46574 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530322.1 protein_id gnl|my_center|LOCUS_03120 47225 47234 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49465 47972 gene locus_tag LOCUS_03130 49465 47972 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530323.1 protein_id gnl|my_center|LOCUS_03130 50217 49726 gene locus_tag LOCUS_03140 50217 49726 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530324.1 protein_id gnl|my_center|LOCUS_03140 50301 51686 gene locus_tag LOCUS_03150 50301 51686 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530325.1 protein_id gnl|my_center|LOCUS_03150 51812 52597 gene locus_tag LOCUS_03160 gene ehuA 51812 52597 CDS product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299081.1 protein_id gnl|my_center|LOCUS_03160 52695 53546 gene locus_tag LOCUS_03170 gene ehuB 52695 53546 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530327.1 protein_id gnl|my_center|LOCUS_03170 53737 54396 gene locus_tag LOCUS_03180 gene ehuC 53737 54396 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530328.1 protein_id gnl|my_center|LOCUS_03180 54396 55055 gene locus_tag LOCUS_03190 gene ehuD 54396 55055 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530329.1 protein_id gnl|my_center|LOCUS_03190 55061 55837 gene locus_tag LOCUS_03200 gene eutA 55061 55837 CDS product ectoine utilization protein EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530330.1 protein_id gnl|my_center|LOCUS_03200 56021 57016 gene locus_tag LOCUS_03210 gene eutB 56021 57016 CDS product hydroxyectoine utilization dehydratase EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167355184.1 protein_id gnl|my_center|LOCUS_03210 57013 58005 gene locus_tag LOCUS_03220 gene eutC 57013 58005 CDS product ectoine utilization protein EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530332.1 protein_id gnl|my_center|LOCUS_03220 58044 59222 gene locus_tag LOCUS_03230 gene doeA 58044 59222 CDS product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530333.1 protein_id gnl|my_center|LOCUS_03230 59228 60229 gene locus_tag LOCUS_03240 gene doeB 59228 60229 CDS product N(2)-acetyl-L-2,4-diaminobutanoate deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530334.1 protein_id gnl|my_center|LOCUS_03240 61936 60317 gene locus_tag LOCUS_03250 61936 60317 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531743.1 protein_id gnl|my_center|LOCUS_03250 63524 62091 gene locus_tag LOCUS_03260 63524 62091 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392306.1 protein_id gnl|my_center|LOCUS_03260 64788 63616 gene locus_tag LOCUS_03270 64788 63616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 66129 64789 gene locus_tag LOCUS_03280 66129 64789 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_03280 66808 66119 gene locus_tag LOCUS_03290 66808 66119 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940085.1 protein_id gnl|my_center|LOCUS_03290 68094 66805 gene locus_tag LOCUS_03300 68094 66805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 69411 68101 gene locus_tag LOCUS_03310 69411 68101 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088825.1 protein_id gnl|my_center|LOCUS_03310 70482 69430 gene locus_tag LOCUS_03320 70482 69430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088829.1 protein_id gnl|my_center|LOCUS_03320 72561 70735 gene locus_tag LOCUS_03330 72561 70735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 73602 72682 gene locus_tag LOCUS_03340 73602 72682 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086197.1 protein_id gnl|my_center|LOCUS_03340 74734 73613 gene locus_tag LOCUS_03350 74734 73613 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086196.1 protein_id gnl|my_center|LOCUS_03350 74870 75520 gene locus_tag LOCUS_03360 74870 75520 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339095.1 protein_id gnl|my_center|LOCUS_03360 75962 76663 gene locus_tag LOCUS_03370 75962 76663 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296810.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03370 78037 76880 gene locus_tag LOCUS_03380 78037 76880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 78136 78723 gene locus_tag LOCUS_03390 78136 78723 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921379.1 protein_id gnl|my_center|LOCUS_03390 79496 78762 gene locus_tag LOCUS_03400 79496 78762 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225011.1 protein_id gnl|my_center|LOCUS_03400 80683 79520 gene locus_tag LOCUS_03410 gene dgoD 80683 79520 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703894.1 protein_id gnl|my_center|LOCUS_03410 81812 80715 gene locus_tag LOCUS_03420 gene ugpC 81812 80715 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_03420 82713 81823 gene locus_tag LOCUS_03430 82713 81823 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459730.1 protein_id gnl|my_center|LOCUS_03430 83546 82710 gene locus_tag LOCUS_03440 83546 82710 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898777.1 protein_id gnl|my_center|LOCUS_03440 85214 83733 gene locus_tag LOCUS_03450 85214 83733 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973776.1 protein_id gnl|my_center|LOCUS_03450 85428 86138 gene locus_tag LOCUS_03460 85428 86138 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877666.1 protein_id gnl|my_center|LOCUS_03460 86193 87359 gene locus_tag LOCUS_03470 86193 87359 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_03470 87419 88777 gene locus_tag LOCUS_03480 87419 88777 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_03480 88873 89199 gene locus_tag LOCUS_03490 88873 89199 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087569.1 protein_id gnl|my_center|LOCUS_03490 89209 90408 gene locus_tag LOCUS_03500 89209 90408 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524840.1 protein_id gnl|my_center|LOCUS_03500 91616 90561 gene locus_tag LOCUS_03510 91616 90561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121652022.1 protein_id gnl|my_center|LOCUS_03510 92453 91620 gene locus_tag LOCUS_03520 92453 91620 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225802.1 protein_id gnl|my_center|LOCUS_03520 93300 92464 gene locus_tag LOCUS_03530 93300 92464 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091310187.1 protein_id gnl|my_center|LOCUS_03530 94719 93457 gene locus_tag LOCUS_03540 94719 93457 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225804.1 protein_id gnl|my_center|LOCUS_03540 95917 94739 gene locus_tag LOCUS_03550 95917 94739 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226619.1 protein_id gnl|my_center|LOCUS_03550 96459 96229 gene locus_tag LOCUS_03560 96459 96229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 96385 96936 gene locus_tag LOCUS_03570 96385 96936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 97766 96933 gene locus_tag LOCUS_03580 97766 96933 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173599.1 protein_id gnl|my_center|LOCUS_03580 99250 97763 gene locus_tag LOCUS_03590 99250 97763 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533135.1 protein_id gnl|my_center|LOCUS_03590 100499 99270 gene locus_tag LOCUS_03600 100499 99270 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533134.1 protein_id gnl|my_center|LOCUS_03600 100641 101330 gene locus_tag LOCUS_03610 100641 101330 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533133.1 protein_id gnl|my_center|LOCUS_03610 101520 102092 gene locus_tag LOCUS_03620 101520 102092 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533129.1 protein_id gnl|my_center|LOCUS_03620 103053 102157 gene locus_tag LOCUS_03630 103053 102157 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968296.1 protein_id gnl|my_center|LOCUS_03630 103222 104274 gene locus_tag LOCUS_03640 103222 104274 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523473.1 protein_id gnl|my_center|LOCUS_03640 104271 105056 gene locus_tag LOCUS_03650 104271 105056 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972912.1 protein_id gnl|my_center|LOCUS_03650 105145 106065 gene locus_tag LOCUS_03660 105145 106065 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529529.1 protein_id gnl|my_center|LOCUS_03660 106138 107151 gene locus_tag LOCUS_03670 106138 107151 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529526.1 protein_id gnl|my_center|LOCUS_03670 >Feature sequence004 <1 1790 gene locus_tag LOCUS_03680 <1 1790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525283.1:M23 family metallopeptidase 1996 3636 gene locus_tag LOCUS_03690 1996 3636 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967381.1 protein_id gnl|my_center|LOCUS_03690 4227 3691 gene locus_tag LOCUS_03700 4227 3691 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525282.1 protein_id gnl|my_center|LOCUS_03700 4408 4417 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4438 5013 gene locus_tag LOCUS_03710 4438 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299099.1 protein_id gnl|my_center|LOCUS_03710 5379 5086 gene locus_tag LOCUS_03720 5379 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 7946 5397 gene locus_tag LOCUS_03730 7946 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 9328 8336 gene locus_tag LOCUS_03740 gene ftsZ 9328 8336 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532929.1 protein_id gnl|my_center|LOCUS_03740 10317 9586 gene locus_tag LOCUS_03750 10317 9586 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050596197.1 protein_id gnl|my_center|LOCUS_03750 10476 12134 gene locus_tag LOCUS_03760 10476 12134 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529813.1 protein_id gnl|my_center|LOCUS_03760 12136 13281 gene locus_tag LOCUS_03770 12136 13281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529814.1 protein_id gnl|my_center|LOCUS_03770 13265 14191 gene locus_tag LOCUS_03780 13265 14191 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529815.1 protein_id gnl|my_center|LOCUS_03780 14181 14987 gene locus_tag LOCUS_03790 14181 14987 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529816.1 protein_id gnl|my_center|LOCUS_03790 15013 16044 gene locus_tag LOCUS_03800 15013 16044 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531376.1 protein_id gnl|my_center|LOCUS_03800 16315 16500 gene locus_tag LOCUS_03810 16315 16500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 17237 16497 gene locus_tag LOCUS_03820 17237 16497 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525382.1 protein_id gnl|my_center|LOCUS_03820 17450 17896 gene locus_tag LOCUS_03830 17450 17896 CDS product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525383.1 protein_id gnl|my_center|LOCUS_03830 18200 19303 gene locus_tag LOCUS_03840 gene nirK 18200 19303 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524994.1 protein_id gnl|my_center|LOCUS_03840 19375 20247 gene locus_tag LOCUS_03850 19375 20247 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524993.1 protein_id gnl|my_center|LOCUS_03850 20272 20721 gene locus_tag LOCUS_03860 20272 20721 CDS product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920892.1 protein_id gnl|my_center|LOCUS_03860 20803 21234 gene locus_tag LOCUS_03870 20803 21234 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092588120.1 protein_id gnl|my_center|LOCUS_03870 22635 21253 gene locus_tag LOCUS_03880 gene hemN 22635 21253 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525005.1 protein_id gnl|my_center|LOCUS_03880 22761 23489 gene locus_tag LOCUS_03890 22761 23489 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215732092.1 protein_id gnl|my_center|LOCUS_03890 24030 23518 gene locus_tag LOCUS_03900 24030 23518 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525003.1 protein_id gnl|my_center|LOCUS_03900 24176 25786 gene locus_tag LOCUS_03910 gene ccoN 24176 25786 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525002.1 protein_id gnl|my_center|LOCUS_03910 25797 26528 gene locus_tag LOCUS_03920 gene ccoO 25797 26528 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533257.1 protein_id gnl|my_center|LOCUS_03920 26540 26689 gene locus_tag LOCUS_03930 26540 26689 CDS product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525000.1 protein_id gnl|my_center|LOCUS_03930 26692 27555 gene locus_tag LOCUS_03940 gene ccoP 26692 27555 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524999.1 protein_id gnl|my_center|LOCUS_03940 27715 29286 gene locus_tag LOCUS_03950 gene ccoG 27715 29286 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164757824.1 protein_id gnl|my_center|LOCUS_03950 29283 29777 gene locus_tag LOCUS_03960 29283 29777 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524997.1 protein_id gnl|my_center|LOCUS_03960 29774 32065 gene locus_tag LOCUS_03970 29774 32065 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533252.1 protein_id gnl|my_center|LOCUS_03970 32062 32214 gene locus_tag LOCUS_03980 gene ccoS 32062 32214 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524995.1 protein_id gnl|my_center|LOCUS_03980 32319 33017 gene locus_tag LOCUS_03990 32319 33017 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525380.1 protein_id gnl|my_center|LOCUS_03990 33607 33059 gene locus_tag LOCUS_04000 33607 33059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089631.1 protein_id gnl|my_center|LOCUS_04000 34034 33765 gene locus_tag LOCUS_04010 34034 33765 CDS product DUF6455 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525379.1 protein_id gnl|my_center|LOCUS_04010 34360 35916 gene locus_tag LOCUS_04020 34360 35916 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525377.1 protein_id gnl|my_center|LOCUS_04020 35903 36517 gene locus_tag LOCUS_04030 gene fixJ 35903 36517 CDS product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525376.1 protein_id gnl|my_center|LOCUS_04030 36738 36514 gene locus_tag LOCUS_04040 36738 36514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095080464.1 protein_id gnl|my_center|LOCUS_04040 36873 37319 gene locus_tag LOCUS_04050 36873 37319 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525374.1 protein_id gnl|my_center|LOCUS_04050 37537 38184 gene locus_tag LOCUS_04060 37537 38184 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525373.1 protein_id gnl|my_center|LOCUS_04060 39222 38413 gene locus_tag LOCUS_04070 39222 38413 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_04070 40957 39392 gene locus_tag LOCUS_04080 40957 39392 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399701.1 protein_id gnl|my_center|LOCUS_04080 42355 41354 gene locus_tag LOCUS_04090 42355 41354 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531159.1 protein_id gnl|my_center|LOCUS_04090 43512 42832 gene locus_tag LOCUS_04100 43512 42832 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088698.1 protein_id gnl|my_center|LOCUS_04100 46831 43532 gene locus_tag LOCUS_04110 46831 43532 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108722853.1 protein_id gnl|my_center|LOCUS_04110 47073 48845 gene locus_tag LOCUS_04120 47073 48845 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171602985.1 protein_id gnl|my_center|LOCUS_04120 49065 51950 gene locus_tag LOCUS_04130 49065 51950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 53415 52030 gene locus_tag LOCUS_04140 53415 52030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970593.1 protein_id gnl|my_center|LOCUS_04140 53955 53485 gene locus_tag LOCUS_04150 53955 53485 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310431.1 protein_id gnl|my_center|LOCUS_04150 55007 54183 gene locus_tag LOCUS_04160 55007 54183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 55212 56627 gene locus_tag LOCUS_04170 55212 56627 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395351.1 protein_id gnl|my_center|LOCUS_04170 57128 56649 gene locus_tag LOCUS_04180 57128 56649 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310724.1 protein_id gnl|my_center|LOCUS_04180 58500 57319 gene locus_tag LOCUS_04190 58500 57319 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391469.1 protein_id gnl|my_center|LOCUS_04190 59495 58497 gene locus_tag LOCUS_04200 59495 58497 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531312.1 protein_id gnl|my_center|LOCUS_04200 61414 59498 gene locus_tag LOCUS_04210 61414 59498 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391465.1 protein_id gnl|my_center|LOCUS_04210 61273 61282 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 63135 61411 gene locus_tag LOCUS_04220 63135 61411 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391463.1 protein_id gnl|my_center|LOCUS_04220 64753 63449 gene locus_tag LOCUS_04230 64753 63449 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312222.1 protein_id gnl|my_center|LOCUS_04230 66427 65249 gene locus_tag LOCUS_04240 66427 65249 CDS product DUF3095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391459.1 protein_id gnl|my_center|LOCUS_04240 66501 67589 gene locus_tag LOCUS_04250 66501 67589 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061518.1 protein_id gnl|my_center|LOCUS_04250 67586 68350 gene locus_tag LOCUS_04260 67586 68350 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061519.1 protein_id gnl|my_center|LOCUS_04260 69206 68352 gene locus_tag LOCUS_04270 69206 68352 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391458.1 protein_id gnl|my_center|LOCUS_04270 69790 69341 gene locus_tag LOCUS_04280 69790 69341 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531302.1 protein_id gnl|my_center|LOCUS_04280 72692 69978 gene locus_tag LOCUS_04290 72692 69978 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850752.1 protein_id gnl|my_center|LOCUS_04290 72843 73517 gene locus_tag LOCUS_04300 72843 73517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391489.1 protein_id gnl|my_center|LOCUS_04300 73743 73555 gene locus_tag LOCUS_04310 73743 73555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 74606 73872 gene locus_tag LOCUS_04320 74606 73872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 73943 73952 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 75847 74603 gene locus_tag LOCUS_04330 75847 74603 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061530.1 protein_id gnl|my_center|LOCUS_04330 77030 75849 gene locus_tag LOCUS_04340 77030 75849 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061529.1 protein_id gnl|my_center|LOCUS_04340 77155 77340 gene locus_tag LOCUS_04350 77155 77340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 78227 80080 gene locus_tag LOCUS_04360 78227 80080 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067211.1 protein_id gnl|my_center|LOCUS_04360 80208 81653 gene locus_tag LOCUS_04370 80208 81653 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192257226.1 protein_id gnl|my_center|LOCUS_04370 82222 82614 gene locus_tag LOCUS_04380 82222 82614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 83333 82773 gene locus_tag LOCUS_04390 83333 82773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 83484 83687 gene locus_tag LOCUS_04400 83484 83687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 84198 86210 gene locus_tag LOCUS_04410 84198 86210 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101804821.1 protein_id gnl|my_center|LOCUS_04410 86395 88359 gene locus_tag LOCUS_04420 86395 88359 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140190.1 protein_id gnl|my_center|LOCUS_04420 88459 88764 gene locus_tag LOCUS_04430 88459 88764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 90719 89988 gene locus_tag LOCUS_04440 90719 89988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 90966 91121 gene locus_tag LOCUS_04450 90966 91121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 92160 91294 gene locus_tag LOCUS_04460 92160 91294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 93138 92920 gene locus_tag LOCUS_04470 93138 92920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 93025 94119 gene locus_tag LOCUS_04480 93025 94119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 95391 94261 gene locus_tag LOCUS_04490 95391 94261 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061500.1 protein_id gnl|my_center|LOCUS_04490 95637 96917 gene locus_tag LOCUS_04500 95637 96917 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_04500 96945 97964 gene locus_tag LOCUS_04510 96945 97964 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_04510 98011 98802 gene locus_tag LOCUS_04520 98011 98802 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 protein_id gnl|my_center|LOCUS_04520 98884 100854 gene locus_tag LOCUS_04530 gene asnB 98884 100854 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_04530 101030 102454 gene locus_tag LOCUS_04540 101030 102454 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532712.1 protein_id gnl|my_center|LOCUS_04540 102630 103103 gene locus_tag LOCUS_04550 102630 103103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337797.1 protein_id gnl|my_center|LOCUS_04550 >Feature sequence005 <1 710 gene locus_tag LOCUS_04560 <1 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063173609.1:branched-chain amino acid ABC transporter permease 716 2005 gene locus_tag LOCUS_04570 716 2005 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532985.1 protein_id gnl|my_center|LOCUS_04570 3460 2273 gene locus_tag LOCUS_04580 3460 2273 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982221.1 protein_id gnl|my_center|LOCUS_04580 4005 3811 gene locus_tag LOCUS_04590 4005 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 4474 3905 gene locus_tag LOCUS_04600 4474 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 4591 4962 gene locus_tag LOCUS_04610 4591 4962 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525071.1 protein_id gnl|my_center|LOCUS_04610 6258 5017 gene locus_tag LOCUS_04620 6258 5017 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815690.1 protein_id gnl|my_center|LOCUS_04620 7825 7001 gene locus_tag LOCUS_04630 7825 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 9384 7822 gene locus_tag LOCUS_04640 9384 7822 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114442713.1 protein_id gnl|my_center|LOCUS_04640 9653 9498 gene locus_tag LOCUS_04650 9653 9498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 9925 10242 gene locus_tag LOCUS_04660 9925 10242 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525070.1 protein_id gnl|my_center|LOCUS_04660 10359 10508 gene locus_tag LOCUS_04670 10359 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 10505 10684 gene locus_tag LOCUS_04680 10505 10684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 10918 11268 gene locus_tag LOCUS_04690 10918 11268 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969702.1 protein_id gnl|my_center|LOCUS_04690 11262 12275 gene locus_tag LOCUS_04700 11262 12275 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502350.1 protein_id gnl|my_center|LOCUS_04700 12649 12317 gene locus_tag LOCUS_04710 12649 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04710 13512 13081 gene locus_tag LOCUS_04720 13512 13081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525086.1 protein_id gnl|my_center|LOCUS_04720 14476 13562 gene locus_tag LOCUS_04730 14476 13562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528199.1 protein_id gnl|my_center|LOCUS_04730 15175 14642 gene locus_tag LOCUS_04740 15175 14642 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090374.1 protein_id gnl|my_center|LOCUS_04740 15418 16581 gene locus_tag LOCUS_04750 15418 16581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525081.1 protein_id gnl|my_center|LOCUS_04750 16574 17191 gene locus_tag LOCUS_04760 16574 17191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525082.1 protein_id gnl|my_center|LOCUS_04760 17640 17209 gene locus_tag LOCUS_04770 17640 17209 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504647.1 protein_id gnl|my_center|LOCUS_04770 18151 17633 gene locus_tag LOCUS_04780 18151 17633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 18038 18253 gene locus_tag LOCUS_04790 18038 18253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 19370 18300 gene locus_tag LOCUS_04800 19370 18300 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164753819.1 protein_id gnl|my_center|LOCUS_04800 18838 18847 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20875 19994 gene locus_tag LOCUS_04810 20875 19994 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525135.1 protein_id gnl|my_center|LOCUS_04810 21267 20872 gene locus_tag LOCUS_04820 21267 20872 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525134.1 protein_id gnl|my_center|LOCUS_04820 21884 21264 gene locus_tag LOCUS_04830 21884 21264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525133.1 protein_id gnl|my_center|LOCUS_04830 22310 22663 gene locus_tag LOCUS_04840 22310 22663 CDS product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525116.1 protein_id gnl|my_center|LOCUS_04840 22853 23146 gene locus_tag LOCUS_04850 22853 23146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525119.1 protein_id gnl|my_center|LOCUS_04850 23859 23167 gene locus_tag LOCUS_04860 23859 23167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 26440 24923 gene locus_tag LOCUS_04870 26440 24923 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970696.1 protein_id gnl|my_center|LOCUS_04870 26758 26444 gene locus_tag LOCUS_04880 26758 26444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530127.1 protein_id gnl|my_center|LOCUS_04880 27644 26820 gene locus_tag LOCUS_04890 27644 26820 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525031.1 protein_id gnl|my_center|LOCUS_04890 28211 27828 gene locus_tag LOCUS_04900 28211 27828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 28824 28423 gene locus_tag LOCUS_04910 28824 28423 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038770.1 protein_id gnl|my_center|LOCUS_04910 29671 29913 gene locus_tag LOCUS_04920 29671 29913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 29974 30480 gene locus_tag LOCUS_04930 29974 30480 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530428.1 protein_id gnl|my_center|LOCUS_04930 30752 30940 gene locus_tag LOCUS_04940 30752 30940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 32190 31867 gene locus_tag LOCUS_04950 32190 31867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525091.1 protein_id gnl|my_center|LOCUS_04950 32596 32282 gene locus_tag LOCUS_04960 32596 32282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 33020 33277 gene locus_tag LOCUS_04970 33020 33277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 33727 34365 gene locus_tag LOCUS_04980 33727 34365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396385.1 protein_id gnl|my_center|LOCUS_04980 37002 35680 gene locus_tag LOCUS_04990 37002 35680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 35933 35941 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37591 37782 gene locus_tag LOCUS_05000 37591 37782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 38732 37791 gene locus_tag LOCUS_05010 38732 37791 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368405.1 protein_id gnl|my_center|LOCUS_05010 39848 38862 gene locus_tag LOCUS_05020 39848 38862 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533367.1 protein_id gnl|my_center|LOCUS_05020 40286 41005 gene locus_tag LOCUS_05030 40286 41005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 41098 42306 gene locus_tag LOCUS_05040 41098 42306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 42303 43709 gene locus_tag LOCUS_05050 42303 43709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970593.1 protein_id gnl|my_center|LOCUS_05050 44056 44223 gene locus_tag LOCUS_05060 44056 44223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 44260 45762 gene locus_tag LOCUS_05070 44260 45762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 46449 45778 gene locus_tag LOCUS_05080 46449 45778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163562.1 protein_id gnl|my_center|LOCUS_05080 46595 47344 gene locus_tag LOCUS_05090 46595 47344 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525102.1 protein_id gnl|my_center|LOCUS_05090 47370 47975 gene locus_tag LOCUS_05100 47370 47975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533175.1 protein_id gnl|my_center|LOCUS_05100 48292 48867 gene locus_tag LOCUS_05110 48292 48867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05110 48981 49280 gene locus_tag LOCUS_05120 48981 49280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 51316 49550 gene locus_tag LOCUS_05130 51316 49550 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171602985.1 protein_id gnl|my_center|LOCUS_05130 51558 52277 gene locus_tag LOCUS_05140 51558 52277 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540175.1 protein_id gnl|my_center|LOCUS_05140 52746 54581 gene locus_tag LOCUS_05150 52746 54581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 54676 56382 gene locus_tag LOCUS_05160 54676 56382 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090750.1 protein_id gnl|my_center|LOCUS_05160 56618 57472 gene locus_tag LOCUS_05170 56618 57472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 57685 57999 gene locus_tag LOCUS_05180 57685 57999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525146.1 protein_id gnl|my_center|LOCUS_05180 58268 59272 gene locus_tag LOCUS_05190 58268 59272 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041958803.1 protein_id gnl|my_center|LOCUS_05190 59236 59445 gene locus_tag LOCUS_05200 59236 59445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 59748 60254 gene locus_tag LOCUS_05210 59748 60254 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090375.1 protein_id gnl|my_center|LOCUS_05210 60251 61831 gene locus_tag LOCUS_05220 60251 61831 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970696.1 protein_id gnl|my_center|LOCUS_05220 61831 62436 gene locus_tag LOCUS_05230 61831 62436 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967327.1 protein_id gnl|my_center|LOCUS_05230 62563 63510 gene locus_tag LOCUS_05240 62563 63510 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_05240 64142 63951 gene locus_tag LOCUS_05250 64142 63951 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767547.1 protein_id gnl|my_center|LOCUS_05250 65142 64942 gene locus_tag LOCUS_05260 65142 64942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 65044 65781 gene locus_tag LOCUS_05270 gene rnz 65044 65781 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086661.1 protein_id gnl|my_center|LOCUS_05270 65790 66257 gene locus_tag LOCUS_05280 65790 66257 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102894.1 protein_id gnl|my_center|LOCUS_05280 66632 67639 gene locus_tag LOCUS_05290 66632 67639 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192256499.1 protein_id gnl|my_center|LOCUS_05290 67702 68721 gene locus_tag LOCUS_05300 67702 68721 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192256499.1 protein_id gnl|my_center|LOCUS_05300 68767 69774 gene locus_tag LOCUS_05310 68767 69774 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192256499.1 protein_id gnl|my_center|LOCUS_05310 69771 70376 gene locus_tag LOCUS_05320 69771 70376 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_05320 70342 72996 gene locus_tag LOCUS_05330 70342 72996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 72993 73358 gene locus_tag LOCUS_05340 72993 73358 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_05340 73372 74520 gene locus_tag LOCUS_05350 73372 74520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 74929 76320 gene locus_tag LOCUS_05360 74929 76320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 76701 76483 gene locus_tag LOCUS_05370 76701 76483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 76962 76732 gene locus_tag LOCUS_05380 76962 76732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 78649 77021 gene locus_tag LOCUS_05390 gene groL 78649 77021 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530719.1 protein_id gnl|my_center|LOCUS_05390 79131 78712 gene locus_tag LOCUS_05400 79131 78712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 79362 79703 gene locus_tag LOCUS_05410 79362 79703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 79703 80005 gene locus_tag LOCUS_05420 79703 80005 CDS product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501657.1 protein_id gnl|my_center|LOCUS_05420 80587 80378 gene locus_tag LOCUS_05430 80587 80378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 81234 80923 gene locus_tag LOCUS_05440 81234 80923 CDS product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525019.1 protein_id gnl|my_center|LOCUS_05440 82182 81673 gene locus_tag LOCUS_05450 82182 81673 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525023.1 protein_id gnl|my_center|LOCUS_05450 82759 82277 gene locus_tag LOCUS_05460 82759 82277 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192281448.1 protein_id gnl|my_center|LOCUS_05460 83335 83048 gene locus_tag LOCUS_05470 83335 83048 CDS product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530721.1 protein_id gnl|my_center|LOCUS_05470 83659 83354 gene locus_tag LOCUS_05480 83659 83354 CDS product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531275.1 protein_id gnl|my_center|LOCUS_05480 84792 84232 gene locus_tag LOCUS_05490 gene msuE 84792 84232 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528153.1 protein_id gnl|my_center|LOCUS_05490 86146 84899 gene locus_tag LOCUS_05500 86146 84899 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528154.1 protein_id gnl|my_center|LOCUS_05500 86961 86170 gene locus_tag LOCUS_05510 86961 86170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171068.1 protein_id gnl|my_center|LOCUS_05510 88373 87033 gene locus_tag LOCUS_05520 88373 87033 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528156.1 protein_id gnl|my_center|LOCUS_05520 89513 88458 gene locus_tag LOCUS_05530 89513 88458 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528157.1 protein_id gnl|my_center|LOCUS_05530 90415 89516 gene locus_tag LOCUS_05540 90415 89516 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171066.1 protein_id gnl|my_center|LOCUS_05540 91326 90412 gene locus_tag LOCUS_05550 91326 90412 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528159.1 protein_id gnl|my_center|LOCUS_05550 92520 91417 gene locus_tag LOCUS_05560 gene sfnG 92520 91417 CDS product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528160.1 protein_id gnl|my_center|LOCUS_05560 94105 92684 gene locus_tag LOCUS_05570 94105 92684 CDS product FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528161.1 protein_id gnl|my_center|LOCUS_05570 94701 94102 gene locus_tag LOCUS_05580 94701 94102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05580 95302 94637 gene locus_tag LOCUS_05590 95302 94637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05590 94766 94775 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 95823 95629 gene locus_tag LOCUS_05600 95823 95629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528709.1 protein_id gnl|my_center|LOCUS_05600 >Feature sequence006 963 658 gene locus_tag LOCUS_05610 963 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 1530 1318 gene locus_tag LOCUS_05620 1530 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 3459 2686 gene locus_tag LOCUS_05630 3459 2686 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084919.1 protein_id gnl|my_center|LOCUS_05630 4220 5674 gene locus_tag LOCUS_05640 4220 5674 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529719.1 protein_id gnl|my_center|LOCUS_05640 6504 6139 gene locus_tag LOCUS_05650 6504 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05650 6755 6501 gene locus_tag LOCUS_05660 6755 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 7837 8895 gene locus_tag LOCUS_05670 7837 8895 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 protein_id gnl|my_center|LOCUS_05670 10557 9502 gene locus_tag LOCUS_05680 10557 9502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 12620 10554 gene locus_tag LOCUS_05690 12620 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 13633 12623 gene locus_tag LOCUS_05700 13633 12623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 14119 14469 gene locus_tag LOCUS_05710 14119 14469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 17292 14491 gene locus_tag LOCUS_05720 17292 14491 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146312796.1 protein_id gnl|my_center|LOCUS_05720 17910 23810 gene locus_tag LOCUS_05730 17910 23810 CDS product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061269.1 protein_id gnl|my_center|LOCUS_05730 23824 24948 gene locus_tag LOCUS_05740 23824 24948 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063891.1 protein_id gnl|my_center|LOCUS_05740 24945 27587 gene locus_tag LOCUS_05750 24945 27587 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730250.1 protein_id gnl|my_center|LOCUS_05750 26027 26036 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27986 27609 gene locus_tag LOCUS_05760 27986 27609 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012112382.1 protein_id gnl|my_center|LOCUS_05760 28641 27991 gene locus_tag LOCUS_05770 28641 27991 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577776.1 protein_id gnl|my_center|LOCUS_05770 29100 29351 gene locus_tag LOCUS_05780 29100 29351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 30794 31057 gene locus_tag LOCUS_05790 30794 31057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153443159.1 protein_id gnl|my_center|LOCUS_05790 31720 31947 gene locus_tag LOCUS_05800 31720 31947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 32289 34124 gene locus_tag LOCUS_05810 gene thiC 32289 34124 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976311.1 protein_id gnl|my_center|LOCUS_05810 34121 35122 gene locus_tag LOCUS_05820 gene thiO 34121 35122 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972408.1 protein_id gnl|my_center|LOCUS_05820 35091 35288 gene locus_tag LOCUS_05830 gene thiS 35091 35288 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969799.1 protein_id gnl|my_center|LOCUS_05830 35290 36063 gene locus_tag LOCUS_05840 35290 36063 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972406.1 protein_id gnl|my_center|LOCUS_05840 36060 36665 gene locus_tag LOCUS_05850 36060 36665 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252920.1 protein_id gnl|my_center|LOCUS_05850 36656 37471 gene locus_tag LOCUS_05860 gene thiD 36656 37471 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 protein_id gnl|my_center|LOCUS_05860 39053 39487 gene locus_tag LOCUS_05870 39053 39487 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833896.1 protein_id gnl|my_center|LOCUS_05870 39532 40299 gene locus_tag LOCUS_05880 39532 40299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 40865 40644 gene locus_tag LOCUS_05890 40865 40644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 40992 40780 gene locus_tag LOCUS_05900 40992 40780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05900 44483 41943 gene locus_tag LOCUS_05910 44483 41943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 44948 47419 gene locus_tag LOCUS_05920 44948 47419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05920 47400 48311 gene locus_tag LOCUS_05930 47400 48311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05930 48361 48741 gene locus_tag LOCUS_05940 48361 48741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05940 50770 49283 gene locus_tag LOCUS_05950 50770 49283 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394607.1 protein_id gnl|my_center|LOCUS_05950 52876 51032 gene locus_tag LOCUS_05960 gene recQ 52876 51032 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529051.1 protein_id gnl|my_center|LOCUS_05960 54596 53016 gene locus_tag LOCUS_05970 54596 53016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 55036 56049 gene locus_tag LOCUS_05980 55036 56049 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528896.1 protein_id gnl|my_center|LOCUS_05980 56404 56066 gene locus_tag LOCUS_05990 56404 56066 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529048.1 protein_id gnl|my_center|LOCUS_05990 57206 56415 gene locus_tag LOCUS_06000 gene kduD 57206 56415 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529047.1 protein_id gnl|my_center|LOCUS_06000 57570 59129 gene locus_tag LOCUS_06010 57570 59129 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529040.1 protein_id gnl|my_center|LOCUS_06010 60079 59159 gene locus_tag LOCUS_06020 60079 59159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 60639 60232 gene locus_tag LOCUS_06030 60639 60232 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529039.1 protein_id gnl|my_center|LOCUS_06030 62319 60739 gene locus_tag LOCUS_06040 gene atpD 62319 60739 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529038.1 protein_id gnl|my_center|LOCUS_06040 63283 62396 gene locus_tag LOCUS_06050 63283 62396 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529037.1 protein_id gnl|my_center|LOCUS_06050 64595 63318 gene locus_tag LOCUS_06060 gene atpA 64595 63318 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529036.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06060 64521 64530 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 65363 64803 gene locus_tag LOCUS_06070 65363 64803 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529035.1 protein_id gnl|my_center|LOCUS_06070 66005 65610 gene locus_tag LOCUS_06080 66005 65610 CDS product DUF4345 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529034.1 protein_id gnl|my_center|LOCUS_06080 66794 66099 gene locus_tag LOCUS_06090 66794 66099 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529033.1 protein_id gnl|my_center|LOCUS_06090 66857 67102 gene locus_tag LOCUS_06100 66857 67102 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626232.1 protein_id gnl|my_center|LOCUS_06100 67099 67554 gene locus_tag LOCUS_06110 67099 67554 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626231.1 protein_id gnl|my_center|LOCUS_06110 68254 67565 gene locus_tag LOCUS_06120 68254 67565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06120 69765 68251 gene locus_tag LOCUS_06130 69765 68251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06130 68357 68366 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69855 70511 gene locus_tag LOCUS_06140 gene fsa 69855 70511 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529031.1 protein_id gnl|my_center|LOCUS_06140 71255 70689 gene locus_tag LOCUS_06150 gene lptE 71255 70689 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529029.1 protein_id gnl|my_center|LOCUS_06150 71634 71242 gene locus_tag LOCUS_06160 71634 71242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06160 73883 71661 gene locus_tag LOCUS_06170 gene leuS 73883 71661 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529028.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06170 71749 71758 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 73956 74693 gene locus_tag LOCUS_06180 73956 74693 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529027.1 protein_id gnl|my_center|LOCUS_06180 74763 75017 gene locus_tag LOCUS_06190 74763 75017 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332761.1 protein_id gnl|my_center|LOCUS_06190 75084 75317 gene locus_tag LOCUS_06200 75084 75317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06200 75639 75415 gene locus_tag LOCUS_06210 75639 75415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 75547 76596 gene locus_tag LOCUS_06220 75547 76596 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529026.1 protein_id gnl|my_center|LOCUS_06220 77525 76659 gene locus_tag LOCUS_06230 77525 76659 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529025.1 protein_id gnl|my_center|LOCUS_06230 77654 78868 gene locus_tag LOCUS_06240 77654 78868 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529024.1 protein_id gnl|my_center|LOCUS_06240 78919 79953 gene locus_tag LOCUS_06250 78919 79953 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529023.1 protein_id gnl|my_center|LOCUS_06250 80494 80060 gene locus_tag LOCUS_06260 80494 80060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 80917 80645 gene locus_tag LOCUS_06270 80917 80645 CDS product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529022.1 protein_id gnl|my_center|LOCUS_06270 81212 83167 gene locus_tag LOCUS_06280 gene acs 81212 83167 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529021.1 protein_id gnl|my_center|LOCUS_06280 83167 83679 gene locus_tag LOCUS_06290 83167 83679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 83211 83220 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 85407 83989 gene locus_tag LOCUS_06300 85407 83989 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529018.1 protein_id gnl|my_center|LOCUS_06300 86595 85726 gene locus_tag LOCUS_06310 86595 85726 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529017.1 protein_id gnl|my_center|LOCUS_06310 86845 87510 gene locus_tag LOCUS_06320 86845 87510 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529016.1 protein_id gnl|my_center|LOCUS_06320 87891 87652 gene locus_tag LOCUS_06330 87891 87652 CDS product DUF1674 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529015.1 protein_id gnl|my_center|LOCUS_06330 87976 88989 gene locus_tag LOCUS_06340 gene htpX 87976 88989 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529014.1 protein_id gnl|my_center|LOCUS_06340 88517 88526 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 88947 90218 gene locus_tag LOCUS_06350 88947 90218 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173296.1 protein_id gnl|my_center|LOCUS_06350 89773 89782 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 90419 92143 gene locus_tag LOCUS_06360 90419 92143 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529012.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence007 793 981 gene locus_tag LOCUS_06370 793 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 1057 2115 gene locus_tag LOCUS_06380 1057 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2013 2267 gene locus_tag LOCUS_06390 2013 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 2655 5627 gene locus_tag LOCUS_06400 2655 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 5850 6065 gene locus_tag LOCUS_06410 5850 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 6989 6276 gene locus_tag LOCUS_06420 6989 6276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205180329.1 protein_id gnl|my_center|LOCUS_06420 7500 6991 gene locus_tag LOCUS_06430 7500 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 8663 7656 gene locus_tag LOCUS_06440 8663 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 9028 9528 gene locus_tag LOCUS_06450 9028 9528 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529843.1 protein_id gnl|my_center|LOCUS_06450 9828 9601 gene locus_tag LOCUS_06460 9828 9601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 10553 10780 gene locus_tag LOCUS_06470 10553 10780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 11150 11713 gene locus_tag LOCUS_06480 gene nodL 11150 11713 CDS product nodulation O-acetyltransferase NodL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970947.1 protein_id gnl|my_center|LOCUS_06480 12914 12021 gene locus_tag LOCUS_06490 12914 12021 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533515.1 protein_id gnl|my_center|LOCUS_06490 13161 12949 gene locus_tag LOCUS_06500 gene nifT 13161 12949 CDS product putative nitrogen fixation protein NifT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533514.1 protein_id gnl|my_center|LOCUS_06500 13487 13158 gene locus_tag LOCUS_06510 13487 13158 CDS product nitrogen fixation protein NifZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533513.1 protein_id gnl|my_center|LOCUS_06510 13758 13564 gene locus_tag LOCUS_06520 13758 13564 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533512.1 protein_id gnl|my_center|LOCUS_06520 15269 13788 gene locus_tag LOCUS_06530 gene nifB 15269 13788 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533511.1 protein_id gnl|my_center|LOCUS_06530 15528 15746 gene locus_tag LOCUS_06540 15528 15746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 16663 16355 gene locus_tag LOCUS_06550 16663 16355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 17075 16551 gene locus_tag LOCUS_06560 17075 16551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06560 17640 17341 gene locus_tag LOCUS_06570 17640 17341 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533510.1 protein_id gnl|my_center|LOCUS_06570 18957 17653 gene locus_tag LOCUS_06580 18957 17653 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533509.1 protein_id gnl|my_center|LOCUS_06580 20077 18968 gene locus_tag LOCUS_06590 20077 18968 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533508.1 protein_id gnl|my_center|LOCUS_06590 21014 20094 gene locus_tag LOCUS_06600 21014 20094 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533507.1 protein_id gnl|my_center|LOCUS_06600 21511 21134 gene locus_tag LOCUS_06610 gene nifW 21511 21134 CDS product nitrogenase stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533506.1 protein_id gnl|my_center|LOCUS_06610 22913 21699 gene locus_tag LOCUS_06620 gene nifS 22913 21699 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533504.1 protein_id gnl|my_center|LOCUS_06620 23581 23261 gene locus_tag LOCUS_06630 23581 23261 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533503.1 protein_id gnl|my_center|LOCUS_06630 24174 25232 gene locus_tag LOCUS_06640 24174 25232 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533502.1 protein_id gnl|my_center|LOCUS_06640 26714 25482 gene locus_tag LOCUS_06650 26714 25482 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533492.1 protein_id gnl|my_center|LOCUS_06650 27372 27686 gene locus_tag LOCUS_06660 27372 27686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 28204 29382 gene locus_tag LOCUS_06670 28204 29382 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533500.1 protein_id gnl|my_center|LOCUS_06670 29412 30260 gene locus_tag LOCUS_06680 29412 30260 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533499.1 protein_id gnl|my_center|LOCUS_06680 30409 31326 gene locus_tag LOCUS_06690 30409 31326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06690 31160 31169 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31248 32024 gene locus_tag LOCUS_06700 31248 32024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06700 32163 33215 gene locus_tag LOCUS_06710 32163 33215 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533497.1 protein_id gnl|my_center|LOCUS_06710 33230 33829 gene locus_tag LOCUS_06720 33230 33829 CDS product nitrogen fixation protein NifQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857649.1 protein_id gnl|my_center|LOCUS_06720 35217 33826 gene locus_tag LOCUS_06730 gene rpoN 35217 33826 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533495.1 protein_id gnl|my_center|LOCUS_06730 35862 35329 gene locus_tag LOCUS_06740 35862 35329 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533494.1 protein_id gnl|my_center|LOCUS_06740 37046 38242 gene locus_tag LOCUS_06750 gene hisC 37046 38242 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857627.1 protein_id gnl|my_center|LOCUS_06750 38564 39304 gene locus_tag LOCUS_06760 38564 39304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 39759 39394 gene locus_tag LOCUS_06770 39759 39394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 39667 39984 gene locus_tag LOCUS_06780 39667 39984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06780 39870 40199 gene locus_tag LOCUS_06790 39870 40199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06790 40244 40579 gene locus_tag LOCUS_06800 40244 40579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 40719 40576 gene locus_tag LOCUS_06810 40719 40576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06810 41087 41860 gene locus_tag LOCUS_06820 41087 41860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 42180 42022 gene locus_tag LOCUS_06830 42180 42022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 42377 42189 gene locus_tag LOCUS_06840 42377 42189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 42848 43294 gene locus_tag LOCUS_06850 42848 43294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 43354 44052 gene locus_tag LOCUS_06860 gene queC 43354 44052 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533307.1 protein_id gnl|my_center|LOCUS_06860 44052 44408 gene locus_tag LOCUS_06870 gene queD 44052 44408 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533306.1 protein_id gnl|my_center|LOCUS_06870 44405 45139 gene locus_tag LOCUS_06880 gene queE 44405 45139 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533305.1 protein_id gnl|my_center|LOCUS_06880 45986 46684 gene locus_tag LOCUS_06890 45986 46684 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533332.1 protein_id gnl|my_center|LOCUS_06890 48002 47649 gene locus_tag LOCUS_06900 48002 47649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 48547 47984 gene locus_tag LOCUS_06910 48547 47984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 49128 50021 gene locus_tag LOCUS_06920 gene nifH 49128 50021 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533491.1 protein_id gnl|my_center|LOCUS_06920 50108 51610 gene locus_tag LOCUS_06930 gene nifD 50108 51610 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533490.1 protein_id gnl|my_center|LOCUS_06930 51740 53281 gene locus_tag LOCUS_06940 gene nifK 51740 53281 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533489.1 protein_id gnl|my_center|LOCUS_06940 53343 54818 gene locus_tag LOCUS_06950 gene nifE 53343 54818 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533488.1 protein_id gnl|my_center|LOCUS_06950 54827 56209 gene locus_tag LOCUS_06960 gene nifN 54827 56209 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533487.1 protein_id gnl|my_center|LOCUS_06960 56226 56672 gene locus_tag LOCUS_06970 gene nifX 56226 56672 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533486.1 protein_id gnl|my_center|LOCUS_06970 56690 57169 gene locus_tag LOCUS_06980 56690 57169 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533485.1 protein_id gnl|my_center|LOCUS_06980 57166 57981 gene locus_tag LOCUS_06990 57166 57981 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533484.1 protein_id gnl|my_center|LOCUS_06990 58077 58949 gene locus_tag LOCUS_07000 58077 58949 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533483.1 protein_id gnl|my_center|LOCUS_07000 59791 61089 gene locus_tag LOCUS_07010 59791 61089 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533481.1 protein_id gnl|my_center|LOCUS_07010 61670 61852 gene locus_tag LOCUS_07020 61670 61852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 62055 61861 gene locus_tag LOCUS_07030 62055 61861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 62779 62183 gene locus_tag LOCUS_07040 gene pyrE 62779 62183 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547500.1 protein_id gnl|my_center|LOCUS_07040 64555 63806 gene locus_tag LOCUS_07050 64555 63806 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089765.1 protein_id gnl|my_center|LOCUS_07050 65543 65737 gene locus_tag LOCUS_07060 65543 65737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 65734 66012 gene locus_tag LOCUS_07070 65734 66012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 66162 67346 gene locus_tag LOCUS_07080 66162 67346 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533480.1 protein_id gnl|my_center|LOCUS_07080 67692 68120 gene locus_tag LOCUS_07090 67692 68120 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533485.1 protein_id gnl|my_center|LOCUS_07090 68167 68370 gene locus_tag LOCUS_07100 68167 68370 CDS product CCE_0567 family metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533479.1 protein_id gnl|my_center|LOCUS_07100 68367 68684 gene locus_tag LOCUS_07110 gene fdxB 68367 68684 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015633444.1 protein_id gnl|my_center|LOCUS_07110 69364 69122 gene locus_tag LOCUS_07120 69364 69122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 69363 70376 gene locus_tag LOCUS_07130 69363 70376 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533477.1 protein_id gnl|my_center|LOCUS_07130 72882 71104 gene locus_tag LOCUS_07140 72882 71104 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061851.1 protein_id gnl|my_center|LOCUS_07140 72929 73180 gene locus_tag LOCUS_07150 72929 73180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 73513 74304 gene locus_tag LOCUS_07160 73513 74304 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533476.1 protein_id gnl|my_center|LOCUS_07160 74555 74313 gene locus_tag LOCUS_07170 74555 74313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 75429 75235 gene locus_tag LOCUS_07180 75429 75235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 75672 75499 gene locus_tag LOCUS_07190 75672 75499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 76202 75876 gene locus_tag LOCUS_07200 76202 75876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 76411 76262 gene locus_tag LOCUS_07210 76411 76262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 77054 78310 gene locus_tag LOCUS_07220 gene ectB 77054 78310 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533470.1 protein_id gnl|my_center|LOCUS_07220 78303 79142 gene locus_tag LOCUS_07230 78303 79142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533469.1 protein_id gnl|my_center|LOCUS_07230 79663 79457 gene locus_tag LOCUS_07240 79663 79457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 81029 80484 gene locus_tag LOCUS_07250 81029 80484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07250 81535 80924 gene locus_tag LOCUS_07260 81535 80924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07260 82245 83087 gene locus_tag LOCUS_07270 82245 83087 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228672.1 protein_id gnl|my_center|LOCUS_07270 83711 83406 gene locus_tag LOCUS_07280 83711 83406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07280 >Feature sequence008 675 130 gene locus_tag LOCUS_07290 675 130 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532714.1 protein_id gnl|my_center|LOCUS_07290 2725 791 gene locus_tag LOCUS_07300 2725 791 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171703.1 protein_id gnl|my_center|LOCUS_07300 3970 3041 gene locus_tag LOCUS_07310 gene rfbD 3970 3041 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532724.1 protein_id gnl|my_center|LOCUS_07310 5043 3967 gene locus_tag LOCUS_07320 gene rfbB 5043 3967 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532725.1 protein_id gnl|my_center|LOCUS_07320 5611 5057 gene locus_tag LOCUS_07330 gene rfbC 5611 5057 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532726.1 protein_id gnl|my_center|LOCUS_07330 6494 5613 gene locus_tag LOCUS_07340 gene rfbA 6494 5613 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532727.1 protein_id gnl|my_center|LOCUS_07340 6717 7658 gene locus_tag LOCUS_07350 6717 7658 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393201.1 protein_id gnl|my_center|LOCUS_07350 8300 7710 gene locus_tag LOCUS_07360 8300 7710 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532736.1 protein_id gnl|my_center|LOCUS_07360 8412 9320 gene locus_tag LOCUS_07370 8412 9320 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532737.1 protein_id gnl|my_center|LOCUS_07370 10109 9324 gene locus_tag LOCUS_07380 10109 9324 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532738.1 protein_id gnl|my_center|LOCUS_07380 11914 10286 gene locus_tag LOCUS_07390 11914 10286 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532739.1 protein_id gnl|my_center|LOCUS_07390 12105 12476 gene locus_tag LOCUS_07400 12105 12476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532740.1 protein_id gnl|my_center|LOCUS_07400 12598 12987 gene locus_tag LOCUS_07410 12598 12987 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532741.1 protein_id gnl|my_center|LOCUS_07410 14075 13083 gene locus_tag LOCUS_07420 14075 13083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 15020 14280 gene locus_tag LOCUS_07430 15020 14280 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532742.1 protein_id gnl|my_center|LOCUS_07430 16254 15139 gene locus_tag LOCUS_07440 16254 15139 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532743.1 protein_id gnl|my_center|LOCUS_07440 19123 16403 gene locus_tag LOCUS_07450 gene ppdK 19123 16403 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532744.1 protein_id gnl|my_center|LOCUS_07450 16464 16473 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19571 20998 gene locus_tag LOCUS_07460 19571 20998 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049733735.1 protein_id gnl|my_center|LOCUS_07460 20998 22413 gene locus_tag LOCUS_07470 20998 22413 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113717.1 protein_id gnl|my_center|LOCUS_07470 22501 23487 gene locus_tag LOCUS_07480 gene gmd 22501 23487 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918894.1 protein_id gnl|my_center|LOCUS_07480 23512 24471 gene locus_tag LOCUS_07490 23512 24471 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_07490 24597 25406 gene locus_tag LOCUS_07500 24597 25406 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284954.1 protein_id gnl|my_center|LOCUS_07500 25416 26156 gene locus_tag LOCUS_07510 25416 26156 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084033.1 protein_id gnl|my_center|LOCUS_07510 26318 27103 gene locus_tag LOCUS_07520 26318 27103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 28657 27143 gene locus_tag LOCUS_07530 28657 27143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 29033 28674 gene locus_tag LOCUS_07540 29033 28674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 29051 30544 gene locus_tag LOCUS_07550 29051 30544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 30541 33414 gene locus_tag LOCUS_07560 30541 33414 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419149.1 protein_id gnl|my_center|LOCUS_07560 33567 35798 gene locus_tag LOCUS_07570 33567 35798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 36938 35931 gene locus_tag LOCUS_07580 36938 35931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 37843 36965 gene locus_tag LOCUS_07590 37843 36965 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 protein_id gnl|my_center|LOCUS_07590 38487 37846 gene locus_tag LOCUS_07600 38487 37846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 39538 38492 gene locus_tag LOCUS_07610 39538 38492 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_07610 39711 40835 gene locus_tag LOCUS_07620 39711 40835 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_07620 40832 41950 gene locus_tag LOCUS_07630 40832 41950 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266713.1 protein_id gnl|my_center|LOCUS_07630 42035 42379 gene locus_tag LOCUS_07640 42035 42379 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532745.1 protein_id gnl|my_center|LOCUS_07640 42557 42631 gene locus_tag LOCUS_t00020 42557 42631 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 43011 42745 gene locus_tag LOCUS_07650 43011 42745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 43318 44022 gene locus_tag LOCUS_07660 43318 44022 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975534.1 protein_id gnl|my_center|LOCUS_07660 44364 44990 gene locus_tag LOCUS_07670 44364 44990 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393330.1 protein_id gnl|my_center|LOCUS_07670 45428 45153 gene locus_tag LOCUS_07680 45428 45153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 46646 45993 gene locus_tag LOCUS_07690 46646 45993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 47176 49017 gene locus_tag LOCUS_07700 47176 49017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 49320 50462 gene locus_tag LOCUS_07710 49320 50462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 50815 50899 gene locus_tag LOCUS_t00030 50815 50899 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 51021 51197 gene locus_tag LOCUS_07720 51021 51197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 51233 52348 gene locus_tag LOCUS_07730 51233 52348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 52385 54403 gene locus_tag LOCUS_07740 52385 54403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 54424 55617 gene locus_tag LOCUS_07750 54424 55617 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807953.1 protein_id gnl|my_center|LOCUS_07750 56959 55697 gene locus_tag LOCUS_07760 56959 55697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 58299 57022 gene locus_tag LOCUS_07770 58299 57022 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259281.1 protein_id gnl|my_center|LOCUS_07770 59072 58314 gene locus_tag LOCUS_07780 59072 58314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 61059 59059 gene locus_tag LOCUS_07790 61059 59059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 62180 61029 gene locus_tag LOCUS_07800 62180 61029 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878121.1 protein_id gnl|my_center|LOCUS_07800 63040 62186 gene locus_tag LOCUS_07810 63040 62186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 64944 63373 gene locus_tag LOCUS_07820 64944 63373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530603.1 protein_id gnl|my_center|LOCUS_07820 65083 66366 gene locus_tag LOCUS_07830 65083 66366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 66363 67424 gene locus_tag LOCUS_07840 66363 67424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 67425 69041 gene locus_tag LOCUS_07850 67425 69041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 69050 69958 gene locus_tag LOCUS_07860 69050 69958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 70337 71314 gene locus_tag LOCUS_07870 70337 71314 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_07870 71314 73233 gene locus_tag LOCUS_07880 71314 73233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 73230 74231 gene locus_tag LOCUS_07890 73230 74231 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_07890 74228 74935 gene locus_tag LOCUS_07900 74228 74935 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884059.1 protein_id gnl|my_center|LOCUS_07900 74949 75257 gene locus_tag LOCUS_07910 74949 75257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 75918 76109 gene locus_tag LOCUS_07920 75918 76109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence009 222 231 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1095 2384 gene locus_tag LOCUS_07930 1095 2384 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527916.1 protein_id gnl|my_center|LOCUS_07930 2494 2805 gene locus_tag LOCUS_07940 2494 2805 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527915.1 protein_id gnl|my_center|LOCUS_07940 2771 3256 gene locus_tag LOCUS_07950 gene bfr 2771 3256 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527914.1 protein_id gnl|my_center|LOCUS_07950 3269 4876 gene locus_tag LOCUS_07960 3269 4876 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527913.1 protein_id gnl|my_center|LOCUS_07960 4876 5955 gene locus_tag LOCUS_07970 4876 5955 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527912.1 protein_id gnl|my_center|LOCUS_07970 5959 7074 gene locus_tag LOCUS_07980 5959 7074 CDS product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527911.1 protein_id gnl|my_center|LOCUS_07980 7350 7078 gene locus_tag LOCUS_07990 7350 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 7231 7968 gene locus_tag LOCUS_08000 gene tsaB 7231 7968 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527910.1 protein_id gnl|my_center|LOCUS_08000 7968 8462 gene locus_tag LOCUS_08010 gene rimI 7968 8462 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527909.1 protein_id gnl|my_center|LOCUS_08010 8490 9290 gene locus_tag LOCUS_08020 8490 9290 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527908.1 protein_id gnl|my_center|LOCUS_08020 9376 10782 gene locus_tag LOCUS_08030 gene miaB 9376 10782 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503457.1 protein_id gnl|my_center|LOCUS_08030 10862 11911 gene locus_tag LOCUS_08040 10862 11911 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527906.1 protein_id gnl|my_center|LOCUS_08040 11924 12418 gene locus_tag LOCUS_08050 gene ybeY 11924 12418 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527905.1 protein_id gnl|my_center|LOCUS_08050 12446 13519 gene locus_tag LOCUS_08060 12446 13519 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527904.1 protein_id gnl|my_center|LOCUS_08060 13657 15249 gene locus_tag LOCUS_08070 gene lnt 13657 15249 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527902.1 protein_id gnl|my_center|LOCUS_08070 15389 15808 gene locus_tag LOCUS_08080 15389 15808 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527901.1 protein_id gnl|my_center|LOCUS_08080 15977 17242 gene locus_tag LOCUS_08090 gene metK 15977 17242 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527900.1 protein_id gnl|my_center|LOCUS_08090 17263 17964 gene locus_tag LOCUS_08100 17263 17964 CDS product tRNA (guanosine(46)-N(7))-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527899.1 protein_id gnl|my_center|LOCUS_08100 18220 18023 gene locus_tag LOCUS_08110 18220 18023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527898.1 protein_id gnl|my_center|LOCUS_08110 18518 19150 gene locus_tag LOCUS_08120 gene rimP 18518 19150 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527897.1 protein_id gnl|my_center|LOCUS_08120 19199 20794 gene locus_tag LOCUS_08130 gene nusA 19199 20794 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527896.1 protein_id gnl|my_center|LOCUS_08130 20833 21483 gene locus_tag LOCUS_08140 20833 21483 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527895.1 protein_id gnl|my_center|LOCUS_08140 21480 24044 gene locus_tag LOCUS_08150 gene infB 21480 24044 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527894.1 protein_id gnl|my_center|LOCUS_08150 24194 24583 gene locus_tag LOCUS_08160 gene rbfA 24194 24583 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527893.1 protein_id gnl|my_center|LOCUS_08160 24583 25548 gene locus_tag LOCUS_08170 gene truB 24583 25548 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527892.1 protein_id gnl|my_center|LOCUS_08170 25695 26789 gene locus_tag LOCUS_08180 gene corA 25695 26789 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527891.1 protein_id gnl|my_center|LOCUS_08180 26983 27252 gene locus_tag LOCUS_08190 gene rpsO 26983 27252 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006202929.1 protein_id gnl|my_center|LOCUS_08190 27670 29820 gene locus_tag LOCUS_08200 gene pnp 27670 29820 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527890.1 protein_id gnl|my_center|LOCUS_08200 29905 30918 gene locus_tag LOCUS_08210 29905 30918 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527889.1 protein_id gnl|my_center|LOCUS_08210 32472 30928 gene locus_tag LOCUS_08220 32472 30928 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527888.1 protein_id gnl|my_center|LOCUS_08220 33386 32574 gene locus_tag LOCUS_08230 gene fabI 33386 32574 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527887.1 protein_id gnl|my_center|LOCUS_08230 34619 33399 gene locus_tag LOCUS_08240 gene fabB 34619 33399 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527886.1 protein_id gnl|my_center|LOCUS_08240 35261 34743 gene locus_tag LOCUS_08250 gene fabA 35261 34743 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527885.1 protein_id gnl|my_center|LOCUS_08250 35560 35958 gene locus_tag LOCUS_08260 35560 35958 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503471.1 protein_id gnl|my_center|LOCUS_08260 35969 36358 gene locus_tag LOCUS_08270 35969 36358 CDS product DUF4260 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527883.1 protein_id gnl|my_center|LOCUS_08270 36840 36355 gene locus_tag LOCUS_08280 36840 36355 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527882.1 protein_id gnl|my_center|LOCUS_08280 37073 38074 gene locus_tag LOCUS_08290 37073 38074 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527881.1 protein_id gnl|my_center|LOCUS_08290 38493 38080 gene locus_tag LOCUS_08300 38493 38080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 39743 38490 gene locus_tag LOCUS_08310 39743 38490 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530809.1 protein_id gnl|my_center|LOCUS_08310 40228 39740 gene locus_tag LOCUS_08320 40228 39740 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527880.1 protein_id gnl|my_center|LOCUS_08320 40974 40153 gene locus_tag LOCUS_08330 40974 40153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 40426 40435 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42163 41006 gene locus_tag LOCUS_08340 gene recF 42163 41006 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527878.1 protein_id gnl|my_center|LOCUS_08340 43172 42189 gene locus_tag LOCUS_08350 gene dnaN 43172 42189 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527877.1 protein_id gnl|my_center|LOCUS_08350 42280 42289 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45120 43576 gene locus_tag LOCUS_08360 gene dnaA 45120 43576 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503475.1 protein_id gnl|my_center|LOCUS_08360 46231 45965 gene locus_tag LOCUS_08370 gene rpsT 46231 45965 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533694.1 protein_id gnl|my_center|LOCUS_08370 47163 46390 gene locus_tag LOCUS_08380 47163 46390 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 protein_id gnl|my_center|LOCUS_08380 48090 47203 gene locus_tag LOCUS_08390 gene mutM 48090 47203 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533692.1 protein_id gnl|my_center|LOCUS_08390 49324 48074 gene locus_tag LOCUS_08400 49324 48074 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533691.1 protein_id gnl|my_center|LOCUS_08400 49506 50462 gene locus_tag LOCUS_08410 49506 50462 CDS product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171180.1 protein_id gnl|my_center|LOCUS_08410 51124 50504 gene locus_tag LOCUS_08420 51124 50504 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533689.1 protein_id gnl|my_center|LOCUS_08420 51570 51163 gene locus_tag LOCUS_08430 51570 51163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 52324 51905 gene locus_tag LOCUS_08440 52324 51905 CDS product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533687.1 protein_id gnl|my_center|LOCUS_08440 52683 52853 gene locus_tag LOCUS_08450 52683 52853 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533686.1 protein_id gnl|my_center|LOCUS_08450 53007 53525 gene locus_tag LOCUS_08460 53007 53525 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533685.1 protein_id gnl|my_center|LOCUS_08460 53762 54544 gene locus_tag LOCUS_08470 gene cpaB 53762 54544 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533684.1 protein_id gnl|my_center|LOCUS_08470 54541 56073 gene locus_tag LOCUS_08480 54541 56073 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533683.1 protein_id gnl|my_center|LOCUS_08480 56088 56828 gene locus_tag LOCUS_08490 56088 56828 CDS product pilus assembly protein CpaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533682.1 protein_id gnl|my_center|LOCUS_08490 56851 58134 gene locus_tag LOCUS_08500 56851 58134 CDS product CpaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533681.1 protein_id gnl|my_center|LOCUS_08500 57899 57908 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58298 58307 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58544 59677 gene locus_tag LOCUS_08510 58544 59677 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533680.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08510 59707 60720 gene locus_tag LOCUS_08520 59707 60720 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533679.1 protein_id gnl|my_center|LOCUS_08520 60730 61746 gene locus_tag LOCUS_08530 60730 61746 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533678.1 protein_id gnl|my_center|LOCUS_08530 61905 62219 gene locus_tag LOCUS_08540 61905 62219 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052820167.1 protein_id gnl|my_center|LOCUS_08540 63090 62266 gene locus_tag LOCUS_08550 63090 62266 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533677.1 protein_id gnl|my_center|LOCUS_08550 63579 63343 gene locus_tag LOCUS_08560 63579 63343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 63469 64680 gene locus_tag LOCUS_08570 63469 64680 CDS product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533676.1 protein_id gnl|my_center|LOCUS_08570 64759 65097 gene locus_tag LOCUS_08580 64759 65097 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533675.1 protein_id gnl|my_center|LOCUS_08580 65126 65986 gene locus_tag LOCUS_08590 65126 65986 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173545.1 protein_id gnl|my_center|LOCUS_08590 66119 68596 gene locus_tag LOCUS_08600 66119 68596 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171190.1 protein_id gnl|my_center|LOCUS_08600 68616 69332 gene locus_tag LOCUS_08610 gene pdeM 68616 69332 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533672.1 protein_id gnl|my_center|LOCUS_08610 70317 69346 gene locus_tag LOCUS_08620 70317 69346 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015931585.1 protein_id gnl|my_center|LOCUS_08620 70411 71289 gene locus_tag LOCUS_08630 70411 71289 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112482.1 protein_id gnl|my_center|LOCUS_08630 72238 71303 gene locus_tag LOCUS_08640 72238 71303 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533671.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence010 50 283 gene locus_tag LOCUS_08650 50 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 384 1385 gene locus_tag LOCUS_08660 384 1385 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 protein_id gnl|my_center|LOCUS_08660 2294 1407 gene locus_tag LOCUS_08670 2294 1407 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242371.1 protein_id gnl|my_center|LOCUS_08670 2469 2855 gene locus_tag LOCUS_08680 2469 2855 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242372.1 protein_id gnl|my_center|LOCUS_08680 3272 4174 gene locus_tag LOCUS_08690 3272 4174 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529092.1 protein_id gnl|my_center|LOCUS_08690 4179 5570 gene locus_tag LOCUS_08700 gene livM 4179 5570 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529093.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08700 5528 5537 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5570 5791 gene locus_tag LOCUS_08710 5570 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08710 5791 6891 gene locus_tag LOCUS_08720 5791 6891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 6891 7619 gene locus_tag LOCUS_08730 6891 7619 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529095.1 protein_id gnl|my_center|LOCUS_08730 7732 8079 gene locus_tag LOCUS_08740 7732 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529096.1 protein_id gnl|my_center|LOCUS_08740 8217 9335 gene locus_tag LOCUS_08750 8217 9335 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394374.1 protein_id gnl|my_center|LOCUS_08750 9543 13001 gene locus_tag LOCUS_08760 gene pyc 9543 13001 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529098.1 protein_id gnl|my_center|LOCUS_08760 13155 13415 gene locus_tag LOCUS_08770 13155 13415 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529099.1 protein_id gnl|my_center|LOCUS_08770 13855 14301 gene locus_tag LOCUS_08780 13855 14301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529100.1 protein_id gnl|my_center|LOCUS_08780 14863 14339 gene locus_tag LOCUS_08790 14863 14339 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085870.1 protein_id gnl|my_center|LOCUS_08790 15033 15377 gene locus_tag LOCUS_08800 15033 15377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529101.1 protein_id gnl|my_center|LOCUS_08800 15837 15433 gene locus_tag LOCUS_08810 gene msrB 15837 15433 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529102.1 protein_id gnl|my_center|LOCUS_08810 17131 15941 gene locus_tag LOCUS_08820 17131 15941 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529103.1 protein_id gnl|my_center|LOCUS_08820 17586 17140 gene locus_tag LOCUS_08830 17586 17140 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529104.1 protein_id gnl|my_center|LOCUS_08830 18856 18017 gene locus_tag LOCUS_08840 18856 18017 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529106.1 protein_id gnl|my_center|LOCUS_08840 19251 19838 gene locus_tag LOCUS_08850 19251 19838 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529107.1 protein_id gnl|my_center|LOCUS_08850 20119 19901 gene locus_tag LOCUS_08860 20119 19901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 20487 20221 gene locus_tag LOCUS_08870 20487 20221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 20270 20279 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20371 20751 gene locus_tag LOCUS_08880 20371 20751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08880 20823 21590 gene locus_tag LOCUS_08890 20823 21590 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529109.1 protein_id gnl|my_center|LOCUS_08890 22130 21642 gene locus_tag LOCUS_08900 22130 21642 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529111.1 protein_id gnl|my_center|LOCUS_08900 22176 22499 gene locus_tag LOCUS_08910 22176 22499 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529112.1 protein_id gnl|my_center|LOCUS_08910 22713 23462 gene locus_tag LOCUS_08920 22713 23462 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529113.1 protein_id gnl|my_center|LOCUS_08920 23472 23801 gene locus_tag LOCUS_08930 23472 23801 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173256.1 protein_id gnl|my_center|LOCUS_08930 24308 23832 gene locus_tag LOCUS_08940 24308 23832 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529116.1 protein_id gnl|my_center|LOCUS_08940 25134 24310 gene locus_tag LOCUS_08950 25134 24310 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226532.1 protein_id gnl|my_center|LOCUS_08950 25288 25890 gene locus_tag LOCUS_08960 25288 25890 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529117.1 protein_id gnl|my_center|LOCUS_08960 26098 26107 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26416 26195 gene locus_tag LOCUS_08970 gene rpmE 26416 26195 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529118.1 protein_id gnl|my_center|LOCUS_08970 26622 28424 gene locus_tag LOCUS_08980 26622 28424 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529119.1 protein_id gnl|my_center|LOCUS_08980 28586 28446 gene locus_tag LOCUS_08990 28586 28446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 30122 28638 gene locus_tag LOCUS_09000 30122 28638 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529120.1 protein_id gnl|my_center|LOCUS_09000 30269 30622 gene locus_tag LOCUS_09010 30269 30622 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529121.1 protein_id gnl|my_center|LOCUS_09010 31110 30685 gene locus_tag LOCUS_09020 31110 30685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529122.1 protein_id gnl|my_center|LOCUS_09020 32378 31350 gene locus_tag LOCUS_09030 32378 31350 CDS product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529123.1 protein_id gnl|my_center|LOCUS_09030 33405 32380 gene locus_tag LOCUS_09040 33405 32380 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529124.1 protein_id gnl|my_center|LOCUS_09040 34304 33612 gene locus_tag LOCUS_09050 34304 33612 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162532.1 protein_id gnl|my_center|LOCUS_09050 35218 34418 gene locus_tag LOCUS_09060 35218 34418 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529126.1 protein_id gnl|my_center|LOCUS_09060 35809 35243 gene locus_tag LOCUS_09070 gene efp 35809 35243 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529127.1 protein_id gnl|my_center|LOCUS_09070 37030 35936 gene locus_tag LOCUS_09080 37030 35936 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529128.1 protein_id gnl|my_center|LOCUS_09080 37679 37032 gene locus_tag LOCUS_09090 37679 37032 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529129.1 protein_id gnl|my_center|LOCUS_09090 38748 37849 gene locus_tag LOCUS_09100 38748 37849 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529130.1 protein_id gnl|my_center|LOCUS_09100 38968 39321 gene locus_tag LOCUS_09110 38968 39321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 40529 39411 gene locus_tag LOCUS_09120 40529 39411 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965106.1 protein_id gnl|my_center|LOCUS_09120 40320 40329 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40680 41114 gene locus_tag LOCUS_09130 40680 41114 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969510.1 protein_id gnl|my_center|LOCUS_09130 41611 41153 gene locus_tag LOCUS_09140 41611 41153 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530753.1 protein_id gnl|my_center|LOCUS_09140 41795 42565 gene locus_tag LOCUS_09150 41795 42565 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529133.1 protein_id gnl|my_center|LOCUS_09150 43155 42604 gene locus_tag LOCUS_09160 43155 42604 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529134.1 protein_id gnl|my_center|LOCUS_09160 43690 44220 gene locus_tag LOCUS_09170 43690 44220 CDS product DUF1465 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529136.1 protein_id gnl|my_center|LOCUS_09170 44497 45006 gene locus_tag LOCUS_09180 gene ruvC 44497 45006 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529137.1 protein_id gnl|my_center|LOCUS_09180 45017 45637 gene locus_tag LOCUS_09190 gene ruvA 45017 45637 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529140.1 protein_id gnl|my_center|LOCUS_09190 45877 47001 gene locus_tag LOCUS_09200 45877 47001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 47047 47847 gene locus_tag LOCUS_09210 47047 47847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09210 47796 47805 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47844 48077 gene locus_tag LOCUS_09220 47844 48077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09220 48207 49109 gene locus_tag LOCUS_09230 48207 49109 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529142.1 protein_id gnl|my_center|LOCUS_09230 50388 49120 gene locus_tag LOCUS_09240 50388 49120 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529143.1 protein_id gnl|my_center|LOCUS_09240 50423 50896 gene locus_tag LOCUS_09250 gene ybgC 50423 50896 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529144.1 protein_id gnl|my_center|LOCUS_09250 51204 51914 gene locus_tag LOCUS_09260 gene tolQ 51204 51914 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529145.1 protein_id gnl|my_center|LOCUS_09260 51924 52376 gene locus_tag LOCUS_09270 gene tolR 51924 52376 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529146.1 protein_id gnl|my_center|LOCUS_09270 52384 53433 gene locus_tag LOCUS_09280 52384 53433 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529147.1 protein_id gnl|my_center|LOCUS_09280 53473 54777 gene locus_tag LOCUS_09290 gene tolB 53473 54777 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529148.1 protein_id gnl|my_center|LOCUS_09290 54960 55202 gene locus_tag LOCUS_09300 54960 55202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09300 55444 55950 gene locus_tag LOCUS_09310 gene pal 55444 55950 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529149.1 protein_id gnl|my_center|LOCUS_09310 56128 57213 gene locus_tag LOCUS_09320 gene ybgF 56128 57213 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529150.1 protein_id gnl|my_center|LOCUS_09320 57272 58519 gene locus_tag LOCUS_09330 gene tilS 57272 58519 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529151.1 protein_id gnl|my_center|LOCUS_09330 58644 60590 gene locus_tag LOCUS_09340 gene ftsH 58644 60590 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529152.1 protein_id gnl|my_center|LOCUS_09340 60509 60518 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 61317 60859 gene locus_tag LOCUS_09350 61317 60859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529153.1 protein_id gnl|my_center|LOCUS_09350 62971 61928 gene locus_tag LOCUS_09360 62971 61928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529154.1 protein_id gnl|my_center|LOCUS_09360 63317 64669 gene locus_tag LOCUS_09370 gene glmM 63317 64669 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529155.1 protein_id gnl|my_center|LOCUS_09370 64897 65712 gene locus_tag LOCUS_09380 64897 65712 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529156.1 protein_id gnl|my_center|LOCUS_09380 65918 66796 gene locus_tag LOCUS_09390 65918 66796 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529157.1 protein_id gnl|my_center|LOCUS_09390 66997 68172 gene locus_tag LOCUS_09400 66997 68172 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 protein_id gnl|my_center|LOCUS_09400 68240 69841 gene locus_tag LOCUS_09410 gene serA 68240 69841 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529159.1 protein_id gnl|my_center|LOCUS_09410 70110 71180 gene locus_tag LOCUS_09420 70110 71180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09420 71025 71034 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 71071 71409 gene locus_tag LOCUS_09430 71071 71409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09430 >Feature sequence011 2496 1360 gene locus_tag LOCUS_09440 2496 1360 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530192.1 protein_id gnl|my_center|LOCUS_09440 3504 2497 gene locus_tag LOCUS_09450 3504 2497 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530191.1 protein_id gnl|my_center|LOCUS_09450 5603 3609 gene locus_tag LOCUS_09460 5603 3609 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530190.1 protein_id gnl|my_center|LOCUS_09460 7263 5797 gene locus_tag LOCUS_09470 7263 5797 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530189.1 protein_id gnl|my_center|LOCUS_09470 7477 8352 gene locus_tag LOCUS_09480 7477 8352 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530188.1 protein_id gnl|my_center|LOCUS_09480 9496 8387 gene locus_tag LOCUS_09490 9496 8387 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173620.1 protein_id gnl|my_center|LOCUS_09490 9949 11718 gene locus_tag LOCUS_09500 9949 11718 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532808.1 protein_id gnl|my_center|LOCUS_09500 11748 12500 gene locus_tag LOCUS_09510 11748 12500 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532807.1 protein_id gnl|my_center|LOCUS_09510 12738 14063 gene locus_tag LOCUS_09520 12738 14063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530577.1 protein_id gnl|my_center|LOCUS_09520 14056 14649 gene locus_tag LOCUS_09530 14056 14649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530580.1 protein_id gnl|my_center|LOCUS_09530 14646 15224 gene locus_tag LOCUS_09540 14646 15224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530579.1 protein_id gnl|my_center|LOCUS_09540 15235 15804 gene locus_tag LOCUS_09550 15235 15804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530578.1 protein_id gnl|my_center|LOCUS_09550 16444 15827 gene locus_tag LOCUS_09560 gene pdxH 16444 15827 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532806.1 protein_id gnl|my_center|LOCUS_09560 16554 16949 gene locus_tag LOCUS_09570 16554 16949 CDS product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532805.1 protein_id gnl|my_center|LOCUS_09570 17050 17994 gene locus_tag LOCUS_09580 17050 17994 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532804.1 protein_id gnl|my_center|LOCUS_09580 18103 18921 gene locus_tag LOCUS_09590 gene fabI 18103 18921 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532803.1 protein_id gnl|my_center|LOCUS_09590 18982 19569 gene locus_tag LOCUS_09600 18982 19569 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532802.1 protein_id gnl|my_center|LOCUS_09600 19883 19620 gene locus_tag LOCUS_09610 19883 19620 CDS product DUF1344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532801.1 protein_id gnl|my_center|LOCUS_09610 21668 20052 gene locus_tag LOCUS_09620 21668 20052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 22403 21681 gene locus_tag LOCUS_09630 22403 21681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 22807 22403 gene locus_tag LOCUS_09640 22807 22403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 23823 22804 gene locus_tag LOCUS_09650 23823 22804 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_09650 24271 25380 gene locus_tag LOCUS_09660 gene aroC 24271 25380 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532800.1 protein_id gnl|my_center|LOCUS_09660 25474 26574 gene locus_tag LOCUS_09670 gene ribB 25474 26574 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532799.1 protein_id gnl|my_center|LOCUS_09670 26602 26988 gene locus_tag LOCUS_09680 26602 26988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09680 28405 27182 gene locus_tag LOCUS_09690 28405 27182 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532797.1 protein_id gnl|my_center|LOCUS_09690 28526 29119 gene locus_tag LOCUS_09700 28526 29119 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532796.1 protein_id gnl|my_center|LOCUS_09700 29249 30229 gene locus_tag LOCUS_09710 29249 30229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532795.1 protein_id gnl|my_center|LOCUS_09710 30317 31243 gene locus_tag LOCUS_09720 30317 31243 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532793.1 protein_id gnl|my_center|LOCUS_09720 31247 31498 gene locus_tag LOCUS_09730 31247 31498 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532792.1 protein_id gnl|my_center|LOCUS_09730 31543 31809 gene locus_tag LOCUS_09740 31543 31809 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532791.1 protein_id gnl|my_center|LOCUS_09740 31818 32738 gene locus_tag LOCUS_09750 31818 32738 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532790.1 protein_id gnl|my_center|LOCUS_09750 32802 34760 gene locus_tag LOCUS_09760 gene dxs 32802 34760 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532789.1 protein_id gnl|my_center|LOCUS_09760 34910 35197 gene locus_tag LOCUS_09770 34910 35197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532788.1 protein_id gnl|my_center|LOCUS_09770 35251 35808 gene locus_tag LOCUS_09780 35251 35808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 35301 35310 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35805 37046 gene locus_tag LOCUS_09790 35805 37046 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532784.1 protein_id gnl|my_center|LOCUS_09790 38463 37051 gene locus_tag LOCUS_09800 gene tldD 38463 37051 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532782.1 protein_id gnl|my_center|LOCUS_09800 39141 38593 gene locus_tag LOCUS_09810 39141 38593 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532781.1 protein_id gnl|my_center|LOCUS_09810 39638 39306 gene locus_tag LOCUS_09820 39638 39306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 39520 40386 gene locus_tag LOCUS_09830 gene coxB 39520 40386 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532780.1 protein_id gnl|my_center|LOCUS_09830 40412 42076 gene locus_tag LOCUS_09840 gene ctaD 40412 42076 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532779.1 protein_id gnl|my_center|LOCUS_09840 42155 43099 gene locus_tag LOCUS_09850 42155 43099 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532778.1 protein_id gnl|my_center|LOCUS_09850 43096 43263 gene locus_tag LOCUS_09860 43096 43263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532777.1 protein_id gnl|my_center|LOCUS_09860 43266 43895 gene locus_tag LOCUS_09870 43266 43895 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532776.1 protein_id gnl|my_center|LOCUS_09870 43897 44778 gene locus_tag LOCUS_09880 43897 44778 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532775.1 protein_id gnl|my_center|LOCUS_09880 44901 45359 gene locus_tag LOCUS_09890 44901 45359 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171659.1 protein_id gnl|my_center|LOCUS_09890 45356 45742 gene locus_tag LOCUS_09900 45356 45742 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503617.1 protein_id gnl|my_center|LOCUS_09900 45790 46494 gene locus_tag LOCUS_09910 45790 46494 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171660.1 protein_id gnl|my_center|LOCUS_09910 46580 47584 gene locus_tag LOCUS_09920 gene ispH 46580 47584 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532771.1 protein_id gnl|my_center|LOCUS_09920 47592 48554 gene locus_tag LOCUS_09930 47592 48554 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532770.1 protein_id gnl|my_center|LOCUS_09930 48551 49081 gene locus_tag LOCUS_09940 gene rnhA 48551 49081 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532769.1 protein_id gnl|my_center|LOCUS_09940 49124 49717 gene locus_tag LOCUS_09950 49124 49717 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970805.1 protein_id gnl|my_center|LOCUS_09950 49817 50479 gene locus_tag LOCUS_09960 49817 50479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 50983 50507 gene locus_tag LOCUS_09970 50983 50507 CDS product DUF2938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532768.1 protein_id gnl|my_center|LOCUS_09970 51550 51071 gene locus_tag LOCUS_09980 51550 51071 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532767.1 protein_id gnl|my_center|LOCUS_09980 52489 51683 gene locus_tag LOCUS_09990 52489 51683 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532766.1 protein_id gnl|my_center|LOCUS_09990 52672 53280 gene locus_tag LOCUS_10000 52672 53280 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532765.1 protein_id gnl|my_center|LOCUS_10000 56172 53281 gene locus_tag LOCUS_10010 56172 53281 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532764.1 protein_id gnl|my_center|LOCUS_10010 56769 56173 gene locus_tag LOCUS_10020 56769 56173 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532763.1 protein_id gnl|my_center|LOCUS_10020 58077 56785 gene locus_tag LOCUS_10030 58077 56785 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532762.1 protein_id gnl|my_center|LOCUS_10030 59489 58092 gene locus_tag LOCUS_10040 gene thrC 59489 58092 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532761.1 protein_id gnl|my_center|LOCUS_10040 59698 59492 gene locus_tag LOCUS_10050 59698 59492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 59618 60340 gene locus_tag LOCUS_10060 59618 60340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532760.1 protein_id gnl|my_center|LOCUS_10060 62035 60473 gene locus_tag LOCUS_10070 62035 60473 CDS product winged helix-turn-helix domain-containing tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533667.1 protein_id gnl|my_center|LOCUS_10070 62140 62601 gene locus_tag LOCUS_10080 62140 62601 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533666.1 protein_id gnl|my_center|LOCUS_10080 63439 62750 gene locus_tag LOCUS_10090 63439 62750 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532759.1 protein_id gnl|my_center|LOCUS_10090 63635 64759 gene locus_tag LOCUS_10100 63635 64759 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532758.1 protein_id gnl|my_center|LOCUS_10100 65429 64818 gene locus_tag LOCUS_10110 65429 64818 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532757.1 protein_id gnl|my_center|LOCUS_10110 66582 65455 gene locus_tag LOCUS_10120 gene mutY 66582 65455 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532756.1 protein_id gnl|my_center|LOCUS_10120 66616 67116 gene locus_tag LOCUS_10130 66616 67116 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532755.1 protein_id gnl|my_center|LOCUS_10130 67288 67986 gene locus_tag LOCUS_10140 67288 67986 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532754.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence012 699 1160 gene locus_tag LOCUS_10150 gene phnG 699 1160 CDS product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529524.1 protein_id gnl|my_center|LOCUS_10150 1160 1765 gene locus_tag LOCUS_10160 gene phnH 1160 1765 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529523.1 protein_id gnl|my_center|LOCUS_10160 1767 2879 gene locus_tag LOCUS_10170 1767 2879 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529522.1 protein_id gnl|my_center|LOCUS_10170 2876 3544 gene locus_tag LOCUS_10180 2876 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 3566 4465 gene locus_tag LOCUS_10190 3566 4465 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529519.1 protein_id gnl|my_center|LOCUS_10190 4462 5298 gene locus_tag LOCUS_10200 gene phnK 4462 5298 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529518.1 protein_id gnl|my_center|LOCUS_10200 4897 4906 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6553 5642 gene locus_tag LOCUS_10210 gene rpoH 6553 5642 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529255.1 protein_id gnl|my_center|LOCUS_10210 7777 6788 gene locus_tag LOCUS_10220 7777 6788 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529256.1 protein_id gnl|my_center|LOCUS_10220 7885 8268 gene locus_tag LOCUS_10230 7885 8268 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529257.1 protein_id gnl|my_center|LOCUS_10230 8265 8678 gene locus_tag LOCUS_10240 8265 8678 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529258.1 protein_id gnl|my_center|LOCUS_10240 8764 8838 gene locus_tag LOCUS_t00040 8764 8838 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9054 9644 gene locus_tag LOCUS_10250 9054 9644 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529260.1 protein_id gnl|my_center|LOCUS_10250 9656 10534 gene locus_tag LOCUS_10260 9656 10534 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529261.1 protein_id gnl|my_center|LOCUS_10260 10838 11206 gene locus_tag LOCUS_10270 10838 11206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173200.1 protein_id gnl|my_center|LOCUS_10270 11649 11434 gene locus_tag LOCUS_10280 11649 11434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529263.1 protein_id gnl|my_center|LOCUS_10280 12224 11880 gene locus_tag LOCUS_10290 12224 11880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529266.1 protein_id gnl|my_center|LOCUS_10290 12409 14364 gene locus_tag LOCUS_10300 12409 14364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10300 14332 14341 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14361 16202 gene locus_tag LOCUS_10310 14361 16202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10310 16752 17780 gene locus_tag LOCUS_10320 16752 17780 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529268.1 protein_id gnl|my_center|LOCUS_10320 17974 19434 gene locus_tag LOCUS_10330 gene pstC 17974 19434 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529269.1 protein_id gnl|my_center|LOCUS_10330 19431 20747 gene locus_tag LOCUS_10340 gene pstA 19431 20747 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529270.1 protein_id gnl|my_center|LOCUS_10340 20763 21587 gene locus_tag LOCUS_10350 gene pstB 20763 21587 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529271.1 protein_id gnl|my_center|LOCUS_10350 21611 22321 gene locus_tag LOCUS_10360 gene phoU 21611 22321 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529272.1 protein_id gnl|my_center|LOCUS_10360 22341 23030 gene locus_tag LOCUS_10370 gene phoB 22341 23030 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010911896.1 protein_id gnl|my_center|LOCUS_10370 24230 23034 gene locus_tag LOCUS_10380 24230 23034 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529273.1 protein_id gnl|my_center|LOCUS_10380 24148 24345 gene locus_tag LOCUS_10390 24148 24345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 24545 25585 gene locus_tag LOCUS_10400 gene xylF 24545 25585 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529274.1 protein_id gnl|my_center|LOCUS_10400 25744 27063 gene locus_tag LOCUS_10410 25744 27063 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529275.1 protein_id gnl|my_center|LOCUS_10410 27092 27892 gene locus_tag LOCUS_10420 27092 27892 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529276.1 protein_id gnl|my_center|LOCUS_10420 28016 29638 gene locus_tag LOCUS_10430 28016 29638 CDS product CHASE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529277.1 protein_id gnl|my_center|LOCUS_10430 29980 29738 gene locus_tag LOCUS_10440 29980 29738 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529278.1 protein_id gnl|my_center|LOCUS_10440 30391 30062 gene locus_tag LOCUS_10450 30391 30062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529279.1 protein_id gnl|my_center|LOCUS_10450 30678 30502 gene locus_tag LOCUS_10460 30678 30502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 31875 30841 gene locus_tag LOCUS_10470 31875 30841 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063169141.1 protein_id gnl|my_center|LOCUS_10470 32205 32041 gene locus_tag LOCUS_10480 32205 32041 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529282.1 protein_id gnl|my_center|LOCUS_10480 33193 32399 gene locus_tag LOCUS_10490 33193 32399 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529283.1 protein_id gnl|my_center|LOCUS_10490 33409 33612 gene locus_tag LOCUS_10500 33409 33612 CDS product NepR family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032809255.1 protein_id gnl|my_center|LOCUS_10500 33616 34167 gene locus_tag LOCUS_10510 33616 34167 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529285.1 protein_id gnl|my_center|LOCUS_10510 34579 34202 gene locus_tag LOCUS_10520 34579 34202 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336897.1 protein_id gnl|my_center|LOCUS_10520 34810 35136 gene locus_tag LOCUS_10530 34810 35136 CDS product DUF883 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529287.1 protein_id gnl|my_center|LOCUS_10530 35153 35611 gene locus_tag LOCUS_10540 35153 35611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529288.1 protein_id gnl|my_center|LOCUS_10540 37180 35666 gene locus_tag LOCUS_10550 37180 35666 CDS product HWE histidine kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173815.1 protein_id gnl|my_center|LOCUS_10550 37344 37511 gene locus_tag LOCUS_10560 37344 37511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529290.1 protein_id gnl|my_center|LOCUS_10560 38467 37547 gene locus_tag LOCUS_10570 38467 37547 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529291.1 protein_id gnl|my_center|LOCUS_10570 38718 40031 gene locus_tag LOCUS_10580 38718 40031 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529292.1 protein_id gnl|my_center|LOCUS_10580 40343 40083 gene locus_tag LOCUS_10590 40343 40083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10590 41641 40232 gene locus_tag LOCUS_10600 41641 40232 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10600 40330 40339 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41862 42794 gene locus_tag LOCUS_10610 41862 42794 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529294.1 protein_id gnl|my_center|LOCUS_10610 42798 43433 gene locus_tag LOCUS_10620 42798 43433 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529295.1 protein_id gnl|my_center|LOCUS_10620 43426 43725 gene locus_tag LOCUS_10630 43426 43725 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529296.1 protein_id gnl|my_center|LOCUS_10630 43868 44926 gene locus_tag LOCUS_10640 43868 44926 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529297.1 protein_id gnl|my_center|LOCUS_10640 45095 44928 gene locus_tag LOCUS_10650 45095 44928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 46351 45092 gene locus_tag LOCUS_10660 46351 45092 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968121.1 protein_id gnl|my_center|LOCUS_10660 47928 46354 gene locus_tag LOCUS_10670 47928 46354 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339387.1 protein_id gnl|my_center|LOCUS_10670 49534 47915 gene locus_tag LOCUS_10680 49534 47915 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966434.1 protein_id gnl|my_center|LOCUS_10680 49733 50527 gene locus_tag LOCUS_10690 49733 50527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 50534 51220 gene locus_tag LOCUS_10700 50534 51220 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564165.1 protein_id gnl|my_center|LOCUS_10700 51273 52355 gene locus_tag LOCUS_10710 51273 52355 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719295.1 protein_id gnl|my_center|LOCUS_10710 52765 52499 gene locus_tag LOCUS_10720 52765 52499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 52507 52516 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52697 53794 gene locus_tag LOCUS_10730 52697 53794 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529298.1 protein_id gnl|my_center|LOCUS_10730 54855 53758 gene locus_tag LOCUS_10740 54855 53758 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532646.1 protein_id gnl|my_center|LOCUS_10740 55883 54987 gene locus_tag LOCUS_10750 55883 54987 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532647.1 protein_id gnl|my_center|LOCUS_10750 55966 57558 gene locus_tag LOCUS_10760 55966 57558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171735.1 protein_id gnl|my_center|LOCUS_10760 57589 58521 gene locus_tag LOCUS_10770 57589 58521 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532649.1 protein_id gnl|my_center|LOCUS_10770 58966 58637 gene locus_tag LOCUS_10780 58966 58637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 59237 60676 gene locus_tag LOCUS_10790 59237 60676 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563245.1 protein_id gnl|my_center|LOCUS_10790 60939 60730 gene locus_tag LOCUS_10800 60939 60730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533291.1 protein_id gnl|my_center|LOCUS_10800 61112 60936 gene locus_tag LOCUS_10810 61112 60936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532732.1 protein_id gnl|my_center|LOCUS_10810 61213 61533 gene locus_tag LOCUS_10820 61213 61533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184871738.1 protein_id gnl|my_center|LOCUS_10820 62267 61563 gene locus_tag LOCUS_10830 62267 61563 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532730.1 protein_id gnl|my_center|LOCUS_10830 63355 62897 gene locus_tag LOCUS_10840 63355 62897 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531548.1 protein_id gnl|my_center|LOCUS_10840 63619 63470 gene locus_tag LOCUS_10850 63619 63470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530518.1 protein_id gnl|my_center|LOCUS_10850 64194 63676 gene locus_tag LOCUS_10860 64194 63676 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967534.1 protein_id gnl|my_center|LOCUS_10860 64147 64156 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 65747 64221 gene locus_tag LOCUS_10870 65747 64221 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204917.1 protein_id gnl|my_center|LOCUS_10870 65882 67714 gene locus_tag LOCUS_10880 65882 67714 CDS product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531526.1 protein_id gnl|my_center|LOCUS_10880 67674 67841 gene locus_tag LOCUS_10890 67674 67841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10890 67933 68094 gene locus_tag LOCUS_10900 67933 68094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 68347 69414 gene locus_tag LOCUS_10910 68347 69414 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804101.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence013 942 457 gene locus_tag LOCUS_10920 942 457 CDS product DUF2948 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530200.1 protein_id gnl|my_center|LOCUS_10920 2415 1123 gene locus_tag LOCUS_10930 gene murA 2415 1123 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530201.1 protein_id gnl|my_center|LOCUS_10930 2751 2551 gene locus_tag LOCUS_10940 2751 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530202.1 protein_id gnl|my_center|LOCUS_10940 3023 3097 gene locus_tag LOCUS_t00050 3023 3097 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3172 3357 gene locus_tag LOCUS_10950 3172 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3889 3470 gene locus_tag LOCUS_10960 3889 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10960 4362 3886 gene locus_tag LOCUS_10970 4362 3886 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508791.1 protein_id gnl|my_center|LOCUS_10970 5159 4374 gene locus_tag LOCUS_10980 5159 4374 CDS product putative DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508790.1 protein_id gnl|my_center|LOCUS_10980 6180 5146 gene locus_tag LOCUS_10990 6180 5146 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508789.1 protein_id gnl|my_center|LOCUS_10990 6493 6224 gene locus_tag LOCUS_11000 6493 6224 CDS product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706878.1 protein_id gnl|my_center|LOCUS_11000 7589 6729 gene locus_tag LOCUS_11010 7589 6729 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441684.1 protein_id gnl|my_center|LOCUS_11010 7811 8086 gene locus_tag LOCUS_11020 7811 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528891.1 protein_id gnl|my_center|LOCUS_11020 8276 8551 gene locus_tag LOCUS_11030 8276 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528891.1 protein_id gnl|my_center|LOCUS_11030 8723 9637 gene locus_tag LOCUS_11040 8723 9637 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399088.1 protein_id gnl|my_center|LOCUS_11040 9825 10325 gene locus_tag LOCUS_11050 9825 10325 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614725.1 protein_id gnl|my_center|LOCUS_11050 10455 11618 gene locus_tag LOCUS_11060 10455 11618 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614724.1 protein_id gnl|my_center|LOCUS_11060 11663 12127 gene locus_tag LOCUS_11070 11663 12127 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614723.1 protein_id gnl|my_center|LOCUS_11070 13104 12190 gene locus_tag LOCUS_11080 13104 12190 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399088.1 protein_id gnl|my_center|LOCUS_11080 13380 14162 gene locus_tag LOCUS_11090 13380 14162 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529312.1 protein_id gnl|my_center|LOCUS_11090 14188 15339 gene locus_tag LOCUS_11100 14188 15339 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085560.1 protein_id gnl|my_center|LOCUS_11100 15373 16767 gene locus_tag LOCUS_11110 15373 16767 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086508.1 protein_id gnl|my_center|LOCUS_11110 16787 18133 gene locus_tag LOCUS_11120 16787 18133 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023908.1 protein_id gnl|my_center|LOCUS_11120 18576 18088 gene locus_tag LOCUS_11130 18576 18088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 18478 18978 gene locus_tag LOCUS_11140 18478 18978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 19867 18962 gene locus_tag LOCUS_11150 19867 18962 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965825.1 protein_id gnl|my_center|LOCUS_11150 21066 20254 gene locus_tag LOCUS_11160 21066 20254 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530391.1 protein_id gnl|my_center|LOCUS_11160 22272 21070 gene locus_tag LOCUS_11170 22272 21070 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530392.1 protein_id gnl|my_center|LOCUS_11170 23888 22272 gene locus_tag LOCUS_11180 23888 22272 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530393.1 protein_id gnl|my_center|LOCUS_11180 25381 23885 gene locus_tag LOCUS_11190 25381 23885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11190 25949 25419 gene locus_tag LOCUS_11200 25949 25419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11200 25491 25500 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27616 25946 gene locus_tag LOCUS_11210 27616 25946 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530395.1 protein_id gnl|my_center|LOCUS_11210 29131 27734 gene locus_tag LOCUS_11220 29131 27734 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530396.1 protein_id gnl|my_center|LOCUS_11220 28811 28820 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29960 29196 gene locus_tag LOCUS_11230 29960 29196 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827580.1 protein_id gnl|my_center|LOCUS_11230 31050 29971 gene locus_tag LOCUS_11240 31050 29971 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530398.1 protein_id gnl|my_center|LOCUS_11240 32217 31054 gene locus_tag LOCUS_11250 32217 31054 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530399.1 protein_id gnl|my_center|LOCUS_11250 33329 32295 gene locus_tag LOCUS_11260 33329 32295 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530400.1 protein_id gnl|my_center|LOCUS_11260 34365 33418 gene locus_tag LOCUS_11270 34365 33418 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530401.1 protein_id gnl|my_center|LOCUS_11270 35199 34450 gene locus_tag LOCUS_11280 35199 34450 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530402.1 protein_id gnl|my_center|LOCUS_11280 35923 35201 gene locus_tag LOCUS_11290 35923 35201 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530403.1 protein_id gnl|my_center|LOCUS_11290 36993 36205 gene locus_tag LOCUS_11300 36993 36205 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173766.1 protein_id gnl|my_center|LOCUS_11300 37391 37044 gene locus_tag LOCUS_11310 37391 37044 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530405.1 protein_id gnl|my_center|LOCUS_11310 38211 37405 gene locus_tag LOCUS_11320 38211 37405 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530406.1 protein_id gnl|my_center|LOCUS_11320 39016 38204 gene locus_tag LOCUS_11330 39016 38204 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530407.1 protein_id gnl|my_center|LOCUS_11330 39911 39021 gene locus_tag LOCUS_11340 39911 39021 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530408.1 protein_id gnl|my_center|LOCUS_11340 40021 40785 gene locus_tag LOCUS_11350 40021 40785 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530409.1 protein_id gnl|my_center|LOCUS_11350 40794 42011 gene locus_tag LOCUS_11360 40794 42011 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530410.1 protein_id gnl|my_center|LOCUS_11360 45639 42100 gene locus_tag LOCUS_11370 45639 42100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 46696 45950 gene locus_tag LOCUS_11380 46696 45950 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529854.1 protein_id gnl|my_center|LOCUS_11380 47624 46917 gene locus_tag LOCUS_11390 47624 46917 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529853.1 protein_id gnl|my_center|LOCUS_11390 47856 48392 gene locus_tag LOCUS_11400 47856 48392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530274.1 protein_id gnl|my_center|LOCUS_11400 48992 48429 gene locus_tag LOCUS_11410 48992 48429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530275.1 protein_id gnl|my_center|LOCUS_11410 49606 48989 gene locus_tag LOCUS_11420 49606 48989 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530276.1 protein_id gnl|my_center|LOCUS_11420 50825 49662 gene locus_tag LOCUS_11430 50825 49662 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530277.1 protein_id gnl|my_center|LOCUS_11430 51409 50822 gene locus_tag LOCUS_11440 51409 50822 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530278.1 protein_id gnl|my_center|LOCUS_11440 51978 51451 gene locus_tag LOCUS_11450 51978 51451 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530279.1 protein_id gnl|my_center|LOCUS_11450 53551 51983 gene locus_tag LOCUS_11460 53551 51983 CDS product pilus assembly protein TadG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530280.1 protein_id gnl|my_center|LOCUS_11460 53914 53615 gene locus_tag LOCUS_11470 53914 53615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530281.1 protein_id gnl|my_center|LOCUS_11470 55346 53901 gene locus_tag LOCUS_11480 55346 53901 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095198234.1 protein_id gnl|my_center|LOCUS_11480 56420 55401 gene locus_tag LOCUS_11490 gene cpaB 56420 55401 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530283.1 protein_id gnl|my_center|LOCUS_11490 56745 56530 gene locus_tag LOCUS_11500 56745 56530 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530284.1 protein_id gnl|my_center|LOCUS_11500 57273 58658 gene locus_tag LOCUS_11510 57273 58658 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530285.1 protein_id gnl|my_center|LOCUS_11510 58658 59629 gene locus_tag LOCUS_11520 58658 59629 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530286.1 protein_id gnl|my_center|LOCUS_11520 59714 60598 gene locus_tag LOCUS_11530 59714 60598 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530287.1 protein_id gnl|my_center|LOCUS_11530 60696 61196 gene locus_tag LOCUS_11540 60696 61196 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530288.1 protein_id gnl|my_center|LOCUS_11540 61198 61737 gene locus_tag LOCUS_11550 61198 61737 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530289.1 protein_id gnl|my_center|LOCUS_11550 62957 61749 gene locus_tag LOCUS_11560 62957 61749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172992.1 protein_id gnl|my_center|LOCUS_11560 63840 63148 gene locus_tag LOCUS_11570 63840 63148 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529851.1 protein_id gnl|my_center|LOCUS_11570 64345 63977 gene locus_tag LOCUS_11580 64345 63977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529850.1 protein_id gnl|my_center|LOCUS_11580 <66130 64421 gene locus_tag LOCUS_11590 <66130 64421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529849.1:VCBS domain-containing protein >Feature sequence014 723 956 gene locus_tag LOCUS_11600 723 956 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503316.1 protein_id gnl|my_center|LOCUS_11600 970 1674 gene locus_tag LOCUS_11610 970 1674 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531717.1 protein_id gnl|my_center|LOCUS_11610 2676 1681 gene locus_tag LOCUS_11620 gene dusA 2676 1681 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172127.1 protein_id gnl|my_center|LOCUS_11620 3688 2864 gene locus_tag LOCUS_11630 3688 2864 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038849.1 protein_id gnl|my_center|LOCUS_11630 4552 4824 gene locus_tag LOCUS_11640 4552 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 4817 5026 gene locus_tag LOCUS_11650 4817 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530154.1 protein_id gnl|my_center|LOCUS_11650 5129 5359 gene locus_tag LOCUS_11660 5129 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 5633 6295 gene locus_tag LOCUS_11670 5633 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 6858 6556 gene locus_tag LOCUS_11680 6858 6556 CDS product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531722.1 protein_id gnl|my_center|LOCUS_11680 7204 8661 gene locus_tag LOCUS_11690 7204 8661 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531731.1 protein_id gnl|my_center|LOCUS_11690 9241 8696 gene locus_tag LOCUS_11700 9241 8696 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531732.1 protein_id gnl|my_center|LOCUS_11700 10881 9253 gene locus_tag LOCUS_11710 10881 9253 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531733.1 protein_id gnl|my_center|LOCUS_11710 11695 11042 gene locus_tag LOCUS_11720 11695 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11720 12159 11692 gene locus_tag LOCUS_11730 12159 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11730 11729 11738 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12877 12284 gene locus_tag LOCUS_11740 12877 12284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 12499 12508 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13806 13039 gene locus_tag LOCUS_11750 gene tpiA 13806 13039 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531736.1 protein_id gnl|my_center|LOCUS_11750 13952 15844 gene locus_tag LOCUS_11760 13952 15844 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531737.1 protein_id gnl|my_center|LOCUS_11760 15841 16851 gene locus_tag LOCUS_11770 gene trpD 15841 16851 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531738.1 protein_id gnl|my_center|LOCUS_11770 16856 17668 gene locus_tag LOCUS_11780 gene trpC 16856 17668 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531739.1 protein_id gnl|my_center|LOCUS_11780 17671 18168 gene locus_tag LOCUS_11790 gene moaC 17671 18168 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531740.1 protein_id gnl|my_center|LOCUS_11790 18168 19373 gene locus_tag LOCUS_11800 18168 19373 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531741.1 protein_id gnl|my_center|LOCUS_11800 19490 20224 gene locus_tag LOCUS_11810 gene lexA 19490 20224 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531746.1 protein_id gnl|my_center|LOCUS_11810 22653 20218 gene locus_tag LOCUS_11820 22653 20218 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531747.1 protein_id gnl|my_center|LOCUS_11820 22780 24312 gene locus_tag LOCUS_11830 gene gltX 22780 24312 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531748.1 protein_id gnl|my_center|LOCUS_11830 24064 24073 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24406 25734 gene locus_tag LOCUS_11840 gene gltA 24406 25734 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531749.1 protein_id gnl|my_center|LOCUS_11840 26947 25781 gene locus_tag LOCUS_11850 gene lpxB 26947 25781 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531750.1 protein_id gnl|my_center|LOCUS_11850 27836 26937 gene locus_tag LOCUS_11860 27836 26937 CDS product LpxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531751.1 protein_id gnl|my_center|LOCUS_11860 28665 27826 gene locus_tag LOCUS_11870 gene lpxA 28665 27826 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531752.1 protein_id gnl|my_center|LOCUS_11870 29133 28675 gene locus_tag LOCUS_11880 gene fabZ 29133 28675 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531753.1 protein_id gnl|my_center|LOCUS_11880 30181 29126 gene locus_tag LOCUS_11890 gene lpxD 30181 29126 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531754.1 protein_id gnl|my_center|LOCUS_11890 32617 30260 gene locus_tag LOCUS_11900 gene bamA 32617 30260 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531755.1 protein_id gnl|my_center|LOCUS_11900 33978 32836 gene locus_tag LOCUS_11910 gene rseP 33978 32836 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531756.1 protein_id gnl|my_center|LOCUS_11910 34925 34029 gene locus_tag LOCUS_11920 34925 34029 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531757.1 protein_id gnl|my_center|LOCUS_11920 34136 34145 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35641 34922 gene locus_tag LOCUS_11930 35641 34922 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531758.1 protein_id gnl|my_center|LOCUS_11930 36232 35675 gene locus_tag LOCUS_11940 gene frr 36232 35675 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531759.1 protein_id gnl|my_center|LOCUS_11940 37073 36351 gene locus_tag LOCUS_11950 gene pyrH 37073 36351 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531760.1 protein_id gnl|my_center|LOCUS_11950 38408 37233 gene locus_tag LOCUS_11960 38408 37233 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531761.1 protein_id gnl|my_center|LOCUS_11960 38908 38381 gene locus_tag LOCUS_11970 38908 38381 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531762.1 protein_id gnl|my_center|LOCUS_11970 39025 39951 gene locus_tag LOCUS_11980 39025 39951 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531763.1 protein_id gnl|my_center|LOCUS_11980 40899 39979 gene locus_tag LOCUS_11990 gene tsf 40899 39979 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531764.1 protein_id gnl|my_center|LOCUS_11990 41796 41017 gene locus_tag LOCUS_12000 gene rpsB 41796 41017 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531765.1 protein_id gnl|my_center|LOCUS_12000 42585 41974 gene locus_tag LOCUS_12010 42585 41974 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969757.1 protein_id gnl|my_center|LOCUS_12010 42860 42582 gene locus_tag LOCUS_12020 42860 42582 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531766.1 protein_id gnl|my_center|LOCUS_12020 43749 42919 gene locus_tag LOCUS_12030 43749 42919 CDS product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531768.1 protein_id gnl|my_center|LOCUS_12030 43888 44352 gene locus_tag LOCUS_12040 43888 44352 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531769.1 protein_id gnl|my_center|LOCUS_12040 44349 44561 gene locus_tag LOCUS_12050 44349 44561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12050 44499 44508 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44521 45114 gene locus_tag LOCUS_12060 44521 45114 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531770.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12060 45186 46370 gene locus_tag LOCUS_12070 45186 46370 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531771.1 protein_id gnl|my_center|LOCUS_12070 46480 46905 gene locus_tag LOCUS_12080 46480 46905 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531772.1 protein_id gnl|my_center|LOCUS_12080 48256 46946 gene locus_tag LOCUS_12090 48256 46946 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531441.1 protein_id gnl|my_center|LOCUS_12090 49783 48296 gene locus_tag LOCUS_12100 49783 48296 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531440.1 protein_id gnl|my_center|LOCUS_12100 50409 49978 gene locus_tag LOCUS_12110 gene rplQ 50409 49978 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531439.1 protein_id gnl|my_center|LOCUS_12110 51524 50514 gene locus_tag LOCUS_12120 51524 50514 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531438.1 protein_id gnl|my_center|LOCUS_12120 52016 51627 gene locus_tag LOCUS_12130 gene rpsK 52016 51627 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205444.1 protein_id gnl|my_center|LOCUS_12130 52543 52175 gene locus_tag LOCUS_12140 gene rpsM 52543 52175 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531437.1 protein_id gnl|my_center|LOCUS_12140 53331 52732 gene locus_tag LOCUS_12150 53331 52732 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531436.1 protein_id gnl|my_center|LOCUS_12150 54668 53328 gene locus_tag LOCUS_12160 gene secY 54668 53328 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531435.1 protein_id gnl|my_center|LOCUS_12160 55333 54860 gene locus_tag LOCUS_12170 gene rplO 55333 54860 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531434.1 protein_id gnl|my_center|LOCUS_12170 55553 55356 gene locus_tag LOCUS_12180 gene rpmD 55553 55356 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205449.1 protein_id gnl|my_center|LOCUS_12180 56148 55579 gene locus_tag LOCUS_12190 gene rpsE 56148 55579 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006333394.1 protein_id gnl|my_center|LOCUS_12190 56585 56226 gene locus_tag LOCUS_12200 gene rplR 56585 56226 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531433.1 protein_id gnl|my_center|LOCUS_12200 57209 56676 gene locus_tag LOCUS_12210 gene rplF 57209 56676 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531432.1 protein_id gnl|my_center|LOCUS_12210 57697 57299 gene locus_tag LOCUS_12220 gene rpsH 57697 57299 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531431.1 protein_id gnl|my_center|LOCUS_12220 58016 57711 gene locus_tag LOCUS_12230 gene rpsN 58016 57711 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531430.1 protein_id gnl|my_center|LOCUS_12230 58621 58043 gene locus_tag LOCUS_12240 gene rplE 58621 58043 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531429.1 protein_id gnl|my_center|LOCUS_12240 58928 58614 gene locus_tag LOCUS_12250 gene rplX 58928 58614 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531428.1 protein_id gnl|my_center|LOCUS_12250 59309 58941 gene locus_tag LOCUS_12260 gene rplN 59309 58941 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205457.1 protein_id gnl|my_center|LOCUS_12260 59621 59382 gene locus_tag LOCUS_12270 gene rpsQ 59621 59382 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909280.1 protein_id gnl|my_center|LOCUS_12270 59833 59633 gene locus_tag LOCUS_12280 gene rpmC 59833 59633 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205459.1 protein_id gnl|my_center|LOCUS_12280 60260 59847 gene locus_tag LOCUS_12290 gene rplP 60260 59847 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531427.1 protein_id gnl|my_center|LOCUS_12290 61019 60288 gene locus_tag LOCUS_12300 gene rpsC 61019 60288 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531426.1 protein_id gnl|my_center|LOCUS_12300 61408 61019 gene locus_tag LOCUS_12310 gene rplV 61408 61019 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205462.1 protein_id gnl|my_center|LOCUS_12310 61689 61411 gene locus_tag LOCUS_12320 gene rpsS 61689 61411 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205463.1 protein_id gnl|my_center|LOCUS_12320 62539 61706 gene locus_tag LOCUS_12330 gene rplB 62539 61706 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531425.1 protein_id gnl|my_center|LOCUS_12330 62855 62562 gene locus_tag LOCUS_12340 62855 62562 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531424.1 protein_id gnl|my_center|LOCUS_12340 63472 62852 gene locus_tag LOCUS_12350 gene rplD 63472 62852 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531423.1 protein_id gnl|my_center|LOCUS_12350 64155 63472 gene locus_tag LOCUS_12360 gene rplC 64155 63472 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531422.1 protein_id gnl|my_center|LOCUS_12360 64591 64283 gene locus_tag LOCUS_12370 gene rpsJ 64591 64283 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909272.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence015 <1 7137 gene locus_tag LOCUS_12380 <1 7137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000331685.1:LPD5 domain-containing protein 7723 7139 gene locus_tag LOCUS_12390 7723 7139 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174804364.1 protein_id gnl|my_center|LOCUS_12390 8057 8908 gene locus_tag LOCUS_12400 8057 8908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 8905 9192 gene locus_tag LOCUS_12410 8905 9192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 9107 9325 gene locus_tag LOCUS_12420 9107 9325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 9336 9692 gene locus_tag LOCUS_12430 9336 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 9721 10005 gene locus_tag LOCUS_12440 9721 10005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 10161 10085 gene locus_tag LOCUS_t00060 10161 10085 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 11233 10352 gene locus_tag LOCUS_12450 11233 10352 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142276.1 protein_id gnl|my_center|LOCUS_12450 11330 12229 gene locus_tag LOCUS_12460 11330 12229 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091419.1 protein_id gnl|my_center|LOCUS_12460 12275 14515 gene locus_tag LOCUS_12470 12275 14515 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532683.1 protein_id gnl|my_center|LOCUS_12470 16162 14699 gene locus_tag LOCUS_12480 gene betB 16162 14699 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532682.1 protein_id gnl|my_center|LOCUS_12480 17867 16215 gene locus_tag LOCUS_12490 gene betA 17867 16215 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532681.1 protein_id gnl|my_center|LOCUS_12490 18858 17860 gene locus_tag LOCUS_12500 18858 17860 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162996.1 protein_id gnl|my_center|LOCUS_12500 20387 18858 gene locus_tag LOCUS_12510 gene betC 20387 18858 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171724.1 protein_id gnl|my_center|LOCUS_12510 20959 20384 gene locus_tag LOCUS_12520 gene betI 20959 20384 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532678.1 protein_id gnl|my_center|LOCUS_12520 21217 22383 gene locus_tag LOCUS_12530 21217 22383 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532677.1 protein_id gnl|my_center|LOCUS_12530 22438 23169 gene locus_tag LOCUS_12540 22438 23169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12540 23154 23163 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23186 23455 gene locus_tag LOCUS_12550 23186 23455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12550 24834 23458 gene locus_tag LOCUS_12560 24834 23458 CDS product TIGR03808 family TAT-translocated repetitive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532675.1 protein_id gnl|my_center|LOCUS_12560 24938 25420 gene locus_tag LOCUS_12570 gene greA 24938 25420 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532674.1 protein_id gnl|my_center|LOCUS_12570 25806 25417 gene locus_tag LOCUS_12580 25806 25417 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 protein_id gnl|my_center|LOCUS_12580 26024 25803 gene locus_tag LOCUS_12590 26024 25803 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405518.1 protein_id gnl|my_center|LOCUS_12590 28219 26096 gene locus_tag LOCUS_12600 gene scpA 28219 26096 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532673.1 protein_id gnl|my_center|LOCUS_12600 29658 28216 gene locus_tag LOCUS_12610 29658 28216 CDS product methylmalonyl-CoA mutase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532672.1 protein_id gnl|my_center|LOCUS_12610 30051 31595 gene locus_tag LOCUS_12620 30051 31595 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532671.1 protein_id gnl|my_center|LOCUS_12620 32548 31925 gene locus_tag LOCUS_12630 32548 31925 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533542.1 protein_id gnl|my_center|LOCUS_12630 32625 34052 gene locus_tag LOCUS_12640 32625 34052 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533544.1 protein_id gnl|my_center|LOCUS_12640 34886 34065 gene locus_tag LOCUS_12650 34886 34065 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532670.1 protein_id gnl|my_center|LOCUS_12650 35720 35058 gene locus_tag LOCUS_12660 35720 35058 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 protein_id gnl|my_center|LOCUS_12660 35928 36806 gene locus_tag LOCUS_12670 35928 36806 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505546.1 protein_id gnl|my_center|LOCUS_12670 36980 37582 gene locus_tag LOCUS_12680 36980 37582 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532667.1 protein_id gnl|my_center|LOCUS_12680 37730 38167 gene locus_tag LOCUS_12690 37730 38167 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532666.1 protein_id gnl|my_center|LOCUS_12690 38177 39127 gene locus_tag LOCUS_12700 38177 39127 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532665.1 protein_id gnl|my_center|LOCUS_12700 39208 41805 gene locus_tag LOCUS_12710 39208 41805 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391136.1 protein_id gnl|my_center|LOCUS_12710 42296 41901 gene locus_tag LOCUS_12720 42296 41901 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532664.1 protein_id gnl|my_center|LOCUS_12720 43172 42546 gene locus_tag LOCUS_12730 43172 42546 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532663.1 protein_id gnl|my_center|LOCUS_12730 45363 43237 gene locus_tag LOCUS_12740 45363 43237 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532662.1 protein_id gnl|my_center|LOCUS_12740 45481 45849 gene locus_tag LOCUS_12750 45481 45849 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164745941.1 protein_id gnl|my_center|LOCUS_12750 46210 46692 gene locus_tag LOCUS_12760 46210 46692 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532660.1 protein_id gnl|my_center|LOCUS_12760 47259 46813 gene locus_tag LOCUS_12770 47259 46813 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532659.1 protein_id gnl|my_center|LOCUS_12770 47729 47352 gene locus_tag LOCUS_12780 47729 47352 CDS product DUF5330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532658.1 protein_id gnl|my_center|LOCUS_12780 48281 48760 gene locus_tag LOCUS_12790 48281 48760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12790 48737 48746 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48757 50016 gene locus_tag LOCUS_12800 48757 50016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12800 49991 50773 gene locus_tag LOCUS_12810 49991 50773 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532656.1 protein_id gnl|my_center|LOCUS_12810 50846 51196 gene locus_tag LOCUS_12820 50846 51196 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532655.1 protein_id gnl|my_center|LOCUS_12820 52171 51191 gene locus_tag LOCUS_12830 52171 51191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171732.1 protein_id gnl|my_center|LOCUS_12830 52435 52617 gene locus_tag LOCUS_12840 52435 52617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532653.1 protein_id gnl|my_center|LOCUS_12840 52575 52584 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 53294 52746 gene locus_tag LOCUS_12850 53294 52746 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532652.1 protein_id gnl|my_center|LOCUS_12850 53871 53287 gene locus_tag LOCUS_12860 53871 53287 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532651.1 protein_id gnl|my_center|LOCUS_12860 56126 53970 gene locus_tag LOCUS_12870 56126 53970 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532650.1 protein_id gnl|my_center|LOCUS_12870 56927 56289 gene locus_tag LOCUS_12880 56927 56289 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501867.1 protein_id gnl|my_center|LOCUS_12880 57077 57319 gene locus_tag LOCUS_12890 57077 57319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 57438 58991 gene locus_tag LOCUS_12900 57438 58991 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530987.1 protein_id gnl|my_center|LOCUS_12900 59126 59533 gene locus_tag LOCUS_12910 59126 59533 CDS product DUF3168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532641.1 protein_id gnl|my_center|LOCUS_12910 59929 59543 gene locus_tag LOCUS_12920 59929 59543 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112418.1 protein_id gnl|my_center|LOCUS_12920 60167 60466 gene locus_tag LOCUS_12930 60167 60466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532640.1 protein_id gnl|my_center|LOCUS_12930 60537 61202 gene locus_tag LOCUS_12940 60537 61202 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532639.1 protein_id gnl|my_center|LOCUS_12940 61186 62622 gene locus_tag LOCUS_12950 61186 62622 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532638.1 protein_id gnl|my_center|LOCUS_12950 62798 63235 gene locus_tag LOCUS_12960 62798 63235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532637.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence016 2241 1390 gene locus_tag LOCUS_12970 2241 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2953 2243 gene locus_tag LOCUS_12980 2953 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 3026 3295 gene locus_tag LOCUS_12990 3026 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 4953 3292 gene locus_tag LOCUS_13000 4953 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 5319 4954 gene locus_tag LOCUS_13010 5319 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 5206 5619 gene locus_tag LOCUS_13020 5206 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 6257 5616 gene locus_tag LOCUS_13030 6257 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 5977 5986 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6748 6254 gene locus_tag LOCUS_13040 6748 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 7358 6753 gene locus_tag LOCUS_13050 7358 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 7485 7835 gene locus_tag LOCUS_13060 7485 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 8596 7832 gene locus_tag LOCUS_13070 8596 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 9219 8593 gene locus_tag LOCUS_13080 9219 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 9428 9243 gene locus_tag LOCUS_13090 9428 9243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 11160 9490 gene locus_tag LOCUS_13100 11160 9490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 13032 11161 gene locus_tag LOCUS_13110 13032 11161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 13745 13032 gene locus_tag LOCUS_13120 13745 13032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 14226 13747 gene locus_tag LOCUS_13130 14226 13747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 14454 14257 gene locus_tag LOCUS_13140 14454 14257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 15032 14514 gene locus_tag LOCUS_13150 15032 14514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 15602 15045 gene locus_tag LOCUS_13160 15602 15045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 16703 15690 gene locus_tag LOCUS_13170 16703 15690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 17811 16738 gene locus_tag LOCUS_13180 17811 16738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 18023 17778 gene locus_tag LOCUS_13190 18023 17778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 18244 18020 gene locus_tag LOCUS_13200 18244 18020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 18495 18241 gene locus_tag LOCUS_13210 18495 18241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 18815 18492 gene locus_tag LOCUS_13220 18815 18492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 21217 18812 gene locus_tag LOCUS_13230 21217 18812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 21934 21218 gene locus_tag LOCUS_13240 21934 21218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 22443 21964 gene locus_tag LOCUS_13250 22443 21964 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313922.1 protein_id gnl|my_center|LOCUS_13250 22676 22440 gene locus_tag LOCUS_13260 22676 22440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 23089 22679 gene locus_tag LOCUS_13270 23089 22679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 23700 23086 gene locus_tag LOCUS_13280 23700 23086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 25210 23759 gene locus_tag LOCUS_13290 25210 23759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 25519 25211 gene locus_tag LOCUS_13300 25519 25211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 25870 25580 gene locus_tag LOCUS_13310 25870 25580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 26169 25882 gene locus_tag LOCUS_13320 26169 25882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 26675 26169 gene locus_tag LOCUS_13330 26675 26169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 27532 26675 gene locus_tag LOCUS_13340 27532 26675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 27816 27478 gene locus_tag LOCUS_13350 27816 27478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 28307 27813 gene locus_tag LOCUS_13360 28307 27813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 28597 28292 gene locus_tag LOCUS_13370 28597 28292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 28957 28625 gene locus_tag LOCUS_13380 28957 28625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 29115 28954 gene locus_tag LOCUS_13390 29115 28954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 29288 29112 gene locus_tag LOCUS_13400 29288 29112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 29385 29867 gene locus_tag LOCUS_13410 29385 29867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 29878 30111 gene locus_tag LOCUS_13420 29878 30111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 30338 30108 gene locus_tag LOCUS_13430 30338 30108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 30543 30328 gene locus_tag LOCUS_13440 30543 30328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 31419 30547 gene locus_tag LOCUS_13450 31419 30547 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024060.1 protein_id gnl|my_center|LOCUS_13450 31861 31406 gene locus_tag LOCUS_13460 31861 31406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460150.1 protein_id gnl|my_center|LOCUS_13460 33318 31867 gene locus_tag LOCUS_13470 33318 31867 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532525.1 protein_id gnl|my_center|LOCUS_13470 33754 33332 gene locus_tag LOCUS_13480 33754 33332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 34260 34421 gene locus_tag LOCUS_13490 34260 34421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 35014 34430 gene locus_tag LOCUS_13500 35014 34430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 36024 35011 gene locus_tag LOCUS_13510 36024 35011 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268012.1 protein_id gnl|my_center|LOCUS_13510 36614 36021 gene locus_tag LOCUS_13520 36614 36021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 37096 36614 gene locus_tag LOCUS_13530 37096 36614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 37884 37129 gene locus_tag LOCUS_13540 37884 37129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 38177 37911 gene locus_tag LOCUS_13550 38177 37911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 38919 38380 gene locus_tag LOCUS_13560 38919 38380 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931436.1 protein_id gnl|my_center|LOCUS_13560 39323 38919 gene locus_tag LOCUS_13570 39323 38919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 40166 39516 gene locus_tag LOCUS_13580 40166 39516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 40199 40441 gene locus_tag LOCUS_13590 40199 40441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 40634 40894 gene locus_tag LOCUS_13600 40634 40894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 41109 40891 gene locus_tag LOCUS_13610 41109 40891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 41214 41552 gene locus_tag LOCUS_13620 41214 41552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 41978 42199 gene locus_tag LOCUS_13630 41978 42199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 42196 42447 gene locus_tag LOCUS_13640 42196 42447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 42444 42707 gene locus_tag LOCUS_13650 42444 42707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 42704 43093 gene locus_tag LOCUS_13660 42704 43093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 43119 44183 gene locus_tag LOCUS_13670 43119 44183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 44187 44870 gene locus_tag LOCUS_13680 gene dnaQ 44187 44870 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_13680 44882 46021 gene locus_tag LOCUS_13690 44882 46021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 46021 46299 gene locus_tag LOCUS_13700 46021 46299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 46299 47369 gene locus_tag LOCUS_13710 46299 47369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 47063 47072 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47369 47830 gene locus_tag LOCUS_13720 47369 47830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 47830 48219 gene locus_tag LOCUS_13730 47830 48219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 48221 48391 gene locus_tag LOCUS_13740 48221 48391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 48388 48558 gene locus_tag LOCUS_13750 48388 48558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 48555 48758 gene locus_tag LOCUS_13760 48555 48758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 48891 49580 gene locus_tag LOCUS_13770 48891 49580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 49570 50106 gene locus_tag LOCUS_13780 49570 50106 CDS product DUF1643 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975413.1 protein_id gnl|my_center|LOCUS_13780 50096 50593 gene locus_tag LOCUS_13790 50096 50593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 50577 50987 gene locus_tag LOCUS_13800 50577 50987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 51126 51377 gene locus_tag LOCUS_13810 51126 51377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 51537 52655 gene locus_tag LOCUS_13820 51537 52655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 53002 53343 gene locus_tag LOCUS_13830 53002 53343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532688.1 protein_id gnl|my_center|LOCUS_13830 54990 53371 gene locus_tag LOCUS_13840 54990 53371 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532689.1 protein_id gnl|my_center|LOCUS_13840 56113 54992 gene locus_tag LOCUS_13850 56113 54992 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532690.1 protein_id gnl|my_center|LOCUS_13850 57029 56106 gene locus_tag LOCUS_13860 57029 56106 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532691.1 protein_id gnl|my_center|LOCUS_13860 58833 57205 gene locus_tag LOCUS_13870 58833 57205 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532692.1 protein_id gnl|my_center|LOCUS_13870 59179 59544 gene locus_tag LOCUS_13880 59179 59544 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564973.1 protein_id gnl|my_center|LOCUS_13880 59544 61364 gene locus_tag LOCUS_13890 59544 61364 CDS product TadG family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532694.1 protein_id gnl|my_center|LOCUS_13890 63005 61368 gene locus_tag LOCUS_13900 63005 61368 CDS product alpha-glucosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532695.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence017 1801 905 gene locus_tag LOCUS_13910 1801 905 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529407.1 protein_id gnl|my_center|LOCUS_13910 1260 1269 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3137 1869 gene locus_tag LOCUS_13920 gene lysA 3137 1869 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529408.1 protein_id gnl|my_center|LOCUS_13920 3374 3189 gene locus_tag LOCUS_13930 3374 3189 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529409.1 protein_id gnl|my_center|LOCUS_13930 4884 3484 gene locus_tag LOCUS_13940 gene argH 4884 3484 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529410.1 protein_id gnl|my_center|LOCUS_13940 4921 5607 gene locus_tag LOCUS_13950 4921 5607 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529411.1 protein_id gnl|my_center|LOCUS_13950 8046 5599 gene locus_tag LOCUS_13960 8046 5599 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529412.1 protein_id gnl|my_center|LOCUS_13960 8389 9741 gene locus_tag LOCUS_13970 8389 9741 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972753.1 protein_id gnl|my_center|LOCUS_13970 9829 10713 gene locus_tag LOCUS_13980 9829 10713 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972754.1 protein_id gnl|my_center|LOCUS_13980 10721 11635 gene locus_tag LOCUS_13990 10721 11635 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972755.1 protein_id gnl|my_center|LOCUS_13990 11646 12746 gene locus_tag LOCUS_14000 11646 12746 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972756.1 protein_id gnl|my_center|LOCUS_14000 12814 13611 gene locus_tag LOCUS_14010 12814 13611 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086914.1 protein_id gnl|my_center|LOCUS_14010 14757 13675 gene locus_tag LOCUS_14020 14757 13675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529417.1 protein_id gnl|my_center|LOCUS_14020 15623 14754 gene locus_tag LOCUS_14030 15623 14754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14030 16345 15602 gene locus_tag LOCUS_14040 16345 15602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14040 15801 15810 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17528 16521 gene locus_tag LOCUS_14050 17528 16521 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529419.1 protein_id gnl|my_center|LOCUS_14050 17732 18268 gene locus_tag LOCUS_14060 17732 18268 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529420.1 protein_id gnl|my_center|LOCUS_14060 18270 18908 gene locus_tag LOCUS_14070 18270 18908 CDS product NrsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529421.1 protein_id gnl|my_center|LOCUS_14070 19051 20499 gene locus_tag LOCUS_14080 19051 20499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14080 20238 20247 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20387 21058 gene locus_tag LOCUS_14090 20387 21058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14090 21946 21068 gene locus_tag LOCUS_14100 21946 21068 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529423.1 protein_id gnl|my_center|LOCUS_14100 22993 22064 gene locus_tag LOCUS_14110 22993 22064 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529424.1 protein_id gnl|my_center|LOCUS_14110 23766 23017 gene locus_tag LOCUS_14120 23766 23017 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529425.1 protein_id gnl|my_center|LOCUS_14120 24748 23939 gene locus_tag LOCUS_14130 24748 23939 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529426.1 protein_id gnl|my_center|LOCUS_14130 25361 24780 gene locus_tag LOCUS_14140 25361 24780 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529427.1 protein_id gnl|my_center|LOCUS_14140 25568 25377 gene locus_tag LOCUS_14150 25568 25377 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529428.1 protein_id gnl|my_center|LOCUS_14150 26425 25592 gene locus_tag LOCUS_14160 26425 25592 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529429.1 protein_id gnl|my_center|LOCUS_14160 26509 27360 gene locus_tag LOCUS_14170 26509 27360 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529430.1 protein_id gnl|my_center|LOCUS_14170 28241 27330 gene locus_tag LOCUS_14180 28241 27330 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529431.1 protein_id gnl|my_center|LOCUS_14180 28397 28711 gene locus_tag LOCUS_14190 28397 28711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 29743 28868 gene locus_tag LOCUS_14200 gene gluQRS 29743 28868 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529432.1 protein_id gnl|my_center|LOCUS_14200 29841 30482 gene locus_tag LOCUS_14210 29841 30482 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529433.1 protein_id gnl|my_center|LOCUS_14210 30648 31268 gene locus_tag LOCUS_14220 30648 31268 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006328497.1 protein_id gnl|my_center|LOCUS_14220 31945 31427 gene locus_tag LOCUS_14230 31945 31427 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529434.1 protein_id gnl|my_center|LOCUS_14230 32561 31971 gene locus_tag LOCUS_14240 32561 31971 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529435.1 protein_id gnl|my_center|LOCUS_14240 32796 32880 gene locus_tag LOCUS_t00070 32796 32880 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 34292 32973 gene locus_tag LOCUS_14250 34292 32973 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329916.1 protein_id gnl|my_center|LOCUS_14250 36015 34297 gene locus_tag LOCUS_14260 36015 34297 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969655.1 protein_id gnl|my_center|LOCUS_14260 37515 36091 gene locus_tag LOCUS_14270 37515 36091 CDS product family 16 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170806.1 protein_id gnl|my_center|LOCUS_14270 38970 37822 gene locus_tag LOCUS_14280 38970 37822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225442.1 protein_id gnl|my_center|LOCUS_14280 40316 39036 gene locus_tag LOCUS_14290 40316 39036 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529437.1 protein_id gnl|my_center|LOCUS_14290 41719 40316 gene locus_tag LOCUS_14300 41719 40316 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529438.1 protein_id gnl|my_center|LOCUS_14300 44740 42008 gene locus_tag LOCUS_14310 gene secA 44740 42008 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529439.1 protein_id gnl|my_center|LOCUS_14310 44992 45909 gene locus_tag LOCUS_14320 44992 45909 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529440.1 protein_id gnl|my_center|LOCUS_14320 46688 46092 gene locus_tag LOCUS_14330 46688 46092 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529441.1 protein_id gnl|my_center|LOCUS_14330 46946 46716 gene locus_tag LOCUS_14340 46946 46716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 46921 48117 gene locus_tag LOCUS_14350 gene argJ 46921 48117 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529442.1 protein_id gnl|my_center|LOCUS_14350 48126 48896 gene locus_tag LOCUS_14360 48126 48896 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529443.1 protein_id gnl|my_center|LOCUS_14360 48893 49315 gene locus_tag LOCUS_14370 gene mutT 48893 49315 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529444.1 protein_id gnl|my_center|LOCUS_14370 49421 49729 gene locus_tag LOCUS_14380 49421 49729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529445.1 protein_id gnl|my_center|LOCUS_14380 49836 50024 gene locus_tag LOCUS_14390 49836 50024 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529446.1 protein_id gnl|my_center|LOCUS_14390 50915 50043 gene locus_tag LOCUS_14400 50915 50043 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529447.1 protein_id gnl|my_center|LOCUS_14400 50982 51770 gene locus_tag LOCUS_14410 50982 51770 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529448.1 protein_id gnl|my_center|LOCUS_14410 51838 52107 gene locus_tag LOCUS_14420 gene grxC 51838 52107 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529449.1 protein_id gnl|my_center|LOCUS_14420 52110 52970 gene locus_tag LOCUS_14430 52110 52970 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529450.1 protein_id gnl|my_center|LOCUS_14430 52967 53392 gene locus_tag LOCUS_14440 52967 53392 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529451.1 protein_id gnl|my_center|LOCUS_14440 53825 53406 gene locus_tag LOCUS_14450 53825 53406 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529453.1 protein_id gnl|my_center|LOCUS_14450 53993 54907 gene locus_tag LOCUS_14460 53993 54907 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529454.1 protein_id gnl|my_center|LOCUS_14460 55493 54936 gene locus_tag LOCUS_14470 55493 54936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14470 55425 55434 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 55981 55700 gene locus_tag LOCUS_14480 55981 55700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 55817 55838 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56202 57455 gene locus_tag LOCUS_14490 56202 57455 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529459.1 protein_id gnl|my_center|LOCUS_14490 57537 59054 gene locus_tag LOCUS_14500 57537 59054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14500 58956 58965 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58970 59803 gene locus_tag LOCUS_14510 58970 59803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14510 59943 61022 gene locus_tag LOCUS_14520 gene prfA 59943 61022 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529461.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence018 <1 560 gene locus_tag LOCUS_14530 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525335.1:SMC-Scp complex subunit ScpB 1726 1508 gene locus_tag LOCUS_14540 1726 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 2492 4561 gene locus_tag LOCUS_14550 2492 4561 CDS product TerB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003681.1 protein_id gnl|my_center|LOCUS_14550 4660 5880 gene locus_tag LOCUS_14560 4660 5880 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003683.1 protein_id gnl|my_center|LOCUS_14560 5861 8119 gene locus_tag LOCUS_14570 5861 8119 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338082.1 protein_id gnl|my_center|LOCUS_14570 8481 8239 gene locus_tag LOCUS_14580 8481 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 8680 11676 gene locus_tag LOCUS_14590 8680 11676 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544913.1 protein_id gnl|my_center|LOCUS_14590 12263 11982 gene locus_tag LOCUS_14600 12263 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 12294 13238 gene locus_tag LOCUS_14610 12294 13238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 13235 16669 gene locus_tag LOCUS_14620 13235 16669 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390981.1 protein_id gnl|my_center|LOCUS_14620 14182 14208 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17108 17326 gene locus_tag LOCUS_14630 17108 17326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 17980 18276 gene locus_tag LOCUS_14640 17980 18276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445478.1 protein_id gnl|my_center|LOCUS_14640 18266 18856 gene locus_tag LOCUS_14650 18266 18856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390698.1 protein_id gnl|my_center|LOCUS_14650 18853 20232 gene locus_tag LOCUS_14660 18853 20232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 21535 20870 gene locus_tag LOCUS_14670 21535 20870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 22216 25122 gene locus_tag LOCUS_14680 22216 25122 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020677315.1 protein_id gnl|my_center|LOCUS_14680 25224 27026 gene locus_tag LOCUS_14690 25224 27026 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031064.1 protein_id gnl|my_center|LOCUS_14690 27125 30220 gene locus_tag LOCUS_14700 27125 30220 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931302.1 protein_id gnl|my_center|LOCUS_14700 30222 31124 gene locus_tag LOCUS_14710 30222 31124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 31165 33267 gene locus_tag LOCUS_14720 31165 33267 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036269.1 protein_id gnl|my_center|LOCUS_14720 35090 33264 gene locus_tag LOCUS_14730 35090 33264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 35436 35699 gene locus_tag LOCUS_14740 35436 35699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 35796 35978 gene locus_tag LOCUS_14750 35796 35978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 37591 36179 gene locus_tag LOCUS_14760 37591 36179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 38441 37581 gene locus_tag LOCUS_14770 38441 37581 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106663661.1 protein_id gnl|my_center|LOCUS_14770 40580 38448 gene locus_tag LOCUS_14780 40580 38448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 41852 41355 gene locus_tag LOCUS_14790 41852 41355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 42055 42651 gene locus_tag LOCUS_14800 42055 42651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 43581 42796 gene locus_tag LOCUS_14810 43581 42796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 44281 43571 gene locus_tag LOCUS_14820 44281 43571 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073963.1 protein_id gnl|my_center|LOCUS_14820 44553 45338 gene locus_tag LOCUS_14830 44553 45338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 46161 46370 gene locus_tag LOCUS_14840 46161 46370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 46463 46612 gene locus_tag LOCUS_14850 46463 46612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 46847 47134 gene locus_tag LOCUS_14860 46847 47134 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314414.1 protein_id gnl|my_center|LOCUS_14860 47144 48880 gene locus_tag LOCUS_14870 47144 48880 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966061.1 protein_id gnl|my_center|LOCUS_14870 48891 49124 gene locus_tag LOCUS_14880 48891 49124 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085981.1 protein_id gnl|my_center|LOCUS_14880 49126 49485 gene locus_tag LOCUS_14890 49126 49485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 49494 50276 gene locus_tag LOCUS_14900 49494 50276 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113102.1 protein_id gnl|my_center|LOCUS_14900 50276 51106 gene locus_tag LOCUS_14910 50276 51106 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113103.1 protein_id gnl|my_center|LOCUS_14910 52083 51253 gene locus_tag LOCUS_14920 52083 51253 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112653.1 protein_id gnl|my_center|LOCUS_14920 52904 52080 gene locus_tag LOCUS_14930 52904 52080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14930 53632 52901 gene locus_tag LOCUS_14940 53632 52901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 54835 53744 gene locus_tag LOCUS_14950 54835 53744 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206779.1 protein_id gnl|my_center|LOCUS_14950 55793 54864 gene locus_tag LOCUS_14960 55793 54864 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112660.1 protein_id gnl|my_center|LOCUS_14960 57226 55865 gene locus_tag LOCUS_14970 57226 55865 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269247.1 protein_id gnl|my_center|LOCUS_14970 57916 57359 gene locus_tag LOCUS_14980 gene msuE 57916 57359 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969839.1 protein_id gnl|my_center|LOCUS_14980 58684 59736 gene locus_tag LOCUS_14990 58684 59736 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253048.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence019 654 199 gene locus_tag LOCUS_15000 654 199 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531488.1 protein_id gnl|my_center|LOCUS_15000 1627 662 gene locus_tag LOCUS_15010 gene lipA 1627 662 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531487.1 protein_id gnl|my_center|LOCUS_15010 2020 1763 gene locus_tag LOCUS_15020 2020 1763 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531486.1 protein_id gnl|my_center|LOCUS_15020 3589 2123 gene locus_tag LOCUS_15030 gene lpdA 3589 2123 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531485.1 protein_id gnl|my_center|LOCUS_15030 4246 3608 gene locus_tag LOCUS_15040 4246 3608 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531484.1 protein_id gnl|my_center|LOCUS_15040 4668 4243 gene locus_tag LOCUS_15050 4668 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 5581 4682 gene locus_tag LOCUS_15060 5581 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15060 6053 5655 gene locus_tag LOCUS_15070 6053 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15070 5685 5694 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6344 6057 gene locus_tag LOCUS_15080 6344 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 7337 6357 gene locus_tag LOCUS_15090 7337 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15090 7356 7365 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8812 7772 gene locus_tag LOCUS_15100 gene pdhA 8812 7772 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531481.1 protein_id gnl|my_center|LOCUS_15100 9332 9009 gene locus_tag LOCUS_15110 9332 9009 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531480.1 protein_id gnl|my_center|LOCUS_15110 10763 9489 gene locus_tag LOCUS_15120 gene eno 10763 9489 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531479.1 protein_id gnl|my_center|LOCUS_15120 11517 11152 gene locus_tag LOCUS_15130 11517 11152 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531477.1 protein_id gnl|my_center|LOCUS_15130 11794 11588 gene locus_tag LOCUS_15140 11794 11588 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_15140 12737 11895 gene locus_tag LOCUS_15150 gene kdsA 12737 11895 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531475.1 protein_id gnl|my_center|LOCUS_15150 13612 12734 gene locus_tag LOCUS_15160 13612 12734 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531474.1 protein_id gnl|my_center|LOCUS_15160 14074 15366 gene locus_tag LOCUS_15170 14074 15366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 15363 16340 gene locus_tag LOCUS_15180 15363 16340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 16333 17346 gene locus_tag LOCUS_15190 16333 17346 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086149.1 protein_id gnl|my_center|LOCUS_15190 17343 18308 gene locus_tag LOCUS_15200 17343 18308 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529382.1 protein_id gnl|my_center|LOCUS_15200 18568 18281 gene locus_tag LOCUS_15210 18568 18281 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531473.1 protein_id gnl|my_center|LOCUS_15210 18802 18668 gene locus_tag LOCUS_15220 18802 18668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 19063 20319 gene locus_tag LOCUS_15230 19063 20319 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531472.1 protein_id gnl|my_center|LOCUS_15230 22357 20384 gene locus_tag LOCUS_15240 22357 20384 CDS product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531470.1 protein_id gnl|my_center|LOCUS_15240 23764 22499 gene locus_tag LOCUS_15250 23764 22499 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531469.1 protein_id gnl|my_center|LOCUS_15250 23939 24598 gene locus_tag LOCUS_15260 23939 24598 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531468.1 protein_id gnl|my_center|LOCUS_15260 25078 24605 gene locus_tag LOCUS_15270 25078 24605 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531467.1 protein_id gnl|my_center|LOCUS_15270 25237 26352 gene locus_tag LOCUS_15280 gene ald 25237 26352 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531466.1 protein_id gnl|my_center|LOCUS_15280 27183 26716 gene locus_tag LOCUS_15290 27183 26716 CDS product DUF1203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531464.1 protein_id gnl|my_center|LOCUS_15290 28019 27462 gene locus_tag LOCUS_15300 28019 27462 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531463.1 protein_id gnl|my_center|LOCUS_15300 28206 28616 gene locus_tag LOCUS_15310 28206 28616 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088400.1 protein_id gnl|my_center|LOCUS_15310 29192 28629 gene locus_tag LOCUS_15320 29192 28629 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531462.1 protein_id gnl|my_center|LOCUS_15320 30049 29198 gene locus_tag LOCUS_15330 gene sseA 30049 29198 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531461.1 protein_id gnl|my_center|LOCUS_15330 30826 30083 gene locus_tag LOCUS_15340 30826 30083 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531460.1 protein_id gnl|my_center|LOCUS_15340 31860 30826 gene locus_tag LOCUS_15350 31860 30826 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531459.1 protein_id gnl|my_center|LOCUS_15350 32076 32918 gene locus_tag LOCUS_15360 32076 32918 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531458.1 protein_id gnl|my_center|LOCUS_15360 32987 33964 gene locus_tag LOCUS_15370 32987 33964 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531457.1 protein_id gnl|my_center|LOCUS_15370 35485 34064 gene locus_tag LOCUS_15380 35485 34064 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531456.1 protein_id gnl|my_center|LOCUS_15380 35892 37424 gene locus_tag LOCUS_15390 35892 37424 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531455.1 protein_id gnl|my_center|LOCUS_15390 37430 38500 gene locus_tag LOCUS_15400 37430 38500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 38944 38549 gene locus_tag LOCUS_15410 38944 38549 CDS product DUF6165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036195.1 protein_id gnl|my_center|LOCUS_15410 39097 40125 gene locus_tag LOCUS_15420 gene waaF 39097 40125 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088670.1 protein_id gnl|my_center|LOCUS_15420 42041 40131 gene locus_tag LOCUS_15430 42041 40131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531454.1 protein_id gnl|my_center|LOCUS_15430 43573 42038 gene locus_tag LOCUS_15440 43573 42038 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531453.1 protein_id gnl|my_center|LOCUS_15440 43932 44270 gene locus_tag LOCUS_15450 43932 44270 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205430.1 protein_id gnl|my_center|LOCUS_15450 44331 45740 gene locus_tag LOCUS_15460 gene glnA 44331 45740 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531452.1 protein_id gnl|my_center|LOCUS_15460 46976 45936 gene locus_tag LOCUS_15470 46976 45936 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531450.1 protein_id gnl|my_center|LOCUS_15470 47285 47482 gene locus_tag LOCUS_15480 47285 47482 CDS product DUF2735 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531449.1 protein_id gnl|my_center|LOCUS_15480 49446 47560 gene locus_tag LOCUS_15490 49446 47560 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531448.1 protein_id gnl|my_center|LOCUS_15490 50422 49631 gene locus_tag LOCUS_15500 50422 49631 CDS product ATP12 family chaperone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531447.1 protein_id gnl|my_center|LOCUS_15500 51351 50434 gene locus_tag LOCUS_15510 51351 50434 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505073.1 protein_id gnl|my_center|LOCUS_15510 51554 51348 gene locus_tag LOCUS_15520 51554 51348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 52560 51580 gene locus_tag LOCUS_15530 52560 51580 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531445.1 protein_id gnl|my_center|LOCUS_15530 52973 52599 gene locus_tag LOCUS_15540 gene crcB 52973 52599 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531444.1 protein_id gnl|my_center|LOCUS_15540 53370 53005 gene locus_tag LOCUS_15550 53370 53005 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329121.1 protein_id gnl|my_center|LOCUS_15550 54952 53435 gene locus_tag LOCUS_15560 54952 53435 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087552.1 protein_id gnl|my_center|LOCUS_15560 55877 55095 gene locus_tag LOCUS_15570 55877 55095 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165113428.1 protein_id gnl|my_center|LOCUS_15570 57139 56309 gene locus_tag LOCUS_15580 57139 56309 CDS product aspartyl/asparaginyl beta-hydroxylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063168068.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence020 286 1182 gene locus_tag LOCUS_15590 286 1182 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532109.1 protein_id gnl|my_center|LOCUS_15590 2238 1201 gene locus_tag LOCUS_15600 2238 1201 CDS product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532108.1 protein_id gnl|my_center|LOCUS_15600 2351 2854 gene locus_tag LOCUS_15610 2351 2854 CDS product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532107.1 protein_id gnl|my_center|LOCUS_15610 3068 2904 gene locus_tag LOCUS_15620 3068 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532106.1 protein_id gnl|my_center|LOCUS_15620 3441 3908 gene locus_tag LOCUS_15630 3441 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532105.1 protein_id gnl|my_center|LOCUS_15630 4026 5093 gene locus_tag LOCUS_15640 4026 5093 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532104.1 protein_id gnl|my_center|LOCUS_15640 5133 6398 gene locus_tag LOCUS_15650 5133 6398 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532103.1 protein_id gnl|my_center|LOCUS_15650 7504 6545 gene locus_tag LOCUS_15660 7504 6545 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532102.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15660 6663 6672 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8007 7501 gene locus_tag LOCUS_15670 8007 7501 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532101.1 protein_id gnl|my_center|LOCUS_15670 9024 8095 gene locus_tag LOCUS_15680 9024 8095 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532100.1 protein_id gnl|my_center|LOCUS_15680 10421 9039 gene locus_tag LOCUS_15690 10421 9039 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532099.1 protein_id gnl|my_center|LOCUS_15690 12060 10423 gene locus_tag LOCUS_15700 12060 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532098.1 protein_id gnl|my_center|LOCUS_15700 12211 12459 gene locus_tag LOCUS_15710 12211 12459 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532091.1 protein_id gnl|my_center|LOCUS_15710 12549 13502 gene locus_tag LOCUS_15720 12549 13502 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532089.1 protein_id gnl|my_center|LOCUS_15720 13681 14076 gene locus_tag LOCUS_15730 13681 14076 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532088.1 protein_id gnl|my_center|LOCUS_15730 14348 14560 gene locus_tag LOCUS_15740 14348 14560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532087.1 protein_id gnl|my_center|LOCUS_15740 15527 14616 gene locus_tag LOCUS_15750 15527 14616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 15753 16847 gene locus_tag LOCUS_15760 15753 16847 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532084.1 protein_id gnl|my_center|LOCUS_15760 17034 17576 gene locus_tag LOCUS_15770 17034 17576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 18557 17643 gene locus_tag LOCUS_15780 gene gcvA 18557 17643 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528412.1 protein_id gnl|my_center|LOCUS_15780 18665 18832 gene locus_tag LOCUS_15790 18665 18832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 18872 19480 gene locus_tag LOCUS_15800 18872 19480 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532083.1 protein_id gnl|my_center|LOCUS_15800 20091 19741 gene locus_tag LOCUS_15810 20091 19741 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967717.1 protein_id gnl|my_center|LOCUS_15810 21235 20165 gene locus_tag LOCUS_15820 21235 20165 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028369.1 protein_id gnl|my_center|LOCUS_15820 21701 21441 gene locus_tag LOCUS_15830 21701 21441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 25656 21883 gene locus_tag LOCUS_15840 25656 21883 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532020.1 protein_id gnl|my_center|LOCUS_15840 26233 27750 gene locus_tag LOCUS_15850 gene gltX 26233 27750 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531892.1 protein_id gnl|my_center|LOCUS_15850 28888 27668 gene locus_tag LOCUS_15860 28888 27668 CDS product DUF2865 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531891.1 protein_id gnl|my_center|LOCUS_15860 31344 29020 gene locus_tag LOCUS_15870 31344 29020 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531890.1 protein_id gnl|my_center|LOCUS_15870 32372 31593 gene locus_tag LOCUS_15880 32372 31593 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531889.1 protein_id gnl|my_center|LOCUS_15880 32493 33314 gene locus_tag LOCUS_15890 32493 33314 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531888.1 protein_id gnl|my_center|LOCUS_15890 33442 34656 gene locus_tag LOCUS_15900 33442 34656 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531887.1 protein_id gnl|my_center|LOCUS_15900 35610 34627 gene locus_tag LOCUS_15910 35610 34627 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531886.1 protein_id gnl|my_center|LOCUS_15910 35687 36874 gene locus_tag LOCUS_15920 35687 36874 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531885.1 protein_id gnl|my_center|LOCUS_15920 36876 37685 gene locus_tag LOCUS_15930 36876 37685 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531884.1 protein_id gnl|my_center|LOCUS_15930 37700 39073 gene locus_tag LOCUS_15940 37700 39073 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531883.1 protein_id gnl|my_center|LOCUS_15940 39167 39736 gene locus_tag LOCUS_15950 39167 39736 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531882.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15950 39204 39213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45924 39844 gene locus_tag LOCUS_15960 45924 39844 CDS product kinesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531880.1 protein_id gnl|my_center|LOCUS_15960 46213 46581 gene locus_tag LOCUS_15970 46213 46581 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531879.1 protein_id gnl|my_center|LOCUS_15970 46771 47091 gene locus_tag LOCUS_15980 46771 47091 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531878.1 protein_id gnl|my_center|LOCUS_15980 47181 48209 gene locus_tag LOCUS_15990 47181 48209 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531877.1 protein_id gnl|my_center|LOCUS_15990 49699 48218 gene locus_tag LOCUS_16000 49699 48218 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531876.1 protein_id gnl|my_center|LOCUS_16000 50554 49937 gene locus_tag LOCUS_16010 50554 49937 CDS product DUF922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920055.1 protein_id gnl|my_center|LOCUS_16010 50819 50828 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 50849 51481 gene locus_tag LOCUS_16020 50849 51481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16020 51485 51844 gene locus_tag LOCUS_16030 gene folB 51485 51844 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531873.1 protein_id gnl|my_center|LOCUS_16030 51828 52340 gene locus_tag LOCUS_16040 gene folK 51828 52340 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531872.1 protein_id gnl|my_center|LOCUS_16040 52922 52374 gene locus_tag LOCUS_16050 52922 52374 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531871.1 protein_id gnl|my_center|LOCUS_16050 54765 52927 gene locus_tag LOCUS_16060 54765 52927 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531870.1 protein_id gnl|my_center|LOCUS_16060 55007 55273 gene locus_tag LOCUS_16070 55007 55273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531867.1 protein_id gnl|my_center|LOCUS_16070 55896 55342 gene locus_tag LOCUS_16080 55896 55342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531866.1 protein_id gnl|my_center|LOCUS_16080 57068 55986 gene locus_tag LOCUS_16090 57068 55986 CDS product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531865.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence021 1265 1723 gene locus_tag LOCUS_16100 1265 1723 CDS product phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530255.1 protein_id gnl|my_center|LOCUS_16100 2082 2158 gene locus_tag LOCUS_t00080 2082 2158 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2429 3115 gene locus_tag LOCUS_16110 2429 3115 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313652.1 protein_id gnl|my_center|LOCUS_16110 3576 4463 gene locus_tag LOCUS_16120 3576 4463 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186540.1 protein_id gnl|my_center|LOCUS_16120 4734 5726 gene locus_tag LOCUS_16130 4734 5726 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434654.1 protein_id gnl|my_center|LOCUS_16130 5875 6762 gene locus_tag LOCUS_16140 5875 6762 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527334.1 protein_id gnl|my_center|LOCUS_16140 6755 7795 gene locus_tag LOCUS_16150 6755 7795 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384672.1 protein_id gnl|my_center|LOCUS_16150 7946 8857 gene locus_tag LOCUS_16160 7946 8857 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973459.1 protein_id gnl|my_center|LOCUS_16160 8850 10367 gene locus_tag LOCUS_16170 8850 10367 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973458.1 protein_id gnl|my_center|LOCUS_16170 10364 11695 gene locus_tag LOCUS_16180 10364 11695 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973457.1 protein_id gnl|my_center|LOCUS_16180 11747 12745 gene locus_tag LOCUS_16190 11747 12745 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973452.1 protein_id gnl|my_center|LOCUS_16190 12898 13908 gene locus_tag LOCUS_16200 12898 13908 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391989.1 protein_id gnl|my_center|LOCUS_16200 14442 14224 gene locus_tag LOCUS_16210 14442 14224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530154.1 protein_id gnl|my_center|LOCUS_16210 14825 14601 gene locus_tag LOCUS_16220 14825 14601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 15499 14729 gene locus_tag LOCUS_16230 15499 14729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16230 14849 14858 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15827 16594 gene locus_tag LOCUS_16240 15827 16594 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331278.1 protein_id gnl|my_center|LOCUS_16240 16602 17366 gene locus_tag LOCUS_16250 16602 17366 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331279.1 protein_id gnl|my_center|LOCUS_16250 17624 19177 gene locus_tag LOCUS_16260 17624 19177 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331276.1 protein_id gnl|my_center|LOCUS_16260 19326 20288 gene locus_tag LOCUS_16270 19326 20288 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314316.1 protein_id gnl|my_center|LOCUS_16270 21359 20361 gene locus_tag LOCUS_16280 21359 20361 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395757.1 protein_id gnl|my_center|LOCUS_16280 21500 23497 gene locus_tag LOCUS_16290 21500 23497 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395834.1 protein_id gnl|my_center|LOCUS_16290 23643 25295 gene locus_tag LOCUS_16300 23643 25295 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532331.1 protein_id gnl|my_center|LOCUS_16300 25566 25835 gene locus_tag LOCUS_16310 25566 25835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 25997 26647 gene locus_tag LOCUS_16320 25997 26647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 26644 27489 gene locus_tag LOCUS_16330 26644 27489 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968114.1 protein_id gnl|my_center|LOCUS_16330 27486 28145 gene locus_tag LOCUS_16340 27486 28145 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968106.1 protein_id gnl|my_center|LOCUS_16340 28147 29487 gene locus_tag LOCUS_16350 28147 29487 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_16350 29468 29477 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29487 30554 gene locus_tag LOCUS_16360 29487 30554 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_16360 30557 32080 gene locus_tag LOCUS_16370 30557 32080 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112630.1 protein_id gnl|my_center|LOCUS_16370 32077 33177 gene locus_tag LOCUS_16380 32077 33177 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 protein_id gnl|my_center|LOCUS_16380 33174 34085 gene locus_tag LOCUS_16390 33174 34085 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529891.1 protein_id gnl|my_center|LOCUS_16390 34501 34755 gene locus_tag LOCUS_16400 34501 34755 CDS product DUF768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530335.1 protein_id gnl|my_center|LOCUS_16400 35929 34805 gene locus_tag LOCUS_16410 35929 34805 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530336.1 protein_id gnl|my_center|LOCUS_16410 37602 36040 gene locus_tag LOCUS_16420 gene xseA 37602 36040 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530337.1 protein_id gnl|my_center|LOCUS_16420 37725 39947 gene locus_tag LOCUS_16430 37725 39947 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525318.1 protein_id gnl|my_center|LOCUS_16430 40929 39973 gene locus_tag LOCUS_16440 40929 39973 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530338.1 protein_id gnl|my_center|LOCUS_16440 41108 41398 gene locus_tag LOCUS_16450 41108 41398 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530339.1 protein_id gnl|my_center|LOCUS_16450 42539 41547 gene locus_tag LOCUS_16460 42539 41547 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530340.1 protein_id gnl|my_center|LOCUS_16460 44067 42643 gene locus_tag LOCUS_16470 44067 42643 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530341.1 protein_id gnl|my_center|LOCUS_16470 44936 44202 gene locus_tag LOCUS_16480 44936 44202 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530342.1 protein_id gnl|my_center|LOCUS_16480 45615 44968 gene locus_tag LOCUS_16490 45615 44968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530343.1 protein_id gnl|my_center|LOCUS_16490 45691 46389 gene locus_tag LOCUS_16500 45691 46389 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530344.1 protein_id gnl|my_center|LOCUS_16500 46811 46951 gene locus_tag LOCUS_16510 46811 46951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162034344.1 protein_id gnl|my_center|LOCUS_16510 47771 46998 gene locus_tag LOCUS_16520 47771 46998 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530346.1 protein_id gnl|my_center|LOCUS_16520 48967 47831 gene locus_tag LOCUS_16530 48967 47831 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530347.1 protein_id gnl|my_center|LOCUS_16530 49787 48990 gene locus_tag LOCUS_16540 49787 48990 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530348.1 protein_id gnl|my_center|LOCUS_16540 49995 51299 gene locus_tag LOCUS_16550 49995 51299 CDS product DUF3422 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530349.1 protein_id gnl|my_center|LOCUS_16550 50794 50803 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51416 51425 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51594 53090 gene locus_tag LOCUS_16560 51594 53090 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530350.1 protein_id gnl|my_center|LOCUS_16560 53274 54455 gene locus_tag LOCUS_16570 53274 54455 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530351.1 protein_id gnl|my_center|LOCUS_16570 54452 54841 gene locus_tag LOCUS_16580 54452 54841 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327476.1 protein_id gnl|my_center|LOCUS_16580 54851 56176 gene locus_tag LOCUS_16590 gene glcF 54851 56176 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530352.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence022 535 206 gene locus_tag LOCUS_16600 gene clpS 535 206 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529964.1 protein_id gnl|my_center|LOCUS_16600 941 627 gene locus_tag LOCUS_16610 941 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529963.1 protein_id gnl|my_center|LOCUS_16610 1362 1120 gene locus_tag LOCUS_16620 1362 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 1705 1403 gene locus_tag LOCUS_16630 1705 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504541.1 protein_id gnl|my_center|LOCUS_16630 1856 1665 gene locus_tag LOCUS_16640 1856 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1945 2661 gene locus_tag LOCUS_16650 1945 2661 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529960.1 protein_id gnl|my_center|LOCUS_16650 2658 4067 gene locus_tag LOCUS_16660 2658 4067 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529959.1 protein_id gnl|my_center|LOCUS_16660 4164 4544 gene locus_tag LOCUS_16670 4164 4544 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529744.1 protein_id gnl|my_center|LOCUS_16670 4823 4587 gene locus_tag LOCUS_16680 4823 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 5048 7003 gene locus_tag LOCUS_16690 5048 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 7903 7085 gene locus_tag LOCUS_16700 7903 7085 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040487.1 protein_id gnl|my_center|LOCUS_16700 9372 7891 gene locus_tag LOCUS_16710 9372 7891 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528609.1 protein_id gnl|my_center|LOCUS_16710 10549 9464 gene locus_tag LOCUS_16720 gene cysK 10549 9464 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528610.1 protein_id gnl|my_center|LOCUS_16720 10719 12791 gene locus_tag LOCUS_16730 10719 12791 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528611.1 protein_id gnl|my_center|LOCUS_16730 13865 12828 gene locus_tag LOCUS_16740 13865 12828 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083827.1 protein_id gnl|my_center|LOCUS_16740 15206 14025 gene locus_tag LOCUS_16750 gene choV 15206 14025 CDS product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529958.1 protein_id gnl|my_center|LOCUS_16750 16057 15203 gene locus_tag LOCUS_16760 gene choW 16057 15203 CDS product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529957.1 protein_id gnl|my_center|LOCUS_16760 17213 16278 gene locus_tag LOCUS_16770 17213 16278 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529956.1 protein_id gnl|my_center|LOCUS_16770 17448 18059 gene locus_tag LOCUS_16780 17448 18059 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529955.1 protein_id gnl|my_center|LOCUS_16780 18123 19136 gene locus_tag LOCUS_16790 18123 19136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 19040 19049 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19338 19721 gene locus_tag LOCUS_16800 19338 19721 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529954.1 protein_id gnl|my_center|LOCUS_16800 19906 19694 gene locus_tag LOCUS_16810 19906 19694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 20022 21110 gene locus_tag LOCUS_16820 20022 21110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529953.1 protein_id gnl|my_center|LOCUS_16820 21144 22289 gene locus_tag LOCUS_16830 21144 22289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529952.1 protein_id gnl|my_center|LOCUS_16830 22314 24224 gene locus_tag LOCUS_16840 22314 24224 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529951.1 protein_id gnl|my_center|LOCUS_16840 24212 24643 gene locus_tag LOCUS_16850 24212 24643 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066524.1 protein_id gnl|my_center|LOCUS_16850 24762 26084 gene locus_tag LOCUS_16860 24762 26084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529950.1 protein_id gnl|my_center|LOCUS_16860 25490 25499 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26100 27224 gene locus_tag LOCUS_16870 26100 27224 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529949.1 protein_id gnl|my_center|LOCUS_16870 27542 29221 gene locus_tag LOCUS_16880 27542 29221 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529948.1 protein_id gnl|my_center|LOCUS_16880 29941 29294 gene locus_tag LOCUS_16890 29941 29294 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529947.1 protein_id gnl|my_center|LOCUS_16890 30067 31104 gene locus_tag LOCUS_16900 30067 31104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 30761 30770 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31648 31091 gene locus_tag LOCUS_16910 31648 31091 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529945.1 protein_id gnl|my_center|LOCUS_16910 31780 32241 gene locus_tag LOCUS_16920 31780 32241 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529944.1 protein_id gnl|my_center|LOCUS_16920 32238 33614 gene locus_tag LOCUS_16930 32238 33614 CDS product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529943.1 protein_id gnl|my_center|LOCUS_16930 33716 34771 gene locus_tag LOCUS_16940 33716 34771 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529941.1 protein_id gnl|my_center|LOCUS_16940 35016 37217 gene locus_tag LOCUS_16950 35016 37217 CDS product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529939.1 protein_id gnl|my_center|LOCUS_16950 37223 38170 gene locus_tag LOCUS_16960 37223 38170 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529938.1 protein_id gnl|my_center|LOCUS_16960 39417 38335 gene locus_tag LOCUS_16970 39417 38335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529936.1 protein_id gnl|my_center|LOCUS_16970 39583 40020 gene locus_tag LOCUS_16980 39583 40020 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529935.1 protein_id gnl|my_center|LOCUS_16980 40091 40864 gene locus_tag LOCUS_16990 40091 40864 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529934.1 protein_id gnl|my_center|LOCUS_16990 40913 41221 gene locus_tag LOCUS_17000 40913 41221 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529933.1 protein_id gnl|my_center|LOCUS_17000 41335 42387 gene locus_tag LOCUS_17010 41335 42387 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529931.1 protein_id gnl|my_center|LOCUS_17010 43251 42475 gene locus_tag LOCUS_17020 43251 42475 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_17020 44421 43255 gene locus_tag LOCUS_17030 44421 43255 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 protein_id gnl|my_center|LOCUS_17030 44856 46532 gene locus_tag LOCUS_17040 gene leuA 44856 46532 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529924.1 protein_id gnl|my_center|LOCUS_17040 46720 48492 gene locus_tag LOCUS_17050 46720 48492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529923.1 protein_id gnl|my_center|LOCUS_17050 48625 49419 gene locus_tag LOCUS_17060 48625 49419 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529922.1 protein_id gnl|my_center|LOCUS_17060 49496 50113 gene locus_tag LOCUS_17070 49496 50113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529921.1 protein_id gnl|my_center|LOCUS_17070 51038 50103 gene locus_tag LOCUS_17080 51038 50103 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529920.1 protein_id gnl|my_center|LOCUS_17080 51107 51610 gene locus_tag LOCUS_17090 51107 51610 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529919.1 protein_id gnl|my_center|LOCUS_17090 52602 51613 gene locus_tag LOCUS_17100 52602 51613 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529918.1 protein_id gnl|my_center|LOCUS_17100 52878 53414 gene locus_tag LOCUS_17110 52878 53414 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529917.1 protein_id gnl|my_center|LOCUS_17110 53529 54290 gene locus_tag LOCUS_17120 53529 54290 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529916.1 protein_id gnl|my_center|LOCUS_17120 54296 55468 gene locus_tag LOCUS_17130 54296 55468 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529915.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence023 1087 716 gene locus_tag LOCUS_17140 1087 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 740 749 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 992 1456 gene locus_tag LOCUS_17150 992 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17150 1453 1962 gene locus_tag LOCUS_17160 1453 1962 CDS product tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531123.1 protein_id gnl|my_center|LOCUS_17160 2776 1973 gene locus_tag LOCUS_17170 2776 1973 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 protein_id gnl|my_center|LOCUS_17170 3216 2833 gene locus_tag LOCUS_17180 3216 2833 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531125.1 protein_id gnl|my_center|LOCUS_17180 3568 4578 gene locus_tag LOCUS_17190 3568 4578 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531126.1 protein_id gnl|my_center|LOCUS_17190 4581 5405 gene locus_tag LOCUS_17200 4581 5405 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531127.1 protein_id gnl|my_center|LOCUS_17200 5392 6243 gene locus_tag LOCUS_17210 5392 6243 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 protein_id gnl|my_center|LOCUS_17210 6440 7738 gene locus_tag LOCUS_17220 6440 7738 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_17220 7741 9138 gene locus_tag LOCUS_17230 7741 9138 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_17230 9349 9930 gene locus_tag LOCUS_17240 9349 9930 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173711.1 protein_id gnl|my_center|LOCUS_17240 9930 10517 gene locus_tag LOCUS_17250 9930 10517 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531132.1 protein_id gnl|my_center|LOCUS_17250 13027 10565 gene locus_tag LOCUS_17260 13027 10565 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531133.1 protein_id gnl|my_center|LOCUS_17260 14205 13024 gene locus_tag LOCUS_17270 14205 13024 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531134.1 protein_id gnl|my_center|LOCUS_17270 14471 14205 gene locus_tag LOCUS_17280 14471 14205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 14923 14459 gene locus_tag LOCUS_17290 14923 14459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 14541 14550 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17373 14920 gene locus_tag LOCUS_17300 17373 14920 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531136.1 protein_id gnl|my_center|LOCUS_17300 17976 17389 gene locus_tag LOCUS_17310 17976 17389 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210333952.1 protein_id gnl|my_center|LOCUS_17310 18212 18916 gene locus_tag LOCUS_17320 18212 18916 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173710.1 protein_id gnl|my_center|LOCUS_17320 20279 18942 gene locus_tag LOCUS_17330 20279 18942 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531139.1 protein_id gnl|my_center|LOCUS_17330 20278 20433 gene locus_tag LOCUS_17340 20278 20433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 21095 20505 gene locus_tag LOCUS_17350 21095 20505 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531140.1 protein_id gnl|my_center|LOCUS_17350 20755 20764 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22305 21088 gene locus_tag LOCUS_17360 22305 21088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 24074 22248 gene locus_tag LOCUS_17370 24074 22248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17370 22573 22582 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24367 24071 gene locus_tag LOCUS_17380 24367 24071 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531142.1 protein_id gnl|my_center|LOCUS_17380 25639 24380 gene locus_tag LOCUS_17390 25639 24380 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531143.1 protein_id gnl|my_center|LOCUS_17390 25796 28348 gene locus_tag LOCUS_17400 25796 28348 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531144.1 protein_id gnl|my_center|LOCUS_17400 28493 28777 gene locus_tag LOCUS_17410 28493 28777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023812335.1 protein_id gnl|my_center|LOCUS_17410 28983 30422 gene locus_tag LOCUS_17420 28983 30422 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531146.1 protein_id gnl|my_center|LOCUS_17420 30419 31777 gene locus_tag LOCUS_17430 30419 31777 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531147.1 protein_id gnl|my_center|LOCUS_17430 31897 32331 gene locus_tag LOCUS_17440 31897 32331 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531148.1 protein_id gnl|my_center|LOCUS_17440 32328 33335 gene locus_tag LOCUS_17450 32328 33335 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531149.1 protein_id gnl|my_center|LOCUS_17450 33366 34835 gene locus_tag LOCUS_17460 33366 34835 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109667839.1 protein_id gnl|my_center|LOCUS_17460 34844 36085 gene locus_tag LOCUS_17470 34844 36085 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531151.1 protein_id gnl|my_center|LOCUS_17470 36082 36834 gene locus_tag LOCUS_17480 36082 36834 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531152.1 protein_id gnl|my_center|LOCUS_17480 36991 39552 gene locus_tag LOCUS_17490 36991 39552 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531153.1 protein_id gnl|my_center|LOCUS_17490 39585 40481 gene locus_tag LOCUS_17500 39585 40481 CDS product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172389.1 protein_id gnl|my_center|LOCUS_17500 40579 40926 gene locus_tag LOCUS_17510 40579 40926 CDS product peptidase inhibitor family I36 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531155.1 protein_id gnl|my_center|LOCUS_17510 41022 41246 gene locus_tag LOCUS_17520 41022 41246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 42222 41257 gene locus_tag LOCUS_17530 42222 41257 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531159.1 protein_id gnl|my_center|LOCUS_17530 42486 42495 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42693 42547 gene locus_tag LOCUS_17540 42693 42547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531161.1 protein_id gnl|my_center|LOCUS_17540 43225 43040 gene locus_tag LOCUS_17550 43225 43040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531162.1 protein_id gnl|my_center|LOCUS_17550 43445 44344 gene locus_tag LOCUS_17560 43445 44344 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531163.1 protein_id gnl|my_center|LOCUS_17560 44344 44694 gene locus_tag LOCUS_17570 44344 44694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116963198.1 protein_id gnl|my_center|LOCUS_17570 45593 44613 gene locus_tag LOCUS_17580 45593 44613 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531164.1 protein_id gnl|my_center|LOCUS_17580 46016 45831 gene locus_tag LOCUS_17590 46016 45831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531165.1 protein_id gnl|my_center|LOCUS_17590 48289 46202 gene locus_tag LOCUS_17600 48289 46202 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531166.1 protein_id gnl|my_center|LOCUS_17600 46329 46338 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49274 48300 gene locus_tag LOCUS_17610 49274 48300 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531167.1 protein_id gnl|my_center|LOCUS_17610 50446 49355 gene locus_tag LOCUS_17620 50446 49355 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531168.1 protein_id gnl|my_center|LOCUS_17620 51042 50443 gene locus_tag LOCUS_17630 51042 50443 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531169.1 protein_id gnl|my_center|LOCUS_17630 51337 51035 gene locus_tag LOCUS_17640 51337 51035 CDS product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531170.1 protein_id gnl|my_center|LOCUS_17640 52244 51474 gene locus_tag LOCUS_17650 52244 51474 CDS product formyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531171.1 protein_id gnl|my_center|LOCUS_17650 52968 52390 gene locus_tag LOCUS_17660 52968 52390 CDS product DUF4893 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531172.1 protein_id gnl|my_center|LOCUS_17660 53623 52994 gene locus_tag LOCUS_17670 53623 52994 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531173.1 protein_id gnl|my_center|LOCUS_17670 53688 53828 gene locus_tag LOCUS_17680 53688 53828 CDS product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531174.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence024 <1 1099 gene locus_tag LOCUS_17690 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393521.1:xylulokinase 1166 1759 gene locus_tag LOCUS_17700 1166 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 2711 1749 gene locus_tag LOCUS_17710 2711 1749 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529318.1 protein_id gnl|my_center|LOCUS_17710 3024 4034 gene locus_tag LOCUS_17720 3024 4034 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246911.1 protein_id gnl|my_center|LOCUS_17720 4169 5107 gene locus_tag LOCUS_17730 4169 5107 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971941.1 protein_id gnl|my_center|LOCUS_17730 5134 6654 gene locus_tag LOCUS_17740 5134 6654 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103981.1 protein_id gnl|my_center|LOCUS_17740 5472 5481 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6786 7553 gene locus_tag LOCUS_17750 6786 7553 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532887.1 protein_id gnl|my_center|LOCUS_17750 7562 8347 gene locus_tag LOCUS_17760 7562 8347 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067339.1 protein_id gnl|my_center|LOCUS_17760 8766 9707 gene locus_tag LOCUS_17770 8766 9707 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 protein_id gnl|my_center|LOCUS_17770 9783 10862 gene locus_tag LOCUS_17780 9783 10862 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 protein_id gnl|my_center|LOCUS_17780 10859 12838 gene locus_tag LOCUS_17790 10859 12838 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 protein_id gnl|my_center|LOCUS_17790 12876 13253 gene locus_tag LOCUS_17800 12876 13253 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532891.1 protein_id gnl|my_center|LOCUS_17800 14639 13281 gene locus_tag LOCUS_17810 14639 13281 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532892.1 protein_id gnl|my_center|LOCUS_17810 14855 15619 gene locus_tag LOCUS_17820 14855 15619 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532893.1 protein_id gnl|my_center|LOCUS_17820 16727 15687 gene locus_tag LOCUS_17830 16727 15687 CDS product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532894.1 protein_id gnl|my_center|LOCUS_17830 17702 16737 gene locus_tag LOCUS_17840 17702 16737 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532895.1 protein_id gnl|my_center|LOCUS_17840 18295 17699 gene locus_tag LOCUS_17850 18295 17699 CDS product dimethylamine monooxygenase subunit DmmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532896.1 protein_id gnl|my_center|LOCUS_17850 19503 18397 gene locus_tag LOCUS_17860 19503 18397 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532897.1 protein_id gnl|my_center|LOCUS_17860 19817 20104 gene locus_tag LOCUS_17870 19817 20104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532898.1 protein_id gnl|my_center|LOCUS_17870 20110 20487 gene locus_tag LOCUS_17880 20110 20487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532899.1 protein_id gnl|my_center|LOCUS_17880 20503 20664 gene locus_tag LOCUS_17890 20503 20664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532900.1 protein_id gnl|my_center|LOCUS_17890 20679 22091 gene locus_tag LOCUS_17900 20679 22091 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532901.1 protein_id gnl|my_center|LOCUS_17900 22127 22816 gene locus_tag LOCUS_17910 22127 22816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171620.1 protein_id gnl|my_center|LOCUS_17910 22813 23142 gene locus_tag LOCUS_17920 22813 23142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532903.1 protein_id gnl|my_center|LOCUS_17920 23228 24124 gene locus_tag LOCUS_17930 23228 24124 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532904.1 protein_id gnl|my_center|LOCUS_17930 24129 24860 gene locus_tag LOCUS_17940 24129 24860 CDS product GXGXG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532905.1 protein_id gnl|my_center|LOCUS_17940 24867 26195 gene locus_tag LOCUS_17950 24867 26195 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010914750.1 protein_id gnl|my_center|LOCUS_17950 26218 27564 gene locus_tag LOCUS_17960 gene glnT 26218 27564 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532906.1 protein_id gnl|my_center|LOCUS_17960 27659 28912 gene locus_tag LOCUS_17970 27659 28912 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532907.1 protein_id gnl|my_center|LOCUS_17970 28923 29198 gene locus_tag LOCUS_17980 28923 29198 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532908.1 protein_id gnl|my_center|LOCUS_17980 29198 32182 gene locus_tag LOCUS_17990 29198 32182 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532909.1 protein_id gnl|my_center|LOCUS_17990 32175 32798 gene locus_tag LOCUS_18000 32175 32798 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532910.1 protein_id gnl|my_center|LOCUS_18000 33068 35437 gene locus_tag LOCUS_18010 33068 35437 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532911.1 protein_id gnl|my_center|LOCUS_18010 35699 37399 gene locus_tag LOCUS_18020 35699 37399 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532912.1 protein_id gnl|my_center|LOCUS_18020 37588 37469 gene locus_tag LOCUS_18030 37588 37469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 40834 37688 gene locus_tag LOCUS_18040 40834 37688 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532913.1 protein_id gnl|my_center|LOCUS_18040 42217 41069 gene locus_tag LOCUS_18050 42217 41069 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532914.1 protein_id gnl|my_center|LOCUS_18050 42876 42271 gene locus_tag LOCUS_18060 42876 42271 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532915.1 protein_id gnl|my_center|LOCUS_18060 44889 43249 gene locus_tag LOCUS_18070 44889 43249 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532916.1 protein_id gnl|my_center|LOCUS_18070 45092 46057 gene locus_tag LOCUS_18080 45092 46057 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532917.1 protein_id gnl|my_center|LOCUS_18080 46149 48203 gene locus_tag LOCUS_18090 46149 48203 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532918.1 protein_id gnl|my_center|LOCUS_18090 48468 49538 gene locus_tag LOCUS_18100 48468 49538 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965983.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence025 <1 577 gene locus_tag LOCUS_18110 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528701.1:GlxA family transcriptional regulator 754 2049 gene locus_tag LOCUS_18120 754 2049 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528700.1 protein_id gnl|my_center|LOCUS_18120 2330 3007 gene locus_tag LOCUS_18130 2330 3007 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528699.1 protein_id gnl|my_center|LOCUS_18130 3018 4097 gene locus_tag LOCUS_18140 3018 4097 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528698.1 protein_id gnl|my_center|LOCUS_18140 4325 5965 gene locus_tag LOCUS_18150 4325 5965 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528697.1 protein_id gnl|my_center|LOCUS_18150 6092 7777 gene locus_tag LOCUS_18160 6092 7777 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104548.1 protein_id gnl|my_center|LOCUS_18160 7859 8692 gene locus_tag LOCUS_18170 7859 8692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531957.1 protein_id gnl|my_center|LOCUS_18170 8860 8997 gene locus_tag LOCUS_18180 8860 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18180 9408 9055 gene locus_tag LOCUS_18190 9408 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 9836 9351 gene locus_tag LOCUS_18200 9836 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 10008 10616 gene locus_tag LOCUS_18210 10008 10616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265569.1 protein_id gnl|my_center|LOCUS_18210 10613 11809 gene locus_tag LOCUS_18220 10613 11809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918452.1 protein_id gnl|my_center|LOCUS_18220 11796 12752 gene locus_tag LOCUS_18230 11796 12752 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918453.1 protein_id gnl|my_center|LOCUS_18230 12749 14053 gene locus_tag LOCUS_18240 12749 14053 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918454.1 protein_id gnl|my_center|LOCUS_18240 14050 15069 gene locus_tag LOCUS_18250 14050 15069 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013896057.1 protein_id gnl|my_center|LOCUS_18250 15056 15922 gene locus_tag LOCUS_18260 15056 15922 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640008.1 protein_id gnl|my_center|LOCUS_18260 16872 16186 gene locus_tag LOCUS_18270 16872 16186 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532294.1 protein_id gnl|my_center|LOCUS_18270 17027 18085 gene locus_tag LOCUS_18280 17027 18085 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173644.1 protein_id gnl|my_center|LOCUS_18280 18997 18194 gene locus_tag LOCUS_18290 18997 18194 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532296.1 protein_id gnl|my_center|LOCUS_18290 21002 19233 gene locus_tag LOCUS_18300 21002 19233 CDS product glucan ABC transporter ATP-binding protein/ permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532297.1 protein_id gnl|my_center|LOCUS_18300 29962 21356 gene locus_tag LOCUS_18310 29962 21356 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532298.1 protein_id gnl|my_center|LOCUS_18310 23740 23749 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30820 30233 gene locus_tag LOCUS_18320 30820 30233 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532299.1 protein_id gnl|my_center|LOCUS_18320 32498 30825 gene locus_tag LOCUS_18330 32498 30825 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532300.1 protein_id gnl|my_center|LOCUS_18330 33342 32524 gene locus_tag LOCUS_18340 gene hutG 33342 32524 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532301.1 protein_id gnl|my_center|LOCUS_18340 34883 33342 gene locus_tag LOCUS_18350 gene hutH 34883 33342 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532302.1 protein_id gnl|my_center|LOCUS_18350 36049 34880 gene locus_tag LOCUS_18360 gene hutI 36049 34880 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532303.1 protein_id gnl|my_center|LOCUS_18360 36212 37567 gene locus_tag LOCUS_18370 36212 37567 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532304.1 protein_id gnl|my_center|LOCUS_18370 37592 38338 gene locus_tag LOCUS_18380 gene hutC 37592 38338 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532305.1 protein_id gnl|my_center|LOCUS_18380 38729 38385 gene locus_tag LOCUS_18390 38729 38385 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532306.1 protein_id gnl|my_center|LOCUS_18390 38936 39796 gene locus_tag LOCUS_18400 gene aztA 38936 39796 CDS product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532307.1 protein_id gnl|my_center|LOCUS_18400 39796 41565 gene locus_tag LOCUS_18410 39796 41565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 40558 40567 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41735 42073 gene locus_tag LOCUS_18420 41735 42073 CDS product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532310.1 protein_id gnl|my_center|LOCUS_18420 42591 42124 gene locus_tag LOCUS_18430 42591 42124 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532311.1 protein_id gnl|my_center|LOCUS_18430 42729 43130 gene locus_tag LOCUS_18440 42729 43130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18440 42987 42996 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43016 43861 gene locus_tag LOCUS_18450 43016 43861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18450 44418 43882 gene locus_tag LOCUS_18460 44418 43882 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973277.1 protein_id gnl|my_center|LOCUS_18460 44708 44415 gene locus_tag LOCUS_18470 44708 44415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532315.1 protein_id gnl|my_center|LOCUS_18470 44853 44713 gene locus_tag LOCUS_18480 44853 44713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18480 45752 44850 gene locus_tag LOCUS_18490 45752 44850 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532316.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18490 44914 44923 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46702 45749 gene locus_tag LOCUS_18500 46702 45749 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173642.1 protein_id gnl|my_center|LOCUS_18500 48012 46699 gene locus_tag LOCUS_18510 gene hmgA 48012 46699 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532318.1 protein_id gnl|my_center|LOCUS_18510 48139 48615 gene locus_tag LOCUS_18520 48139 48615 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532319.1 protein_id gnl|my_center|LOCUS_18520 48631 49272 gene locus_tag LOCUS_18530 48631 49272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 >Feature sequence026 961 299 gene locus_tag LOCUS_18540 961 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 2399 1014 gene locus_tag LOCUS_18550 2399 1014 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528229.1 protein_id gnl|my_center|LOCUS_18550 3893 2553 gene locus_tag LOCUS_18560 3893 2553 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528228.1 protein_id gnl|my_center|LOCUS_18560 2636 2645 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4004 4456 gene locus_tag LOCUS_18570 4004 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528227.1 protein_id gnl|my_center|LOCUS_18570 5437 4463 gene locus_tag LOCUS_18580 5437 4463 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528226.1 protein_id gnl|my_center|LOCUS_18580 5339 5599 gene locus_tag LOCUS_18590 5339 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 6829 5786 gene locus_tag LOCUS_18600 6829 5786 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528225.1 protein_id gnl|my_center|LOCUS_18600 6965 7696 gene locus_tag LOCUS_18610 6965 7696 CDS product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528224.1 protein_id gnl|my_center|LOCUS_18610 7916 8386 gene locus_tag LOCUS_18620 7916 8386 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528223.1 protein_id gnl|my_center|LOCUS_18620 9492 8584 gene locus_tag LOCUS_18630 9492 8584 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528222.1 protein_id gnl|my_center|LOCUS_18630 9539 9949 gene locus_tag LOCUS_18640 9539 9949 CDS product DUF2000 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528221.1 protein_id gnl|my_center|LOCUS_18640 10144 11028 gene locus_tag LOCUS_18650 10144 11028 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081296127.1 protein_id gnl|my_center|LOCUS_18650 11030 12118 gene locus_tag LOCUS_18660 11030 12118 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081714208.1 protein_id gnl|my_center|LOCUS_18660 12115 13098 gene locus_tag LOCUS_18670 12115 13098 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528218.1 protein_id gnl|my_center|LOCUS_18670 13255 13638 gene locus_tag LOCUS_18680 13255 13638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501916.1 protein_id gnl|my_center|LOCUS_18680 14424 13651 gene locus_tag LOCUS_18690 14424 13651 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528216.1 protein_id gnl|my_center|LOCUS_18690 14717 15826 gene locus_tag LOCUS_18700 14717 15826 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528215.1 protein_id gnl|my_center|LOCUS_18700 17111 16083 gene locus_tag LOCUS_18710 17111 16083 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170440.1 protein_id gnl|my_center|LOCUS_18710 18927 17131 gene locus_tag LOCUS_18720 18927 17131 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299056.1 protein_id gnl|my_center|LOCUS_18720 17203 17212 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19529 18924 gene locus_tag LOCUS_18730 19529 18924 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528212.1 protein_id gnl|my_center|LOCUS_18730 20679 19774 gene locus_tag LOCUS_18740 20679 19774 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528211.1 protein_id gnl|my_center|LOCUS_18740 20832 21227 gene locus_tag LOCUS_18750 20832 21227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 21233 22180 gene locus_tag LOCUS_18760 21233 22180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 22405 22196 gene locus_tag LOCUS_18770 22405 22196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 22286 22993 gene locus_tag LOCUS_18780 22286 22993 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528184.1 protein_id gnl|my_center|LOCUS_18780 24915 23218 gene locus_tag LOCUS_18790 gene rpsA 24915 23218 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528183.1 protein_id gnl|my_center|LOCUS_18790 25769 25119 gene locus_tag LOCUS_18800 gene cmk 25769 25119 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528182.1 protein_id gnl|my_center|LOCUS_18800 26092 25766 gene locus_tag LOCUS_18810 26092 25766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 27450 26092 gene locus_tag LOCUS_18820 gene aroA 27450 26092 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528181.1 protein_id gnl|my_center|LOCUS_18820 27655 28047 gene locus_tag LOCUS_18830 27655 28047 CDS product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528180.1 protein_id gnl|my_center|LOCUS_18830 28223 28298 gene locus_tag LOCUS_t00090 28223 28298 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 29135 28446 gene locus_tag LOCUS_18840 29135 28446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 29669 30205 gene locus_tag LOCUS_18850 29669 30205 CDS product DUF5706 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021572.1 protein_id gnl|my_center|LOCUS_18850 30202 31065 gene locus_tag LOCUS_18860 30202 31065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 31154 31792 gene locus_tag LOCUS_18870 31154 31792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 32125 31955 gene locus_tag LOCUS_18880 32125 31955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 32617 32273 gene locus_tag LOCUS_18890 32617 32273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 35523 32614 gene locus_tag LOCUS_18900 35523 32614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 36140 35760 gene locus_tag LOCUS_18910 36140 35760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 37281 36205 gene locus_tag LOCUS_18920 37281 36205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 37960 37340 gene locus_tag LOCUS_18930 37960 37340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 38696 37938 gene locus_tag LOCUS_18940 38696 37938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 39100 38900 gene locus_tag LOCUS_18950 39100 38900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140250.1 protein_id gnl|my_center|LOCUS_18950 40097 39204 gene locus_tag LOCUS_18960 40097 39204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 41424 40084 gene locus_tag LOCUS_18970 41424 40084 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240716.1 protein_id gnl|my_center|LOCUS_18970 41788 42123 gene locus_tag LOCUS_18980 41788 42123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 42186 42929 gene locus_tag LOCUS_18990 42186 42929 CDS product DUF2161 domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531642.1 protein_id gnl|my_center|LOCUS_18990 43440 44171 gene locus_tag LOCUS_19000 43440 44171 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531928.1 protein_id gnl|my_center|LOCUS_19000 44168 45370 gene locus_tag LOCUS_19010 44168 45370 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531927.1 protein_id gnl|my_center|LOCUS_19010 45384 46676 gene locus_tag LOCUS_19020 45384 46676 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531926.1 protein_id gnl|my_center|LOCUS_19020 46866 47789 gene locus_tag LOCUS_19030 46866 47789 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531925.1 protein_id gnl|my_center|LOCUS_19030 47789 48637 gene locus_tag LOCUS_19040 47789 48637 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531924.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence027 1 909 gene locus_tag LOCUS_19050 1 909 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530675.1 protein_id gnl|my_center|LOCUS_19050 906 2684 gene locus_tag LOCUS_19060 906 2684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530674.1 protein_id gnl|my_center|LOCUS_19060 3484 2741 gene locus_tag LOCUS_19070 3484 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19070 3543 4208 gene locus_tag LOCUS_19080 3543 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 3594 3603 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4775 4503 gene locus_tag LOCUS_19090 gene minE 4775 4503 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530672.1 protein_id gnl|my_center|LOCUS_19090 5587 4772 gene locus_tag LOCUS_19100 gene minD 5587 4772 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530671.1 protein_id gnl|my_center|LOCUS_19100 6449 5691 gene locus_tag LOCUS_19110 gene minC 6449 5691 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530670.1 protein_id gnl|my_center|LOCUS_19110 6727 7182 gene locus_tag LOCUS_19120 6727 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 7702 7241 gene locus_tag LOCUS_19130 7702 7241 CDS product phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530255.1 protein_id gnl|my_center|LOCUS_19130 8910 8485 gene locus_tag LOCUS_19140 8910 8485 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 protein_id gnl|my_center|LOCUS_19140 8967 9344 gene locus_tag LOCUS_19150 8967 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 9286 9753 gene locus_tag LOCUS_19160 9286 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 10039 9890 gene locus_tag LOCUS_19170 10039 9890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007609497.1 protein_id gnl|my_center|LOCUS_19170 10371 10087 gene locus_tag LOCUS_19180 10371 10087 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531539.1 protein_id gnl|my_center|LOCUS_19180 10677 10483 gene locus_tag LOCUS_19190 10677 10483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 11131 10808 gene locus_tag LOCUS_19200 11131 10808 CDS product DUF2934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530664.1 protein_id gnl|my_center|LOCUS_19200 11270 12673 gene locus_tag LOCUS_19210 11270 12673 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530415.1 protein_id gnl|my_center|LOCUS_19210 13007 13459 gene locus_tag LOCUS_19220 13007 13459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 14225 13533 gene locus_tag LOCUS_19230 14225 13533 CDS product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530663.1 protein_id gnl|my_center|LOCUS_19230 15486 14368 gene locus_tag LOCUS_19240 15486 14368 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530659.1 protein_id gnl|my_center|LOCUS_19240 15912 16121 gene locus_tag LOCUS_19250 15912 16121 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003508146.1 protein_id gnl|my_center|LOCUS_19250 16237 16473 gene locus_tag LOCUS_19260 16237 16473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 16570 17505 gene locus_tag LOCUS_19270 16570 17505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530658.1 protein_id gnl|my_center|LOCUS_19270 19161 18064 gene locus_tag LOCUS_19280 19161 18064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 20611 19244 gene locus_tag LOCUS_19290 20611 19244 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530657.1 protein_id gnl|my_center|LOCUS_19290 21114 20710 gene locus_tag LOCUS_19300 21114 20710 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530567.1 protein_id gnl|my_center|LOCUS_19300 21235 21933 gene locus_tag LOCUS_19310 21235 21933 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640466.1 protein_id gnl|my_center|LOCUS_19310 22112 23641 gene locus_tag LOCUS_19320 22112 23641 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19320 23581 23772 gene locus_tag LOCUS_19330 23581 23772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19330 23894 24760 gene locus_tag LOCUS_19340 23894 24760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 24994 27588 gene locus_tag LOCUS_19350 24994 27588 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827646.1 protein_id gnl|my_center|LOCUS_19350 29221 27599 gene locus_tag LOCUS_19360 29221 27599 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530640.1 protein_id gnl|my_center|LOCUS_19360 30246 29503 gene locus_tag LOCUS_19370 30246 29503 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530732.1 protein_id gnl|my_center|LOCUS_19370 30897 30373 gene locus_tag LOCUS_19380 30897 30373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 31334 30912 gene locus_tag LOCUS_19390 31334 30912 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391608.1 protein_id gnl|my_center|LOCUS_19390 31820 31371 gene locus_tag LOCUS_19400 31820 31371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 33372 31882 gene locus_tag LOCUS_19410 33372 31882 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920258.1 protein_id gnl|my_center|LOCUS_19410 34278 33454 gene locus_tag LOCUS_19420 34278 33454 CDS product p-hydroxycinnamoyl CoA hydratase/lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920259.1 protein_id gnl|my_center|LOCUS_19420 34383 34835 gene locus_tag LOCUS_19430 34383 34835 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807341.1 protein_id gnl|my_center|LOCUS_19430 36506 34974 gene locus_tag LOCUS_19440 36506 34974 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193177.1 protein_id gnl|my_center|LOCUS_19440 36899 36672 gene locus_tag LOCUS_19450 36899 36672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 36844 37962 gene locus_tag LOCUS_19460 36844 37962 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191662.1 protein_id gnl|my_center|LOCUS_19460 38067 38729 gene locus_tag LOCUS_19470 38067 38729 CDS product phytochelatin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067197.1 protein_id gnl|my_center|LOCUS_19470 38902 39123 gene locus_tag LOCUS_19480 38902 39123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 39720 39133 gene locus_tag LOCUS_19490 39720 39133 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530731.1 protein_id gnl|my_center|LOCUS_19490 39824 40240 gene locus_tag LOCUS_19500 39824 40240 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530730.1 protein_id gnl|my_center|LOCUS_19500 40368 41102 gene locus_tag LOCUS_19510 40368 41102 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530745.1 protein_id gnl|my_center|LOCUS_19510 41076 41085 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41520 41119 gene locus_tag LOCUS_19520 41520 41119 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532891.1 protein_id gnl|my_center|LOCUS_19520 42628 41636 gene locus_tag LOCUS_19530 42628 41636 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270038.1 protein_id gnl|my_center|LOCUS_19530 42787 43179 gene locus_tag LOCUS_19540 42787 43179 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114392.1 protein_id gnl|my_center|LOCUS_19540 44718 43210 gene locus_tag LOCUS_19550 44718 43210 CDS product winged helix-turn-helix domain-containing tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095517487.1 protein_id gnl|my_center|LOCUS_19550 44861 45103 gene locus_tag LOCUS_19560 44861 45103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 46181 45123 gene locus_tag LOCUS_19570 46181 45123 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530748.1 protein_id gnl|my_center|LOCUS_19570 47061 46276 gene locus_tag LOCUS_19580 47061 46276 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312095.1 protein_id gnl|my_center|LOCUS_19580 47363 48118 gene locus_tag LOCUS_19590 47363 48118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 <49093 48260 gene locus_tag LOCUS_19600 <49093 48260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530032.1:DUF2778 domain-containing protein >Feature sequence028 564 1 gene locus_tag LOCUS_19610 564 1 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529627.1 protein_id gnl|my_center|LOCUS_19610 1298 669 gene locus_tag LOCUS_19620 gene upp 1298 669 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529626.1 protein_id gnl|my_center|LOCUS_19620 2410 1436 gene locus_tag LOCUS_19630 2410 1436 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529625.1 protein_id gnl|my_center|LOCUS_19630 2545 3321 gene locus_tag LOCUS_19640 gene ubiE 2545 3321 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529624.1 protein_id gnl|my_center|LOCUS_19640 3350 4924 gene locus_tag LOCUS_19650 gene ubiB 3350 4924 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529623.1 protein_id gnl|my_center|LOCUS_19650 5005 5256 gene locus_tag LOCUS_19660 5005 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 5347 6819 gene locus_tag LOCUS_19670 gene coaBC 5347 6819 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529620.1 protein_id gnl|my_center|LOCUS_19670 8166 6841 gene locus_tag LOCUS_19680 8166 6841 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969977.1 protein_id gnl|my_center|LOCUS_19680 8263 9105 gene locus_tag LOCUS_19690 8263 9105 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969978.1 protein_id gnl|my_center|LOCUS_19690 10602 9136 gene locus_tag LOCUS_19700 10602 9136 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529649.1 protein_id gnl|my_center|LOCUS_19700 11324 10776 gene locus_tag LOCUS_19710 11324 10776 CDS product DUF992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529650.1 protein_id gnl|my_center|LOCUS_19710 11808 11332 gene locus_tag LOCUS_19720 11808 11332 CDS product DUF992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529651.1 protein_id gnl|my_center|LOCUS_19720 12897 12043 gene locus_tag LOCUS_19730 12897 12043 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529652.1 protein_id gnl|my_center|LOCUS_19730 13296 13033 gene locus_tag LOCUS_19740 gene rpsU 13296 13033 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529653.1 protein_id gnl|my_center|LOCUS_19740 13861 13475 gene locus_tag LOCUS_19750 13861 13475 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529654.1 protein_id gnl|my_center|LOCUS_19750 14725 14129 gene locus_tag LOCUS_19760 14725 14129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19760 14849 16246 gene locus_tag LOCUS_19770 14849 16246 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529656.1 protein_id gnl|my_center|LOCUS_19770 16310 16606 gene locus_tag LOCUS_19780 16310 16606 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529658.1 protein_id gnl|my_center|LOCUS_19780 16603 19596 gene locus_tag LOCUS_19790 16603 19596 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529659.1 protein_id gnl|my_center|LOCUS_19790 19589 20167 gene locus_tag LOCUS_19800 19589 20167 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529660.1 protein_id gnl|my_center|LOCUS_19800 20228 20449 gene locus_tag LOCUS_19810 20228 20449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529661.1 protein_id gnl|my_center|LOCUS_19810 20765 20520 gene locus_tag LOCUS_19820 20765 20520 CDS product DUF680 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529664.1 protein_id gnl|my_center|LOCUS_19820 21629 20985 gene locus_tag LOCUS_19830 21629 20985 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529665.1 protein_id gnl|my_center|LOCUS_19830 22553 21777 gene locus_tag LOCUS_19840 22553 21777 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206876.1 protein_id gnl|my_center|LOCUS_19840 23606 22572 gene locus_tag LOCUS_19850 23606 22572 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529667.1 protein_id gnl|my_center|LOCUS_19850 24127 23603 gene locus_tag LOCUS_19860 24127 23603 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529668.1 protein_id gnl|my_center|LOCUS_19860 24943 24128 gene locus_tag LOCUS_19870 24943 24128 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529669.1 protein_id gnl|my_center|LOCUS_19870 25074 26315 gene locus_tag LOCUS_19880 25074 26315 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529670.1 protein_id gnl|my_center|LOCUS_19880 26384 27403 gene locus_tag LOCUS_19890 26384 27403 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529671.1 protein_id gnl|my_center|LOCUS_19890 30720 27589 gene locus_tag LOCUS_19900 30720 27589 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529677.1 protein_id gnl|my_center|LOCUS_19900 31880 30717 gene locus_tag LOCUS_19910 31880 30717 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529678.1 protein_id gnl|my_center|LOCUS_19910 32878 32051 gene locus_tag LOCUS_19920 32878 32051 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529679.1 protein_id gnl|my_center|LOCUS_19920 33027 33845 gene locus_tag LOCUS_19930 33027 33845 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529680.1 protein_id gnl|my_center|LOCUS_19930 33865 35421 gene locus_tag LOCUS_19940 33865 35421 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529681.1 protein_id gnl|my_center|LOCUS_19940 35509 36879 gene locus_tag LOCUS_19950 35509 36879 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529682.1 protein_id gnl|my_center|LOCUS_19950 36948 37460 gene locus_tag LOCUS_19960 36948 37460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 37450 37869 gene locus_tag LOCUS_19970 37450 37869 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651037.1 protein_id gnl|my_center|LOCUS_19970 37886 39271 gene locus_tag LOCUS_19980 37886 39271 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529683.1 protein_id gnl|my_center|LOCUS_19980 39292 40464 gene locus_tag LOCUS_19990 39292 40464 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529684.1 protein_id gnl|my_center|LOCUS_19990 40709 41815 gene locus_tag LOCUS_20000 40709 41815 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529685.1 protein_id gnl|my_center|LOCUS_20000 41877 42791 gene locus_tag LOCUS_20010 41877 42791 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097572960.1 protein_id gnl|my_center|LOCUS_20010 42788 43579 gene locus_tag LOCUS_20020 42788 43579 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529687.1 protein_id gnl|my_center|LOCUS_20020 43605 44669 gene locus_tag LOCUS_20030 43605 44669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529688.1 protein_id gnl|my_center|LOCUS_20030 44824 46374 gene locus_tag LOCUS_20040 44824 46374 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529689.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence029 2101 1277 gene locus_tag LOCUS_20050 2101 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2327 2336 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2343 2537 gene locus_tag LOCUS_20060 2343 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 4435 2558 gene locus_tag LOCUS_20070 4435 2558 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532466.1 protein_id gnl|my_center|LOCUS_20070 4572 4709 gene locus_tag LOCUS_20080 4572 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 5278 4832 gene locus_tag LOCUS_20090 5278 4832 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532467.1 protein_id gnl|my_center|LOCUS_20090 5650 5447 gene locus_tag LOCUS_20100 5650 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532468.1 protein_id gnl|my_center|LOCUS_20100 6305 5643 gene locus_tag LOCUS_20110 6305 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 6691 6239 gene locus_tag LOCUS_20120 6691 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 6374 6383 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7532 6699 gene locus_tag LOCUS_20130 7532 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504290.1 protein_id gnl|my_center|LOCUS_20130 7643 8611 gene locus_tag LOCUS_20140 7643 8611 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532472.1 protein_id gnl|my_center|LOCUS_20140 9100 8936 gene locus_tag LOCUS_20150 9100 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531552.1 protein_id gnl|my_center|LOCUS_20150 9241 9411 gene locus_tag LOCUS_20160 9241 9411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 9489 11567 gene locus_tag LOCUS_20170 9489 11567 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532458.1 protein_id gnl|my_center|LOCUS_20170 11663 11854 gene locus_tag LOCUS_20180 11663 11854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 11972 12268 gene locus_tag LOCUS_20190 11972 12268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 12336 12515 gene locus_tag LOCUS_20200 12336 12515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 12765 13067 gene locus_tag LOCUS_20210 12765 13067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 13957 13169 gene locus_tag LOCUS_20220 13957 13169 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532435.1 protein_id gnl|my_center|LOCUS_20220 14770 14195 gene locus_tag LOCUS_20230 14770 14195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525013.1 protein_id gnl|my_center|LOCUS_20230 15508 14996 gene locus_tag LOCUS_20240 15508 14996 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532473.1 protein_id gnl|my_center|LOCUS_20240 15781 16416 gene locus_tag LOCUS_20250 gene bluB 15781 16416 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391283.1 protein_id gnl|my_center|LOCUS_20250 16764 16513 gene locus_tag LOCUS_20260 16764 16513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 16899 17321 gene locus_tag LOCUS_20270 gene ndk 16899 17321 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531616.1 protein_id gnl|my_center|LOCUS_20270 17829 18026 gene locus_tag LOCUS_20280 17829 18026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 18349 18086 gene locus_tag LOCUS_20290 18349 18086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 18587 19717 gene locus_tag LOCUS_20300 18587 19717 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077380485.1 protein_id gnl|my_center|LOCUS_20300 20006 20677 gene locus_tag LOCUS_20310 20006 20677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 21490 20846 gene locus_tag LOCUS_20320 21490 20846 CDS product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532477.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20320 22051 21569 gene locus_tag LOCUS_20330 22051 21569 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532478.1 protein_id gnl|my_center|LOCUS_20330 22310 22053 gene locus_tag LOCUS_20340 gene moaD 22310 22053 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532479.1 protein_id gnl|my_center|LOCUS_20340 22908 22312 gene locus_tag LOCUS_20350 gene pgsA 22908 22312 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532480.1 protein_id gnl|my_center|LOCUS_20350 25087 23012 gene locus_tag LOCUS_20360 gene uvrC 25087 23012 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532481.1 protein_id gnl|my_center|LOCUS_20360 25848 25084 gene locus_tag LOCUS_20370 25848 25084 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532482.1 protein_id gnl|my_center|LOCUS_20370 26264 26908 gene locus_tag LOCUS_20380 26264 26908 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532483.1 protein_id gnl|my_center|LOCUS_20380 27424 27242 gene locus_tag LOCUS_20390 27424 27242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 27888 27505 gene locus_tag LOCUS_20400 27888 27505 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130493709.1 protein_id gnl|my_center|LOCUS_20400 28695 27979 gene locus_tag LOCUS_20410 28695 27979 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532484.1 protein_id gnl|my_center|LOCUS_20410 29230 28847 gene locus_tag LOCUS_20420 29230 28847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 30389 29862 gene locus_tag LOCUS_20430 30389 29862 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705212.1 protein_id gnl|my_center|LOCUS_20430 30454 31077 gene locus_tag LOCUS_20440 30454 31077 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966328.1 protein_id gnl|my_center|LOCUS_20440 31536 31084 gene locus_tag LOCUS_20450 31536 31084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532490.1 protein_id gnl|my_center|LOCUS_20450 32568 31720 gene locus_tag LOCUS_20460 32568 31720 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532491.1 protein_id gnl|my_center|LOCUS_20460 33199 32576 gene locus_tag LOCUS_20470 33199 32576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532492.1 protein_id gnl|my_center|LOCUS_20470 33872 33216 gene locus_tag LOCUS_20480 33872 33216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 33996 34469 gene locus_tag LOCUS_20490 33996 34469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 35396 36451 gene locus_tag LOCUS_20500 35396 36451 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532493.1 protein_id gnl|my_center|LOCUS_20500 36448 37587 gene locus_tag LOCUS_20510 gene galE 36448 37587 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532494.1 protein_id gnl|my_center|LOCUS_20510 38199 37816 gene locus_tag LOCUS_20520 38199 37816 CDS product DUF995 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032808990.1 protein_id gnl|my_center|LOCUS_20520 38739 39665 gene locus_tag LOCUS_20530 38739 39665 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532498.1 protein_id gnl|my_center|LOCUS_20530 39662 40705 gene locus_tag LOCUS_20540 39662 40705 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136620024.1 protein_id gnl|my_center|LOCUS_20540 43482 41101 gene locus_tag LOCUS_20550 43482 41101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 43579 43588 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44623 43904 gene locus_tag LOCUS_20560 44623 43904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 45309 44791 gene locus_tag LOCUS_20570 45309 44791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 >Feature sequence030 1330 476 gene locus_tag LOCUS_20580 gene lgt 1330 476 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530007.1 protein_id gnl|my_center|LOCUS_20580 1462 1764 gene locus_tag LOCUS_20590 1462 1764 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530008.1 protein_id gnl|my_center|LOCUS_20590 2081 2581 gene locus_tag LOCUS_20600 2081 2581 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530009.1 protein_id gnl|my_center|LOCUS_20600 2600 2959 gene locus_tag LOCUS_20610 2600 2959 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530010.1 protein_id gnl|my_center|LOCUS_20610 4137 3115 gene locus_tag LOCUS_20620 4137 3115 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530012.1 protein_id gnl|my_center|LOCUS_20620 5773 4358 gene locus_tag LOCUS_20630 5773 4358 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530013.1 protein_id gnl|my_center|LOCUS_20630 6542 5823 gene locus_tag LOCUS_20640 6542 5823 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530014.1 protein_id gnl|my_center|LOCUS_20640 7062 6529 gene locus_tag LOCUS_20650 7062 6529 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505623.1 protein_id gnl|my_center|LOCUS_20650 7295 8188 gene locus_tag LOCUS_20660 7295 8188 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530016.1 protein_id gnl|my_center|LOCUS_20660 8336 8644 gene locus_tag LOCUS_20670 8336 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530017.1 protein_id gnl|my_center|LOCUS_20670 8763 9404 gene locus_tag LOCUS_20680 8763 9404 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530018.1 protein_id gnl|my_center|LOCUS_20680 10053 9625 gene locus_tag LOCUS_20690 10053 9625 CDS product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530019.1 protein_id gnl|my_center|LOCUS_20690 10460 10248 gene locus_tag LOCUS_20700 10460 10248 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530020.1 protein_id gnl|my_center|LOCUS_20700 11023 10811 gene locus_tag LOCUS_20710 11023 10811 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006202520.1 protein_id gnl|my_center|LOCUS_20710 11537 11938 gene locus_tag LOCUS_20720 11537 11938 CDS product Kazal-type serine protease inhibitor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530021.1 protein_id gnl|my_center|LOCUS_20720 12166 13800 gene locus_tag LOCUS_20730 12166 13800 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172931.1 protein_id gnl|my_center|LOCUS_20730 14378 14025 gene locus_tag LOCUS_20740 14378 14025 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530023.1 protein_id gnl|my_center|LOCUS_20740 14817 14389 gene locus_tag LOCUS_20750 14817 14389 CDS product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530024.1 protein_id gnl|my_center|LOCUS_20750 15129 14941 gene locus_tag LOCUS_20760 15129 14941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 16824 15235 gene locus_tag LOCUS_20770 16824 15235 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530028.1 protein_id gnl|my_center|LOCUS_20770 21114 17965 gene locus_tag LOCUS_20780 gene uvrB 21114 17965 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064980587.1 protein_id gnl|my_center|LOCUS_20780 20120 20129 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22475 21225 gene locus_tag LOCUS_20790 22475 21225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530033.1 protein_id gnl|my_center|LOCUS_20790 22586 23596 gene locus_tag LOCUS_20800 22586 23596 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530034.1 protein_id gnl|my_center|LOCUS_20800 23571 23580 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23693 24664 gene locus_tag LOCUS_20810 23693 24664 CDS product DUF3137 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530035.1 protein_id gnl|my_center|LOCUS_20810 25150 24668 gene locus_tag LOCUS_20820 25150 24668 CDS product DUF2314 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530036.1 protein_id gnl|my_center|LOCUS_20820 25461 25204 gene locus_tag LOCUS_20830 25461 25204 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931770.1 protein_id gnl|my_center|LOCUS_20830 26145 25585 gene locus_tag LOCUS_20840 26145 25585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530041.1 protein_id gnl|my_center|LOCUS_20840 27233 28171 gene locus_tag LOCUS_20850 27233 28171 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_20850 29187 28264 gene locus_tag LOCUS_20860 29187 28264 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530045.1 protein_id gnl|my_center|LOCUS_20860 28796 28805 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30395 29184 gene locus_tag LOCUS_20870 30395 29184 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_20870 32008 30392 gene locus_tag LOCUS_20880 32008 30392 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530047.1 protein_id gnl|my_center|LOCUS_20880 32216 33157 gene locus_tag LOCUS_20890 32216 33157 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032931383.1 protein_id gnl|my_center|LOCUS_20890 33261 33653 gene locus_tag LOCUS_20900 33261 33653 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530049.1 protein_id gnl|my_center|LOCUS_20900 33757 34017 gene locus_tag LOCUS_20910 33757 34017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 34486 34118 gene locus_tag LOCUS_20920 34486 34118 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504168.1 protein_id gnl|my_center|LOCUS_20920 34580 35185 gene locus_tag LOCUS_20930 34580 35185 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530052.1 protein_id gnl|my_center|LOCUS_20930 37223 35922 gene locus_tag LOCUS_20940 37223 35922 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327635.1 protein_id gnl|my_center|LOCUS_20940 37394 38320 gene locus_tag LOCUS_20950 37394 38320 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530053.1 protein_id gnl|my_center|LOCUS_20950 39238 38330 gene locus_tag LOCUS_20960 39238 38330 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530054.1 protein_id gnl|my_center|LOCUS_20960 39352 39942 gene locus_tag LOCUS_20970 39352 39942 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530055.1 protein_id gnl|my_center|LOCUS_20970 41255 39945 gene locus_tag LOCUS_20980 41255 39945 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530058.1 protein_id gnl|my_center|LOCUS_20980 42238 41303 gene locus_tag LOCUS_20990 42238 41303 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530059.1 protein_id gnl|my_center|LOCUS_20990 42366 43388 gene locus_tag LOCUS_21000 42366 43388 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530060.1 protein_id gnl|my_center|LOCUS_21000 44042 43404 gene locus_tag LOCUS_21010 44042 43404 CDS product LssY C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530061.1 protein_id gnl|my_center|LOCUS_21010 45051 44185 gene locus_tag LOCUS_21020 45051 44185 CDS product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530062.1 protein_id gnl|my_center|LOCUS_21020 45752 45165 gene locus_tag LOCUS_21030 45752 45165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 >Feature sequence031 91 846 gene locus_tag LOCUS_21040 gene istB 91 846 CDS product IS21-like element ISRel16 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007539334.1 protein_id gnl|my_center|LOCUS_21040 2432 1239 gene locus_tag LOCUS_21050 2432 1239 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331284.1 protein_id gnl|my_center|LOCUS_21050 3490 2519 gene locus_tag LOCUS_21060 gene proX 3490 2519 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390230.1 protein_id gnl|my_center|LOCUS_21060 4454 3522 gene locus_tag LOCUS_21070 gene proW 4454 3522 CDS product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764515.1 protein_id gnl|my_center|LOCUS_21070 4720 4816 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5403 6098 gene locus_tag LOCUS_21080 5403 6098 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969994.1 protein_id gnl|my_center|LOCUS_21080 6659 7669 gene locus_tag LOCUS_21090 6659 7669 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390046.1 protein_id gnl|my_center|LOCUS_21090 7666 8649 gene locus_tag LOCUS_21100 7666 8649 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_21100 8636 8881 gene locus_tag LOCUS_21110 8636 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 8973 9740 gene locus_tag LOCUS_21120 8973 9740 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_21120 9867 10937 gene locus_tag LOCUS_21130 9867 10937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 11692 11411 gene locus_tag LOCUS_21140 11692 11411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 11751 11942 gene locus_tag LOCUS_21150 11751 11942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21150 12936 13709 gene locus_tag LOCUS_21160 12936 13709 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337431.1 protein_id gnl|my_center|LOCUS_21160 13958 14323 gene locus_tag LOCUS_21170 13958 14323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 14368 15339 gene locus_tag LOCUS_21180 gene proX 14368 15339 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390230.1 protein_id gnl|my_center|LOCUS_21180 15539 17566 gene locus_tag LOCUS_21190 15539 17566 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533008.1 protein_id gnl|my_center|LOCUS_21190 17850 19424 gene locus_tag LOCUS_21200 17850 19424 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533003.1 protein_id gnl|my_center|LOCUS_21200 19455 20378 gene locus_tag LOCUS_21210 19455 20378 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533004.1 protein_id gnl|my_center|LOCUS_21210 20380 21273 gene locus_tag LOCUS_21220 20380 21273 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533005.1 protein_id gnl|my_center|LOCUS_21220 21312 22283 gene locus_tag LOCUS_21230 21312 22283 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533006.1 protein_id gnl|my_center|LOCUS_21230 22280 23290 gene locus_tag LOCUS_21240 22280 23290 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533007.1 protein_id gnl|my_center|LOCUS_21240 23374 24180 gene locus_tag LOCUS_21250 23374 24180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21250 24089 24598 gene locus_tag LOCUS_21260 24089 24598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21260 24933 24676 gene locus_tag LOCUS_21270 24933 24676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 25279 25500 gene locus_tag LOCUS_21280 25279 25500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 25993 25814 gene locus_tag LOCUS_21290 25993 25814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 27680 26082 gene locus_tag LOCUS_21300 27680 26082 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533003.1 protein_id gnl|my_center|LOCUS_21300 29375 27795 gene locus_tag LOCUS_21310 29375 27795 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532332.1 protein_id gnl|my_center|LOCUS_21310 31047 29716 gene locus_tag LOCUS_21320 31047 29716 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 protein_id gnl|my_center|LOCUS_21320 31174 31356 gene locus_tag LOCUS_21330 31174 31356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 31766 31317 gene locus_tag LOCUS_21340 31766 31317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 32834 33583 gene locus_tag LOCUS_21350 32834 33583 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331279.1 protein_id gnl|my_center|LOCUS_21350 33694 35022 gene locus_tag LOCUS_21360 gene gabT 33694 35022 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706800.1 protein_id gnl|my_center|LOCUS_21360 35338 35574 gene locus_tag LOCUS_21370 35338 35574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 35959 35711 gene locus_tag LOCUS_21380 35959 35711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 36890 38542 gene locus_tag LOCUS_21390 36890 38542 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533329.1 protein_id gnl|my_center|LOCUS_21390 38893 39405 gene locus_tag LOCUS_21400 38893 39405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21400 39731 40021 gene locus_tag LOCUS_21410 39731 40021 CDS product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243280.1 protein_id gnl|my_center|LOCUS_21410 40240 40437 gene locus_tag LOCUS_21420 40240 40437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 40784 41980 gene locus_tag LOCUS_21430 40784 41980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 42089 42730 gene locus_tag LOCUS_21440 gene istB 42089 42730 CDS product IS21-like element IS21 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544830.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21440 42831 43175 gene locus_tag LOCUS_21450 42831 43175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence032 284 2488 gene locus_tag LOCUS_21460 gene cyaD2 284 2488 CDS product adenylate cyclase CyaD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969598.1 protein_id gnl|my_center|LOCUS_21460 3522 2650 gene locus_tag LOCUS_21470 3522 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 3999 3829 gene locus_tag LOCUS_21480 3999 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 4618 4328 gene locus_tag LOCUS_21490 4618 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 4993 4919 gene locus_tag LOCUS_t00100 4993 4919 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6363 5185 gene locus_tag LOCUS_21500 6363 5185 CDS product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827387.1 protein_id gnl|my_center|LOCUS_21500 8486 6651 gene locus_tag LOCUS_21510 gene phaC 8486 6651 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531993.1 protein_id gnl|my_center|LOCUS_21510 8584 8991 gene locus_tag LOCUS_21520 8584 8991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531992.1 protein_id gnl|my_center|LOCUS_21520 9037 10254 gene locus_tag LOCUS_21530 9037 10254 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531991.1 protein_id gnl|my_center|LOCUS_21530 10398 10407 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10434 11630 gene locus_tag LOCUS_21540 10434 11630 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531990.1 protein_id gnl|my_center|LOCUS_21540 11766 11775 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11867 12850 gene locus_tag LOCUS_21550 gene glpX 11867 12850 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531987.1 protein_id gnl|my_center|LOCUS_21550 12898 14730 gene locus_tag LOCUS_21560 gene recJ 12898 14730 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531985.1 protein_id gnl|my_center|LOCUS_21560 14306 14315 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15712 14738 gene locus_tag LOCUS_21570 15712 14738 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173662.1 protein_id gnl|my_center|LOCUS_21570 16253 15795 gene locus_tag LOCUS_21580 gene hisI 16253 15795 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531983.1 protein_id gnl|my_center|LOCUS_21580 16925 16290 gene locus_tag LOCUS_21590 gene folE 16925 16290 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531982.1 protein_id gnl|my_center|LOCUS_21590 17168 17614 gene locus_tag LOCUS_21600 17168 17614 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531981.1 protein_id gnl|my_center|LOCUS_21600 18528 17623 gene locus_tag LOCUS_21610 18528 17623 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531980.1 protein_id gnl|my_center|LOCUS_21610 18848 19222 gene locus_tag LOCUS_21620 gene yidD 18848 19222 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531978.1 protein_id gnl|my_center|LOCUS_21620 19369 20187 gene locus_tag LOCUS_21630 gene blaOXA 19369 20187 CDS product class D beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531977.1 protein_id gnl|my_center|LOCUS_21630 20341 22317 gene locus_tag LOCUS_21640 gene thrS 20341 22317 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531976.1 protein_id gnl|my_center|LOCUS_21640 22403 23341 gene locus_tag LOCUS_21650 22403 23341 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531975.1 protein_id gnl|my_center|LOCUS_21650 24319 23354 gene locus_tag LOCUS_21660 24319 23354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531974.1 protein_id gnl|my_center|LOCUS_21660 24596 24312 gene locus_tag LOCUS_21670 24596 24312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 24484 25068 gene locus_tag LOCUS_21680 24484 25068 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531973.1 protein_id gnl|my_center|LOCUS_21680 25070 25678 gene locus_tag LOCUS_21690 25070 25678 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531972.1 protein_id gnl|my_center|LOCUS_21690 25724 26398 gene locus_tag LOCUS_21700 25724 26398 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531970.1 protein_id gnl|my_center|LOCUS_21700 27313 26432 gene locus_tag LOCUS_21710 27313 26432 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_21710 27765 27313 gene locus_tag LOCUS_21720 27765 27313 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531968.1 protein_id gnl|my_center|LOCUS_21720 27918 28364 gene locus_tag LOCUS_21730 27918 28364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21730 28285 28294 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28325 29023 gene locus_tag LOCUS_21740 28325 29023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21740 30111 29074 gene locus_tag LOCUS_21750 30111 29074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 30126 30135 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30245 30739 gene locus_tag LOCUS_21760 30245 30739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 33134 31077 gene locus_tag LOCUS_21770 gene parE 33134 31077 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531965.1 protein_id gnl|my_center|LOCUS_21770 33367 34299 gene locus_tag LOCUS_21780 gene cpaB 33367 34299 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531964.1 protein_id gnl|my_center|LOCUS_21780 34327 35769 gene locus_tag LOCUS_21790 34327 35769 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531963.1 protein_id gnl|my_center|LOCUS_21790 35774 36049 gene locus_tag LOCUS_21800 35774 36049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 36078 37292 gene locus_tag LOCUS_21810 36078 37292 CDS product CpaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531961.1 protein_id gnl|my_center|LOCUS_21810 37289 38710 gene locus_tag LOCUS_21820 37289 38710 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531960.1 protein_id gnl|my_center|LOCUS_21820 38714 39679 gene locus_tag LOCUS_21830 38714 39679 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531959.1 protein_id gnl|my_center|LOCUS_21830 39681 40649 gene locus_tag LOCUS_21840 39681 40649 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531958.1 protein_id gnl|my_center|LOCUS_21840 40834 41262 gene locus_tag LOCUS_21850 40834 41262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531956.1 protein_id gnl|my_center|LOCUS_21850 41664 42836 gene locus_tag LOCUS_21860 41664 42836 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531955.1 protein_id gnl|my_center|LOCUS_21860 44868 42850 gene locus_tag LOCUS_21870 44868 42850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 >Feature sequence033 779 405 gene locus_tag LOCUS_21880 779 405 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529829.1 protein_id gnl|my_center|LOCUS_21880 1982 891 gene locus_tag LOCUS_21890 1982 891 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529828.1 protein_id gnl|my_center|LOCUS_21890 2169 2468 gene locus_tag LOCUS_21900 2169 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 3340 2405 gene locus_tag LOCUS_21910 3340 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 4361 3477 gene locus_tag LOCUS_21920 4361 3477 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529827.1 protein_id gnl|my_center|LOCUS_21920 6776 4365 gene locus_tag LOCUS_21930 6776 4365 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529826.1 protein_id gnl|my_center|LOCUS_21930 10142 6783 gene locus_tag LOCUS_21940 10142 6783 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529825.1 protein_id gnl|my_center|LOCUS_21940 11439 10249 gene locus_tag LOCUS_21950 11439 10249 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529824.1 protein_id gnl|my_center|LOCUS_21950 11547 12458 gene locus_tag LOCUS_21960 11547 12458 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529823.1 protein_id gnl|my_center|LOCUS_21960 14780 12459 gene locus_tag LOCUS_21970 14780 12459 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529820.1 protein_id gnl|my_center|LOCUS_21970 16083 14905 gene locus_tag LOCUS_21980 16083 14905 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529819.1 protein_id gnl|my_center|LOCUS_21980 17313 16117 gene locus_tag LOCUS_21990 17313 16117 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529818.1 protein_id gnl|my_center|LOCUS_21990 18414 17380 gene locus_tag LOCUS_22000 18414 17380 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529817.1 protein_id gnl|my_center|LOCUS_22000 19235 18438 gene locus_tag LOCUS_22010 19235 18438 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529816.1 protein_id gnl|my_center|LOCUS_22010 20148 19228 gene locus_tag LOCUS_22020 20148 19228 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529815.1 protein_id gnl|my_center|LOCUS_22020 21242 20148 gene locus_tag LOCUS_22030 21242 20148 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529814.1 protein_id gnl|my_center|LOCUS_22030 22287 21361 gene locus_tag LOCUS_22040 22287 21361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22040 23009 22185 gene locus_tag LOCUS_22050 23009 22185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22050 22366 22375 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23271 23924 gene locus_tag LOCUS_22060 23271 23924 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529812.1 protein_id gnl|my_center|LOCUS_22060 23948 24979 gene locus_tag LOCUS_22070 23948 24979 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529811.1 protein_id gnl|my_center|LOCUS_22070 26216 25023 gene locus_tag LOCUS_22080 26216 25023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 26748 27377 gene locus_tag LOCUS_22090 26748 27377 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529810.1 protein_id gnl|my_center|LOCUS_22090 27374 28144 gene locus_tag LOCUS_22100 27374 28144 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529809.1 protein_id gnl|my_center|LOCUS_22100 28697 28263 gene locus_tag LOCUS_22110 28697 28263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529808.1 protein_id gnl|my_center|LOCUS_22110 29776 28694 gene locus_tag LOCUS_22120 gene flhB 29776 28694 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529807.1 protein_id gnl|my_center|LOCUS_22120 30814 29798 gene locus_tag LOCUS_22130 30814 29798 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529806.1 protein_id gnl|my_center|LOCUS_22130 31247 30858 gene locus_tag LOCUS_22140 gene fliN 31247 30858 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529805.1 protein_id gnl|my_center|LOCUS_22140 32219 31281 gene locus_tag LOCUS_22150 32219 31281 CDS product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529804.1 protein_id gnl|my_center|LOCUS_22150 33129 32254 gene locus_tag LOCUS_22160 gene motA 33129 32254 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529803.1 protein_id gnl|my_center|LOCUS_22160 33308 34084 gene locus_tag LOCUS_22170 33308 34084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 34092 34814 gene locus_tag LOCUS_22180 gene flgF 34092 34814 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529801.1 protein_id gnl|my_center|LOCUS_22180 34819 36225 gene locus_tag LOCUS_22190 gene fliI 34819 36225 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529800.1 protein_id gnl|my_center|LOCUS_22190 36206 37051 gene locus_tag LOCUS_22200 36206 37051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529799.1 protein_id gnl|my_center|LOCUS_22200 37155 37535 gene locus_tag LOCUS_22210 gene flgB 37155 37535 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529798.1 protein_id gnl|my_center|LOCUS_22210 37538 37957 gene locus_tag LOCUS_22220 gene flgC 37538 37957 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529797.1 protein_id gnl|my_center|LOCUS_22220 37954 38286 gene locus_tag LOCUS_22230 37954 38286 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529796.1 protein_id gnl|my_center|LOCUS_22230 38296 39084 gene locus_tag LOCUS_22240 gene flgG 38296 39084 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529795.1 protein_id gnl|my_center|LOCUS_22240 39091 39639 gene locus_tag LOCUS_22250 gene flgA 39091 39639 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529794.1 protein_id gnl|my_center|LOCUS_22250 39639 40877 gene locus_tag LOCUS_22260 39639 40877 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529793.1 protein_id gnl|my_center|LOCUS_22260 40881 41459 gene locus_tag LOCUS_22270 40881 41459 CDS product MotE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032808152.1 protein_id gnl|my_center|LOCUS_22270 41456 42160 gene locus_tag LOCUS_22280 gene flgH 41456 42160 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529791.1 protein_id gnl|my_center|LOCUS_22280 42187 42681 gene locus_tag LOCUS_22290 42187 42681 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529790.1 protein_id gnl|my_center|LOCUS_22290 42678 43409 gene locus_tag LOCUS_22300 gene fliP 42678 43409 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529789.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence034 902 1789 gene locus_tag LOCUS_22310 902 1789 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528030.1 protein_id gnl|my_center|LOCUS_22310 1786 4227 gene locus_tag LOCUS_22320 1786 4227 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528031.1 protein_id gnl|my_center|LOCUS_22320 4864 4232 gene locus_tag LOCUS_22330 4864 4232 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170453.1 protein_id gnl|my_center|LOCUS_22330 4981 5877 gene locus_tag LOCUS_22340 4981 5877 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528033.1 protein_id gnl|my_center|LOCUS_22340 6819 5896 gene locus_tag LOCUS_22350 6819 5896 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528034.1 protein_id gnl|my_center|LOCUS_22350 8182 6902 gene locus_tag LOCUS_22360 8182 6902 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528035.1 protein_id gnl|my_center|LOCUS_22360 8357 10111 gene locus_tag LOCUS_22370 8357 10111 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528036.1 protein_id gnl|my_center|LOCUS_22370 10196 10636 gene locus_tag LOCUS_22380 10196 10636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 11687 10647 gene locus_tag LOCUS_22390 11687 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22390 11869 11878 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12293 12556 gene locus_tag LOCUS_22400 12293 12556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 12811 13278 gene locus_tag LOCUS_22410 12811 13278 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528038.1 protein_id gnl|my_center|LOCUS_22410 14958 13426 gene locus_tag LOCUS_22420 14958 13426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 16565 14955 gene locus_tag LOCUS_22430 16565 14955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 17407 16643 gene locus_tag LOCUS_22440 17407 16643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 19190 17598 gene locus_tag LOCUS_22450 19190 17598 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528039.1 protein_id gnl|my_center|LOCUS_22450 19537 19295 gene locus_tag LOCUS_22460 19537 19295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 20159 19623 gene locus_tag LOCUS_22470 20159 19623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564969.1 protein_id gnl|my_center|LOCUS_22470 20454 20173 gene locus_tag LOCUS_22480 20454 20173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 20650 22467 gene locus_tag LOCUS_22490 20650 22467 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729746.1 protein_id gnl|my_center|LOCUS_22490 22523 23605 gene locus_tag LOCUS_22500 22523 23605 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528042.1 protein_id gnl|my_center|LOCUS_22500 24975 23602 gene locus_tag LOCUS_22510 24975 23602 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403192.1 protein_id gnl|my_center|LOCUS_22510 25615 25109 gene locus_tag LOCUS_22520 25615 25109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22520 25903 25760 gene locus_tag LOCUS_22530 25903 25760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22530 26888 26088 gene locus_tag LOCUS_22540 26888 26088 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241590.1 protein_id gnl|my_center|LOCUS_22540 27155 26904 gene locus_tag LOCUS_22550 27155 26904 CDS product DUF6356 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528043.1 protein_id gnl|my_center|LOCUS_22550 27304 27741 gene locus_tag LOCUS_22560 27304 27741 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528044.1 protein_id gnl|my_center|LOCUS_22560 27827 28312 gene locus_tag LOCUS_22570 gene dut 27827 28312 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528045.1 protein_id gnl|my_center|LOCUS_22570 28312 28971 gene locus_tag LOCUS_22580 28312 28971 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528046.1 protein_id gnl|my_center|LOCUS_22580 29149 29973 gene locus_tag LOCUS_22590 29149 29973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528047.1 protein_id gnl|my_center|LOCUS_22590 30052 30855 gene locus_tag LOCUS_22600 30052 30855 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528048.1 protein_id gnl|my_center|LOCUS_22600 31560 30865 gene locus_tag LOCUS_22610 31560 30865 CDS product sulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528050.1 protein_id gnl|my_center|LOCUS_22610 32527 31625 gene locus_tag LOCUS_22620 32527 31625 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528051.1 protein_id gnl|my_center|LOCUS_22620 32804 33796 gene locus_tag LOCUS_22630 32804 33796 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528052.1 protein_id gnl|my_center|LOCUS_22630 34087 34803 gene locus_tag LOCUS_22640 34087 34803 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528053.1 protein_id gnl|my_center|LOCUS_22640 35180 36322 gene locus_tag LOCUS_22650 35180 36322 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532601.1 protein_id gnl|my_center|LOCUS_22650 36583 36756 gene locus_tag LOCUS_22660 36583 36756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 37952 36852 gene locus_tag LOCUS_22670 37952 36852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 40358 38079 gene locus_tag LOCUS_22680 40358 38079 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528054.1 protein_id gnl|my_center|LOCUS_22680 41695 40505 gene locus_tag LOCUS_22690 41695 40505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 42412 42421 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42430 42924 gene locus_tag LOCUS_22700 42430 42924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22700 42865 42874 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence035 1017 1382 gene locus_tag LOCUS_22710 1017 1382 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910112.1 protein_id gnl|my_center|LOCUS_22710 1373 1954 gene locus_tag LOCUS_22720 1373 1954 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531090.1 protein_id gnl|my_center|LOCUS_22720 1959 2561 gene locus_tag LOCUS_22730 1959 2561 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531091.1 protein_id gnl|my_center|LOCUS_22730 2596 2928 gene locus_tag LOCUS_22740 2596 2928 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_22740 3035 4225 gene locus_tag LOCUS_22750 3035 4225 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531092.1 protein_id gnl|my_center|LOCUS_22750 4226 5503 gene locus_tag LOCUS_22760 4226 5503 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531093.1 protein_id gnl|my_center|LOCUS_22760 5514 6818 gene locus_tag LOCUS_22770 gene nuoF 5514 6818 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531094.1 protein_id gnl|my_center|LOCUS_22770 6893 7588 gene locus_tag LOCUS_22780 6893 7588 CDS product NADH-ubiquinone dehydrogenase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531095.1 protein_id gnl|my_center|LOCUS_22780 7663 9744 gene locus_tag LOCUS_22790 gene nuoG 7663 9744 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531096.1 protein_id gnl|my_center|LOCUS_22790 9747 10790 gene locus_tag LOCUS_22800 gene nuoH 9747 10790 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531097.1 protein_id gnl|my_center|LOCUS_22800 10790 11281 gene locus_tag LOCUS_22810 gene nuoI 10790 11281 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531098.1 protein_id gnl|my_center|LOCUS_22810 11411 12031 gene locus_tag LOCUS_22820 11411 12031 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531099.1 protein_id gnl|my_center|LOCUS_22820 12033 12341 gene locus_tag LOCUS_22830 gene nuoK 12033 12341 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910101.1 protein_id gnl|my_center|LOCUS_22830 12352 14325 gene locus_tag LOCUS_22840 gene nuoL 12352 14325 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531100.1 protein_id gnl|my_center|LOCUS_22840 14325 15830 gene locus_tag LOCUS_22850 14325 15830 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531101.1 protein_id gnl|my_center|LOCUS_22850 15849 17285 gene locus_tag LOCUS_22860 gene nuoN 15849 17285 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531102.1 protein_id gnl|my_center|LOCUS_22860 17302 18111 gene locus_tag LOCUS_22870 17302 18111 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531103.1 protein_id gnl|my_center|LOCUS_22870 18147 19817 gene locus_tag LOCUS_22880 18147 19817 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531104.1 protein_id gnl|my_center|LOCUS_22880 19945 20349 gene locus_tag LOCUS_22890 gene mce 19945 20349 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531105.1 protein_id gnl|my_center|LOCUS_22890 20346 20630 gene locus_tag LOCUS_22900 20346 20630 CDS product DUF1467 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531106.1 protein_id gnl|my_center|LOCUS_22900 21162 22490 gene locus_tag LOCUS_22910 21162 22490 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531107.1 protein_id gnl|my_center|LOCUS_22910 22567 22576 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22618 23802 gene locus_tag LOCUS_22920 22618 23802 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531108.1 protein_id gnl|my_center|LOCUS_22920 23802 24482 gene locus_tag LOCUS_22930 23802 24482 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160544.1 protein_id gnl|my_center|LOCUS_22930 24994 26244 gene locus_tag LOCUS_22940 24994 26244 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531110.1 protein_id gnl|my_center|LOCUS_22940 27007 26264 gene locus_tag LOCUS_22950 gene lipB 27007 26264 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531111.1 protein_id gnl|my_center|LOCUS_22950 27245 27329 gene locus_tag LOCUS_t00110 27245 27329 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 30158 27474 gene locus_tag LOCUS_22960 30158 27474 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933304.1 protein_id gnl|my_center|LOCUS_22960 30922 30230 gene locus_tag LOCUS_22970 30922 30230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22970 31173 30916 gene locus_tag LOCUS_22980 31173 30916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22980 30931 30940 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32161 31262 gene locus_tag LOCUS_22990 gene sucD 32161 31262 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329405.1 protein_id gnl|my_center|LOCUS_22990 33363 32176 gene locus_tag LOCUS_23000 33363 32176 CDS product malate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329404.1 protein_id gnl|my_center|LOCUS_23000 34338 33382 gene locus_tag LOCUS_23010 34338 33382 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163160.1 protein_id gnl|my_center|LOCUS_23010 35541 34351 gene locus_tag LOCUS_23020 35541 34351 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243814.1 protein_id gnl|my_center|LOCUS_23020 36280 35663 gene locus_tag LOCUS_23030 36280 35663 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329401.1 protein_id gnl|my_center|LOCUS_23030 36724 38142 gene locus_tag LOCUS_23040 gene mgtE 36724 38142 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531112.1 protein_id gnl|my_center|LOCUS_23040 38268 38654 gene locus_tag LOCUS_23050 38268 38654 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531113.1 protein_id gnl|my_center|LOCUS_23050 39152 38676 gene locus_tag LOCUS_23060 39152 38676 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531114.1 protein_id gnl|my_center|LOCUS_23060 40150 39149 gene locus_tag LOCUS_23070 40150 39149 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531115.1 protein_id gnl|my_center|LOCUS_23070 41545 40367 gene locus_tag LOCUS_23080 41545 40367 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929288.1 protein_id gnl|my_center|LOCUS_23080 41693 42370 gene locus_tag LOCUS_23090 41693 42370 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397451.1 protein_id gnl|my_center|LOCUS_23090 42666 42845 gene locus_tag LOCUS_23100 42666 42845 CDS product CbtB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531117.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence036 489 133 gene locus_tag LOCUS_23110 489 133 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530112.1 protein_id gnl|my_center|LOCUS_23110 1363 1052 gene locus_tag LOCUS_23120 1363 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 1398 1407 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1420 1881 gene locus_tag LOCUS_23130 1420 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23130 2377 1913 gene locus_tag LOCUS_23140 2377 1913 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530114.1 protein_id gnl|my_center|LOCUS_23140 2570 3364 gene locus_tag LOCUS_23150 2570 3364 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530115.1 protein_id gnl|my_center|LOCUS_23150 3975 3376 gene locus_tag LOCUS_23160 3975 3376 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530116.1 protein_id gnl|my_center|LOCUS_23160 4072 5256 gene locus_tag LOCUS_23170 4072 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 4916 4925 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5816 5166 gene locus_tag LOCUS_23180 5816 5166 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530118.1 protein_id gnl|my_center|LOCUS_23180 6773 5865 gene locus_tag LOCUS_23190 6773 5865 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173776.1 protein_id gnl|my_center|LOCUS_23190 5986 5995 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8296 6935 gene locus_tag LOCUS_23200 8296 6935 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530120.1 protein_id gnl|my_center|LOCUS_23200 8549 9004 gene locus_tag LOCUS_23210 gene mntR 8549 9004 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504117.1 protein_id gnl|my_center|LOCUS_23210 9102 9290 gene locus_tag LOCUS_23220 9102 9290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530122.1 protein_id gnl|my_center|LOCUS_23220 11361 9313 gene locus_tag LOCUS_23230 11361 9313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 11567 12478 gene locus_tag LOCUS_23240 11567 12478 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530123.1 protein_id gnl|my_center|LOCUS_23240 12640 13908 gene locus_tag LOCUS_23250 12640 13908 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530124.1 protein_id gnl|my_center|LOCUS_23250 15262 14057 gene locus_tag LOCUS_23260 gene carA 15262 14057 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530125.1 protein_id gnl|my_center|LOCUS_23260 15520 15969 gene locus_tag LOCUS_23270 15520 15969 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530126.1 protein_id gnl|my_center|LOCUS_23270 16569 16003 gene locus_tag LOCUS_23280 16569 16003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23280 16988 16554 gene locus_tag LOCUS_23290 16988 16554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23290 17109 17666 gene locus_tag LOCUS_23300 17109 17666 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530142.1 protein_id gnl|my_center|LOCUS_23300 18941 17760 gene locus_tag LOCUS_23310 18941 17760 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530145.1 protein_id gnl|my_center|LOCUS_23310 19281 18973 gene locus_tag LOCUS_23320 19281 18973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 21063 19399 gene locus_tag LOCUS_23330 21063 19399 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530146.1 protein_id gnl|my_center|LOCUS_23330 21451 21618 gene locus_tag LOCUS_23340 21451 21618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23340 21956 23899 gene locus_tag LOCUS_23350 gene dnaG 21956 23899 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530148.1 protein_id gnl|my_center|LOCUS_23350 24266 26296 gene locus_tag LOCUS_23360 gene rpoD 24266 26296 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530149.1 protein_id gnl|my_center|LOCUS_23360 26514 26807 gene locus_tag LOCUS_23370 26514 26807 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530150.1 protein_id gnl|my_center|LOCUS_23370 26990 27370 gene locus_tag LOCUS_23380 26990 27370 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530151.1 protein_id gnl|my_center|LOCUS_23380 27680 27423 gene locus_tag LOCUS_23390 27680 27423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 27951 28619 gene locus_tag LOCUS_23400 27951 28619 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530152.1 protein_id gnl|my_center|LOCUS_23400 28972 28712 gene locus_tag LOCUS_23410 28972 28712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 29535 29026 gene locus_tag LOCUS_23420 29535 29026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23420 29832 30491 gene locus_tag LOCUS_23430 29832 30491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 30559 30852 gene locus_tag LOCUS_23440 30559 30852 CDS product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530153.1 protein_id gnl|my_center|LOCUS_23440 31607 30864 gene locus_tag LOCUS_23450 31607 30864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23450 33439 31640 gene locus_tag LOCUS_23460 33439 31640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23460 34818 33436 gene locus_tag LOCUS_23470 34818 33436 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172865.1 protein_id gnl|my_center|LOCUS_23470 35628 34987 gene locus_tag LOCUS_23480 35628 34987 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530163.1 protein_id gnl|my_center|LOCUS_23480 35738 36694 gene locus_tag LOCUS_23490 35738 36694 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530164.1 protein_id gnl|my_center|LOCUS_23490 37253 36627 gene locus_tag LOCUS_23500 37253 36627 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530165.1 protein_id gnl|my_center|LOCUS_23500 37320 37745 gene locus_tag LOCUS_23510 37320 37745 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530166.1 protein_id gnl|my_center|LOCUS_23510 38037 40892 gene locus_tag LOCUS_23520 38037 40892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 41891 40941 gene locus_tag LOCUS_23530 41891 40941 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530167.1 protein_id gnl|my_center|LOCUS_23530 42060 42932 gene locus_tag LOCUS_23540 42060 42932 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530168.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence037 1243 248 gene locus_tag LOCUS_23550 1243 248 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528379.1 protein_id gnl|my_center|LOCUS_23550 2850 1306 gene locus_tag LOCUS_23560 2850 1306 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528380.1 protein_id gnl|my_center|LOCUS_23560 3777 2965 gene locus_tag LOCUS_23570 3777 2965 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528381.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23570 3835 3844 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4533 5648 gene locus_tag LOCUS_23580 4533 5648 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502024.1 protein_id gnl|my_center|LOCUS_23580 5720 6025 gene locus_tag LOCUS_23590 5720 6025 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038219.1 protein_id gnl|my_center|LOCUS_23590 6049 6561 gene locus_tag LOCUS_23600 6049 6561 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038220.1 protein_id gnl|my_center|LOCUS_23600 6655 7455 gene locus_tag LOCUS_23610 6655 7455 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526186.1 protein_id gnl|my_center|LOCUS_23610 8071 9546 gene locus_tag LOCUS_23620 8071 9546 CDS product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920255.1 protein_id gnl|my_center|LOCUS_23620 9569 10336 gene locus_tag LOCUS_23630 9569 10336 CDS product coniferyl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401012.1 protein_id gnl|my_center|LOCUS_23630 10464 10388 gene locus_tag LOCUS_t00120 10464 10388 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11604 10657 gene locus_tag LOCUS_23640 11604 10657 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528385.1 protein_id gnl|my_center|LOCUS_23640 11179 11188 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12846 11959 gene locus_tag LOCUS_23650 12846 11959 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528386.1 protein_id gnl|my_center|LOCUS_23650 14262 13651 gene locus_tag LOCUS_23660 14262 13651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 14023 14032 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14293 14841 gene locus_tag LOCUS_23670 14293 14841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23670 14796 14805 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14841 15317 gene locus_tag LOCUS_23680 14841 15317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23680 15643 16749 gene locus_tag LOCUS_23690 15643 16749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528388.1 protein_id gnl|my_center|LOCUS_23690 16832 17452 gene locus_tag LOCUS_23700 16832 17452 CDS product nucleoside triphosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528389.1 protein_id gnl|my_center|LOCUS_23700 17552 17872 gene locus_tag LOCUS_23710 17552 17872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 18606 17902 gene locus_tag LOCUS_23720 18606 17902 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528391.1 protein_id gnl|my_center|LOCUS_23720 19965 18757 gene locus_tag LOCUS_23730 19965 18757 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528392.1 protein_id gnl|my_center|LOCUS_23730 20224 19970 gene locus_tag LOCUS_23740 20224 19970 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528393.1 protein_id gnl|my_center|LOCUS_23740 20752 21273 gene locus_tag LOCUS_23750 20752 21273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23750 20765 20774 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21302 21604 gene locus_tag LOCUS_23760 21302 21604 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528395.1 protein_id gnl|my_center|LOCUS_23760 21615 21869 gene locus_tag LOCUS_23770 21615 21869 CDS product DUF1272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528396.1 protein_id gnl|my_center|LOCUS_23770 21907 22512 gene locus_tag LOCUS_23780 21907 22512 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528397.1 protein_id gnl|my_center|LOCUS_23780 22509 22814 gene locus_tag LOCUS_23790 22509 22814 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528398.1 protein_id gnl|my_center|LOCUS_23790 23350 22859 gene locus_tag LOCUS_23800 23350 22859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528399.1 protein_id gnl|my_center|LOCUS_23800 23851 23480 gene locus_tag LOCUS_23810 23851 23480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 24019 25749 gene locus_tag LOCUS_23820 gene ureC 24019 25749 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170136789.1 protein_id gnl|my_center|LOCUS_23820 25426 25435 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26214 26444 gene locus_tag LOCUS_23830 26214 26444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23830 26523 26807 gene locus_tag LOCUS_23840 26523 26807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23840 26868 27473 gene locus_tag LOCUS_23850 26868 27473 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969342.1 protein_id gnl|my_center|LOCUS_23850 27470 28069 gene locus_tag LOCUS_23860 gene ureE 27470 28069 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528404.1 protein_id gnl|my_center|LOCUS_23860 28062 28727 gene locus_tag LOCUS_23870 28062 28727 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173514.1 protein_id gnl|my_center|LOCUS_23870 28724 29164 gene locus_tag LOCUS_23880 28724 29164 CDS product DUF3995 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528406.1 protein_id gnl|my_center|LOCUS_23880 29161 29793 gene locus_tag LOCUS_23890 gene ureG 29161 29793 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528407.1 protein_id gnl|my_center|LOCUS_23890 29871 30638 gene locus_tag LOCUS_23900 29871 30638 CDS product class II aldolase and adducin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528408.1 protein_id gnl|my_center|LOCUS_23900 31353 30721 gene locus_tag LOCUS_23910 31353 30721 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528409.1 protein_id gnl|my_center|LOCUS_23910 31716 31725 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31743 32528 gene locus_tag LOCUS_23920 31743 32528 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528410.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23920 32845 33753 gene locus_tag LOCUS_23930 gene gcvA 32845 33753 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528412.1 protein_id gnl|my_center|LOCUS_23930 33949 35259 gene locus_tag LOCUS_23940 33949 35259 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528413.1 protein_id gnl|my_center|LOCUS_23940 35400 36272 gene locus_tag LOCUS_23950 35400 36272 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528414.1 protein_id gnl|my_center|LOCUS_23950 36284 37108 gene locus_tag LOCUS_23960 36284 37108 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528415.1 protein_id gnl|my_center|LOCUS_23960 37161 38165 gene locus_tag LOCUS_23970 37161 38165 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528416.1 protein_id gnl|my_center|LOCUS_23970 38222 38231 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38269 38946 gene locus_tag LOCUS_23980 38269 38946 CDS product L-iditol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528417.1 protein_id gnl|my_center|LOCUS_23980 39120 40598 gene locus_tag LOCUS_23990 39120 40598 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528418.1 protein_id gnl|my_center|LOCUS_23990 40619 41302 gene locus_tag LOCUS_24000 40619 41302 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528419.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence038 <1 643 gene locus_tag LOCUS_24010 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530715.1:ATP-binding protein 1688 702 gene locus_tag LOCUS_24020 1688 702 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528455.1 protein_id gnl|my_center|LOCUS_24020 2841 1768 gene locus_tag LOCUS_24030 2841 1768 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530576.1 protein_id gnl|my_center|LOCUS_24030 4358 2841 gene locus_tag LOCUS_24040 4358 2841 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976197.1 protein_id gnl|my_center|LOCUS_24040 5359 4355 gene locus_tag LOCUS_24050 5359 4355 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028064.1 protein_id gnl|my_center|LOCUS_24050 6748 5522 gene locus_tag LOCUS_24060 6748 5522 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532433.1 protein_id gnl|my_center|LOCUS_24060 7169 6924 gene locus_tag LOCUS_24070 7169 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530767.1 protein_id gnl|my_center|LOCUS_24070 7438 7698 gene locus_tag LOCUS_24080 7438 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 9133 7739 gene locus_tag LOCUS_24090 9133 7739 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530540.1 protein_id gnl|my_center|LOCUS_24090 9378 9716 gene locus_tag LOCUS_24100 9378 9716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530794.1 protein_id gnl|my_center|LOCUS_24100 9847 10014 gene locus_tag LOCUS_24110 9847 10014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531988.1 protein_id gnl|my_center|LOCUS_24110 10089 10346 gene locus_tag LOCUS_24120 10089 10346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530770.1 protein_id gnl|my_center|LOCUS_24120 10472 10930 gene locus_tag LOCUS_24130 10472 10930 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530776.1 protein_id gnl|my_center|LOCUS_24130 11396 11941 gene locus_tag LOCUS_24140 11396 11941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 12219 11950 gene locus_tag LOCUS_24150 12219 11950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 12388 12582 gene locus_tag LOCUS_24160 12388 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 13462 12944 gene locus_tag LOCUS_24170 gene msrA 13462 12944 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530793.1 protein_id gnl|my_center|LOCUS_24170 14486 13587 gene locus_tag LOCUS_24180 14486 13587 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525230.1 protein_id gnl|my_center|LOCUS_24180 14921 14598 gene locus_tag LOCUS_24190 14921 14598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531611.1 protein_id gnl|my_center|LOCUS_24190 15115 14921 gene locus_tag LOCUS_24200 15115 14921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530788.1 protein_id gnl|my_center|LOCUS_24200 15339 15100 gene locus_tag LOCUS_24210 15339 15100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 15646 15443 gene locus_tag LOCUS_24220 15646 15443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 16725 15643 gene locus_tag LOCUS_24230 16725 15643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 17174 16941 gene locus_tag LOCUS_24240 17174 16941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 17253 18107 gene locus_tag LOCUS_24250 17253 18107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 18885 18196 gene locus_tag LOCUS_24260 18885 18196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 19192 18830 gene locus_tag LOCUS_24270 19192 18830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 19643 19185 gene locus_tag LOCUS_24280 19643 19185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 19954 20460 gene locus_tag LOCUS_24290 19954 20460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 20547 20852 gene locus_tag LOCUS_24300 20547 20852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 20874 21623 gene locus_tag LOCUS_24310 20874 21623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918147.1 protein_id gnl|my_center|LOCUS_24310 21720 22025 gene locus_tag LOCUS_24320 21720 22025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530780.1 protein_id gnl|my_center|LOCUS_24320 22547 22125 gene locus_tag LOCUS_24330 22547 22125 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530779.1 protein_id gnl|my_center|LOCUS_24330 23608 22853 gene locus_tag LOCUS_24340 23608 22853 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035685.1 protein_id gnl|my_center|LOCUS_24340 23764 24240 gene locus_tag LOCUS_24350 23764 24240 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930202.1 protein_id gnl|my_center|LOCUS_24350 24700 24230 gene locus_tag LOCUS_24360 24700 24230 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421494.1 protein_id gnl|my_center|LOCUS_24360 24811 25365 gene locus_tag LOCUS_24370 24811 25365 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836254.1 protein_id gnl|my_center|LOCUS_24370 26845 25481 gene locus_tag LOCUS_24380 26845 25481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 27127 26969 gene locus_tag LOCUS_24390 27127 26969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 27799 27443 gene locus_tag LOCUS_24400 27799 27443 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525746.1 protein_id gnl|my_center|LOCUS_24400 28141 28296 gene locus_tag LOCUS_24410 28141 28296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 29300 28329 gene locus_tag LOCUS_24420 29300 28329 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531569.1 protein_id gnl|my_center|LOCUS_24420 29595 29912 gene locus_tag LOCUS_24430 29595 29912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 29919 30200 gene locus_tag LOCUS_24440 29919 30200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 30923 30204 gene locus_tag LOCUS_24450 30923 30204 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339467.1 protein_id gnl|my_center|LOCUS_24450 31205 31726 gene locus_tag LOCUS_24460 31205 31726 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530428.1 protein_id gnl|my_center|LOCUS_24460 31906 32280 gene locus_tag LOCUS_24470 31906 32280 CDS product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530978.1 protein_id gnl|my_center|LOCUS_24470 32489 33388 gene locus_tag LOCUS_24480 32489 33388 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531673.1 protein_id gnl|my_center|LOCUS_24480 33737 33441 gene locus_tag LOCUS_24490 33737 33441 CDS product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530721.1 protein_id gnl|my_center|LOCUS_24490 34046 33747 gene locus_tag LOCUS_24500 34046 33747 CDS product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531722.1 protein_id gnl|my_center|LOCUS_24500 34508 34693 gene locus_tag LOCUS_24510 34508 34693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 34933 35148 gene locus_tag LOCUS_24520 34933 35148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 35161 35361 gene locus_tag LOCUS_24530 35161 35361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 35678 35388 gene locus_tag LOCUS_24540 35678 35388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 36462 36683 gene locus_tag LOCUS_24550 36462 36683 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167484192.1 protein_id gnl|my_center|LOCUS_24550 36899 37243 gene locus_tag LOCUS_24560 36899 37243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 37622 37251 gene locus_tag LOCUS_24570 37622 37251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 37829 37632 gene locus_tag LOCUS_24580 37829 37632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 38233 38727 gene locus_tag LOCUS_24590 38233 38727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533214.1 protein_id gnl|my_center|LOCUS_24590 38888 39118 gene locus_tag LOCUS_24600 38888 39118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 39156 39638 gene locus_tag LOCUS_24610 39156 39638 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531555.1 protein_id gnl|my_center|LOCUS_24610 39662 39970 gene locus_tag LOCUS_24620 39662 39970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 40477 40019 gene locus_tag LOCUS_24630 40477 40019 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530158.1 protein_id gnl|my_center|LOCUS_24630 40667 41413 gene locus_tag LOCUS_24640 40667 41413 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530159.1 protein_id gnl|my_center|LOCUS_24640 41410 41709 gene locus_tag LOCUS_24650 41410 41709 CDS product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530160.1 protein_id gnl|my_center|LOCUS_24650 >Feature sequence039 572 1354 gene locus_tag LOCUS_24660 572 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 1441 2085 gene locus_tag LOCUS_24670 1441 2085 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_24670 3626 2376 gene locus_tag LOCUS_24680 3626 2376 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244177.1 protein_id gnl|my_center|LOCUS_24680 4370 3630 gene locus_tag LOCUS_24690 4370 3630 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524793.1 protein_id gnl|my_center|LOCUS_24690 4667 4446 gene locus_tag LOCUS_24700 4667 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 4698 5111 gene locus_tag LOCUS_24710 4698 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 5755 5147 gene locus_tag LOCUS_24720 5755 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 6423 6085 gene locus_tag LOCUS_24730 6423 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311963.1 protein_id gnl|my_center|LOCUS_24730 7002 6442 gene locus_tag LOCUS_24740 7002 6442 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393195.1 protein_id gnl|my_center|LOCUS_24740 9372 7006 gene locus_tag LOCUS_24750 9372 7006 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393193.1 protein_id gnl|my_center|LOCUS_24750 10547 9369 gene locus_tag LOCUS_24760 10547 9369 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393192.1 protein_id gnl|my_center|LOCUS_24760 11065 10544 gene locus_tag LOCUS_24770 11065 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975309.1 protein_id gnl|my_center|LOCUS_24770 12937 11195 gene locus_tag LOCUS_24780 12937 11195 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975308.1 protein_id gnl|my_center|LOCUS_24780 14384 13242 gene locus_tag LOCUS_24790 14384 13242 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254833.1 protein_id gnl|my_center|LOCUS_24790 14621 14923 gene locus_tag LOCUS_24800 14621 14923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 15037 15267 gene locus_tag LOCUS_24810 15037 15267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 15946 15344 gene locus_tag LOCUS_24820 15946 15344 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525272.1 protein_id gnl|my_center|LOCUS_24820 16749 15979 gene locus_tag LOCUS_24830 16749 15979 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258646.1 protein_id gnl|my_center|LOCUS_24830 16657 16947 gene locus_tag LOCUS_24840 16657 16947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 18444 17059 gene locus_tag LOCUS_24850 18444 17059 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416624.1 protein_id gnl|my_center|LOCUS_24850 18675 18980 gene locus_tag LOCUS_24860 18675 18980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530714.1 protein_id gnl|my_center|LOCUS_24860 19464 19150 gene locus_tag LOCUS_24870 19464 19150 CDS product MocE family 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968075.1 protein_id gnl|my_center|LOCUS_24870 20476 19529 gene locus_tag LOCUS_24880 20476 19529 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528361.1 protein_id gnl|my_center|LOCUS_24880 21652 20645 gene locus_tag LOCUS_24890 21652 20645 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968074.1 protein_id gnl|my_center|LOCUS_24890 22467 21676 gene locus_tag LOCUS_24900 22467 21676 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393072.1 protein_id gnl|my_center|LOCUS_24900 23689 22751 gene locus_tag LOCUS_24910 23689 22751 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097615290.1 protein_id gnl|my_center|LOCUS_24910 23937 24209 gene locus_tag LOCUS_24920 23937 24209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 24579 24238 gene locus_tag LOCUS_24930 24579 24238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 24732 26846 gene locus_tag LOCUS_24940 24732 26846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 26993 27805 gene locus_tag LOCUS_24950 26993 27805 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970863.1 protein_id gnl|my_center|LOCUS_24950 28726 27896 gene locus_tag LOCUS_24960 28726 27896 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564977.1 protein_id gnl|my_center|LOCUS_24960 28962 29171 gene locus_tag LOCUS_24970 28962 29171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525120.1 protein_id gnl|my_center|LOCUS_24970 29824 29192 gene locus_tag LOCUS_24980 29824 29192 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530706.1 protein_id gnl|my_center|LOCUS_24980 30196 30696 gene locus_tag LOCUS_24990 30196 30696 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530702.1 protein_id gnl|my_center|LOCUS_24990 30765 31541 gene locus_tag LOCUS_25000 30765 31541 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530701.1 protein_id gnl|my_center|LOCUS_25000 31357 31366 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31538 33832 gene locus_tag LOCUS_25010 31538 33832 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530700.1 protein_id gnl|my_center|LOCUS_25010 34934 33924 gene locus_tag LOCUS_25020 34934 33924 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404431.1 protein_id gnl|my_center|LOCUS_25020 35032 35964 gene locus_tag LOCUS_25030 35032 35964 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113398.1 protein_id gnl|my_center|LOCUS_25030 36739 35981 gene locus_tag LOCUS_25040 36739 35981 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087714.1 protein_id gnl|my_center|LOCUS_25040 38106 36736 gene locus_tag LOCUS_25050 38106 36736 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087715.1 protein_id gnl|my_center|LOCUS_25050 38422 38817 gene locus_tag LOCUS_25060 38422 38817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173730.1 protein_id gnl|my_center|LOCUS_25060 39390 38845 gene locus_tag LOCUS_25070 39390 38845 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680960.1 protein_id gnl|my_center|LOCUS_25070 39592 39885 gene locus_tag LOCUS_25080 39592 39885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 41459 39921 gene locus_tag LOCUS_25090 41459 39921 CDS product winged helix-turn-helix domain-containing tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402524.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence040 900 319 gene locus_tag LOCUS_25100 900 319 CDS product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531317.1 protein_id gnl|my_center|LOCUS_25100 2015 897 gene locus_tag LOCUS_25110 2015 897 CDS product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531316.1 protein_id gnl|my_center|LOCUS_25110 2247 2387 gene locus_tag LOCUS_25120 2247 2387 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531315.1 protein_id gnl|my_center|LOCUS_25120 2439 2579 gene locus_tag LOCUS_25130 2439 2579 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531314.1 protein_id gnl|my_center|LOCUS_25130 2994 4403 gene locus_tag LOCUS_25140 gene trmFO 2994 4403 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531313.1 protein_id gnl|my_center|LOCUS_25140 5354 4404 gene locus_tag LOCUS_25150 5354 4404 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564975.1 protein_id gnl|my_center|LOCUS_25150 5782 5354 gene locus_tag LOCUS_25160 5782 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531309.1 protein_id gnl|my_center|LOCUS_25160 6712 5864 gene locus_tag LOCUS_25170 6712 5864 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172317.1 protein_id gnl|my_center|LOCUS_25170 7103 6714 gene locus_tag LOCUS_25180 7103 6714 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531307.1 protein_id gnl|my_center|LOCUS_25180 9669 7114 gene locus_tag LOCUS_25190 gene secDF 9669 7114 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_25190 10060 9722 gene locus_tag LOCUS_25200 gene yajC 10060 9722 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531305.1 protein_id gnl|my_center|LOCUS_25200 10337 11212 gene locus_tag LOCUS_25210 10337 11212 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531304.1 protein_id gnl|my_center|LOCUS_25210 12526 11309 gene locus_tag LOCUS_25220 12526 11309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 12679 13212 gene locus_tag LOCUS_25230 12679 13212 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529308.1 protein_id gnl|my_center|LOCUS_25230 13349 14950 gene locus_tag LOCUS_25240 13349 14950 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529309.1 protein_id gnl|my_center|LOCUS_25240 16373 15213 gene locus_tag LOCUS_25250 16373 15213 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529310.1 protein_id gnl|my_center|LOCUS_25250 17154 16366 gene locus_tag LOCUS_25260 17154 16366 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529311.1 protein_id gnl|my_center|LOCUS_25260 17379 18167 gene locus_tag LOCUS_25270 17379 18167 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529312.1 protein_id gnl|my_center|LOCUS_25270 18327 19145 gene locus_tag LOCUS_25280 18327 19145 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528003.1 protein_id gnl|my_center|LOCUS_25280 19142 20530 gene locus_tag LOCUS_25290 gene chrA 19142 20530 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528002.1 protein_id gnl|my_center|LOCUS_25290 20734 22128 gene locus_tag LOCUS_25300 20734 22128 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530218.1 protein_id gnl|my_center|LOCUS_25300 22325 23221 gene locus_tag LOCUS_25310 22325 23221 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531798.1 protein_id gnl|my_center|LOCUS_25310 23121 23130 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23241 23900 gene locus_tag LOCUS_25320 23241 23900 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531799.1 protein_id gnl|my_center|LOCUS_25320 23963 25300 gene locus_tag LOCUS_25330 23963 25300 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531800.1 protein_id gnl|my_center|LOCUS_25330 25300 26238 gene locus_tag LOCUS_25340 25300 26238 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531801.1 protein_id gnl|my_center|LOCUS_25340 26240 27061 gene locus_tag LOCUS_25350 26240 27061 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531802.1 protein_id gnl|my_center|LOCUS_25350 27098 28156 gene locus_tag LOCUS_25360 gene ugpC 27098 28156 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531803.1 protein_id gnl|my_center|LOCUS_25360 28420 29349 gene locus_tag LOCUS_25370 28420 29349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 30489 29527 gene locus_tag LOCUS_25380 30489 29527 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969507.1 protein_id gnl|my_center|LOCUS_25380 30946 31986 gene locus_tag LOCUS_25390 30946 31986 CDS product trans-3-hydroxy-L-proline dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975160.1 protein_id gnl|my_center|LOCUS_25390 32211 32135 gene locus_tag LOCUS_t00130 32211 32135 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33531 32368 gene locus_tag LOCUS_25400 33531 32368 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529349.1 protein_id gnl|my_center|LOCUS_25400 33747 34919 gene locus_tag LOCUS_25410 33747 34919 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529350.1 protein_id gnl|my_center|LOCUS_25410 34924 36048 gene locus_tag LOCUS_25420 34924 36048 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529351.1 protein_id gnl|my_center|LOCUS_25420 36357 36067 gene locus_tag LOCUS_25430 36357 36067 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503732.1 protein_id gnl|my_center|LOCUS_25430 37658 36369 gene locus_tag LOCUS_25440 37658 36369 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529353.1 protein_id gnl|my_center|LOCUS_25440 39256 38276 gene locus_tag LOCUS_25450 39256 38276 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529354.1 protein_id gnl|my_center|LOCUS_25450 40238 39327 gene locus_tag LOCUS_25460 40238 39327 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529355.1 protein_id gnl|my_center|LOCUS_25460 40401 40249 gene locus_tag LOCUS_25470 40401 40249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529356.1 protein_id gnl|my_center|LOCUS_25470 40654 41265 gene locus_tag LOCUS_25480 40654 41265 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529357.1 protein_id gnl|my_center|LOCUS_25480 >Feature sequence041 <1 760 gene locus_tag LOCUS_25490 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529738.1:DUF882 domain-containing protein 898 971 gene locus_tag LOCUS_t00140 898 971 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1765 1127 gene locus_tag LOCUS_25500 1765 1127 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529740.1 protein_id gnl|my_center|LOCUS_25500 2063 1851 gene locus_tag LOCUS_25510 2063 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 1972 2874 gene locus_tag LOCUS_25520 1972 2874 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529741.1 protein_id gnl|my_center|LOCUS_25520 2995 3738 gene locus_tag LOCUS_25530 2995 3738 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529742.1 protein_id gnl|my_center|LOCUS_25530 3955 4716 gene locus_tag LOCUS_25540 3955 4716 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529743.1 protein_id gnl|my_center|LOCUS_25540 5930 4746 gene locus_tag LOCUS_25550 5930 4746 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529745.1 protein_id gnl|my_center|LOCUS_25550 6014 6700 gene locus_tag LOCUS_25560 6014 6700 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529746.1 protein_id gnl|my_center|LOCUS_25560 6714 7703 gene locus_tag LOCUS_25570 6714 7703 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529747.1 protein_id gnl|my_center|LOCUS_25570 7703 7885 gene locus_tag LOCUS_25580 7703 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25580 7892 7901 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7956 8933 gene locus_tag LOCUS_25590 7956 8933 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529749.1 protein_id gnl|my_center|LOCUS_25590 10128 8941 gene locus_tag LOCUS_25600 10128 8941 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529750.1 protein_id gnl|my_center|LOCUS_25600 10781 10137 gene locus_tag LOCUS_25610 10781 10137 CDS product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529751.1 protein_id gnl|my_center|LOCUS_25610 11792 10893 gene locus_tag LOCUS_25620 11792 10893 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529752.1 protein_id gnl|my_center|LOCUS_25620 12638 11796 gene locus_tag LOCUS_25630 12638 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25630 13012 12557 gene locus_tag LOCUS_25640 13012 12557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25640 12653 12662 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13553 14686 gene locus_tag LOCUS_25650 gene odc2 13553 14686 CDS product ornithine/lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529754.1 protein_id gnl|my_center|LOCUS_25650 14786 15493 gene locus_tag LOCUS_25660 14786 15493 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529755.1 protein_id gnl|my_center|LOCUS_25660 15883 15599 gene locus_tag LOCUS_25670 15883 15599 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 protein_id gnl|my_center|LOCUS_25670 16576 16055 gene locus_tag LOCUS_25680 16576 16055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529757.1 protein_id gnl|my_center|LOCUS_25680 17021 16605 gene locus_tag LOCUS_25690 17021 16605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529758.1 protein_id gnl|my_center|LOCUS_25690 17584 17030 gene locus_tag LOCUS_25700 17584 17030 CDS product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529759.1 protein_id gnl|my_center|LOCUS_25700 17750 18019 gene locus_tag LOCUS_25710 17750 18019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 18405 18016 gene locus_tag LOCUS_25720 18405 18016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529767.1 protein_id gnl|my_center|LOCUS_25720 19162 18410 gene locus_tag LOCUS_25730 gene fliR 19162 18410 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529768.1 protein_id gnl|my_center|LOCUS_25730 21246 19159 gene locus_tag LOCUS_25740 gene flhA 21246 19159 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529769.1 protein_id gnl|my_center|LOCUS_25740 21386 21685 gene locus_tag LOCUS_25750 21386 21685 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529770.1 protein_id gnl|my_center|LOCUS_25750 21832 22935 gene locus_tag LOCUS_25760 21832 22935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25760 22920 22929 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22932 23561 gene locus_tag LOCUS_25770 22932 23561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25770 23708 24367 gene locus_tag LOCUS_25780 23708 24367 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530470.1 protein_id gnl|my_center|LOCUS_25780 24444 25484 gene locus_tag LOCUS_25790 24444 25484 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530469.1 protein_id gnl|my_center|LOCUS_25790 25507 26379 gene locus_tag LOCUS_25800 25507 26379 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160916.1 protein_id gnl|my_center|LOCUS_25800 26379 27176 gene locus_tag LOCUS_25810 26379 27176 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530467.1 protein_id gnl|my_center|LOCUS_25810 27173 27673 gene locus_tag LOCUS_25820 27173 27673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25820 27656 27665 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27673 28296 gene locus_tag LOCUS_25830 27673 28296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25830 28334 29719 gene locus_tag LOCUS_25840 28334 29719 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530465.1 protein_id gnl|my_center|LOCUS_25840 29780 30148 gene locus_tag LOCUS_25850 29780 30148 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530464.1 protein_id gnl|my_center|LOCUS_25850 31828 30185 gene locus_tag LOCUS_25860 31828 30185 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529772.1 protein_id gnl|my_center|LOCUS_25860 33890 32016 gene locus_tag LOCUS_25870 gene asnB 33890 32016 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027075.1 protein_id gnl|my_center|LOCUS_25870 34306 34040 gene locus_tag LOCUS_25880 gene fliQ 34306 34040 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529773.1 protein_id gnl|my_center|LOCUS_25880 34736 34329 gene locus_tag LOCUS_25890 gene flgD 34736 34329 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529774.1 protein_id gnl|my_center|LOCUS_25890 35179 34736 gene locus_tag LOCUS_25900 gene flbT 35179 34736 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529775.1 protein_id gnl|my_center|LOCUS_25900 35523 35176 gene locus_tag LOCUS_25910 gene flaF 35523 35176 CDS product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529776.1 protein_id gnl|my_center|LOCUS_25910 36604 35555 gene locus_tag LOCUS_25920 36604 35555 CDS product flagellar hook-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529777.1 protein_id gnl|my_center|LOCUS_25920 36895 36608 gene locus_tag LOCUS_25930 36895 36608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25930 36900 36909 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37057 37302 gene locus_tag LOCUS_25940 37057 37302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 37948 38130 gene locus_tag LOCUS_25950 37948 38130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 39311 38058 gene locus_tag LOCUS_25960 39311 38058 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529779.1 protein_id gnl|my_center|LOCUS_25960 40077 39409 gene locus_tag LOCUS_25970 40077 39409 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529780.1 protein_id gnl|my_center|LOCUS_25970 40901 40311 gene locus_tag LOCUS_25980 40901 40311 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050596211.1 protein_id gnl|my_center|LOCUS_25980 <41557 40831 gene locus_tag LOCUS_25990 <41557 40831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011974483.1:flagellar hook-length control protein FliK >Feature sequence042 800 567 gene locus_tag LOCUS_26000 800 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 1285 2796 gene locus_tag LOCUS_26010 1285 2796 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254000.1 protein_id gnl|my_center|LOCUS_26010 4826 2898 gene locus_tag LOCUS_26020 4826 2898 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967293.1 protein_id gnl|my_center|LOCUS_26020 5538 4984 gene locus_tag LOCUS_26030 5538 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 5795 5538 gene locus_tag LOCUS_26040 5795 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 5566 5575 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6665 5805 gene locus_tag LOCUS_26050 6665 5805 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170199.1 protein_id gnl|my_center|LOCUS_26050 6989 8905 gene locus_tag LOCUS_26060 6989 8905 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564967.1 protein_id gnl|my_center|LOCUS_26060 8954 10918 gene locus_tag LOCUS_26070 8954 10918 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564967.1 protein_id gnl|my_center|LOCUS_26070 11240 11872 gene locus_tag LOCUS_26080 11240 11872 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532366.1 protein_id gnl|my_center|LOCUS_26080 12045 13268 gene locus_tag LOCUS_26090 12045 13268 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163217.1 protein_id gnl|my_center|LOCUS_26090 14024 13320 gene locus_tag LOCUS_26100 14024 13320 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114283.1 protein_id gnl|my_center|LOCUS_26100 14176 14487 gene locus_tag LOCUS_26110 14176 14487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 14559 15074 gene locus_tag LOCUS_26120 14559 15074 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032899511.1 protein_id gnl|my_center|LOCUS_26120 17859 15082 gene locus_tag LOCUS_26130 17859 15082 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974776.1 protein_id gnl|my_center|LOCUS_26130 19664 18132 gene locus_tag LOCUS_26140 19664 18132 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532370.1 protein_id gnl|my_center|LOCUS_26140 21219 19996 gene locus_tag LOCUS_26150 21219 19996 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532371.1 protein_id gnl|my_center|LOCUS_26150 21703 21242 gene locus_tag LOCUS_26160 21703 21242 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532372.1 protein_id gnl|my_center|LOCUS_26160 22148 22612 gene locus_tag LOCUS_26170 22148 22612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26170 22952 22961 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22979 23260 gene locus_tag LOCUS_26180 22979 23260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26180 23257 24831 gene locus_tag LOCUS_26190 23257 24831 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203086395.1 protein_id gnl|my_center|LOCUS_26190 24951 28052 gene locus_tag LOCUS_26200 24951 28052 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266339.1 protein_id gnl|my_center|LOCUS_26200 28128 28538 gene locus_tag LOCUS_26210 28128 28538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058776.1 protein_id gnl|my_center|LOCUS_26210 28711 28719 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28737 28880 gene locus_tag LOCUS_26220 28737 28880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 30394 28895 gene locus_tag LOCUS_26230 30394 28895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 30544 31377 gene locus_tag LOCUS_26240 30544 31377 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532382.1 protein_id gnl|my_center|LOCUS_26240 32309 31374 gene locus_tag LOCUS_26250 32309 31374 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085299.1 protein_id gnl|my_center|LOCUS_26250 33624 32491 gene locus_tag LOCUS_26260 33624 32491 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171838.1 protein_id gnl|my_center|LOCUS_26260 34901 33621 gene locus_tag LOCUS_26270 34901 33621 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532384.1 protein_id gnl|my_center|LOCUS_26270 36096 34915 gene locus_tag LOCUS_26280 36096 34915 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532385.1 protein_id gnl|my_center|LOCUS_26280 36225 36851 gene locus_tag LOCUS_26290 36225 36851 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171837.1 protein_id gnl|my_center|LOCUS_26290 37734 36856 gene locus_tag LOCUS_26300 37734 36856 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530651.1 protein_id gnl|my_center|LOCUS_26300 37860 38621 gene locus_tag LOCUS_26310 37860 38621 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275285.1 protein_id gnl|my_center|LOCUS_26310 39442 38618 gene locus_tag LOCUS_26320 39442 38618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532387.1 protein_id gnl|my_center|LOCUS_26320 39506 40300 gene locus_tag LOCUS_26330 39506 40300 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532388.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence043 952 248 gene locus_tag LOCUS_26340 952 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531598.1 protein_id gnl|my_center|LOCUS_26340 1611 952 gene locus_tag LOCUS_26350 1611 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531599.1 protein_id gnl|my_center|LOCUS_26350 1857 1651 gene locus_tag LOCUS_26360 1857 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 2410 1919 gene locus_tag LOCUS_26370 2410 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531601.1 protein_id gnl|my_center|LOCUS_26370 3247 2423 gene locus_tag LOCUS_26380 3247 2423 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531602.1 protein_id gnl|my_center|LOCUS_26380 7165 4796 gene locus_tag LOCUS_26390 7165 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531609.1 protein_id gnl|my_center|LOCUS_26390 7458 7273 gene locus_tag LOCUS_26400 7458 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 8035 7430 gene locus_tag LOCUS_26410 8035 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 8730 8095 gene locus_tag LOCUS_26420 8730 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 9119 8799 gene locus_tag LOCUS_26430 9119 8799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531611.1 protein_id gnl|my_center|LOCUS_26430 9307 9119 gene locus_tag LOCUS_26440 9307 9119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 9543 9286 gene locus_tag LOCUS_26450 9543 9286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 9757 9545 gene locus_tag LOCUS_26460 9757 9545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 10431 9760 gene locus_tag LOCUS_26470 10431 9760 CDS product glycosyl hydrolase 108 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531615.1 protein_id gnl|my_center|LOCUS_26470 11832 10441 gene locus_tag LOCUS_26480 11832 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 11954 12337 gene locus_tag LOCUS_26490 11954 12337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 13836 12412 gene locus_tag LOCUS_26500 13836 12412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531618.1 protein_id gnl|my_center|LOCUS_26500 14074 13811 gene locus_tag LOCUS_26510 14074 13811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 14349 14071 gene locus_tag LOCUS_26520 14349 14071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 15873 15031 gene locus_tag LOCUS_26530 15873 15031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 15078 15087 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17459 15870 gene locus_tag LOCUS_26540 17459 15870 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913116.1 protein_id gnl|my_center|LOCUS_26540 17806 17456 gene locus_tag LOCUS_26550 17806 17456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 18684 17803 gene locus_tag LOCUS_26560 18684 17803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 18866 18681 gene locus_tag LOCUS_26570 18866 18681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 19072 18863 gene locus_tag LOCUS_26580 19072 18863 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165815993.1 protein_id gnl|my_center|LOCUS_26580 19192 19662 gene locus_tag LOCUS_26590 19192 19662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 19659 20864 gene locus_tag LOCUS_26600 19659 20864 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531626.1 protein_id gnl|my_center|LOCUS_26600 20938 21027 gene locus_tag LOCUS_t00150 20938 21027 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 21918 21631 gene locus_tag LOCUS_26610 21918 21631 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532019.1 protein_id gnl|my_center|LOCUS_26610 22074 22463 gene locus_tag LOCUS_26620 22074 22463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 24881 22863 gene locus_tag LOCUS_26630 24881 22863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 25142 25957 gene locus_tag LOCUS_26640 25142 25957 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_26640 25954 26913 gene locus_tag LOCUS_26650 25954 26913 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_26650 26876 27556 gene locus_tag LOCUS_26660 26876 27556 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065795.1 protein_id gnl|my_center|LOCUS_26660 27553 28746 gene locus_tag LOCUS_26670 27553 28746 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122758.1 protein_id gnl|my_center|LOCUS_26670 28746 29684 gene locus_tag LOCUS_26680 28746 29684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 29686 30666 gene locus_tag LOCUS_26690 29686 30666 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546066.1 protein_id gnl|my_center|LOCUS_26690 31433 30723 gene locus_tag LOCUS_26700 31433 30723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 31389 31706 gene locus_tag LOCUS_26710 31389 31706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 32110 33555 gene locus_tag LOCUS_26720 32110 33555 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525276.1 protein_id gnl|my_center|LOCUS_26720 34094 33570 gene locus_tag LOCUS_26730 34094 33570 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525282.1 protein_id gnl|my_center|LOCUS_26730 34263 34670 gene locus_tag LOCUS_26740 34263 34670 CDS product DUF930 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032808257.1 protein_id gnl|my_center|LOCUS_26740 34861 35520 gene locus_tag LOCUS_26750 34861 35520 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531644.1 protein_id gnl|my_center|LOCUS_26750 35641 36954 gene locus_tag LOCUS_26760 gene rimO 35641 36954 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531645.1 protein_id gnl|my_center|LOCUS_26760 38089 37022 gene locus_tag LOCUS_26770 38089 37022 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531647.1 protein_id gnl|my_center|LOCUS_26770 39062 38142 gene locus_tag LOCUS_26780 39062 38142 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531648.1 protein_id gnl|my_center|LOCUS_26780 40171 39062 gene locus_tag LOCUS_26790 40171 39062 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531649.1 protein_id gnl|my_center|LOCUS_26790 <40684 40171 gene locus_tag LOCUS_26800 <40684 40171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063172149.1:ABC transporter ATP-binding protein >Feature sequence044 293 1180 gene locus_tag LOCUS_26810 293 1180 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531403.1 protein_id gnl|my_center|LOCUS_26810 1325 1252 gene locus_tag LOCUS_t00160 1325 1252 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1499 1415 gene locus_tag LOCUS_t00170 1499 1415 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1709 2563 gene locus_tag LOCUS_26820 gene rlmB 1709 2563 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531400.1 protein_id gnl|my_center|LOCUS_26820 2577 2990 gene locus_tag LOCUS_26830 2577 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 4045 3128 gene locus_tag LOCUS_26840 4045 3128 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531399.1 protein_id gnl|my_center|LOCUS_26840 4950 4153 gene locus_tag LOCUS_26850 gene hyi 4950 4153 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531398.1 protein_id gnl|my_center|LOCUS_26850 6770 4977 gene locus_tag LOCUS_26860 gene gcl 6770 4977 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531397.1 protein_id gnl|my_center|LOCUS_26860 6115 6124 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6926 7726 gene locus_tag LOCUS_26870 6926 7726 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531396.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26870 7629 7638 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7642 7863 gene locus_tag LOCUS_26880 7642 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26880 7937 8395 gene locus_tag LOCUS_26890 7937 8395 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532225.1 protein_id gnl|my_center|LOCUS_26890 8752 8396 gene locus_tag LOCUS_26900 8752 8396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531395.1 protein_id gnl|my_center|LOCUS_26900 9254 8937 gene locus_tag LOCUS_26910 9254 8937 CDS product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531394.1 protein_id gnl|my_center|LOCUS_26910 9601 9434 gene locus_tag LOCUS_26920 9601 9434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531392.1 protein_id gnl|my_center|LOCUS_26920 9881 9956 gene locus_tag LOCUS_t00180 9881 9956 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 10432 9992 gene locus_tag LOCUS_26930 10432 9992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 11027 10419 gene locus_tag LOCUS_26940 11027 10419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 11761 11024 gene locus_tag LOCUS_26950 11761 11024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 12102 12302 gene locus_tag LOCUS_26960 12102 12302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 12586 12987 gene locus_tag LOCUS_26970 12586 12987 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038770.1 protein_id gnl|my_center|LOCUS_26970 13225 13052 gene locus_tag LOCUS_26980 13225 13052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 13303 13503 gene locus_tag LOCUS_26990 13303 13503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 13629 13904 gene locus_tag LOCUS_27000 13629 13904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 14143 14322 gene locus_tag LOCUS_27010 14143 14322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 15005 14709 gene locus_tag LOCUS_27020 15005 14709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 15441 14980 gene locus_tag LOCUS_27030 15441 14980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 16352 15531 gene locus_tag LOCUS_27040 16352 15531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 17025 16459 gene locus_tag LOCUS_27050 17025 16459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 19685 17313 gene locus_tag LOCUS_27060 19685 17313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 20513 20319 gene locus_tag LOCUS_27070 20513 20319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 21787 20510 gene locus_tag LOCUS_27080 21787 20510 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240716.1 protein_id gnl|my_center|LOCUS_27080 22152 21925 gene locus_tag LOCUS_27090 22152 21925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 22833 22174 gene locus_tag LOCUS_27100 22833 22174 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531378.1 protein_id gnl|my_center|LOCUS_27100 23728 22994 gene locus_tag LOCUS_27110 23728 22994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27110 23733 23742 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23885 24034 gene locus_tag LOCUS_27120 23885 24034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 25538 24504 gene locus_tag LOCUS_27130 25538 24504 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531376.1 protein_id gnl|my_center|LOCUS_27130 25811 26014 gene locus_tag LOCUS_27140 25811 26014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 26694 27467 gene locus_tag LOCUS_27150 26694 27467 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531374.1 protein_id gnl|my_center|LOCUS_27150 27693 29213 gene locus_tag LOCUS_27160 27693 29213 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172295.1 protein_id gnl|my_center|LOCUS_27160 29877 29281 gene locus_tag LOCUS_27170 29877 29281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531372.1 protein_id gnl|my_center|LOCUS_27170 30735 30127 gene locus_tag LOCUS_27180 30735 30127 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531371.1 protein_id gnl|my_center|LOCUS_27180 31277 30891 gene locus_tag LOCUS_27190 31277 30891 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531370.1 protein_id gnl|my_center|LOCUS_27190 31780 31409 gene locus_tag LOCUS_27200 31780 31409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531369.1 protein_id gnl|my_center|LOCUS_27200 32507 32079 gene locus_tag LOCUS_27210 32507 32079 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531368.1 protein_id gnl|my_center|LOCUS_27210 33538 32570 gene locus_tag LOCUS_27220 gene prfB 33538 32570 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531367.1 protein_id gnl|my_center|LOCUS_27220 36286 33830 gene locus_tag LOCUS_27230 36286 33830 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531366.1 protein_id gnl|my_center|LOCUS_27230 37679 36498 gene locus_tag LOCUS_27240 37679 36498 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531365.1 protein_id gnl|my_center|LOCUS_27240 >Feature sequence045 426 920 gene locus_tag LOCUS_27250 gene ribH 426 920 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532245.1 protein_id gnl|my_center|LOCUS_27250 917 1417 gene locus_tag LOCUS_27260 gene nusB 917 1417 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532244.1 protein_id gnl|my_center|LOCUS_27260 1414 2640 gene locus_tag LOCUS_27270 1414 2640 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532243.1 protein_id gnl|my_center|LOCUS_27270 3314 3081 gene locus_tag LOCUS_27280 3314 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 3501 3510 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3578 4642 gene locus_tag LOCUS_27290 3578 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27290 4553 4562 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4594 5043 gene locus_tag LOCUS_27300 4594 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27300 8479 5111 gene locus_tag LOCUS_27310 8479 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 8855 8484 gene locus_tag LOCUS_27320 8855 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 9697 9149 gene locus_tag LOCUS_27330 9697 9149 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532236.1 protein_id gnl|my_center|LOCUS_27330 9180 9189 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9814 10350 gene locus_tag LOCUS_27340 9814 10350 CDS product ubiquinol-cytochrome C chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532235.1 protein_id gnl|my_center|LOCUS_27340 10361 10909 gene locus_tag LOCUS_27350 10361 10909 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532234.1 protein_id gnl|my_center|LOCUS_27350 11059 12105 gene locus_tag LOCUS_27360 gene plsX 11059 12105 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504675.1 protein_id gnl|my_center|LOCUS_27360 12115 13086 gene locus_tag LOCUS_27370 12115 13086 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532232.1 protein_id gnl|my_center|LOCUS_27370 13189 13512 gene locus_tag LOCUS_27380 13189 13512 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532231.1 protein_id gnl|my_center|LOCUS_27380 13644 14186 gene locus_tag LOCUS_27390 13644 14186 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532230.1 protein_id gnl|my_center|LOCUS_27390 14581 14306 gene locus_tag LOCUS_27400 14581 14306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 16084 16353 gene locus_tag LOCUS_27410 16084 16353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 16478 16554 gene locus_tag LOCUS_t00190 16478 16554 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17903 16641 gene locus_tag LOCUS_27420 17903 16641 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532223.1 protein_id gnl|my_center|LOCUS_27420 19435 17900 gene locus_tag LOCUS_27430 19435 17900 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532222.1 protein_id gnl|my_center|LOCUS_27430 20718 19588 gene locus_tag LOCUS_27440 20718 19588 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532221.1 protein_id gnl|my_center|LOCUS_27440 21245 20727 gene locus_tag LOCUS_27450 21245 20727 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532220.1 protein_id gnl|my_center|LOCUS_27450 21551 23725 gene locus_tag LOCUS_27460 21551 23725 CDS product exopolysaccharide transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532219.1 protein_id gnl|my_center|LOCUS_27460 25011 23785 gene locus_tag LOCUS_27470 25011 23785 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532217.1 protein_id gnl|my_center|LOCUS_27470 25102 26160 gene locus_tag LOCUS_27480 25102 26160 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532216.1 protein_id gnl|my_center|LOCUS_27480 26725 26327 gene locus_tag LOCUS_27490 26725 26327 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089492.1 protein_id gnl|my_center|LOCUS_27490 27229 26777 gene locus_tag LOCUS_27500 27229 26777 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329997.1 protein_id gnl|my_center|LOCUS_27500 27451 27230 gene locus_tag LOCUS_27510 27451 27230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329187.1 protein_id gnl|my_center|LOCUS_27510 27876 27484 gene locus_tag LOCUS_27520 27876 27484 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531183.1 protein_id gnl|my_center|LOCUS_27520 28350 27940 gene locus_tag LOCUS_27530 28350 27940 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531186.1 protein_id gnl|my_center|LOCUS_27530 28670 28347 gene locus_tag LOCUS_27540 28670 28347 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531187.1 protein_id gnl|my_center|LOCUS_27540 28996 28781 gene locus_tag LOCUS_27550 28996 28781 CDS product DUF2842 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532215.1 protein_id gnl|my_center|LOCUS_27550 29149 30240 gene locus_tag LOCUS_27560 29149 30240 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532214.1 protein_id gnl|my_center|LOCUS_27560 31385 30453 gene locus_tag LOCUS_27570 gene argC 31385 30453 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532212.1 protein_id gnl|my_center|LOCUS_27570 32417 31416 gene locus_tag LOCUS_27580 gene speB 32417 31416 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532211.1 protein_id gnl|my_center|LOCUS_27580 32542 33804 gene locus_tag LOCUS_27590 32542 33804 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532210.1 protein_id gnl|my_center|LOCUS_27590 33837 34895 gene locus_tag LOCUS_27600 33837 34895 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532209.1 protein_id gnl|my_center|LOCUS_27600 35819 34947 gene locus_tag LOCUS_27610 35819 34947 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532208.1 protein_id gnl|my_center|LOCUS_27610 35914 36825 gene locus_tag LOCUS_27620 35914 36825 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532207.1 protein_id gnl|my_center|LOCUS_27620 37362 36886 gene locus_tag LOCUS_27630 gene rpsI 37362 36886 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532206.1 protein_id gnl|my_center|LOCUS_27630 37826 37362 gene locus_tag LOCUS_27640 gene rplM 37826 37362 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532205.1 protein_id gnl|my_center|LOCUS_27640 38518 38054 gene locus_tag LOCUS_27650 38518 38054 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532204.1 protein_id gnl|my_center|LOCUS_27650 38703 39524 gene locus_tag LOCUS_27660 38703 39524 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532203.1 protein_id gnl|my_center|LOCUS_27660 39550 39972 gene locus_tag LOCUS_27670 39550 39972 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532202.1 protein_id gnl|my_center|LOCUS_27670 >Feature sequence046 <1 1068 gene locus_tag LOCUS_27680 <1 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532629.1:bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase 1215 1685 gene locus_tag LOCUS_27690 1215 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 4112 1791 gene locus_tag LOCUS_27700 4112 1791 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532627.1 protein_id gnl|my_center|LOCUS_27700 6926 4281 gene locus_tag LOCUS_27710 gene pepN 6926 4281 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532626.1 protein_id gnl|my_center|LOCUS_27710 7081 7260 gene locus_tag LOCUS_27720 7081 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 7257 8228 gene locus_tag LOCUS_27730 7257 8228 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532624.1 protein_id gnl|my_center|LOCUS_27730 8023 8032 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9081 8269 gene locus_tag LOCUS_27740 9081 8269 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532623.1 protein_id gnl|my_center|LOCUS_27740 10084 9167 gene locus_tag LOCUS_27750 10084 9167 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171746.1 protein_id gnl|my_center|LOCUS_27750 10685 10134 gene locus_tag LOCUS_27760 10685 10134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532621.1 protein_id gnl|my_center|LOCUS_27760 10973 12652 gene locus_tag LOCUS_27770 10973 12652 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532620.1 protein_id gnl|my_center|LOCUS_27770 12794 13393 gene locus_tag LOCUS_27780 12794 13393 CDS product DUF922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532619.1 protein_id gnl|my_center|LOCUS_27780 14423 13413 gene locus_tag LOCUS_27790 14423 13413 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532618.1 protein_id gnl|my_center|LOCUS_27790 16063 14561 gene locus_tag LOCUS_27800 16063 14561 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505273.1 protein_id gnl|my_center|LOCUS_27800 16396 16202 gene locus_tag LOCUS_27810 16396 16202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532616.1 protein_id gnl|my_center|LOCUS_27810 16581 16429 gene locus_tag LOCUS_27820 16581 16429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 17103 16762 gene locus_tag LOCUS_27830 17103 16762 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532615.1 protein_id gnl|my_center|LOCUS_27830 17538 17804 gene locus_tag LOCUS_27840 17538 17804 CDS product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532614.1 protein_id gnl|my_center|LOCUS_27840 17893 18072 gene locus_tag LOCUS_27850 17893 18072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 18122 19243 gene locus_tag LOCUS_27860 18122 19243 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532613.1 protein_id gnl|my_center|LOCUS_27860 21266 19290 gene locus_tag LOCUS_27870 21266 19290 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532612.1 protein_id gnl|my_center|LOCUS_27870 21645 21316 gene locus_tag LOCUS_27880 21645 21316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532609.1 protein_id gnl|my_center|LOCUS_27880 22344 21805 gene locus_tag LOCUS_27890 22344 21805 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_27890 23953 22346 gene locus_tag LOCUS_27900 23953 22346 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532608.1 protein_id gnl|my_center|LOCUS_27900 24201 24593 gene locus_tag LOCUS_27910 24201 24593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 25774 24611 gene locus_tag LOCUS_27920 25774 24611 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532607.1 protein_id gnl|my_center|LOCUS_27920 26456 25827 gene locus_tag LOCUS_27930 26456 25827 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532606.1 protein_id gnl|my_center|LOCUS_27930 26794 26510 gene locus_tag LOCUS_27940 26794 26510 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402696.1 protein_id gnl|my_center|LOCUS_27940 28026 26914 gene locus_tag LOCUS_27950 28026 26914 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532603.1 protein_id gnl|my_center|LOCUS_27950 28445 28122 gene locus_tag LOCUS_27960 28445 28122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967309.1 protein_id gnl|my_center|LOCUS_27960 29678 28704 gene locus_tag LOCUS_27970 29678 28704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 30026 31525 gene locus_tag LOCUS_27980 30026 31525 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442740.1 protein_id gnl|my_center|LOCUS_27980 31565 32518 gene locus_tag LOCUS_27990 31565 32518 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966354.1 protein_id gnl|my_center|LOCUS_27990 33522 32725 gene locus_tag LOCUS_28000 33522 32725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026616082.1 protein_id gnl|my_center|LOCUS_28000 34035 35606 gene locus_tag LOCUS_28010 34035 35606 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532602.1 protein_id gnl|my_center|LOCUS_28010 35631 35819 gene locus_tag LOCUS_28020 35631 35819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 >Feature sequence047 <1 968 gene locus_tag LOCUS_28030 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028173732.1:HlyD family type I secretion periplasmic adaptor subunit 1200 2105 gene locus_tag LOCUS_28040 1200 2105 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027134.1 protein_id gnl|my_center|LOCUS_28040 2138 2872 gene locus_tag LOCUS_28050 2138 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 2940 3668 gene locus_tag LOCUS_28060 2940 3668 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812168.1 protein_id gnl|my_center|LOCUS_28060 3748 5127 gene locus_tag LOCUS_28070 3748 5127 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532193.1 protein_id gnl|my_center|LOCUS_28070 5322 6596 gene locus_tag LOCUS_28080 5322 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 8350 6668 gene locus_tag LOCUS_28090 gene ade 8350 6668 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066541.1 protein_id gnl|my_center|LOCUS_28090 9092 10159 gene locus_tag LOCUS_28100 9092 10159 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976242.1 protein_id gnl|my_center|LOCUS_28100 10304 10747 gene locus_tag LOCUS_28110 10304 10747 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530517.1 protein_id gnl|my_center|LOCUS_28110 11460 11065 gene locus_tag LOCUS_28120 11460 11065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28120 12251 11463 gene locus_tag LOCUS_28130 12251 11463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28130 11496 11505 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12516 12752 gene locus_tag LOCUS_28140 12516 12752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533630.1 protein_id gnl|my_center|LOCUS_28140 12878 14128 gene locus_tag LOCUS_28150 12878 14128 CDS product pilus assembly protein TadG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531999.1 protein_id gnl|my_center|LOCUS_28150 14133 14573 gene locus_tag LOCUS_28160 14133 14573 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531998.1 protein_id gnl|my_center|LOCUS_28160 14563 14970 gene locus_tag LOCUS_28170 14563 14970 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531997.1 protein_id gnl|my_center|LOCUS_28170 15268 16119 gene locus_tag LOCUS_28180 15268 16119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528937.1 protein_id gnl|my_center|LOCUS_28180 16487 16242 gene locus_tag LOCUS_28190 16487 16242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 16368 16775 gene locus_tag LOCUS_28200 16368 16775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311637.1 protein_id gnl|my_center|LOCUS_28200 17183 16860 gene locus_tag LOCUS_28210 17183 16860 CDS product exopolysaccharide production repressor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530628.1 protein_id gnl|my_center|LOCUS_28210 17713 17417 gene locus_tag LOCUS_28220 17713 17417 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082959.1 protein_id gnl|my_center|LOCUS_28220 18953 17952 gene locus_tag LOCUS_28230 18953 17952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 19846 19127 gene locus_tag LOCUS_28240 19846 19127 CDS product DUF1236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013894153.1 protein_id gnl|my_center|LOCUS_28240 20048 20347 gene locus_tag LOCUS_28250 20048 20347 CDS product DUF1236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530625.1 protein_id gnl|my_center|LOCUS_28250 20546 20767 gene locus_tag LOCUS_28260 20546 20767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532436.1 protein_id gnl|my_center|LOCUS_28260 21181 20858 gene locus_tag LOCUS_28270 21181 20858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530627.1 protein_id gnl|my_center|LOCUS_28270 21340 21696 gene locus_tag LOCUS_28280 21340 21696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530773.1 protein_id gnl|my_center|LOCUS_28280 21628 21637 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22013 21684 gene locus_tag LOCUS_28290 22013 21684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 22331 22340 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22591 22800 gene locus_tag LOCUS_28300 22591 22800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 22898 23152 gene locus_tag LOCUS_28310 22898 23152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 23609 23809 gene locus_tag LOCUS_28320 23609 23809 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061019.1 protein_id gnl|my_center|LOCUS_28320 24041 24403 gene locus_tag LOCUS_28330 24041 24403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 24400 24585 gene locus_tag LOCUS_28340 24400 24585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109672801.1 protein_id gnl|my_center|LOCUS_28340 24935 24690 gene locus_tag LOCUS_28350 24935 24690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 25277 24975 gene locus_tag LOCUS_28360 25277 24975 CDS product DUF1236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531386.1 protein_id gnl|my_center|LOCUS_28360 25612 25274 gene locus_tag LOCUS_28370 25612 25274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 26166 25966 gene locus_tag LOCUS_28380 26166 25966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 26558 26340 gene locus_tag LOCUS_28390 26558 26340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 26836 26627 gene locus_tag LOCUS_28400 26836 26627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 27393 27184 gene locus_tag LOCUS_28410 27393 27184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 27784 28095 gene locus_tag LOCUS_28420 27784 28095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 28335 28970 gene locus_tag LOCUS_28430 28335 28970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267784.1 protein_id gnl|my_center|LOCUS_28430 29363 29019 gene locus_tag LOCUS_28440 29363 29019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 30553 29465 gene locus_tag LOCUS_28450 30553 29465 CDS product GSU2403 family nucleotidyltransferase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081162719.1 protein_id gnl|my_center|LOCUS_28450 32211 31162 gene locus_tag LOCUS_28460 32211 31162 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018642169.1 protein_id gnl|my_center|LOCUS_28460 32944 32333 gene locus_tag LOCUS_28470 32944 32333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 33046 33339 gene locus_tag LOCUS_28480 33046 33339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 33412 33684 gene locus_tag LOCUS_28490 33412 33684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 33457 33466 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33761 34618 gene locus_tag LOCUS_28500 33761 34618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530585.1 protein_id gnl|my_center|LOCUS_28500 34710 35369 gene locus_tag LOCUS_28510 34710 35369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 35290 35595 gene locus_tag LOCUS_28520 35290 35595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence048 1778 2188 gene locus_tag LOCUS_28530 1778 2188 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533653.1 protein_id gnl|my_center|LOCUS_28530 3156 2341 gene locus_tag LOCUS_28540 3156 2341 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533652.1 protein_id gnl|my_center|LOCUS_28540 3447 4178 gene locus_tag LOCUS_28550 3447 4178 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533651.1 protein_id gnl|my_center|LOCUS_28550 4277 4915 gene locus_tag LOCUS_28560 4277 4915 CDS product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533650.1 protein_id gnl|my_center|LOCUS_28560 4928 5677 gene locus_tag LOCUS_28570 4928 5677 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533649.1 protein_id gnl|my_center|LOCUS_28570 6725 5826 gene locus_tag LOCUS_28580 gene ppk2 6725 5826 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533648.1 protein_id gnl|my_center|LOCUS_28580 6886 8151 gene locus_tag LOCUS_28590 6886 8151 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171201.1 protein_id gnl|my_center|LOCUS_28590 8263 8988 gene locus_tag LOCUS_28600 gene phoU 8263 8988 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533646.1 protein_id gnl|my_center|LOCUS_28600 9080 10090 gene locus_tag LOCUS_28610 9080 10090 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533645.1 protein_id gnl|my_center|LOCUS_28610 10728 10210 gene locus_tag LOCUS_28620 10728 10210 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533644.1 protein_id gnl|my_center|LOCUS_28620 11085 12284 gene locus_tag LOCUS_28630 11085 12284 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533643.1 protein_id gnl|my_center|LOCUS_28630 12302 13213 gene locus_tag LOCUS_28640 gene argF 12302 13213 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533642.1 protein_id gnl|my_center|LOCUS_28640 13316 14323 gene locus_tag LOCUS_28650 13316 14323 CDS product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533641.1 protein_id gnl|my_center|LOCUS_28650 15247 14438 gene locus_tag LOCUS_28660 15247 14438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 15743 15351 gene locus_tag LOCUS_28670 gene apaG 15743 15351 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533640.1 protein_id gnl|my_center|LOCUS_28670 15969 17105 gene locus_tag LOCUS_28680 15969 17105 CDS product ceramide glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533639.1 protein_id gnl|my_center|LOCUS_28680 16969 16978 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18315 17128 gene locus_tag LOCUS_28690 18315 17128 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533638.1 protein_id gnl|my_center|LOCUS_28690 18534 19628 gene locus_tag LOCUS_28700 18534 19628 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533637.1 protein_id gnl|my_center|LOCUS_28700 19726 20499 gene locus_tag LOCUS_28710 19726 20499 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533636.1 protein_id gnl|my_center|LOCUS_28710 21664 20672 gene locus_tag LOCUS_28720 gene gguC 21664 20672 CDS product GguC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533635.1 protein_id gnl|my_center|LOCUS_28720 23258 21966 gene locus_tag LOCUS_28730 gene gguB 23258 21966 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533634.1 protein_id gnl|my_center|LOCUS_28730 24790 23255 gene locus_tag LOCUS_28740 gene gguA 24790 23255 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533633.1 protein_id gnl|my_center|LOCUS_28740 26047 24980 gene locus_tag LOCUS_28750 gene chvE 26047 24980 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533632.1 protein_id gnl|my_center|LOCUS_28750 26341 27330 gene locus_tag LOCUS_28760 26341 27330 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533631.1 protein_id gnl|my_center|LOCUS_28760 27842 28294 gene locus_tag LOCUS_28770 27842 28294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 28733 28530 gene locus_tag LOCUS_28780 28733 28530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 29348 29275 gene locus_tag LOCUS_t00200 29348 29275 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 29526 30479 gene locus_tag LOCUS_28790 29526 30479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 30493 31251 gene locus_tag LOCUS_28800 30493 31251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 31356 31619 gene locus_tag LOCUS_28810 31356 31619 CDS product DUF6460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533620.1 protein_id gnl|my_center|LOCUS_28810 32525 31623 gene locus_tag LOCUS_28820 32525 31623 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533619.1 protein_id gnl|my_center|LOCUS_28820 32686 33966 gene locus_tag LOCUS_28830 32686 33966 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173551.1 protein_id gnl|my_center|LOCUS_28830 34517 34035 gene locus_tag LOCUS_28840 34517 34035 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529453.1 protein_id gnl|my_center|LOCUS_28840 34625 35023 gene locus_tag LOCUS_28850 34625 35023 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089793.1 protein_id gnl|my_center|LOCUS_28850 <35637 35087 gene locus_tag LOCUS_28860 <35637 35087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533617.1:quinone-dependent dihydroorotate dehydrogenase >Feature sequence049 691 1245 gene locus_tag LOCUS_28870 gene tsaA 691 1245 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530932.1 protein_id gnl|my_center|LOCUS_28870 1245 1559 gene locus_tag LOCUS_28880 1245 1559 CDS product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530931.1 protein_id gnl|my_center|LOCUS_28880 1673 2632 gene locus_tag LOCUS_28890 1673 2632 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530929.1 protein_id gnl|my_center|LOCUS_28890 2766 3674 gene locus_tag LOCUS_28900 2766 3674 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530928.1 protein_id gnl|my_center|LOCUS_28900 3041 3047 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4341 3727 gene locus_tag LOCUS_28910 4341 3727 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530927.1 protein_id gnl|my_center|LOCUS_28910 4537 5103 gene locus_tag LOCUS_28920 4537 5103 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530926.1 protein_id gnl|my_center|LOCUS_28920 6270 5149 gene locus_tag LOCUS_28930 6270 5149 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530925.1 protein_id gnl|my_center|LOCUS_28930 6718 6383 gene locus_tag LOCUS_28940 6718 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 7609 6833 gene locus_tag LOCUS_28950 gene tam 7609 6833 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530924.1 protein_id gnl|my_center|LOCUS_28950 7104 7113 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9411 7762 gene locus_tag LOCUS_28960 gene ettA 9411 7762 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530923.1 protein_id gnl|my_center|LOCUS_28960 9673 10932 gene locus_tag LOCUS_28970 9673 10932 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240324.1 protein_id gnl|my_center|LOCUS_28970 11980 10970 gene locus_tag LOCUS_28980 11980 10970 CDS product ribonuclease T(2) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530922.1 protein_id gnl|my_center|LOCUS_28980 12170 13102 gene locus_tag LOCUS_28990 12170 13102 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530921.1 protein_id gnl|my_center|LOCUS_28990 13186 14361 gene locus_tag LOCUS_29000 13186 14361 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530920.1 protein_id gnl|my_center|LOCUS_29000 14358 16007 gene locus_tag LOCUS_29010 14358 16007 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530919.1 protein_id gnl|my_center|LOCUS_29010 16515 16075 gene locus_tag LOCUS_29020 16515 16075 CDS product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530918.1 protein_id gnl|my_center|LOCUS_29020 17943 16660 gene locus_tag LOCUS_29030 17943 16660 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534205.1 protein_id gnl|my_center|LOCUS_29030 18067 18525 gene locus_tag LOCUS_29040 18067 18525 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530917.1 protein_id gnl|my_center|LOCUS_29040 19537 18566 gene locus_tag LOCUS_29050 19537 18566 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530916.1 protein_id gnl|my_center|LOCUS_29050 20750 19701 gene locus_tag LOCUS_29060 20750 19701 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530915.1 protein_id gnl|my_center|LOCUS_29060 19738 19747 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21625 20747 gene locus_tag LOCUS_29070 21625 20747 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530914.1 protein_id gnl|my_center|LOCUS_29070 22579 21788 gene locus_tag LOCUS_29080 22579 21788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530913.1 protein_id gnl|my_center|LOCUS_29080 22710 23114 gene locus_tag LOCUS_29090 22710 23114 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530912.1 protein_id gnl|my_center|LOCUS_29090 23572 23195 gene locus_tag LOCUS_29100 23572 23195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172509.1 protein_id gnl|my_center|LOCUS_29100 25026 23575 gene locus_tag LOCUS_29110 gene hydA 25026 23575 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530910.1 protein_id gnl|my_center|LOCUS_29110 26341 25091 gene locus_tag LOCUS_29120 26341 25091 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530909.1 protein_id gnl|my_center|LOCUS_29120 27739 26411 gene locus_tag LOCUS_29130 27739 26411 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530907.1 protein_id gnl|my_center|LOCUS_29130 27982 28623 gene locus_tag LOCUS_29140 27982 28623 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530906.1 protein_id gnl|my_center|LOCUS_29140 29510 28638 gene locus_tag LOCUS_29150 29510 28638 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530905.1 protein_id gnl|my_center|LOCUS_29150 29599 30462 gene locus_tag LOCUS_29160 29599 30462 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530904.1 protein_id gnl|my_center|LOCUS_29160 30455 31177 gene locus_tag LOCUS_29170 30455 31177 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530903.1 protein_id gnl|my_center|LOCUS_29170 31710 31216 gene locus_tag LOCUS_29180 31710 31216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 32182 31805 gene locus_tag LOCUS_29190 32182 31805 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530897.1 protein_id gnl|my_center|LOCUS_29190 32704 32246 gene locus_tag LOCUS_29200 32704 32246 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530896.1 protein_id gnl|my_center|LOCUS_29200 33261 32710 gene locus_tag LOCUS_29210 33261 32710 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530895.1 protein_id gnl|my_center|LOCUS_29210 34670 33357 gene locus_tag LOCUS_29220 gene preA 34670 33357 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530894.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence050 <1 892 gene locus_tag LOCUS_29230 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530369.1:RsmB/NOP family class I SAM-dependent RNA methyltransferase 988 1446 gene locus_tag LOCUS_29240 988 1446 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530371.1 protein_id gnl|my_center|LOCUS_29240 1450 2106 gene locus_tag LOCUS_29250 1450 2106 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530372.1 protein_id gnl|my_center|LOCUS_29250 2162 3724 gene locus_tag LOCUS_29260 gene guaA 2162 3724 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530373.1 protein_id gnl|my_center|LOCUS_29260 4735 5772 gene locus_tag LOCUS_29270 4735 5772 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533354.1 protein_id gnl|my_center|LOCUS_29270 6619 7335 gene locus_tag LOCUS_29280 6619 7335 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397232.1 protein_id gnl|my_center|LOCUS_29280 8559 8023 gene locus_tag LOCUS_29290 8559 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 9067 8756 gene locus_tag LOCUS_29300 9067 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530766.1 protein_id gnl|my_center|LOCUS_29300 9649 9846 gene locus_tag LOCUS_29310 9649 9846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 9895 10116 gene locus_tag LOCUS_29320 9895 10116 CDS product DUF768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525056.1 protein_id gnl|my_center|LOCUS_29320 10117 10398 gene locus_tag LOCUS_29330 10117 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095203224.1 protein_id gnl|my_center|LOCUS_29330 10563 10775 gene locus_tag LOCUS_29340 10563 10775 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167484192.1 protein_id gnl|my_center|LOCUS_29340 11259 11681 gene locus_tag LOCUS_29350 11259 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 12686 12853 gene locus_tag LOCUS_29360 12686 12853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 13937 12909 gene locus_tag LOCUS_29370 13937 12909 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530876.1 protein_id gnl|my_center|LOCUS_29370 14205 14062 gene locus_tag LOCUS_29380 14205 14062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 14503 14330 gene locus_tag LOCUS_29390 14503 14330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 14772 14500 gene locus_tag LOCUS_29400 14772 14500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29400 14915 15415 gene locus_tag LOCUS_29410 14915 15415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 15989 15729 gene locus_tag LOCUS_29420 15989 15729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 16237 16902 gene locus_tag LOCUS_29430 16237 16902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 17000 18271 gene locus_tag LOCUS_29440 17000 18271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 18246 18255 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18363 19964 gene locus_tag LOCUS_29450 18363 19964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 19978 20472 gene locus_tag LOCUS_29460 19978 20472 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_29460 20802 20548 gene locus_tag LOCUS_29470 20802 20548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 20695 21546 gene locus_tag LOCUS_29480 20695 21546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 22480 22238 gene locus_tag LOCUS_29490 22480 22238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 22904 22542 gene locus_tag LOCUS_29500 22904 22542 CDS product DUF3088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265530.1 protein_id gnl|my_center|LOCUS_29500 24905 23100 gene locus_tag LOCUS_29510 24905 23100 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530492.1 protein_id gnl|my_center|LOCUS_29510 25089 26459 gene locus_tag LOCUS_29520 25089 26459 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530493.1 protein_id gnl|my_center|LOCUS_29520 26472 27245 gene locus_tag LOCUS_29530 26472 27245 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530494.1 protein_id gnl|my_center|LOCUS_29530 27300 28943 gene locus_tag LOCUS_29540 27300 28943 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530495.1 protein_id gnl|my_center|LOCUS_29540 28981 29940 gene locus_tag LOCUS_29550 28981 29940 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530496.1 protein_id gnl|my_center|LOCUS_29550 29937 30824 gene locus_tag LOCUS_29560 29937 30824 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530497.1 protein_id gnl|my_center|LOCUS_29560 32401 31061 gene locus_tag LOCUS_29570 32401 31061 CDS product FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528704.1 protein_id gnl|my_center|LOCUS_29570 33010 34023 gene locus_tag LOCUS_29580 gene tauA 33010 34023 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528706.1 protein_id gnl|my_center|LOCUS_29580 >Feature sequence051 317 392 gene locus_tag LOCUS_t00210 317 392 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2083 515 gene locus_tag LOCUS_29590 2083 515 CDS product indolepyruvate oxidoreductase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527965.1 protein_id gnl|my_center|LOCUS_29590 4229 2076 gene locus_tag LOCUS_29600 4229 2076 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527966.1 protein_id gnl|my_center|LOCUS_29600 4761 4279 gene locus_tag LOCUS_29610 4761 4279 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527967.1 protein_id gnl|my_center|LOCUS_29610 6332 4761 gene locus_tag LOCUS_29620 6332 4761 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527968.1 protein_id gnl|my_center|LOCUS_29620 7413 6622 gene locus_tag LOCUS_29630 7413 6622 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527969.1 protein_id gnl|my_center|LOCUS_29630 7533 8486 gene locus_tag LOCUS_29640 7533 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29640 8324 8333 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8483 9121 gene locus_tag LOCUS_29650 8483 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29650 9234 10760 gene locus_tag LOCUS_29660 9234 10760 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527971.1 protein_id gnl|my_center|LOCUS_29660 10831 11838 gene locus_tag LOCUS_29670 10831 11838 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527972.1 protein_id gnl|my_center|LOCUS_29670 11831 12679 gene locus_tag LOCUS_29680 11831 12679 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527973.1 protein_id gnl|my_center|LOCUS_29680 12676 13566 gene locus_tag LOCUS_29690 12676 13566 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527974.1 protein_id gnl|my_center|LOCUS_29690 13559 14389 gene locus_tag LOCUS_29700 13559 14389 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527975.1 protein_id gnl|my_center|LOCUS_29700 14565 16859 gene locus_tag LOCUS_29710 14565 16859 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527977.1 protein_id gnl|my_center|LOCUS_29710 16856 17629 gene locus_tag LOCUS_29720 16856 17629 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527978.1 protein_id gnl|my_center|LOCUS_29720 17623 18093 gene locus_tag LOCUS_29730 17623 18093 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527979.1 protein_id gnl|my_center|LOCUS_29730 18090 18902 gene locus_tag LOCUS_29740 18090 18902 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527980.1 protein_id gnl|my_center|LOCUS_29740 18984 20132 gene locus_tag LOCUS_29750 18984 20132 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527981.1 protein_id gnl|my_center|LOCUS_29750 20182 20577 gene locus_tag LOCUS_29760 20182 20577 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_29760 20781 21509 gene locus_tag LOCUS_29770 20781 21509 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817039.1 protein_id gnl|my_center|LOCUS_29770 21675 22700 gene locus_tag LOCUS_29780 21675 22700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 22491 22500 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22642 22833 gene locus_tag LOCUS_29790 22642 22833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 22934 23719 gene locus_tag LOCUS_29800 22934 23719 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527986.1 protein_id gnl|my_center|LOCUS_29800 23835 24512 gene locus_tag LOCUS_29810 23835 24512 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527987.1 protein_id gnl|my_center|LOCUS_29810 24553 25833 gene locus_tag LOCUS_29820 24553 25833 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527988.1 protein_id gnl|my_center|LOCUS_29820 26688 25858 gene locus_tag LOCUS_29830 26688 25858 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527989.1 protein_id gnl|my_center|LOCUS_29830 27548 26685 gene locus_tag LOCUS_29840 27548 26685 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527990.1 protein_id gnl|my_center|LOCUS_29840 28459 27548 gene locus_tag LOCUS_29850 28459 27548 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527991.1 protein_id gnl|my_center|LOCUS_29850 29467 28460 gene locus_tag LOCUS_29860 29467 28460 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527992.1 protein_id gnl|my_center|LOCUS_29860 31111 29513 gene locus_tag LOCUS_29870 31111 29513 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527124.1 protein_id gnl|my_center|LOCUS_29870 31851 33554 gene locus_tag LOCUS_29880 31851 33554 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527994.1 protein_id gnl|my_center|LOCUS_29880 >Feature sequence052 <1 817 gene locus_tag LOCUS_29890 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011971095.1:type IV secretion system protein VirB10 798 1814 gene locus_tag LOCUS_29900 gene virB11 798 1814 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971096.1 protein_id gnl|my_center|LOCUS_29900 1811 3949 gene locus_tag LOCUS_29910 1811 3949 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971097.1 protein_id gnl|my_center|LOCUS_29910 4040 4204 gene locus_tag LOCUS_29920 4040 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 4701 4228 gene locus_tag LOCUS_29930 4701 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 5150 5788 gene locus_tag LOCUS_29940 5150 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 5778 6230 gene locus_tag LOCUS_29950 5778 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 6829 6620 gene locus_tag LOCUS_29960 6829 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 6962 7801 gene locus_tag LOCUS_29970 6962 7801 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531673.1 protein_id gnl|my_center|LOCUS_29970 8319 8086 gene locus_tag LOCUS_29980 8319 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 8723 8995 gene locus_tag LOCUS_29990 8723 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184871738.1 protein_id gnl|my_center|LOCUS_29990 9282 8992 gene locus_tag LOCUS_30000 9282 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525247.1 protein_id gnl|my_center|LOCUS_30000 9784 9317 gene locus_tag LOCUS_30010 9784 9317 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528917.1 protein_id gnl|my_center|LOCUS_30010 10984 10778 gene locus_tag LOCUS_30020 10984 10778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971104.1 protein_id gnl|my_center|LOCUS_30020 13450 10991 gene locus_tag LOCUS_30030 13450 10991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971105.1 protein_id gnl|my_center|LOCUS_30030 13855 13454 gene locus_tag LOCUS_30040 gene mobC 13855 13454 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971106.1 protein_id gnl|my_center|LOCUS_30040 14496 15209 gene locus_tag LOCUS_30050 14496 15209 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971107.1 protein_id gnl|my_center|LOCUS_30050 15202 15642 gene locus_tag LOCUS_30060 15202 15642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234939659.1 protein_id gnl|my_center|LOCUS_30060 15673 16038 gene locus_tag LOCUS_30070 15673 16038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 16309 16818 gene locus_tag LOCUS_30080 16309 16818 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036588671.1 protein_id gnl|my_center|LOCUS_30080 17788 18198 gene locus_tag LOCUS_30090 17788 18198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 18352 18843 gene locus_tag LOCUS_30100 18352 18843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 18740 18946 gene locus_tag LOCUS_30110 18740 18946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 19192 19001 gene locus_tag LOCUS_30120 19192 19001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 19784 20806 gene locus_tag LOCUS_30130 19784 20806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 20914 22824 gene locus_tag LOCUS_30140 20914 22824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 22828 24789 gene locus_tag LOCUS_30150 22828 24789 CDS product DUF2357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876141.1 protein_id gnl|my_center|LOCUS_30150 24925 27234 gene locus_tag LOCUS_30160 24925 27234 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537646.1 protein_id gnl|my_center|LOCUS_30160 25476 25485 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28174 28473 gene locus_tag LOCUS_30170 28174 28473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 28821 29351 gene locus_tag LOCUS_30180 28821 29351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 29348 29527 gene locus_tag LOCUS_30190 29348 29527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 30145 29636 gene locus_tag LOCUS_30200 30145 29636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 30972 30379 gene locus_tag LOCUS_30210 30972 30379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30210 31535 30948 gene locus_tag LOCUS_30220 31535 30948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30220 30993 31002 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31742 32926 gene locus_tag LOCUS_30230 31742 32926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 32972 33925 gene locus_tag LOCUS_30240 32972 33925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 >Feature sequence053 <1 532 gene locus_tag LOCUS_30250 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011971082.1:thermonuclease family protein 640 1179 gene locus_tag LOCUS_30260 640 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971080.1 protein_id gnl|my_center|LOCUS_30260 1179 1607 gene locus_tag LOCUS_30270 1179 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971079.1 protein_id gnl|my_center|LOCUS_30270 1586 1804 gene locus_tag LOCUS_30280 1586 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 2633 2884 gene locus_tag LOCUS_30290 2633 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 3173 3457 gene locus_tag LOCUS_30300 3173 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 3474 3893 gene locus_tag LOCUS_30310 3474 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 3962 4351 gene locus_tag LOCUS_30320 3962 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895392.1 protein_id gnl|my_center|LOCUS_30320 5072 4710 gene locus_tag LOCUS_30330 5072 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 6811 7818 gene locus_tag LOCUS_30340 6811 7818 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971076.1 protein_id gnl|my_center|LOCUS_30340 7989 8195 gene locus_tag LOCUS_30350 7989 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 9574 8357 gene locus_tag LOCUS_30360 9574 8357 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090709.1 protein_id gnl|my_center|LOCUS_30360 11941 9578 gene locus_tag LOCUS_30370 11941 9578 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090710.1 protein_id gnl|my_center|LOCUS_30370 12741 11947 gene locus_tag LOCUS_30380 12741 11947 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090711.1 protein_id gnl|my_center|LOCUS_30380 12938 13564 gene locus_tag LOCUS_30390 12938 13564 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067207.1 protein_id gnl|my_center|LOCUS_30390 13588 14949 gene locus_tag LOCUS_30400 13588 14949 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327635.1 protein_id gnl|my_center|LOCUS_30400 15616 15170 gene locus_tag LOCUS_30410 15616 15170 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525374.1 protein_id gnl|my_center|LOCUS_30410 16963 15680 gene locus_tag LOCUS_30420 16963 15680 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_30420 19428 16972 gene locus_tag LOCUS_30430 19428 16972 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021360.1 protein_id gnl|my_center|LOCUS_30430 20983 19478 gene locus_tag LOCUS_30440 20983 19478 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831569.1 protein_id gnl|my_center|LOCUS_30440 21664 20996 gene locus_tag LOCUS_30450 21664 20996 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966090.1 protein_id gnl|my_center|LOCUS_30450 21978 21667 gene locus_tag LOCUS_30460 21978 21667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 22390 21998 gene locus_tag LOCUS_30470 22390 21998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 22745 22467 gene locus_tag LOCUS_30480 22745 22467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 23510 22758 gene locus_tag LOCUS_30490 23510 22758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 23967 23557 gene locus_tag LOCUS_30500 23967 23557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 24437 26860 gene locus_tag LOCUS_30510 24437 26860 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965926.1 protein_id gnl|my_center|LOCUS_30510 26912 28132 gene locus_tag LOCUS_30520 26912 28132 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391721.1 protein_id gnl|my_center|LOCUS_30520 28134 29417 gene locus_tag LOCUS_30530 28134 29417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 30090 31355 gene locus_tag LOCUS_30540 30090 31355 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967584.1 protein_id gnl|my_center|LOCUS_30540 31509 32036 gene locus_tag LOCUS_30550 gene hemG 31509 32036 CDS product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945460.1 protein_id gnl|my_center|LOCUS_30550 32307 32669 gene locus_tag LOCUS_30560 32307 32669 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967601.1 protein_id gnl|my_center|LOCUS_30560 32747 33277 gene locus_tag LOCUS_30570 32747 33277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30570 33288 33500 gene locus_tag LOCUS_30580 33288 33500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325697.1 protein_id gnl|my_center|LOCUS_30580 >Feature sequence054 479 1033 gene locus_tag LOCUS_30590 gene moaB 479 1033 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532836.1 protein_id gnl|my_center|LOCUS_30590 2029 1055 gene locus_tag LOCUS_30600 2029 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532837.1 protein_id gnl|my_center|LOCUS_30600 2739 2236 gene locus_tag LOCUS_30610 2739 2236 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532838.1 protein_id gnl|my_center|LOCUS_30610 2889 4043 gene locus_tag LOCUS_30620 2889 4043 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023808673.1 protein_id gnl|my_center|LOCUS_30620 4191 4886 gene locus_tag LOCUS_30630 4191 4886 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532840.1 protein_id gnl|my_center|LOCUS_30630 5617 5126 gene locus_tag LOCUS_30640 5617 5126 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532841.1 protein_id gnl|my_center|LOCUS_30640 6224 5628 gene locus_tag LOCUS_30650 6224 5628 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532842.1 protein_id gnl|my_center|LOCUS_30650 6512 6288 gene locus_tag LOCUS_30660 6512 6288 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006206606.1 protein_id gnl|my_center|LOCUS_30660 7338 6580 gene locus_tag LOCUS_30670 7338 6580 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532843.1 protein_id gnl|my_center|LOCUS_30670 7794 7402 gene locus_tag LOCUS_30680 7794 7402 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532844.1 protein_id gnl|my_center|LOCUS_30680 9245 8061 gene locus_tag LOCUS_30690 9245 8061 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532845.1 protein_id gnl|my_center|LOCUS_30690 10536 9376 gene locus_tag LOCUS_30700 10536 9376 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532846.1 protein_id gnl|my_center|LOCUS_30700 10475 10690 gene locus_tag LOCUS_30710 10475 10690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 10716 11669 gene locus_tag LOCUS_30720 10716 11669 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532847.1 protein_id gnl|my_center|LOCUS_30720 13190 11763 gene locus_tag LOCUS_30730 gene der 13190 11763 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532848.1 protein_id gnl|my_center|LOCUS_30730 13859 13194 gene locus_tag LOCUS_30740 13859 13194 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532849.1 protein_id gnl|my_center|LOCUS_30740 14063 15070 gene locus_tag LOCUS_30750 14063 15070 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532850.1 protein_id gnl|my_center|LOCUS_30750 16352 15093 gene locus_tag LOCUS_30760 gene sbmA 16352 15093 CDS product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532851.1 protein_id gnl|my_center|LOCUS_30760 17589 16474 gene locus_tag LOCUS_30770 17589 16474 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532852.1 protein_id gnl|my_center|LOCUS_30770 17931 17725 gene locus_tag LOCUS_30780 17931 17725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 18027 18941 gene locus_tag LOCUS_30790 18027 18941 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532854.1 protein_id gnl|my_center|LOCUS_30790 19164 20420 gene locus_tag LOCUS_30800 19164 20420 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532855.1 protein_id gnl|my_center|LOCUS_30800 20443 20799 gene locus_tag LOCUS_30810 20443 20799 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532856.1 protein_id gnl|my_center|LOCUS_30810 21359 21006 gene locus_tag LOCUS_30820 21359 21006 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532857.1 protein_id gnl|my_center|LOCUS_30820 21517 21870 gene locus_tag LOCUS_30830 21517 21870 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808563.1 protein_id gnl|my_center|LOCUS_30830 21867 22346 gene locus_tag LOCUS_30840 21867 22346 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126727.1 protein_id gnl|my_center|LOCUS_30840 22785 22432 gene locus_tag LOCUS_30850 22785 22432 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532858.1 protein_id gnl|my_center|LOCUS_30850 23866 22952 gene locus_tag LOCUS_30860 23866 22952 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528521.1 protein_id gnl|my_center|LOCUS_30860 23819 23828 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25365 23866 gene locus_tag LOCUS_30870 25365 23866 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528520.1 protein_id gnl|my_center|LOCUS_30870 24946 24955 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27023 25437 gene locus_tag LOCUS_30880 gene ggt 27023 25437 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528519.1 protein_id gnl|my_center|LOCUS_30880 27846 27046 gene locus_tag LOCUS_30890 27846 27046 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528518.1 protein_id gnl|my_center|LOCUS_30890 28760 27843 gene locus_tag LOCUS_30900 28760 27843 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528517.1 protein_id gnl|my_center|LOCUS_30900 29362 28760 gene locus_tag LOCUS_30910 29362 28760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30910 29399 29408 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30893 29886 gene locus_tag LOCUS_30920 30893 29886 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528515.1 protein_id gnl|my_center|LOCUS_30920 31160 31861 gene locus_tag LOCUS_30930 31160 31861 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050596197.1 protein_id gnl|my_center|LOCUS_30930 32926 31871 gene locus_tag LOCUS_30940 32926 31871 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532860.1 protein_id gnl|my_center|LOCUS_30940 32500 32509 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33524 32916 gene locus_tag LOCUS_30950 33524 32916 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532861.1 protein_id gnl|my_center|LOCUS_30950 >Feature sequence055 <1 701 gene locus_tag LOCUS_30960 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530963.1:cell division protein FtsZ 1012 1986 gene locus_tag LOCUS_30970 gene lpxC 1012 1986 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530964.1 protein_id gnl|my_center|LOCUS_30970 2204 3073 gene locus_tag LOCUS_30980 2204 3073 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530965.1 protein_id gnl|my_center|LOCUS_30980 3082 4755 gene locus_tag LOCUS_30990 gene recN 3082 4755 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530966.1 protein_id gnl|my_center|LOCUS_30990 5039 7246 gene locus_tag LOCUS_31000 gene ligA 5039 7246 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530967.1 protein_id gnl|my_center|LOCUS_31000 7246 7932 gene locus_tag LOCUS_31010 7246 7932 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530968.1 protein_id gnl|my_center|LOCUS_31010 8049 8777 gene locus_tag LOCUS_31020 8049 8777 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530969.1 protein_id gnl|my_center|LOCUS_31020 8774 9070 gene locus_tag LOCUS_31030 8774 9070 CDS product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530970.1 protein_id gnl|my_center|LOCUS_31030 9949 9323 gene locus_tag LOCUS_31040 9949 9323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31040 11175 9835 gene locus_tag LOCUS_31050 11175 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31050 10166 10175 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12132 11260 gene locus_tag LOCUS_31060 12132 11260 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530972.1 protein_id gnl|my_center|LOCUS_31060 12720 12142 gene locus_tag LOCUS_31070 12720 12142 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530973.1 protein_id gnl|my_center|LOCUS_31070 12932 13429 gene locus_tag LOCUS_31080 12932 13429 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310780.1 protein_id gnl|my_center|LOCUS_31080 13490 13978 gene locus_tag LOCUS_31090 13490 13978 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530974.1 protein_id gnl|my_center|LOCUS_31090 14100 14741 gene locus_tag LOCUS_31100 14100 14741 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530975.1 protein_id gnl|my_center|LOCUS_31100 14996 15427 gene locus_tag LOCUS_31110 14996 15427 CDS product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530978.1 protein_id gnl|my_center|LOCUS_31110 16186 15527 gene locus_tag LOCUS_31120 16186 15527 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530979.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31120 16401 16093 gene locus_tag LOCUS_31130 16401 16093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31130 16246 16255 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16533 16814 gene locus_tag LOCUS_31140 16533 16814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530980.1 protein_id gnl|my_center|LOCUS_31140 17396 16821 gene locus_tag LOCUS_31150 17396 16821 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_31150 17570 17579 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17620 18753 gene locus_tag LOCUS_31160 17620 18753 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530983.1 protein_id gnl|my_center|LOCUS_31160 20229 18757 gene locus_tag LOCUS_31170 20229 18757 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063168296.1 protein_id gnl|my_center|LOCUS_31170 20635 20387 gene locus_tag LOCUS_31180 20635 20387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 21180 20632 gene locus_tag LOCUS_31190 21180 20632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845917.1 protein_id gnl|my_center|LOCUS_31190 21285 22199 gene locus_tag LOCUS_31200 21285 22199 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968210.1 protein_id gnl|my_center|LOCUS_31200 22431 23222 gene locus_tag LOCUS_31210 22431 23222 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532670.1 protein_id gnl|my_center|LOCUS_31210 24748 23282 gene locus_tag LOCUS_31220 24748 23282 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530985.1 protein_id gnl|my_center|LOCUS_31220 24957 25271 gene locus_tag LOCUS_31230 24957 25271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530988.1 protein_id gnl|my_center|LOCUS_31230 26327 25302 gene locus_tag LOCUS_31240 26327 25302 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530989.1 protein_id gnl|my_center|LOCUS_31240 26525 27553 gene locus_tag LOCUS_31250 26525 27553 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530990.1 protein_id gnl|my_center|LOCUS_31250 27550 28458 gene locus_tag LOCUS_31260 27550 28458 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530991.1 protein_id gnl|my_center|LOCUS_31260 28575 29588 gene locus_tag LOCUS_31270 28575 29588 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530992.1 protein_id gnl|my_center|LOCUS_31270 29678 30475 gene locus_tag LOCUS_31280 29678 30475 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530993.1 protein_id gnl|my_center|LOCUS_31280 30472 31518 gene locus_tag LOCUS_31290 30472 31518 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530994.1 protein_id gnl|my_center|LOCUS_31290 <33274 31525 gene locus_tag LOCUS_31300 <33274 31525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530996.1:UvrD-helicase domain-containing protein >Feature sequence056 1001 117 gene locus_tag LOCUS_31310 1001 117 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089657.1 protein_id gnl|my_center|LOCUS_31310 1381 1061 gene locus_tag LOCUS_31320 1381 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089658.1 protein_id gnl|my_center|LOCUS_31320 1526 1891 gene locus_tag LOCUS_31330 1526 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 1936 2805 gene locus_tag LOCUS_31340 1936 2805 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226536.1 protein_id gnl|my_center|LOCUS_31340 4513 2858 gene locus_tag LOCUS_31350 4513 2858 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528300.1 protein_id gnl|my_center|LOCUS_31350 5539 4553 gene locus_tag LOCUS_31360 5539 4553 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528301.1 protein_id gnl|my_center|LOCUS_31360 6413 5808 gene locus_tag LOCUS_31370 6413 5808 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528302.1 protein_id gnl|my_center|LOCUS_31370 7025 6453 gene locus_tag LOCUS_31380 7025 6453 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528303.1 protein_id gnl|my_center|LOCUS_31380 8057 7167 gene locus_tag LOCUS_31390 8057 7167 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528304.1 protein_id gnl|my_center|LOCUS_31390 8154 9149 gene locus_tag LOCUS_31400 8154 9149 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528305.1 protein_id gnl|my_center|LOCUS_31400 9991 9389 gene locus_tag LOCUS_31410 9991 9389 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528306.1 protein_id gnl|my_center|LOCUS_31410 12440 10032 gene locus_tag LOCUS_31420 gene pheT 12440 10032 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528307.1 protein_id gnl|my_center|LOCUS_31420 12859 12437 gene locus_tag LOCUS_31430 12859 12437 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528308.1 protein_id gnl|my_center|LOCUS_31430 13941 12856 gene locus_tag LOCUS_31440 gene pheS 13941 12856 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528309.1 protein_id gnl|my_center|LOCUS_31440 14438 14037 gene locus_tag LOCUS_31450 gene rplT 14438 14037 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528310.1 protein_id gnl|my_center|LOCUS_31450 14679 14476 gene locus_tag LOCUS_31460 gene rpmI 14679 14476 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006201248.1 protein_id gnl|my_center|LOCUS_31460 15568 14918 gene locus_tag LOCUS_31470 15568 14918 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528311.1 protein_id gnl|my_center|LOCUS_31470 16181 15777 gene locus_tag LOCUS_31480 gene infC 16181 15777 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528312.1 protein_id gnl|my_center|LOCUS_31480 16533 17303 gene locus_tag LOCUS_31490 16533 17303 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528313.1 protein_id gnl|my_center|LOCUS_31490 17306 18490 gene locus_tag LOCUS_31500 17306 18490 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528314.1 protein_id gnl|my_center|LOCUS_31500 18663 18454 gene locus_tag LOCUS_31510 18663 18454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 18635 19039 gene locus_tag LOCUS_31520 18635 19039 CDS product DUF2852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528315.1 protein_id gnl|my_center|LOCUS_31520 19139 19897 gene locus_tag LOCUS_31530 19139 19897 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528316.1 protein_id gnl|my_center|LOCUS_31530 20143 19925 gene locus_tag LOCUS_31540 20143 19925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528317.1 protein_id gnl|my_center|LOCUS_31540 20255 20914 gene locus_tag LOCUS_31550 20255 20914 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528318.1 protein_id gnl|my_center|LOCUS_31550 20941 22161 gene locus_tag LOCUS_31560 gene trpB 20941 22161 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528319.1 protein_id gnl|my_center|LOCUS_31560 22164 23003 gene locus_tag LOCUS_31570 gene trpA 22164 23003 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528320.1 protein_id gnl|my_center|LOCUS_31570 23043 23969 gene locus_tag LOCUS_31580 gene accD 23043 23969 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528321.1 protein_id gnl|my_center|LOCUS_31580 24624 24349 gene locus_tag LOCUS_31590 24624 24349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 24359 24368 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24604 25434 gene locus_tag LOCUS_31600 24604 25434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31600 25491 25910 gene locus_tag LOCUS_31610 25491 25910 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901099.1 protein_id gnl|my_center|LOCUS_31610 26213 25932 gene locus_tag LOCUS_31620 26213 25932 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528325.1 protein_id gnl|my_center|LOCUS_31620 26669 26346 gene locus_tag LOCUS_31630 gene trxA 26669 26346 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528326.1 protein_id gnl|my_center|LOCUS_31630 30256 26744 gene locus_tag LOCUS_31640 gene addA 30256 26744 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528327.1 protein_id gnl|my_center|LOCUS_31640 <32181 30253 gene locus_tag LOCUS_31650 <32181 30253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528328.1:double-strand break repair protein AddB >Feature sequence057 19 960 gene locus_tag LOCUS_31660 19 960 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529592.1 protein_id gnl|my_center|LOCUS_31660 991 1000 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1340 1074 gene locus_tag LOCUS_31670 1340 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31670 3245 1794 gene locus_tag LOCUS_31680 3245 1794 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529596.1 protein_id gnl|my_center|LOCUS_31680 4153 3254 gene locus_tag LOCUS_31690 4153 3254 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529597.1 protein_id gnl|my_center|LOCUS_31690 4684 4244 gene locus_tag LOCUS_31700 4684 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027161333.1 protein_id gnl|my_center|LOCUS_31700 5240 4701 gene locus_tag LOCUS_31710 5240 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529599.1 protein_id gnl|my_center|LOCUS_31710 5599 5207 gene locus_tag LOCUS_31720 5599 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529600.1 protein_id gnl|my_center|LOCUS_31720 6093 5623 gene locus_tag LOCUS_31730 6093 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529601.1 protein_id gnl|my_center|LOCUS_31730 7240 6335 gene locus_tag LOCUS_31740 7240 6335 CDS product bifunctional helix-turn-helix domain-containing protein/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529602.1 protein_id gnl|my_center|LOCUS_31740 7880 7386 gene locus_tag LOCUS_31750 7880 7386 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529603.1 protein_id gnl|my_center|LOCUS_31750 7903 8709 gene locus_tag LOCUS_31760 gene nth 7903 8709 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529604.1 protein_id gnl|my_center|LOCUS_31760 9216 8761 gene locus_tag LOCUS_31770 9216 8761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 9427 9963 gene locus_tag LOCUS_31780 9427 9963 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529609.1 protein_id gnl|my_center|LOCUS_31780 12448 9971 gene locus_tag LOCUS_31790 12448 9971 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114236.1 protein_id gnl|my_center|LOCUS_31790 13530 12778 gene locus_tag LOCUS_31800 13530 12778 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529610.1 protein_id gnl|my_center|LOCUS_31800 13734 14699 gene locus_tag LOCUS_31810 13734 14699 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529611.1 protein_id gnl|my_center|LOCUS_31810 14832 15365 gene locus_tag LOCUS_31820 14832 15365 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529612.1 protein_id gnl|my_center|LOCUS_31820 15370 16893 gene locus_tag LOCUS_31830 15370 16893 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529613.1 protein_id gnl|my_center|LOCUS_31830 16909 18093 gene locus_tag LOCUS_31840 16909 18093 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529614.1 protein_id gnl|my_center|LOCUS_31840 18090 18938 gene locus_tag LOCUS_31850 18090 18938 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529615.1 protein_id gnl|my_center|LOCUS_31850 19393 18941 gene locus_tag LOCUS_31860 19393 18941 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529616.1 protein_id gnl|my_center|LOCUS_31860 19812 19552 gene locus_tag LOCUS_31870 19812 19552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 20091 20489 gene locus_tag LOCUS_31880 20091 20489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31880 20473 20637 gene locus_tag LOCUS_31890 20473 20637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31890 21419 20727 gene locus_tag LOCUS_31900 21419 20727 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529648.1 protein_id gnl|my_center|LOCUS_31900 24148 21416 gene locus_tag LOCUS_31910 24148 21416 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529647.1 protein_id gnl|my_center|LOCUS_31910 24789 24220 gene locus_tag LOCUS_31920 gene kdpC 24789 24220 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529646.1 protein_id gnl|my_center|LOCUS_31920 25721 24801 gene locus_tag LOCUS_31930 25721 24801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31930 26911 25673 gene locus_tag LOCUS_31940 26911 25673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31940 25725 25734 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27123 26908 gene locus_tag LOCUS_31950 27123 26908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529644.1 protein_id gnl|my_center|LOCUS_31950 28849 27146 gene locus_tag LOCUS_31960 gene kdpA 28849 27146 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529643.1 protein_id gnl|my_center|LOCUS_31960 29398 31188 gene locus_tag LOCUS_31970 29398 31188 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528754.1 protein_id gnl|my_center|LOCUS_31970 <31921 31344 gene locus_tag LOCUS_31980 <31921 31344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528753.1:amidohydrolase/deacetylase family metallohydrolase >Feature sequence058 270 1367 gene locus_tag LOCUS_31990 270 1367 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532575.1 protein_id gnl|my_center|LOCUS_31990 1373 2836 gene locus_tag LOCUS_32000 1373 2836 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532574.1 protein_id gnl|my_center|LOCUS_32000 2960 3232 gene locus_tag LOCUS_32010 2960 3232 CDS product DUF3303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532573.1 protein_id gnl|my_center|LOCUS_32010 3332 3970 gene locus_tag LOCUS_32020 3332 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 4914 3976 gene locus_tag LOCUS_32030 4914 3976 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532572.1 protein_id gnl|my_center|LOCUS_32030 4981 5916 gene locus_tag LOCUS_32040 4981 5916 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532571.1 protein_id gnl|my_center|LOCUS_32040 8065 5927 gene locus_tag LOCUS_32050 8065 5927 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532570.1 protein_id gnl|my_center|LOCUS_32050 8828 8220 gene locus_tag LOCUS_32060 8828 8220 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967222.1 protein_id gnl|my_center|LOCUS_32060 10009 8966 gene locus_tag LOCUS_32070 10009 8966 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705178.1 protein_id gnl|my_center|LOCUS_32070 10850 10020 gene locus_tag LOCUS_32080 10850 10020 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_32080 11614 10976 gene locus_tag LOCUS_32090 11614 10976 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532569.1 protein_id gnl|my_center|LOCUS_32090 12474 11614 gene locus_tag LOCUS_32100 12474 11614 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532568.1 protein_id gnl|my_center|LOCUS_32100 12559 13890 gene locus_tag LOCUS_32110 12559 13890 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145923747.1 protein_id gnl|my_center|LOCUS_32110 13972 14553 gene locus_tag LOCUS_32120 13972 14553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 15456 14566 gene locus_tag LOCUS_32130 15456 14566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171775.1 protein_id gnl|my_center|LOCUS_32130 15745 15467 gene locus_tag LOCUS_32140 15745 15467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008874920.1 protein_id gnl|my_center|LOCUS_32140 16450 16073 gene locus_tag LOCUS_32150 16450 16073 CDS product TIGR02301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532565.1 protein_id gnl|my_center|LOCUS_32150 16952 16524 gene locus_tag LOCUS_32160 16952 16524 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532564.1 protein_id gnl|my_center|LOCUS_32160 17068 17832 gene locus_tag LOCUS_32170 17068 17832 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532563.1 protein_id gnl|my_center|LOCUS_32170 18067 17912 gene locus_tag LOCUS_32180 18067 17912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532562.1 protein_id gnl|my_center|LOCUS_32180 18459 19892 gene locus_tag LOCUS_32190 gene cysS 18459 19892 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532561.1 protein_id gnl|my_center|LOCUS_32190 20071 20478 gene locus_tag LOCUS_32200 20071 20478 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971377.1 protein_id gnl|my_center|LOCUS_32200 20475 20861 gene locus_tag LOCUS_32210 20475 20861 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532560.1 protein_id gnl|my_center|LOCUS_32210 20868 21359 gene locus_tag LOCUS_32220 20868 21359 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532559.1 protein_id gnl|my_center|LOCUS_32220 21356 21832 gene locus_tag LOCUS_32230 21356 21832 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532558.1 protein_id gnl|my_center|LOCUS_32230 21829 22797 gene locus_tag LOCUS_32240 gene pip 21829 22797 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532557.1 protein_id gnl|my_center|LOCUS_32240 22985 24601 gene locus_tag LOCUS_32250 gene cimA 22985 24601 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564965.1 protein_id gnl|my_center|LOCUS_32250 24606 25133 gene locus_tag LOCUS_32260 24606 25133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 25255 26175 gene locus_tag LOCUS_32270 gene rarD 25255 26175 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532555.1 protein_id gnl|my_center|LOCUS_32270 26242 26928 gene locus_tag LOCUS_32280 26242 26928 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532554.1 protein_id gnl|my_center|LOCUS_32280 27532 26900 gene locus_tag LOCUS_32290 27532 26900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 28639 27641 gene locus_tag LOCUS_32300 28639 27641 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173629.1 protein_id gnl|my_center|LOCUS_32300 28979 29203 gene locus_tag LOCUS_32310 28979 29203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 29278 30138 gene locus_tag LOCUS_32320 29278 30138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 30837 30226 gene locus_tag LOCUS_32330 30837 30226 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532550.1 protein_id gnl|my_center|LOCUS_32330 >Feature sequence059 2268 961 gene locus_tag LOCUS_32340 gene ftsA 2268 961 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530962.1 protein_id gnl|my_center|LOCUS_32340 3194 2265 gene locus_tag LOCUS_32350 3194 2265 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530961.1 protein_id gnl|my_center|LOCUS_32350 4117 3191 gene locus_tag LOCUS_32360 4117 3191 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530960.1 protein_id gnl|my_center|LOCUS_32360 5450 4485 gene locus_tag LOCUS_32370 gene murB 5450 4485 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530959.1 protein_id gnl|my_center|LOCUS_32370 6853 5447 gene locus_tag LOCUS_32380 gene murC 6853 5447 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530958.1 protein_id gnl|my_center|LOCUS_32380 7977 6850 gene locus_tag LOCUS_32390 gene murG 7977 6850 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530957.1 protein_id gnl|my_center|LOCUS_32390 9130 7979 gene locus_tag LOCUS_32400 gene ftsW 9130 7979 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530956.1 protein_id gnl|my_center|LOCUS_32400 10530 9130 gene locus_tag LOCUS_32410 gene murD 10530 9130 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530955.1 protein_id gnl|my_center|LOCUS_32410 11621 10539 gene locus_tag LOCUS_32420 gene mraY 11621 10539 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530954.1 protein_id gnl|my_center|LOCUS_32420 13081 11648 gene locus_tag LOCUS_32430 13081 11648 CDS product UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-diaminopimelate--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530953.1 protein_id gnl|my_center|LOCUS_32430 14551 13115 gene locus_tag LOCUS_32440 14551 13115 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530952.1 protein_id gnl|my_center|LOCUS_32440 14083 14092 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16333 14606 gene locus_tag LOCUS_32450 16333 14606 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530951.1 protein_id gnl|my_center|LOCUS_32450 16725 16330 gene locus_tag LOCUS_32460 16725 16330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530950.1 protein_id gnl|my_center|LOCUS_32460 17746 16730 gene locus_tag LOCUS_32470 gene rsmH 17746 16730 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530949.1 protein_id gnl|my_center|LOCUS_32470 18231 17743 gene locus_tag LOCUS_32480 gene mraZ 18231 17743 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530948.1 protein_id gnl|my_center|LOCUS_32480 18618 19733 gene locus_tag LOCUS_32490 18618 19733 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530947.1 protein_id gnl|my_center|LOCUS_32490 20992 20279 gene locus_tag LOCUS_32500 20992 20279 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530946.1 protein_id gnl|my_center|LOCUS_32500 21945 21178 gene locus_tag LOCUS_32510 21945 21178 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530945.1 protein_id gnl|my_center|LOCUS_32510 22661 21942 gene locus_tag LOCUS_32520 22661 21942 CDS product DnaJ family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530944.1 protein_id gnl|my_center|LOCUS_32520 23022 22819 gene locus_tag LOCUS_32530 23022 22819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 23212 26826 gene locus_tag LOCUS_32540 23212 26826 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530942.1 protein_id gnl|my_center|LOCUS_32540 26858 28150 gene locus_tag LOCUS_32550 26858 28150 CDS product DUF3419 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530941.1 protein_id gnl|my_center|LOCUS_32550 28150 28815 gene locus_tag LOCUS_32560 28150 28815 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530940.1 protein_id gnl|my_center|LOCUS_32560 30195 28816 gene locus_tag LOCUS_32570 30195 28816 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530939.1 protein_id gnl|my_center|LOCUS_32570 30509 31303 gene locus_tag LOCUS_32580 30509 31303 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530938.1 protein_id gnl|my_center|LOCUS_32580 >Feature sequence060 2057 546 gene locus_tag LOCUS_32590 gene radA 2057 546 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532526.1 protein_id gnl|my_center|LOCUS_32590 3661 2171 gene locus_tag LOCUS_32600 3661 2171 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532525.1 protein_id gnl|my_center|LOCUS_32600 4849 3881 gene locus_tag LOCUS_32610 4849 3881 CDS product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532524.1 protein_id gnl|my_center|LOCUS_32610 5287 4967 gene locus_tag LOCUS_32620 5287 4967 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532523.1 protein_id gnl|my_center|LOCUS_32620 6668 5379 gene locus_tag LOCUS_32630 6668 5379 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532522.1 protein_id gnl|my_center|LOCUS_32630 7529 6945 gene locus_tag LOCUS_32640 gene rplI 7529 6945 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532521.1 protein_id gnl|my_center|LOCUS_32640 7993 7745 gene locus_tag LOCUS_32650 gene rpsR 7993 7745 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203718.1 protein_id gnl|my_center|LOCUS_32650 8484 7993 gene locus_tag LOCUS_32660 gene rpsF 8484 7993 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532520.1 protein_id gnl|my_center|LOCUS_32660 10712 8787 gene locus_tag LOCUS_32670 10712 8787 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532518.1 protein_id gnl|my_center|LOCUS_32670 10967 11509 gene locus_tag LOCUS_32680 10967 11509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32680 11352 11361 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11398 11940 gene locus_tag LOCUS_32690 11398 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32690 11998 12735 gene locus_tag LOCUS_32700 gene fabG 11998 12735 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532516.1 protein_id gnl|my_center|LOCUS_32700 12948 13184 gene locus_tag LOCUS_32710 12948 13184 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203723.1 protein_id gnl|my_center|LOCUS_32710 13219 14502 gene locus_tag LOCUS_32720 13219 14502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 14187 14196 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14499 15734 gene locus_tag LOCUS_32730 gene mltG 14499 15734 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532514.1 protein_id gnl|my_center|LOCUS_32730 15980 16870 gene locus_tag LOCUS_32740 15980 16870 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532513.1 protein_id gnl|my_center|LOCUS_32740 16876 17550 gene locus_tag LOCUS_32750 gene gmk 16876 17550 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532512.1 protein_id gnl|my_center|LOCUS_32750 17803 18903 gene locus_tag LOCUS_32760 17803 18903 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525053.1 protein_id gnl|my_center|LOCUS_32760 18857 20905 gene locus_tag LOCUS_32770 18857 20905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32770 20734 20743 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21090 22475 gene locus_tag LOCUS_32780 21090 22475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 22472 22846 gene locus_tag LOCUS_32790 22472 22846 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038081.1 protein_id gnl|my_center|LOCUS_32790 23716 22886 gene locus_tag LOCUS_32800 gene rsmA 23716 22886 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532511.1 protein_id gnl|my_center|LOCUS_32800 24770 23742 gene locus_tag LOCUS_32810 gene pdxA 24770 23742 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532510.1 protein_id gnl|my_center|LOCUS_32810 25783 24860 gene locus_tag LOCUS_32820 25783 24860 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504313.1 protein_id gnl|my_center|LOCUS_32820 28395 25969 gene locus_tag LOCUS_32830 28395 25969 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171795.1 protein_id gnl|my_center|LOCUS_32830 29477 28395 gene locus_tag LOCUS_32840 gene lptG 29477 28395 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299091.1 protein_id gnl|my_center|LOCUS_32840 30676 29480 gene locus_tag LOCUS_32850 gene lptF 30676 29480 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532506.1 protein_id gnl|my_center|LOCUS_32850 >Feature sequence061 244 1176 gene locus_tag LOCUS_32860 244 1176 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527946.1 protein_id gnl|my_center|LOCUS_32860 1274 1648 gene locus_tag LOCUS_32870 1274 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527945.1 protein_id gnl|my_center|LOCUS_32870 2594 1653 gene locus_tag LOCUS_32880 2594 1653 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527944.1 protein_id gnl|my_center|LOCUS_32880 4271 2643 gene locus_tag LOCUS_32890 4271 2643 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527943.1 protein_id gnl|my_center|LOCUS_32890 5407 4268 gene locus_tag LOCUS_32900 5407 4268 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527942.1 protein_id gnl|my_center|LOCUS_32900 6504 5407 gene locus_tag LOCUS_32910 6504 5407 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527941.1 protein_id gnl|my_center|LOCUS_32910 8397 6535 gene locus_tag LOCUS_32920 8397 6535 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527940.1 protein_id gnl|my_center|LOCUS_32920 10274 8397 gene locus_tag LOCUS_32930 10274 8397 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527939.1 protein_id gnl|my_center|LOCUS_32930 11066 10431 gene locus_tag LOCUS_32940 11066 10431 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527938.1 protein_id gnl|my_center|LOCUS_32940 11261 11989 gene locus_tag LOCUS_32950 11261 11989 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527937.1 protein_id gnl|my_center|LOCUS_32950 12000 12863 gene locus_tag LOCUS_32960 12000 12863 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527936.1 protein_id gnl|my_center|LOCUS_32960 13716 12874 gene locus_tag LOCUS_32970 13716 12874 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971007.1 protein_id gnl|my_center|LOCUS_32970 13804 14790 gene locus_tag LOCUS_32980 13804 14790 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456725.1 protein_id gnl|my_center|LOCUS_32980 15144 14842 gene locus_tag LOCUS_32990 15144 14842 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527935.1 protein_id gnl|my_center|LOCUS_32990 16107 15166 gene locus_tag LOCUS_33000 gene nudC 16107 15166 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527934.1 protein_id gnl|my_center|LOCUS_33000 16559 16140 gene locus_tag LOCUS_33010 16559 16140 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527933.1 protein_id gnl|my_center|LOCUS_33010 16962 18776 gene locus_tag LOCUS_33020 16962 18776 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527932.1 protein_id gnl|my_center|LOCUS_33020 18853 19176 gene locus_tag LOCUS_33030 18853 19176 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527931.1 protein_id gnl|my_center|LOCUS_33030 19391 20395 gene locus_tag LOCUS_33040 19391 20395 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527929.1 protein_id gnl|my_center|LOCUS_33040 20491 21096 gene locus_tag LOCUS_33050 gene recR 20491 21096 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527928.1 protein_id gnl|my_center|LOCUS_33050 21274 22551 gene locus_tag LOCUS_33060 21274 22551 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527927.1 protein_id gnl|my_center|LOCUS_33060 22811 24448 gene locus_tag LOCUS_33070 22811 24448 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527926.1 protein_id gnl|my_center|LOCUS_33070 24467 25534 gene locus_tag LOCUS_33080 24467 25534 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527925.1 protein_id gnl|my_center|LOCUS_33080 25531 26451 gene locus_tag LOCUS_33090 25531 26451 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527924.1 protein_id gnl|my_center|LOCUS_33090 26448 27302 gene locus_tag LOCUS_33100 26448 27302 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527923.1 protein_id gnl|my_center|LOCUS_33100 27299 28045 gene locus_tag LOCUS_33110 27299 28045 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527922.1 protein_id gnl|my_center|LOCUS_33110 31141 28052 gene locus_tag LOCUS_33120 31141 28052 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527921.1 protein_id gnl|my_center|LOCUS_33120 >Feature sequence062 285 1016 gene locus_tag LOCUS_33130 285 1016 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532980.1 protein_id gnl|my_center|LOCUS_33130 1013 1504 gene locus_tag LOCUS_33140 1013 1504 CDS product DUF3830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532979.1 protein_id gnl|my_center|LOCUS_33140 1497 1850 gene locus_tag LOCUS_33150 1497 1850 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532978.1 protein_id gnl|my_center|LOCUS_33150 1847 2902 gene locus_tag LOCUS_33160 1847 2902 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_33160 2908 3336 gene locus_tag LOCUS_33170 2908 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532976.1 protein_id gnl|my_center|LOCUS_33170 3386 4645 gene locus_tag LOCUS_33180 3386 4645 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532975.1 protein_id gnl|my_center|LOCUS_33180 6061 5024 gene locus_tag LOCUS_33190 6061 5024 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192249737.1 protein_id gnl|my_center|LOCUS_33190 6518 6069 gene locus_tag LOCUS_33200 gene aroQ 6518 6069 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007537427.1 protein_id gnl|my_center|LOCUS_33200 6921 6553 gene locus_tag LOCUS_33210 6921 6553 CDS product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886723.1 protein_id gnl|my_center|LOCUS_33210 7793 6936 gene locus_tag LOCUS_33220 7793 6936 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165918514.1 protein_id gnl|my_center|LOCUS_33220 8573 7812 gene locus_tag LOCUS_33230 8573 7812 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007537433.1 protein_id gnl|my_center|LOCUS_33230 9418 8594 gene locus_tag LOCUS_33240 9418 8594 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441052.1 protein_id gnl|my_center|LOCUS_33240 10109 9459 gene locus_tag LOCUS_33250 10109 9459 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173513672.1 protein_id gnl|my_center|LOCUS_33250 10784 10119 gene locus_tag LOCUS_33260 10784 10119 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244575.1 protein_id gnl|my_center|LOCUS_33260 11652 10831 gene locus_tag LOCUS_33270 11652 10831 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244574.1 protein_id gnl|my_center|LOCUS_33270 12389 11652 gene locus_tag LOCUS_33280 12389 11652 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441056.1 protein_id gnl|my_center|LOCUS_33280 12645 13538 gene locus_tag LOCUS_33290 12645 13538 CDS product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877177.1 protein_id gnl|my_center|LOCUS_33290 13563 14345 gene locus_tag LOCUS_33300 13563 14345 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018237596.1 protein_id gnl|my_center|LOCUS_33300 14354 15148 gene locus_tag LOCUS_33310 gene hpaI 14354 15148 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027999571.1 protein_id gnl|my_center|LOCUS_33310 15132 15815 gene locus_tag LOCUS_33320 15132 15815 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859589.1 protein_id gnl|my_center|LOCUS_33320 16242 16039 gene locus_tag LOCUS_33330 16242 16039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 16821 18554 gene locus_tag LOCUS_33340 16821 18554 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171602985.1 protein_id gnl|my_center|LOCUS_33340 18968 18672 gene locus_tag LOCUS_33350 18968 18672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 20733 19042 gene locus_tag LOCUS_33360 20733 19042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 22294 22076 gene locus_tag LOCUS_33370 22294 22076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 22809 23915 gene locus_tag LOCUS_33380 22809 23915 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066875295.1 protein_id gnl|my_center|LOCUS_33380 23921 24259 gene locus_tag LOCUS_33390 23921 24259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 24256 26367 gene locus_tag LOCUS_33400 24256 26367 CDS product large subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063786.1 protein_id gnl|my_center|LOCUS_33400 26893 26297 gene locus_tag LOCUS_33410 26893 26297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 26804 26998 gene locus_tag LOCUS_33420 26804 26998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 30318 30327 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence063 855 1946 gene locus_tag LOCUS_33430 gene ltrA 855 1946 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975503.1 protein_id gnl|my_center|LOCUS_33430 2153 2665 gene locus_tag LOCUS_33440 2153 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 3619 2735 gene locus_tag LOCUS_33450 gene purU 3619 2735 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243246.1 protein_id gnl|my_center|LOCUS_33450 4393 3827 gene locus_tag LOCUS_33460 4393 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 7316 4386 gene locus_tag LOCUS_33470 7316 4386 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532909.1 protein_id gnl|my_center|LOCUS_33470 7618 7313 gene locus_tag LOCUS_33480 7618 7313 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112308747.1 protein_id gnl|my_center|LOCUS_33480 8882 7629 gene locus_tag LOCUS_33490 8882 7629 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536326.1 protein_id gnl|my_center|LOCUS_33490 8979 9992 gene locus_tag LOCUS_33500 8979 9992 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973658.1 protein_id gnl|my_center|LOCUS_33500 11765 10791 gene locus_tag LOCUS_33510 11765 10791 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530232.1 protein_id gnl|my_center|LOCUS_33510 13239 11893 gene locus_tag LOCUS_33520 13239 11893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 13878 14087 gene locus_tag LOCUS_33530 13878 14087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 14855 16111 gene locus_tag LOCUS_33540 gene gbcA 14855 16111 CDS product glycine-betaine demethylase subunit GbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244552.1 protein_id gnl|my_center|LOCUS_33540 16119 17390 gene locus_tag LOCUS_33550 16119 17390 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392670.1 protein_id gnl|my_center|LOCUS_33550 18832 19770 gene locus_tag LOCUS_33560 18832 19770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 20898 21119 gene locus_tag LOCUS_33570 20898 21119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 21541 21993 gene locus_tag LOCUS_33580 21541 21993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 23115 22897 gene locus_tag LOCUS_33590 23115 22897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33590 23544 25208 gene locus_tag LOCUS_33600 23544 25208 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532880.1 protein_id gnl|my_center|LOCUS_33600 25314 26228 gene locus_tag LOCUS_33610 25314 26228 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095091852.1 protein_id gnl|my_center|LOCUS_33610 26225 27094 gene locus_tag LOCUS_33620 26225 27094 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532882.1 protein_id gnl|my_center|LOCUS_33620 27087 29204 gene locus_tag LOCUS_33630 27087 29204 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532883.1 protein_id gnl|my_center|LOCUS_33630 30435 29929 gene locus_tag LOCUS_33640 30435 29929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 >Feature sequence064 1741 692 gene locus_tag LOCUS_33650 1741 692 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525214.1 protein_id gnl|my_center|LOCUS_33650 3534 1747 gene locus_tag LOCUS_33660 3534 1747 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183463334.1 protein_id gnl|my_center|LOCUS_33660 4114 3527 gene locus_tag LOCUS_33670 4114 3527 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525212.1 protein_id gnl|my_center|LOCUS_33670 4351 5028 gene locus_tag LOCUS_33680 4351 5028 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525211.1 protein_id gnl|my_center|LOCUS_33680 5400 5095 gene locus_tag LOCUS_33690 5400 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530594.1 protein_id gnl|my_center|LOCUS_33690 6645 5614 gene locus_tag LOCUS_33700 6645 5614 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530601.1 protein_id gnl|my_center|LOCUS_33700 6769 7827 gene locus_tag LOCUS_33710 6769 7827 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969874.1 protein_id gnl|my_center|LOCUS_33710 7834 8892 gene locus_tag LOCUS_33720 gene alsB 7834 8892 CDS product D-allose transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046187.1 protein_id gnl|my_center|LOCUS_33720 9034 10020 gene locus_tag LOCUS_33730 9034 10020 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707231.1 protein_id gnl|my_center|LOCUS_33730 10017 10793 gene locus_tag LOCUS_33740 10017 10793 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530724.1 protein_id gnl|my_center|LOCUS_33740 10798 11652 gene locus_tag LOCUS_33750 10798 11652 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969271.1 protein_id gnl|my_center|LOCUS_33750 12063 11686 gene locus_tag LOCUS_33760 12063 11686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 13549 12104 gene locus_tag LOCUS_33770 13549 12104 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085473.1 protein_id gnl|my_center|LOCUS_33770 14376 13591 gene locus_tag LOCUS_33780 14376 13591 CDS product coniferyl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401012.1 protein_id gnl|my_center|LOCUS_33780 15440 14379 gene locus_tag LOCUS_33790 15440 14379 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533092.1 protein_id gnl|my_center|LOCUS_33790 16333 15437 gene locus_tag LOCUS_33800 16333 15437 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533093.1 protein_id gnl|my_center|LOCUS_33800 16713 16330 gene locus_tag LOCUS_33810 16713 16330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33810 16688 17071 gene locus_tag LOCUS_33820 16688 17071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 17787 17047 gene locus_tag LOCUS_33830 17787 17047 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089146.1 protein_id gnl|my_center|LOCUS_33830 19129 17813 gene locus_tag LOCUS_33840 19129 17813 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110400007.1 protein_id gnl|my_center|LOCUS_33840 20230 19313 gene locus_tag LOCUS_33850 gene pcaQ 20230 19313 CDS product pca operon transcription factor PcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532965.1 protein_id gnl|my_center|LOCUS_33850 20323 21132 gene locus_tag LOCUS_33860 gene pcaD 20323 21132 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532964.1 protein_id gnl|my_center|LOCUS_33860 21125 21529 gene locus_tag LOCUS_33870 gene pcaC 21125 21529 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532963.1 protein_id gnl|my_center|LOCUS_33870 21522 22274 gene locus_tag LOCUS_33880 gene pcaH 21522 22274 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532962.1 protein_id gnl|my_center|LOCUS_33880 22274 22888 gene locus_tag LOCUS_33890 gene pcaG 22274 22888 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532961.1 protein_id gnl|my_center|LOCUS_33890 22900 23952 gene locus_tag LOCUS_33900 22900 23952 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532960.1 protein_id gnl|my_center|LOCUS_33900 23952 25124 gene locus_tag LOCUS_33910 gene pobA 23952 25124 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532959.1 protein_id gnl|my_center|LOCUS_33910 26362 25103 gene locus_tag LOCUS_33920 26362 25103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 25483 25492 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27166 26363 gene locus_tag LOCUS_33930 27166 26363 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528953.1 protein_id gnl|my_center|LOCUS_33930 28020 27163 gene locus_tag LOCUS_33940 28020 27163 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528952.1 protein_id gnl|my_center|LOCUS_33940 28112 28894 gene locus_tag LOCUS_33950 28112 28894 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528951.1 protein_id gnl|my_center|LOCUS_33950 29077 29802 gene locus_tag LOCUS_33960 29077 29802 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530802.1 protein_id gnl|my_center|LOCUS_33960 >Feature sequence065 479 1816 gene locus_tag LOCUS_33970 479 1816 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533171.1 protein_id gnl|my_center|LOCUS_33970 2284 1862 gene locus_tag LOCUS_33980 2284 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33980 3308 2418 gene locus_tag LOCUS_33990 3308 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33990 2476 2485 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6526 3677 gene locus_tag LOCUS_34000 gene tssH 6526 3677 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525311.1 protein_id gnl|my_center|LOCUS_34000 5145 5154 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6861 8036 gene locus_tag LOCUS_34010 gene tssA 6861 8036 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525310.1 protein_id gnl|my_center|LOCUS_34010 8043 8582 gene locus_tag LOCUS_34020 gene tssB 8043 8582 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525309.1 protein_id gnl|my_center|LOCUS_34020 8586 10094 gene locus_tag LOCUS_34030 gene tssC 8586 10094 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504477.1 protein_id gnl|my_center|LOCUS_34030 10143 10598 gene locus_tag LOCUS_34040 10143 10598 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525307.1 protein_id gnl|my_center|LOCUS_34040 10585 11340 gene locus_tag LOCUS_34050 gene tssE 10585 11340 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525306.1 protein_id gnl|my_center|LOCUS_34050 11342 13216 gene locus_tag LOCUS_34060 gene tssF 11342 13216 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525305.1 protein_id gnl|my_center|LOCUS_34060 13180 14247 gene locus_tag LOCUS_34070 gene tssG 13180 14247 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525304.1 protein_id gnl|my_center|LOCUS_34070 14244 15629 gene locus_tag LOCUS_34080 gene tagH 14244 15629 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525303.1 protein_id gnl|my_center|LOCUS_34080 15633 16085 gene locus_tag LOCUS_34090 gene tssJ 15633 16085 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525302.1 protein_id gnl|my_center|LOCUS_34090 16135 17469 gene locus_tag LOCUS_34100 gene tssK 16135 17469 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525301.1 protein_id gnl|my_center|LOCUS_34100 17474 18805 gene locus_tag LOCUS_34110 gene icmH 17474 18805 CDS product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525300.1 protein_id gnl|my_center|LOCUS_34110 18807 22343 gene locus_tag LOCUS_34120 gene tssM 18807 22343 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525299.1 protein_id gnl|my_center|LOCUS_34120 22325 22867 gene locus_tag LOCUS_34130 gene tagF 22325 22867 CDS product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107648622.1 protein_id gnl|my_center|LOCUS_34130 22867 23964 gene locus_tag LOCUS_34140 22867 23964 CDS product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123798.1 protein_id gnl|my_center|LOCUS_34140 23961 24980 gene locus_tag LOCUS_34150 23961 24980 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115088.1 protein_id gnl|my_center|LOCUS_34150 24980 25951 gene locus_tag LOCUS_34160 24980 25951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 25961 26872 gene locus_tag LOCUS_34170 25961 26872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 27214 26873 gene locus_tag LOCUS_34180 27214 26873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 27636 27214 gene locus_tag LOCUS_34190 27636 27214 CDS product DUF6484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525291.1 protein_id gnl|my_center|LOCUS_34190 29977 27650 gene locus_tag LOCUS_34200 gene tssI 29977 27650 CDS product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525290.1 protein_id gnl|my_center|LOCUS_34200 >Feature sequence066 2314 62 gene locus_tag LOCUS_34210 gene parC 2314 62 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532278.1 protein_id gnl|my_center|LOCUS_34210 2707 3897 gene locus_tag LOCUS_34220 2707 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532279.1 protein_id gnl|my_center|LOCUS_34220 3958 3967 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5942 4149 gene locus_tag LOCUS_34230 gene aspS 5942 4149 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027038352.1 protein_id gnl|my_center|LOCUS_34230 7124 6366 gene locus_tag LOCUS_34240 7124 6366 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577770.1 protein_id gnl|my_center|LOCUS_34240 7245 8465 gene locus_tag LOCUS_34250 7245 8465 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104266.1 protein_id gnl|my_center|LOCUS_34250 8386 8395 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9523 8528 gene locus_tag LOCUS_34260 9523 8528 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_34260 9655 10116 gene locus_tag LOCUS_34270 9655 10116 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329579.1 protein_id gnl|my_center|LOCUS_34270 10304 11548 gene locus_tag LOCUS_34280 10304 11548 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532282.1 protein_id gnl|my_center|LOCUS_34280 11622 12773 gene locus_tag LOCUS_34290 gene rnd 11622 12773 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532283.1 protein_id gnl|my_center|LOCUS_34290 13385 12966 gene locus_tag LOCUS_34300 13385 12966 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532284.1 protein_id gnl|my_center|LOCUS_34300 13876 13382 gene locus_tag LOCUS_34310 13876 13382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532285.1 protein_id gnl|my_center|LOCUS_34310 15503 14001 gene locus_tag LOCUS_34320 gene guaB 15503 14001 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532286.1 protein_id gnl|my_center|LOCUS_34320 15560 15859 gene locus_tag LOCUS_34330 15560 15859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 16017 17438 gene locus_tag LOCUS_34340 16017 17438 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532287.1 protein_id gnl|my_center|LOCUS_34340 18290 17598 gene locus_tag LOCUS_34350 18290 17598 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532288.1 protein_id gnl|my_center|LOCUS_34350 19318 18290 gene locus_tag LOCUS_34360 19318 18290 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532289.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34360 19334 19343 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19858 20790 gene locus_tag LOCUS_34370 19858 20790 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532290.1 protein_id gnl|my_center|LOCUS_34370 20938 21011 gene locus_tag LOCUS_t00220 20938 21011 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 21057 21560 gene locus_tag LOCUS_34380 21057 21560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 21239 21248 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21753 21550 gene locus_tag LOCUS_34390 21753 21550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 22173 21862 gene locus_tag LOCUS_34400 22173 21862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 25098 22729 gene locus_tag LOCUS_34410 25098 22729 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725056.1 protein_id gnl|my_center|LOCUS_34410 26316 25111 gene locus_tag LOCUS_34420 26316 25111 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_34420 26432 26893 gene locus_tag LOCUS_34430 26432 26893 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265920.1 protein_id gnl|my_center|LOCUS_34430 26926 27537 gene locus_tag LOCUS_34440 26926 27537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 29448 27619 gene locus_tag LOCUS_34450 29448 27619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 30123 29596 gene locus_tag LOCUS_34460 30123 29596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 >Feature sequence067 <1 1451 gene locus_tag LOCUS_34470 <1 1451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256716.1:ATP-dependent RecD-like DNA helicase 1945 2703 gene locus_tag LOCUS_34480 1945 2703 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531909.1 protein_id gnl|my_center|LOCUS_34480 4763 2655 gene locus_tag LOCUS_34490 gene recG 4763 2655 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531908.1 protein_id gnl|my_center|LOCUS_34490 4775 5143 gene locus_tag LOCUS_34500 4775 5143 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531907.1 protein_id gnl|my_center|LOCUS_34500 5157 6818 gene locus_tag LOCUS_34510 5157 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34510 6758 6767 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6836 8590 gene locus_tag LOCUS_34520 6836 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34520 8912 10297 gene locus_tag LOCUS_34530 8912 10297 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531905.1 protein_id gnl|my_center|LOCUS_34530 10400 11182 gene locus_tag LOCUS_34540 10400 11182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530791.1 protein_id gnl|my_center|LOCUS_34540 11887 11195 gene locus_tag LOCUS_34550 11887 11195 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531904.1 protein_id gnl|my_center|LOCUS_34550 12302 11919 gene locus_tag LOCUS_34560 12302 11919 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531903.1 protein_id gnl|my_center|LOCUS_34560 13474 12404 gene locus_tag LOCUS_34570 13474 12404 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531902.1 protein_id gnl|my_center|LOCUS_34570 13795 14223 gene locus_tag LOCUS_34580 13795 14223 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531901.1 protein_id gnl|my_center|LOCUS_34580 14334 14693 gene locus_tag LOCUS_34590 14334 14693 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531900.1 protein_id gnl|my_center|LOCUS_34590 14734 15333 gene locus_tag LOCUS_34600 14734 15333 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531899.1 protein_id gnl|my_center|LOCUS_34600 15948 15337 gene locus_tag LOCUS_34610 15948 15337 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531898.1 protein_id gnl|my_center|LOCUS_34610 16508 15948 gene locus_tag LOCUS_34620 16508 15948 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531897.1 protein_id gnl|my_center|LOCUS_34620 16598 17311 gene locus_tag LOCUS_34630 16598 17311 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531896.1 protein_id gnl|my_center|LOCUS_34630 17439 19115 gene locus_tag LOCUS_34640 17439 19115 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531895.1 protein_id gnl|my_center|LOCUS_34640 19960 19688 gene locus_tag LOCUS_34650 19960 19688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 20257 21363 gene locus_tag LOCUS_34660 20257 21363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34660 20278 20287 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21745 21434 gene locus_tag LOCUS_34670 21745 21434 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532019.1 protein_id gnl|my_center|LOCUS_34670 22249 21851 gene locus_tag LOCUS_34680 22249 21851 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532018.1 protein_id gnl|my_center|LOCUS_34680 23049 22549 gene locus_tag LOCUS_34690 gene gpt 23049 22549 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532017.1 protein_id gnl|my_center|LOCUS_34690 24032 23199 gene locus_tag LOCUS_34700 24032 23199 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532016.1 protein_id gnl|my_center|LOCUS_34700 24857 24114 gene locus_tag LOCUS_34710 24857 24114 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532015.1 protein_id gnl|my_center|LOCUS_34710 24994 25650 gene locus_tag LOCUS_34720 24994 25650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34720 25647 25961 gene locus_tag LOCUS_34730 25647 25961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34730 26655 26416 gene locus_tag LOCUS_34740 26655 26416 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532013.1 protein_id gnl|my_center|LOCUS_34740 26965 26687 gene locus_tag LOCUS_34750 26965 26687 CDS product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532012.1 protein_id gnl|my_center|LOCUS_34750 27204 27761 gene locus_tag LOCUS_34760 27204 27761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929871.1 protein_id gnl|my_center|LOCUS_34760 27906 28277 gene locus_tag LOCUS_34770 27906 28277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34770 28274 28483 gene locus_tag LOCUS_34780 28274 28483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34780 28577 28662 gene locus_tag LOCUS_t00230 28577 28662 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28941 29837 gene locus_tag LOCUS_34790 28941 29837 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525230.1 protein_id gnl|my_center|LOCUS_34790 >Feature sequence068 1139 393 gene locus_tag LOCUS_34800 1139 393 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528582.1 protein_id gnl|my_center|LOCUS_34800 2092 1415 gene locus_tag LOCUS_34810 gene rpe 2092 1415 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528583.1 protein_id gnl|my_center|LOCUS_34810 4257 2299 gene locus_tag LOCUS_34820 4257 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 8150 4386 gene locus_tag LOCUS_34830 8150 4386 CDS product DUF11 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528584.1 protein_id gnl|my_center|LOCUS_34830 10096 8162 gene locus_tag LOCUS_34840 10096 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032808071.1 protein_id gnl|my_center|LOCUS_34840 11447 10506 gene locus_tag LOCUS_34850 11447 10506 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528299.1 protein_id gnl|my_center|LOCUS_34850 12447 11665 gene locus_tag LOCUS_34860 12447 11665 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528298.1 protein_id gnl|my_center|LOCUS_34860 14524 12440 gene locus_tag LOCUS_34870 14524 12440 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528297.1 protein_id gnl|my_center|LOCUS_34870 15746 14583 gene locus_tag LOCUS_34880 15746 14583 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528296.1 protein_id gnl|my_center|LOCUS_34880 16863 15751 gene locus_tag LOCUS_34890 16863 15751 CDS product carnitine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528295.1 protein_id gnl|my_center|LOCUS_34890 17489 16860 gene locus_tag LOCUS_34900 17489 16860 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528294.1 protein_id gnl|my_center|LOCUS_34900 18421 17504 gene locus_tag LOCUS_34910 18421 17504 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528293.1 protein_id gnl|my_center|LOCUS_34910 18498 19478 gene locus_tag LOCUS_34920 18498 19478 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528292.1 protein_id gnl|my_center|LOCUS_34920 19689 19480 gene locus_tag LOCUS_34930 19689 19480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528291.1 protein_id gnl|my_center|LOCUS_34930 21201 19876 gene locus_tag LOCUS_34940 gene xylA 21201 19876 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528289.1 protein_id gnl|my_center|LOCUS_34940 21316 21678 gene locus_tag LOCUS_34950 21316 21678 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528288.1 protein_id gnl|my_center|LOCUS_34950 23330 21876 gene locus_tag LOCUS_34960 gene xylB 23330 21876 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528287.1 protein_id gnl|my_center|LOCUS_34960 24738 23413 gene locus_tag LOCUS_34970 24738 23413 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 protein_id gnl|my_center|LOCUS_34970 25468 24845 gene locus_tag LOCUS_34980 25468 24845 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528284.1 protein_id gnl|my_center|LOCUS_34980 25690 26460 gene locus_tag LOCUS_34990 25690 26460 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528282.1 protein_id gnl|my_center|LOCUS_34990 26582 27748 gene locus_tag LOCUS_35000 26582 27748 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528281.1 protein_id gnl|my_center|LOCUS_35000 27748 28134 gene locus_tag LOCUS_35010 27748 28134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 28131 28376 gene locus_tag LOCUS_35020 28131 28376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 28501 29112 gene locus_tag LOCUS_35030 28501 29112 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528278.1 protein_id gnl|my_center|LOCUS_35030 >Feature sequence069 987 445 gene locus_tag LOCUS_35040 987 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35040 487 496 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1041 1340 gene locus_tag LOCUS_35050 1041 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35050 2753 1476 gene locus_tag LOCUS_35060 2753 1476 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532170.1 protein_id gnl|my_center|LOCUS_35060 3362 2895 gene locus_tag LOCUS_35070 3362 2895 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532169.1 protein_id gnl|my_center|LOCUS_35070 3459 6845 gene locus_tag LOCUS_35080 3459 6845 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532168.1 protein_id gnl|my_center|LOCUS_35080 8108 6855 gene locus_tag LOCUS_35090 gene tyrS 8108 6855 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532167.1 protein_id gnl|my_center|LOCUS_35090 8342 9985 gene locus_tag LOCUS_35100 8342 9985 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532166.1 protein_id gnl|my_center|LOCUS_35100 10029 10883 gene locus_tag LOCUS_35110 10029 10883 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532165.1 protein_id gnl|my_center|LOCUS_35110 11564 10890 gene locus_tag LOCUS_35120 11564 10890 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532163.1 protein_id gnl|my_center|LOCUS_35120 11814 12974 gene locus_tag LOCUS_35130 11814 12974 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532162.1 protein_id gnl|my_center|LOCUS_35130 13158 14675 gene locus_tag LOCUS_35140 gene sufB 13158 14675 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532161.1 protein_id gnl|my_center|LOCUS_35140 14907 15662 gene locus_tag LOCUS_35150 gene sufC 14907 15662 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532160.1 protein_id gnl|my_center|LOCUS_35150 15688 16962 gene locus_tag LOCUS_35160 gene sufD 15688 16962 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532159.1 protein_id gnl|my_center|LOCUS_35160 17059 18300 gene locus_tag LOCUS_35170 17059 18300 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532158.1 protein_id gnl|my_center|LOCUS_35170 18297 18698 gene locus_tag LOCUS_35180 18297 18698 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532157.1 protein_id gnl|my_center|LOCUS_35180 18707 19195 gene locus_tag LOCUS_35190 18707 19195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 19292 19678 gene locus_tag LOCUS_35200 gene sufA 19292 19678 CDS product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532156.1 protein_id gnl|my_center|LOCUS_35200 19689 20207 gene locus_tag LOCUS_35210 19689 20207 CDS product DUF2199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222121.1 protein_id gnl|my_center|LOCUS_35210 20712 20215 gene locus_tag LOCUS_35220 20712 20215 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532155.1 protein_id gnl|my_center|LOCUS_35220 20802 21125 gene locus_tag LOCUS_35230 20802 21125 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532154.1 protein_id gnl|my_center|LOCUS_35230 22046 21129 gene locus_tag LOCUS_35240 22046 21129 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532153.1 protein_id gnl|my_center|LOCUS_35240 23070 22087 gene locus_tag LOCUS_35250 23070 22087 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532152.1 protein_id gnl|my_center|LOCUS_35250 23314 23514 gene locus_tag LOCUS_35260 23314 23514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35260 23498 23507 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23619 24449 gene locus_tag LOCUS_35270 23619 24449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35270 24688 27345 gene locus_tag LOCUS_35280 gene alaS 24688 27345 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532150.1 protein_id gnl|my_center|LOCUS_35280 27157 27166 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27396 28190 gene locus_tag LOCUS_35290 27396 28190 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092159.1 protein_id gnl|my_center|LOCUS_35290 29042 28257 gene locus_tag LOCUS_35300 29042 28257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 >Feature sequence070 1479 250 gene locus_tag LOCUS_35310 1479 250 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531491.1 protein_id gnl|my_center|LOCUS_35310 1973 1665 gene locus_tag LOCUS_35320 1973 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 1863 2735 gene locus_tag LOCUS_35330 gene dusB 1863 2735 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531492.1 protein_id gnl|my_center|LOCUS_35330 2732 3874 gene locus_tag LOCUS_35340 2732 3874 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531493.1 protein_id gnl|my_center|LOCUS_35340 3871 5331 gene locus_tag LOCUS_35350 gene ntrC 3871 5331 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531494.1 protein_id gnl|my_center|LOCUS_35350 6267 5377 gene locus_tag LOCUS_35360 6267 5377 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503852.1 protein_id gnl|my_center|LOCUS_35360 6925 6302 gene locus_tag LOCUS_35370 6925 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 7388 9697 gene locus_tag LOCUS_35380 7388 9697 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505196.1 protein_id gnl|my_center|LOCUS_35380 9687 11048 gene locus_tag LOCUS_35390 9687 11048 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531496.1 protein_id gnl|my_center|LOCUS_35390 11148 12011 gene locus_tag LOCUS_35400 11148 12011 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531497.1 protein_id gnl|my_center|LOCUS_35400 12156 12401 gene locus_tag LOCUS_35410 gene hfq 12156 12401 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006202172.1 protein_id gnl|my_center|LOCUS_35410 12402 13787 gene locus_tag LOCUS_35420 gene hflX 12402 13787 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531499.1 protein_id gnl|my_center|LOCUS_35420 14618 13794 gene locus_tag LOCUS_35430 gene mazG 14618 13794 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531500.1 protein_id gnl|my_center|LOCUS_35430 15886 14702 gene locus_tag LOCUS_35440 15886 14702 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531501.1 protein_id gnl|my_center|LOCUS_35440 16083 16601 gene locus_tag LOCUS_35450 16083 16601 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827403.1 protein_id gnl|my_center|LOCUS_35450 16598 17368 gene locus_tag LOCUS_35460 16598 17368 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531511.1 protein_id gnl|my_center|LOCUS_35460 17387 18106 gene locus_tag LOCUS_35470 17387 18106 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531512.1 protein_id gnl|my_center|LOCUS_35470 18275 18562 gene locus_tag LOCUS_35480 18275 18562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35480 18646 19152 gene locus_tag LOCUS_35490 18646 19152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35490 20080 19169 gene locus_tag LOCUS_35500 20080 19169 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531517.1 protein_id gnl|my_center|LOCUS_35500 21033 20827 gene locus_tag LOCUS_35510 21033 20827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 21879 21115 gene locus_tag LOCUS_35520 21879 21115 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705555.1 protein_id gnl|my_center|LOCUS_35520 22729 21911 gene locus_tag LOCUS_35530 22729 21911 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531573.1 protein_id gnl|my_center|LOCUS_35530 23527 22733 gene locus_tag LOCUS_35540 23527 22733 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 protein_id gnl|my_center|LOCUS_35540 25077 23527 gene locus_tag LOCUS_35550 gene metG 25077 23527 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531575.1 protein_id gnl|my_center|LOCUS_35550 26216 25161 gene locus_tag LOCUS_35560 26216 25161 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531576.1 protein_id gnl|my_center|LOCUS_35560 26887 26213 gene locus_tag LOCUS_35570 gene tmk 26887 26213 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173682.1 protein_id gnl|my_center|LOCUS_35570 28108 26951 gene locus_tag LOCUS_35580 28108 26951 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173681.1 protein_id gnl|my_center|LOCUS_35580 >Feature sequence071 4576 5625 gene locus_tag LOCUS_35590 4576 5625 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529717.1 protein_id gnl|my_center|LOCUS_35590 5650 6540 gene locus_tag LOCUS_35600 5650 6540 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577538.1 protein_id gnl|my_center|LOCUS_35600 7296 6544 gene locus_tag LOCUS_35610 7296 6544 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651594.1 protein_id gnl|my_center|LOCUS_35610 7912 7445 gene locus_tag LOCUS_35620 7912 7445 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529716.1 protein_id gnl|my_center|LOCUS_35620 8368 9324 gene locus_tag LOCUS_35630 8368 9324 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529715.1 protein_id gnl|my_center|LOCUS_35630 10177 9404 gene locus_tag LOCUS_35640 gene hisN 10177 9404 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529714.1 protein_id gnl|my_center|LOCUS_35640 11412 10495 gene locus_tag LOCUS_35650 11412 10495 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210328225.1 protein_id gnl|my_center|LOCUS_35650 11636 11962 gene locus_tag LOCUS_35660 11636 11962 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006199474.1 protein_id gnl|my_center|LOCUS_35660 12075 12149 gene locus_tag LOCUS_t00240 12075 12149 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12462 12253 gene locus_tag LOCUS_35670 12462 12253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529712.1 protein_id gnl|my_center|LOCUS_35670 13717 12755 gene locus_tag LOCUS_35680 13717 12755 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388007.1 protein_id gnl|my_center|LOCUS_35680 14799 13714 gene locus_tag LOCUS_35690 gene gmd 14799 13714 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388006.1 protein_id gnl|my_center|LOCUS_35690 16053 14899 gene locus_tag LOCUS_35700 16053 14899 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529707.1 protein_id gnl|my_center|LOCUS_35700 16292 17332 gene locus_tag LOCUS_35710 16292 17332 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529706.1 protein_id gnl|my_center|LOCUS_35710 17329 18345 gene locus_tag LOCUS_35720 17329 18345 CDS product 1,5-anhydro-D-fructose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535887.1 protein_id gnl|my_center|LOCUS_35720 18342 19943 gene locus_tag LOCUS_35730 18342 19943 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173052.1 protein_id gnl|my_center|LOCUS_35730 19936 20712 gene locus_tag LOCUS_35740 19936 20712 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529703.1 protein_id gnl|my_center|LOCUS_35740 20722 21624 gene locus_tag LOCUS_35750 20722 21624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35750 21363 21372 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21533 22252 gene locus_tag LOCUS_35760 21533 22252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35760 22313 23566 gene locus_tag LOCUS_35770 22313 23566 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529701.1 protein_id gnl|my_center|LOCUS_35770 23688 24647 gene locus_tag LOCUS_35780 23688 24647 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529700.1 protein_id gnl|my_center|LOCUS_35780 24644 25588 gene locus_tag LOCUS_35790 24644 25588 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529699.1 protein_id gnl|my_center|LOCUS_35790 25593 26708 gene locus_tag LOCUS_35800 25593 26708 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529698.1 protein_id gnl|my_center|LOCUS_35800 26777 28279 gene locus_tag LOCUS_35810 26777 28279 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529696.1 protein_id gnl|my_center|LOCUS_35810 >Feature sequence072 <1 534 gene locus_tag LOCUS_35820 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528936.1:glucose 1-dehydrogenase 2066 558 gene locus_tag LOCUS_35830 2066 558 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528938.1 protein_id gnl|my_center|LOCUS_35830 2432 2088 gene locus_tag LOCUS_35840 2432 2088 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528939.1 protein_id gnl|my_center|LOCUS_35840 2802 2461 gene locus_tag LOCUS_35850 2802 2461 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528940.1 protein_id gnl|my_center|LOCUS_35850 3167 2817 gene locus_tag LOCUS_35860 3167 2817 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528941.1 protein_id gnl|my_center|LOCUS_35860 4438 3164 gene locus_tag LOCUS_35870 4438 3164 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528942.1 protein_id gnl|my_center|LOCUS_35870 5373 4453 gene locus_tag LOCUS_35880 5373 4453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528943.1 protein_id gnl|my_center|LOCUS_35880 5391 5400 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6289 5498 gene locus_tag LOCUS_35890 6289 5498 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528944.1 protein_id gnl|my_center|LOCUS_35890 7358 6477 gene locus_tag LOCUS_35900 7358 6477 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530845.1 protein_id gnl|my_center|LOCUS_35900 8370 7366 gene locus_tag LOCUS_35910 8370 7366 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530846.1 protein_id gnl|my_center|LOCUS_35910 9739 8372 gene locus_tag LOCUS_35920 9739 8372 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160700.1 protein_id gnl|my_center|LOCUS_35920 10235 9753 gene locus_tag LOCUS_35930 10235 9753 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530848.1 protein_id gnl|my_center|LOCUS_35930 11144 10350 gene locus_tag LOCUS_35940 11144 10350 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530849.1 protein_id gnl|my_center|LOCUS_35940 11603 11160 gene locus_tag LOCUS_35950 11603 11160 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530850.1 protein_id gnl|my_center|LOCUS_35950 12554 11727 gene locus_tag LOCUS_35960 12554 11727 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530851.1 protein_id gnl|my_center|LOCUS_35960 13714 12716 gene locus_tag LOCUS_35970 13714 12716 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530853.1 protein_id gnl|my_center|LOCUS_35970 14513 13770 gene locus_tag LOCUS_35980 14513 13770 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530854.1 protein_id gnl|my_center|LOCUS_35980 14963 15952 gene locus_tag LOCUS_35990 14963 15952 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530855.1 protein_id gnl|my_center|LOCUS_35990 16213 16911 gene locus_tag LOCUS_36000 16213 16911 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530859.1 protein_id gnl|my_center|LOCUS_36000 17868 16930 gene locus_tag LOCUS_36010 17868 16930 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530857.1 protein_id gnl|my_center|LOCUS_36010 18003 18884 gene locus_tag LOCUS_36020 18003 18884 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530858.1 protein_id gnl|my_center|LOCUS_36020 18987 19763 gene locus_tag LOCUS_36030 18987 19763 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530859.1 protein_id gnl|my_center|LOCUS_36030 20071 19784 gene locus_tag LOCUS_36040 20071 19784 CDS product DUF3175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160693.1 protein_id gnl|my_center|LOCUS_36040 20242 21474 gene locus_tag LOCUS_36050 20242 21474 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530861.1 protein_id gnl|my_center|LOCUS_36050 21623 22651 gene locus_tag LOCUS_36060 21623 22651 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530862.1 protein_id gnl|my_center|LOCUS_36060 22070 22155 gene locus_tag LOCUS_t00250 22070 22155 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 22960 24084 gene locus_tag LOCUS_36070 22960 24084 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530863.1 protein_id gnl|my_center|LOCUS_36070 24165 25700 gene locus_tag LOCUS_36080 24165 25700 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530864.1 protein_id gnl|my_center|LOCUS_36080 25009 25018 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25714 26694 gene locus_tag LOCUS_36090 25714 26694 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530865.1 protein_id gnl|my_center|LOCUS_36090 26691 27677 gene locus_tag LOCUS_36100 26691 27677 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530866.1 protein_id gnl|my_center|LOCUS_36100 >Feature sequence073 437 1540 gene locus_tag LOCUS_36110 gene ychF 437 1540 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529993.1 protein_id gnl|my_center|LOCUS_36110 1707 2681 gene locus_tag LOCUS_36120 gene corA 1707 2681 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529992.1 protein_id gnl|my_center|LOCUS_36120 2797 3267 gene locus_tag LOCUS_36130 2797 3267 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529991.1 protein_id gnl|my_center|LOCUS_36130 3264 3734 gene locus_tag LOCUS_36140 3264 3734 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529990.1 protein_id gnl|my_center|LOCUS_36140 4384 3839 gene locus_tag LOCUS_36150 4384 3839 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529989.1 protein_id gnl|my_center|LOCUS_36150 5335 4481 gene locus_tag LOCUS_36160 5335 4481 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529986.1 protein_id gnl|my_center|LOCUS_36160 6660 5356 gene locus_tag LOCUS_36170 6660 5356 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529985.1 protein_id gnl|my_center|LOCUS_36170 7237 6677 gene locus_tag LOCUS_36180 gene petA 7237 6677 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529984.1 protein_id gnl|my_center|LOCUS_36180 7488 7895 gene locus_tag LOCUS_36190 7488 7895 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529983.1 protein_id gnl|my_center|LOCUS_36190 8251 7937 gene locus_tag LOCUS_36200 8251 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529982.1 protein_id gnl|my_center|LOCUS_36200 10143 8260 gene locus_tag LOCUS_36210 10143 8260 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529980.1 protein_id gnl|my_center|LOCUS_36210 12020 10140 gene locus_tag LOCUS_36220 12020 10140 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529979.1 protein_id gnl|my_center|LOCUS_36220 12924 13382 gene locus_tag LOCUS_36230 12924 13382 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529977.1 protein_id gnl|my_center|LOCUS_36230 13534 13977 gene locus_tag LOCUS_36240 gene soxR 13534 13977 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529976.1 protein_id gnl|my_center|LOCUS_36240 14258 14001 gene locus_tag LOCUS_36250 14258 14001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529975.1 protein_id gnl|my_center|LOCUS_36250 14367 15281 gene locus_tag LOCUS_36260 gene hemF 14367 15281 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529974.1 protein_id gnl|my_center|LOCUS_36260 15528 15788 gene locus_tag LOCUS_36270 15528 15788 CDS product DUF1344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529973.1 protein_id gnl|my_center|LOCUS_36270 16025 16210 gene locus_tag LOCUS_36280 16025 16210 CDS product DUF1059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529972.1 protein_id gnl|my_center|LOCUS_36280 16470 17060 gene locus_tag LOCUS_36290 16470 17060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225996736.1 protein_id gnl|my_center|LOCUS_36290 17075 18124 gene locus_tag LOCUS_36300 17075 18124 CDS product S8/S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234888302.1 protein_id gnl|my_center|LOCUS_36300 19400 18132 gene locus_tag LOCUS_36310 19400 18132 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529971.1 protein_id gnl|my_center|LOCUS_36310 20029 19397 gene locus_tag LOCUS_36320 20029 19397 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529970.1 protein_id gnl|my_center|LOCUS_36320 20664 20029 gene locus_tag LOCUS_36330 20664 20029 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529969.1 protein_id gnl|my_center|LOCUS_36330 20804 21808 gene locus_tag LOCUS_36340 20804 21808 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529968.1 protein_id gnl|my_center|LOCUS_36340 21808 22812 gene locus_tag LOCUS_36350 21808 22812 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529967.1 protein_id gnl|my_center|LOCUS_36350 22809 25628 gene locus_tag LOCUS_36360 22809 25628 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529966.1 protein_id gnl|my_center|LOCUS_36360 >Feature sequence074 693 1370 gene locus_tag LOCUS_36370 693 1370 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530368.1 protein_id gnl|my_center|LOCUS_36370 3644 1449 gene locus_tag LOCUS_36380 gene katG 3644 1449 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530141.1 protein_id gnl|my_center|LOCUS_36380 3785 4693 gene locus_tag LOCUS_36390 gene oxyR 3785 4693 CDS product hydrogen peroxide-inducible genes activator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401206.1 protein_id gnl|my_center|LOCUS_36390 5615 4656 gene locus_tag LOCUS_36400 5615 4656 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459274.1 protein_id gnl|my_center|LOCUS_36400 6737 6096 gene locus_tag LOCUS_36410 6737 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 6751 7890 gene locus_tag LOCUS_36420 6751 7890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36420 8169 10718 gene locus_tag LOCUS_36430 8169 10718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 10784 11629 gene locus_tag LOCUS_36440 10784 11629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 11644 12414 gene locus_tag LOCUS_36450 11644 12414 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_36450 12641 13459 gene locus_tag LOCUS_36460 12641 13459 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018209695.1 protein_id gnl|my_center|LOCUS_36460 13456 15324 gene locus_tag LOCUS_36470 13456 15324 CDS product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397828.1 protein_id gnl|my_center|LOCUS_36470 15337 16383 gene locus_tag LOCUS_36480 15337 16383 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973597.1 protein_id gnl|my_center|LOCUS_36480 17610 16654 gene locus_tag LOCUS_36490 17610 16654 CDS product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530361.1 protein_id gnl|my_center|LOCUS_36490 17597 17728 gene locus_tag LOCUS_36500 17597 17728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 18473 17820 gene locus_tag LOCUS_36510 18473 17820 CDS product poly-gamma-glutamate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244789.1 protein_id gnl|my_center|LOCUS_36510 20250 18484 gene locus_tag LOCUS_36520 20250 18484 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530360.1 protein_id gnl|my_center|LOCUS_36520 20396 20405 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21129 20428 gene locus_tag LOCUS_36530 gene hisG 21129 20428 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530359.1 protein_id gnl|my_center|LOCUS_36530 22265 21126 gene locus_tag LOCUS_36540 22265 21126 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530358.1 protein_id gnl|my_center|LOCUS_36540 21724 21733 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23949 22444 gene locus_tag LOCUS_36550 gene hisS 23949 22444 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530357.1 protein_id gnl|my_center|LOCUS_36550 24148 24396 gene locus_tag LOCUS_36560 24148 24396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530356.1 protein_id gnl|my_center|LOCUS_36560 25108 24470 gene locus_tag LOCUS_36570 25108 24470 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 protein_id gnl|my_center|LOCUS_36570 25334 26062 gene locus_tag LOCUS_36580 25334 26062 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530354.1 protein_id gnl|my_center|LOCUS_36580 26354 27274 gene locus_tag LOCUS_36590 26354 27274 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530353.1 protein_id gnl|my_center|LOCUS_36590 >Feature sequence075 <1 1155 gene locus_tag LOCUS_36600 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222062.1:MFS transporter 2349 1189 gene locus_tag LOCUS_36610 2349 1189 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266227.1 protein_id gnl|my_center|LOCUS_36610 2460 3365 gene locus_tag LOCUS_36620 2460 3365 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527033.1 protein_id gnl|my_center|LOCUS_36620 3456 5534 gene locus_tag LOCUS_36630 3456 5534 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926970.1 protein_id gnl|my_center|LOCUS_36630 5539 7524 gene locus_tag LOCUS_36640 5539 7524 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064681.1 protein_id gnl|my_center|LOCUS_36640 7521 7823 gene locus_tag LOCUS_36650 7521 7823 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028094393.1 protein_id gnl|my_center|LOCUS_36650 7820 9187 gene locus_tag LOCUS_36660 7820 9187 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266228.1 protein_id gnl|my_center|LOCUS_36660 10552 9227 gene locus_tag LOCUS_36670 10552 9227 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970441.1 protein_id gnl|my_center|LOCUS_36670 10776 11252 gene locus_tag LOCUS_36680 10776 11252 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970442.1 protein_id gnl|my_center|LOCUS_36680 12620 11148 gene locus_tag LOCUS_36690 12620 11148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 12994 12641 gene locus_tag LOCUS_36700 12994 12641 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240974.1 protein_id gnl|my_center|LOCUS_36700 13698 13006 gene locus_tag LOCUS_36710 13698 13006 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399913.1 protein_id gnl|my_center|LOCUS_36710 14389 13700 gene locus_tag LOCUS_36720 14389 13700 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240975.1 protein_id gnl|my_center|LOCUS_36720 15200 14472 gene locus_tag LOCUS_36730 15200 14472 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240976.1 protein_id gnl|my_center|LOCUS_36730 16104 15328 gene locus_tag LOCUS_36740 16104 15328 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877446.1 protein_id gnl|my_center|LOCUS_36740 17046 16567 gene locus_tag LOCUS_36750 17046 16567 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877448.1 protein_id gnl|my_center|LOCUS_36750 18780 17125 gene locus_tag LOCUS_36760 18780 17125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967984.1 protein_id gnl|my_center|LOCUS_36760 19622 18777 gene locus_tag LOCUS_36770 19622 18777 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153436039.1 protein_id gnl|my_center|LOCUS_36770 20575 19625 gene locus_tag LOCUS_36780 20575 19625 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967982.1 protein_id gnl|my_center|LOCUS_36780 22274 20664 gene locus_tag LOCUS_36790 22274 20664 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967981.1 protein_id gnl|my_center|LOCUS_36790 23061 22339 gene locus_tag LOCUS_36800 23061 22339 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169993.1 protein_id gnl|my_center|LOCUS_36800 24675 23302 gene locus_tag LOCUS_36810 24675 23302 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967979.1 protein_id gnl|my_center|LOCUS_36810 25135 24686 gene locus_tag LOCUS_36820 25135 24686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36820 25542 25132 gene locus_tag LOCUS_36830 25542 25132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36830 25199 25208 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25856 26524 gene locus_tag LOCUS_36840 25856 26524 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243598.1 protein_id gnl|my_center|LOCUS_36840 >Feature sequence076 348 950 gene locus_tag LOCUS_36850 gene rimM 348 950 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528858.1 protein_id gnl|my_center|LOCUS_36850 947 1642 gene locus_tag LOCUS_36860 gene trmD 947 1642 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528859.1 protein_id gnl|my_center|LOCUS_36860 2468 1716 gene locus_tag LOCUS_36870 2468 1716 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528860.1 protein_id gnl|my_center|LOCUS_36870 2782 3318 gene locus_tag LOCUS_36880 2782 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 3489 3923 gene locus_tag LOCUS_36890 3489 3923 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528862.1 protein_id gnl|my_center|LOCUS_36890 3920 4423 gene locus_tag LOCUS_36900 3920 4423 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528863.1 protein_id gnl|my_center|LOCUS_36900 4601 5398 gene locus_tag LOCUS_36910 4601 5398 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528864.1 protein_id gnl|my_center|LOCUS_36910 5659 6474 gene locus_tag LOCUS_36920 5659 6474 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528865.1 protein_id gnl|my_center|LOCUS_36920 6533 7168 gene locus_tag LOCUS_36930 6533 7168 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528866.1 protein_id gnl|my_center|LOCUS_36930 7225 7485 gene locus_tag LOCUS_36940 7225 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 7552 8961 gene locus_tag LOCUS_36950 gene leuC 7552 8961 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528868.1 protein_id gnl|my_center|LOCUS_36950 9135 10331 gene locus_tag LOCUS_36960 9135 10331 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528870.1 protein_id gnl|my_center|LOCUS_36960 10413 11615 gene locus_tag LOCUS_36970 10413 11615 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528871.1 protein_id gnl|my_center|LOCUS_36970 11958 11599 gene locus_tag LOCUS_36980 11958 11599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528872.1 protein_id gnl|my_center|LOCUS_36980 12218 12658 gene locus_tag LOCUS_36990 12218 12658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528873.1 protein_id gnl|my_center|LOCUS_36990 12983 13315 gene locus_tag LOCUS_37000 gene sdhC 12983 13315 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528874.1 protein_id gnl|my_center|LOCUS_37000 13318 13713 gene locus_tag LOCUS_37010 gene sdhD 13318 13713 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 protein_id gnl|my_center|LOCUS_37010 13718 15550 gene locus_tag LOCUS_37020 gene sdhA 13718 15550 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528876.1 protein_id gnl|my_center|LOCUS_37020 15553 15987 gene locus_tag LOCUS_37030 15553 15987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129903.1 protein_id gnl|my_center|LOCUS_37030 15987 16766 gene locus_tag LOCUS_37040 15987 16766 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528877.1 protein_id gnl|my_center|LOCUS_37040 17006 17638 gene locus_tag LOCUS_37050 17006 17638 CDS product DUF480 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163303.1 protein_id gnl|my_center|LOCUS_37050 18333 17908 gene locus_tag LOCUS_37060 18333 17908 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528883.1 protein_id gnl|my_center|LOCUS_37060 18749 19105 gene locus_tag LOCUS_37070 18749 19105 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528885.1 protein_id gnl|my_center|LOCUS_37070 20728 19121 gene locus_tag LOCUS_37080 20728 19121 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969248.1 protein_id gnl|my_center|LOCUS_37080 22248 20725 gene locus_tag LOCUS_37090 22248 20725 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973394.1 protein_id gnl|my_center|LOCUS_37090 23083 22241 gene locus_tag LOCUS_37100 23083 22241 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973395.1 protein_id gnl|my_center|LOCUS_37100 24803 22995 gene locus_tag LOCUS_37110 24803 22995 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973396.1 protein_id gnl|my_center|LOCUS_37110 25841 24867 gene locus_tag LOCUS_37120 25841 24867 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255513.1 protein_id gnl|my_center|LOCUS_37120 25754 25763 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence077 1430 2326 gene locus_tag LOCUS_37130 1430 2326 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235611.1 protein_id gnl|my_center|LOCUS_37130 2544 2356 gene locus_tag LOCUS_37140 2544 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501638.1 protein_id gnl|my_center|LOCUS_37140 2900 5275 gene locus_tag LOCUS_37150 2900 5275 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142384.1 protein_id gnl|my_center|LOCUS_37150 5275 5838 gene locus_tag LOCUS_37160 5275 5838 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199702189.1 protein_id gnl|my_center|LOCUS_37160 6017 6493 gene locus_tag LOCUS_37170 6017 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 6545 7081 gene locus_tag LOCUS_37180 6545 7081 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640141.1 protein_id gnl|my_center|LOCUS_37180 7097 7393 gene locus_tag LOCUS_37190 7097 7393 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729587.1 protein_id gnl|my_center|LOCUS_37190 8130 7474 gene locus_tag LOCUS_37200 8130 7474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 9473 8265 gene locus_tag LOCUS_37210 9473 8265 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969494.1 protein_id gnl|my_center|LOCUS_37210 9767 10186 gene locus_tag LOCUS_37220 9767 10186 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530756.1 protein_id gnl|my_center|LOCUS_37220 11104 10211 gene locus_tag LOCUS_37230 gene gcvA 11104 10211 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530746.1 protein_id gnl|my_center|LOCUS_37230 11225 11929 gene locus_tag LOCUS_37240 11225 11929 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530747.1 protein_id gnl|my_center|LOCUS_37240 12896 12003 gene locus_tag LOCUS_37250 12896 12003 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529760.1 protein_id gnl|my_center|LOCUS_37250 13836 12898 gene locus_tag LOCUS_37260 13836 12898 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529761.1 protein_id gnl|my_center|LOCUS_37260 15271 13946 gene locus_tag LOCUS_37270 15271 13946 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529762.1 protein_id gnl|my_center|LOCUS_37270 16401 15310 gene locus_tag LOCUS_37280 gene ugpC 16401 15310 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529763.1 protein_id gnl|my_center|LOCUS_37280 15671 15680 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17443 16832 gene locus_tag LOCUS_37290 17443 16832 CDS product DUF922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530749.1 protein_id gnl|my_center|LOCUS_37290 19053 17521 gene locus_tag LOCUS_37300 19053 17521 CDS product winged helix-turn-helix domain-containing tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967955.1 protein_id gnl|my_center|LOCUS_37300 19360 19118 gene locus_tag LOCUS_37310 19360 19118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 19736 19515 gene locus_tag LOCUS_37320 19736 19515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 19705 19908 gene locus_tag LOCUS_37330 19705 19908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 19978 21423 gene locus_tag LOCUS_37340 19978 21423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 22065 21916 gene locus_tag LOCUS_37350 22065 21916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 22188 22355 gene locus_tag LOCUS_37360 22188 22355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37360 22608 23708 gene locus_tag LOCUS_37370 22608 23708 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532464.1 protein_id gnl|my_center|LOCUS_37370 23705 24160 gene locus_tag LOCUS_37380 23705 24160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 24223 24852 gene locus_tag LOCUS_37390 24223 24852 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142691.1 protein_id gnl|my_center|LOCUS_37390 24983 25225 gene locus_tag LOCUS_37400 24983 25225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969104.1 protein_id gnl|my_center|LOCUS_37400 <25831 25264 gene locus_tag LOCUS_37410 <25831 25264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972812.1:D-tagatose-bisphosphate aldolase, class II, non-catalytic subunit >Feature sequence078 279 288 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1659 1087 gene locus_tag LOCUS_37420 1659 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 1589 1598 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1652 2305 gene locus_tag LOCUS_37430 1652 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37430 2470 3471 gene locus_tag LOCUS_37440 2470 3471 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532293.1 protein_id gnl|my_center|LOCUS_37440 3803 3531 gene locus_tag LOCUS_37450 3803 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525317.1 protein_id gnl|my_center|LOCUS_37450 4042 3800 gene locus_tag LOCUS_37460 4042 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 4231 5586 gene locus_tag LOCUS_37470 4231 5586 CDS product selenium-binding family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977998.1 protein_id gnl|my_center|LOCUS_37470 5583 5954 gene locus_tag LOCUS_37480 5583 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 5951 6409 gene locus_tag LOCUS_37490 5951 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 6591 7481 gene locus_tag LOCUS_37500 6591 7481 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525230.1 protein_id gnl|my_center|LOCUS_37500 8721 7540 gene locus_tag LOCUS_37510 8721 7540 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815690.1 protein_id gnl|my_center|LOCUS_37510 9371 8814 gene locus_tag LOCUS_37520 9371 8814 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943415.1 protein_id gnl|my_center|LOCUS_37520 9630 10952 gene locus_tag LOCUS_37530 9630 10952 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867639.1 protein_id gnl|my_center|LOCUS_37530 11008 12123 gene locus_tag LOCUS_37540 11008 12123 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529097.1 protein_id gnl|my_center|LOCUS_37540 12179 12868 gene locus_tag LOCUS_37550 12179 12868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 12545 12554 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13424 12771 gene locus_tag LOCUS_37560 13424 12771 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505017.1 protein_id gnl|my_center|LOCUS_37560 13800 13809 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13873 14418 gene locus_tag LOCUS_37570 13873 14418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37570 14678 14364 gene locus_tag LOCUS_37580 14678 14364 CDS product cupredoxin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532430.1 protein_id gnl|my_center|LOCUS_37580 15199 14675 gene locus_tag LOCUS_37590 15199 14675 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532429.1 protein_id gnl|my_center|LOCUS_37590 15975 15286 gene locus_tag LOCUS_37600 15975 15286 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532428.1 protein_id gnl|my_center|LOCUS_37600 17150 16071 gene locus_tag LOCUS_37610 17150 16071 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532427.1 protein_id gnl|my_center|LOCUS_37610 18530 17364 gene locus_tag LOCUS_37620 18530 17364 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532426.1 protein_id gnl|my_center|LOCUS_37620 18844 19479 gene locus_tag LOCUS_37630 18844 19479 CDS product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532425.1 protein_id gnl|my_center|LOCUS_37630 19486 20340 gene locus_tag LOCUS_37640 19486 20340 CDS product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532424.1 protein_id gnl|my_center|LOCUS_37640 20778 21806 gene locus_tag LOCUS_37650 20778 21806 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532423.1 protein_id gnl|my_center|LOCUS_37650 21870 23057 gene locus_tag LOCUS_37660 21870 23057 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532422.1 protein_id gnl|my_center|LOCUS_37660 23062 24219 gene locus_tag LOCUS_37670 23062 24219 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532421.1 protein_id gnl|my_center|LOCUS_37670 24295 25098 gene locus_tag LOCUS_37680 24295 25098 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532420.1 protein_id gnl|my_center|LOCUS_37680 25396 25193 gene locus_tag LOCUS_37690 25396 25193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 >Feature sequence079 1019 885 gene locus_tag LOCUS_37700 1019 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 2043 1249 gene locus_tag LOCUS_37710 2043 1249 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528365.1 protein_id gnl|my_center|LOCUS_37710 3067 2075 gene locus_tag LOCUS_37720 gene iolG 3067 2075 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528364.1 protein_id gnl|my_center|LOCUS_37720 3918 3148 gene locus_tag LOCUS_37730 3918 3148 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528363.1 protein_id gnl|my_center|LOCUS_37730 4997 3921 gene locus_tag LOCUS_37740 4997 3921 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528362.1 protein_id gnl|my_center|LOCUS_37740 6054 5113 gene locus_tag LOCUS_37750 6054 5113 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528361.1 protein_id gnl|my_center|LOCUS_37750 7397 6366 gene locus_tag LOCUS_37760 7397 6366 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528360.1 protein_id gnl|my_center|LOCUS_37760 7584 8681 gene locus_tag LOCUS_37770 7584 8681 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528359.1 protein_id gnl|my_center|LOCUS_37770 8725 9039 gene locus_tag LOCUS_37780 8725 9039 CDS product MocE family 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528358.1 protein_id gnl|my_center|LOCUS_37780 9149 9158 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9971 9369 gene locus_tag LOCUS_37790 9971 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 9599 9608 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9907 10281 gene locus_tag LOCUS_37800 9907 10281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37800 9914 9923 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10330 11136 gene locus_tag LOCUS_37810 10330 11136 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393072.1 protein_id gnl|my_center|LOCUS_37810 12068 11157 gene locus_tag LOCUS_37820 12068 11157 CDS product DUF1402 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170435.1 protein_id gnl|my_center|LOCUS_37820 13752 12442 gene locus_tag LOCUS_37830 gene hslU 13752 12442 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528355.1 protein_id gnl|my_center|LOCUS_37830 14356 13757 gene locus_tag LOCUS_37840 14356 13757 CDS product DUF2585 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528354.1 protein_id gnl|my_center|LOCUS_37840 14925 14362 gene locus_tag LOCUS_37850 14925 14362 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528352.1 protein_id gnl|my_center|LOCUS_37850 15488 14937 gene locus_tag LOCUS_37860 gene hslV 15488 14937 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528351.1 protein_id gnl|my_center|LOCUS_37860 15731 16330 gene locus_tag LOCUS_37870 gene hisB 15731 16330 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528350.1 protein_id gnl|my_center|LOCUS_37870 16334 16810 gene locus_tag LOCUS_37880 16334 16810 CDS product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528349.1 protein_id gnl|my_center|LOCUS_37880 16812 17471 gene locus_tag LOCUS_37890 gene hisH 16812 17471 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528348.1 protein_id gnl|my_center|LOCUS_37890 17158 17167 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17472 17762 gene locus_tag LOCUS_37900 17472 17762 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528347.1 protein_id gnl|my_center|LOCUS_37900 17765 18511 gene locus_tag LOCUS_37910 gene hisA 17765 18511 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528346.1 protein_id gnl|my_center|LOCUS_37910 18508 19347 gene locus_tag LOCUS_37920 18508 19347 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528345.1 protein_id gnl|my_center|LOCUS_37920 19347 20138 gene locus_tag LOCUS_37930 gene hisF 19347 20138 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501998.1 protein_id gnl|my_center|LOCUS_37930 20148 20471 gene locus_tag LOCUS_37940 20148 20471 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528343.1 protein_id gnl|my_center|LOCUS_37940 20496 21455 gene locus_tag LOCUS_37950 gene coaA 20496 21455 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528342.1 protein_id gnl|my_center|LOCUS_37950 22591 21506 gene locus_tag LOCUS_37960 22591 21506 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482300.1 protein_id gnl|my_center|LOCUS_37960 23988 22864 gene locus_tag LOCUS_37970 23988 22864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 24832 24212 gene locus_tag LOCUS_37980 24832 24212 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528341.1 protein_id gnl|my_center|LOCUS_37980 >Feature sequence080 912 82 gene locus_tag LOCUS_37990 912 82 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398188.1 protein_id gnl|my_center|LOCUS_37990 1933 917 gene locus_tag LOCUS_38000 1933 917 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529526.1 protein_id gnl|my_center|LOCUS_38000 2969 2004 gene locus_tag LOCUS_38010 2969 2004 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529527.1 protein_id gnl|my_center|LOCUS_38010 4519 2966 gene locus_tag LOCUS_38020 4519 2966 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529528.1 protein_id gnl|my_center|LOCUS_38020 5660 4665 gene locus_tag LOCUS_38030 5660 4665 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529529.1 protein_id gnl|my_center|LOCUS_38030 6973 5975 gene locus_tag LOCUS_38040 6973 5975 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529530.1 protein_id gnl|my_center|LOCUS_38040 8529 7024 gene locus_tag LOCUS_38050 8529 7024 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529531.1 protein_id gnl|my_center|LOCUS_38050 8776 9678 gene locus_tag LOCUS_38060 8776 9678 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529532.1 protein_id gnl|my_center|LOCUS_38060 10118 9765 gene locus_tag LOCUS_38070 10118 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 10378 10821 gene locus_tag LOCUS_38080 10378 10821 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529534.1 protein_id gnl|my_center|LOCUS_38080 10854 11375 gene locus_tag LOCUS_38090 10854 11375 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529535.1 protein_id gnl|my_center|LOCUS_38090 11495 13024 gene locus_tag LOCUS_38100 11495 13024 CDS product copper resistance CopC/CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529536.1 protein_id gnl|my_center|LOCUS_38100 12690 12699 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13222 13782 gene locus_tag LOCUS_38110 13222 13782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 14286 13849 gene locus_tag LOCUS_38120 14286 13849 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968167.1 protein_id gnl|my_center|LOCUS_38120 14477 15901 gene locus_tag LOCUS_38130 gene gndA 14477 15901 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529537.1 protein_id gnl|my_center|LOCUS_38130 17301 16264 gene locus_tag LOCUS_38140 17301 16264 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529538.1 protein_id gnl|my_center|LOCUS_38140 17709 18947 gene locus_tag LOCUS_38150 17709 18947 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529539.1 protein_id gnl|my_center|LOCUS_38150 19049 19942 gene locus_tag LOCUS_38160 19049 19942 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504415.1 protein_id gnl|my_center|LOCUS_38160 19935 20870 gene locus_tag LOCUS_38170 19935 20870 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504414.1 protein_id gnl|my_center|LOCUS_38170 20873 21967 gene locus_tag LOCUS_38180 gene ugpC 20873 21967 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529542.1 protein_id gnl|my_center|LOCUS_38180 22015 22761 gene locus_tag LOCUS_38190 22015 22761 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529543.1 protein_id gnl|my_center|LOCUS_38190 22773 23915 gene locus_tag LOCUS_38200 22773 23915 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529544.1 protein_id gnl|my_center|LOCUS_38200 24050 25096 gene locus_tag LOCUS_38210 gene mgrA 24050 25096 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529545.1 protein_id gnl|my_center|LOCUS_38210 >Feature sequence081 959 120 gene locus_tag LOCUS_38220 959 120 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528253.1 protein_id gnl|my_center|LOCUS_38220 2679 1024 gene locus_tag LOCUS_38230 2679 1024 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528251.1 protein_id gnl|my_center|LOCUS_38230 3503 2679 gene locus_tag LOCUS_38240 3503 2679 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528250.1 protein_id gnl|my_center|LOCUS_38240 4473 3514 gene locus_tag LOCUS_38250 4473 3514 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528249.1 protein_id gnl|my_center|LOCUS_38250 6076 4490 gene locus_tag LOCUS_38260 6076 4490 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528248.1 protein_id gnl|my_center|LOCUS_38260 8215 6230 gene locus_tag LOCUS_38270 8215 6230 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528247.1 protein_id gnl|my_center|LOCUS_38270 8880 8287 gene locus_tag LOCUS_38280 8880 8287 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528246.1 protein_id gnl|my_center|LOCUS_38280 9391 8900 gene locus_tag LOCUS_38290 9391 8900 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528245.1 protein_id gnl|my_center|LOCUS_38290 10251 9388 gene locus_tag LOCUS_38300 10251 9388 CDS product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528244.1 protein_id gnl|my_center|LOCUS_38300 11744 10320 gene locus_tag LOCUS_38310 gene puuE 11744 10320 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528243.1 protein_id gnl|my_center|LOCUS_38310 11939 12313 gene locus_tag LOCUS_38320 gene uraH 11939 12313 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528242.1 protein_id gnl|my_center|LOCUS_38320 12317 13798 gene locus_tag LOCUS_38330 gene xdhA 12317 13798 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528241.1 protein_id gnl|my_center|LOCUS_38330 13971 13783 gene locus_tag LOCUS_38340 13971 13783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 14145 14154 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14225 16156 gene locus_tag LOCUS_38350 gene xdhB 14225 16156 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528240.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38350 16153 17121 gene locus_tag LOCUS_38360 gene xdhC 16153 17121 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528239.1 protein_id gnl|my_center|LOCUS_38360 17257 18093 gene locus_tag LOCUS_38370 17257 18093 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268384.1 protein_id gnl|my_center|LOCUS_38370 19358 18090 gene locus_tag LOCUS_38380 19358 18090 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528238.1 protein_id gnl|my_center|LOCUS_38380 20302 19355 gene locus_tag LOCUS_38390 20302 19355 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528237.1 protein_id gnl|my_center|LOCUS_38390 21300 20380 gene locus_tag LOCUS_38400 21300 20380 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528236.1 protein_id gnl|my_center|LOCUS_38400 21497 22714 gene locus_tag LOCUS_38410 21497 22714 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528235.1 protein_id gnl|my_center|LOCUS_38410 22716 24029 gene locus_tag LOCUS_38420 gene guaD 22716 24029 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528234.1 protein_id gnl|my_center|LOCUS_38420 24095 24598 gene locus_tag LOCUS_38430 24095 24598 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528233.1 protein_id gnl|my_center|LOCUS_38430 >Feature sequence082 <1 790 gene locus_tag LOCUS_38440 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528112.1:glycosyltransferase 872 1309 gene locus_tag LOCUS_38450 872 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528111.1 protein_id gnl|my_center|LOCUS_38450 1539 2330 gene locus_tag LOCUS_38460 1539 2330 CDS product family 16 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528110.1 protein_id gnl|my_center|LOCUS_38460 2479 2691 gene locus_tag LOCUS_38470 2479 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38470 2671 2680 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2688 3779 gene locus_tag LOCUS_38480 2688 3779 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528109.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38480 3812 4891 gene locus_tag LOCUS_38490 3812 4891 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528106.1 protein_id gnl|my_center|LOCUS_38490 5031 6113 gene locus_tag LOCUS_38500 5031 6113 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392042.1 protein_id gnl|my_center|LOCUS_38500 6110 7576 gene locus_tag LOCUS_38510 6110 7576 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982280.1 protein_id gnl|my_center|LOCUS_38510 7628 8617 gene locus_tag LOCUS_38520 7628 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 8621 8923 gene locus_tag LOCUS_38530 8621 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 9168 10277 gene locus_tag LOCUS_38540 9168 10277 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528103.1 protein_id gnl|my_center|LOCUS_38540 10293 11276 gene locus_tag LOCUS_38550 10293 11276 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173531.1 protein_id gnl|my_center|LOCUS_38550 11276 12220 gene locus_tag LOCUS_38560 11276 12220 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528101.1 protein_id gnl|my_center|LOCUS_38560 12210 13172 gene locus_tag LOCUS_38570 12210 13172 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528100.1 protein_id gnl|my_center|LOCUS_38570 13233 14129 gene locus_tag LOCUS_38580 13233 14129 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528099.1 protein_id gnl|my_center|LOCUS_38580 14297 16681 gene locus_tag LOCUS_38590 14297 16681 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528098.1 protein_id gnl|my_center|LOCUS_38590 17867 16773 gene locus_tag LOCUS_38600 17867 16773 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082510.1 protein_id gnl|my_center|LOCUS_38600 17866 18858 gene locus_tag LOCUS_38610 17866 18858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 19589 18882 gene locus_tag LOCUS_38620 19589 18882 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528097.1 protein_id gnl|my_center|LOCUS_38620 19910 19737 gene locus_tag LOCUS_38630 19910 19737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 21828 19921 gene locus_tag LOCUS_38640 21828 19921 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528095.1 protein_id gnl|my_center|LOCUS_38640 21910 22287 gene locus_tag LOCUS_38650 21910 22287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 22827 23114 gene locus_tag LOCUS_38660 22827 23114 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528093.1 protein_id gnl|my_center|LOCUS_38660 23111 23545 gene locus_tag LOCUS_38670 23111 23545 CDS product lasso peptide biosynthesis B2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528092.1 protein_id gnl|my_center|LOCUS_38670 23542 24507 gene locus_tag LOCUS_38680 23542 24507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528091.1 protein_id gnl|my_center|LOCUS_38680 24476 24485 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24696 24535 gene locus_tag LOCUS_38690 24696 24535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 >Feature sequence083 745 248 gene locus_tag LOCUS_38700 745 248 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528772.1 protein_id gnl|my_center|LOCUS_38700 955 1029 gene locus_tag LOCUS_t00260 955 1029 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1465 3108 gene locus_tag LOCUS_38710 1465 3108 CDS product heme peroxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929330.1 protein_id gnl|my_center|LOCUS_38710 3121 3615 gene locus_tag LOCUS_38720 3121 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 6091 3629 gene locus_tag LOCUS_38730 6091 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 6064 7419 gene locus_tag LOCUS_38740 6064 7419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 7905 7567 gene locus_tag LOCUS_38750 7905 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38750 7573 7581 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8097 8969 gene locus_tag LOCUS_38760 gene rocF 8097 8969 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533362.1 protein_id gnl|my_center|LOCUS_38760 8972 10030 gene locus_tag LOCUS_38770 8972 10030 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530320.1 protein_id gnl|my_center|LOCUS_38770 10153 10162 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11215 10214 gene locus_tag LOCUS_38780 11215 10214 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521613.1 protein_id gnl|my_center|LOCUS_38780 12424 11408 gene locus_tag LOCUS_38790 12424 11408 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400585.1 protein_id gnl|my_center|LOCUS_38790 13923 12421 gene locus_tag LOCUS_38800 13923 12421 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400583.1 protein_id gnl|my_center|LOCUS_38800 15042 14071 gene locus_tag LOCUS_38810 15042 14071 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708271.1 protein_id gnl|my_center|LOCUS_38810 16086 15220 gene locus_tag LOCUS_38820 16086 15220 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504770.1 protein_id gnl|my_center|LOCUS_38820 16193 17461 gene locus_tag LOCUS_38830 16193 17461 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530183.1 protein_id gnl|my_center|LOCUS_38830 17620 18480 gene locus_tag LOCUS_38840 17620 18480 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530184.1 protein_id gnl|my_center|LOCUS_38840 18477 19313 gene locus_tag LOCUS_38850 18477 19313 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530185.1 protein_id gnl|my_center|LOCUS_38850 19684 19274 gene locus_tag LOCUS_38860 19684 19274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 19671 19679 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19686 20327 gene locus_tag LOCUS_38870 19686 20327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38870 20540 22573 gene locus_tag LOCUS_38880 20540 22573 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530187.1 protein_id gnl|my_center|LOCUS_38880 23068 22640 gene locus_tag LOCUS_38890 23068 22640 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528746.1 protein_id gnl|my_center|LOCUS_38890 23226 24347 gene locus_tag LOCUS_38900 23226 24347 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528745.1 protein_id gnl|my_center|LOCUS_38900 >Feature sequence084 2102 825 gene locus_tag LOCUS_38910 2102 825 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532712.1 protein_id gnl|my_center|LOCUS_38910 2907 2587 gene locus_tag LOCUS_38920 2907 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 2992 3001 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3063 3473 gene locus_tag LOCUS_38930 3063 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38930 3488 5413 gene locus_tag LOCUS_38940 gene cysN 3488 5413 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503688.1 protein_id gnl|my_center|LOCUS_38940 5424 6212 gene locus_tag LOCUS_38950 gene cysQ 5424 6212 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503689.1 protein_id gnl|my_center|LOCUS_38950 7498 6356 gene locus_tag LOCUS_38960 7498 6356 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532708.1 protein_id gnl|my_center|LOCUS_38960 8725 7802 gene locus_tag LOCUS_38970 8725 7802 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532707.1 protein_id gnl|my_center|LOCUS_38970 9168 8722 gene locus_tag LOCUS_38980 9168 8722 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532706.1 protein_id gnl|my_center|LOCUS_38980 10395 9169 gene locus_tag LOCUS_38990 10395 9169 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532705.1 protein_id gnl|my_center|LOCUS_38990 10607 11641 gene locus_tag LOCUS_39000 10607 11641 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503693.1 protein_id gnl|my_center|LOCUS_39000 11802 12866 gene locus_tag LOCUS_39010 11802 12866 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532703.1 protein_id gnl|my_center|LOCUS_39010 12869 13651 gene locus_tag LOCUS_39020 12869 13651 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027035860.1 protein_id gnl|my_center|LOCUS_39020 13793 16255 gene locus_tag LOCUS_39030 13793 16255 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532701.1 protein_id gnl|my_center|LOCUS_39030 16380 18617 gene locus_tag LOCUS_39040 gene glgB 16380 18617 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532700.1 protein_id gnl|my_center|LOCUS_39040 18653 19918 gene locus_tag LOCUS_39050 gene glgC 18653 19918 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532699.1 protein_id gnl|my_center|LOCUS_39050 19937 20908 gene locus_tag LOCUS_39060 19937 20908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39060 20858 20867 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21003 21365 gene locus_tag LOCUS_39070 21003 21365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39070 21369 22997 gene locus_tag LOCUS_39080 21369 22997 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532697.1 protein_id gnl|my_center|LOCUS_39080 >Feature sequence085 241 1011 gene locus_tag LOCUS_39090 241 1011 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532178.1 protein_id gnl|my_center|LOCUS_39090 1150 1075 gene locus_tag LOCUS_t00270 1150 1075 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1369 1445 gene locus_tag LOCUS_t00280 1369 1445 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1807 1580 gene locus_tag LOCUS_39100 1807 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 3206 2280 gene locus_tag LOCUS_39110 gene rbsK 3206 2280 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532180.1 protein_id gnl|my_center|LOCUS_39110 3663 3211 gene locus_tag LOCUS_39120 3663 3211 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532181.1 protein_id gnl|my_center|LOCUS_39120 4755 3694 gene locus_tag LOCUS_39130 gene ugpC 4755 3694 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532182.1 protein_id gnl|my_center|LOCUS_39130 5030 6694 gene locus_tag LOCUS_39140 5030 6694 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532183.1 protein_id gnl|my_center|LOCUS_39140 6796 7917 gene locus_tag LOCUS_39150 6796 7917 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532184.1 protein_id gnl|my_center|LOCUS_39150 7930 8847 gene locus_tag LOCUS_39160 7930 8847 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532185.1 protein_id gnl|my_center|LOCUS_39160 9749 9006 gene locus_tag LOCUS_39170 9749 9006 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532186.1 protein_id gnl|my_center|LOCUS_39170 10320 9754 gene locus_tag LOCUS_39180 10320 9754 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532187.1 protein_id gnl|my_center|LOCUS_39180 10509 11531 gene locus_tag LOCUS_39190 10509 11531 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532188.1 protein_id gnl|my_center|LOCUS_39190 11786 11604 gene locus_tag LOCUS_39200 11786 11604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39200 11850 11859 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14491 12080 gene locus_tag LOCUS_39210 gene lon 14491 12080 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532189.1 protein_id gnl|my_center|LOCUS_39210 16039 14765 gene locus_tag LOCUS_39220 gene clpX 16039 14765 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532190.1 protein_id gnl|my_center|LOCUS_39220 16963 16334 gene locus_tag LOCUS_39230 gene clpP 16963 16334 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532191.1 protein_id gnl|my_center|LOCUS_39230 17297 17890 gene locus_tag LOCUS_39240 17297 17890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532192.1 protein_id gnl|my_center|LOCUS_39240 18990 17887 gene locus_tag LOCUS_39250 18990 17887 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532194.1 protein_id gnl|my_center|LOCUS_39250 19096 20349 gene locus_tag LOCUS_39260 19096 20349 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532195.1 protein_id gnl|my_center|LOCUS_39260 20375 21082 gene locus_tag LOCUS_39270 gene ehuB 20375 21082 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530327.1 protein_id gnl|my_center|LOCUS_39270 21449 21099 gene locus_tag LOCUS_39280 21449 21099 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532197.1 protein_id gnl|my_center|LOCUS_39280 22729 21449 gene locus_tag LOCUS_39290 22729 21449 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532198.1 protein_id gnl|my_center|LOCUS_39290 23411 22890 gene locus_tag LOCUS_39300 23411 22890 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532199.1 protein_id gnl|my_center|LOCUS_39300 <23959 23408 gene locus_tag LOCUS_39310 <23959 23408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532201.1:AAA family ATPase >Feature sequence086 3 437 gene locus_tag LOCUS_39320 3 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 217 226 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 562 1278 gene locus_tag LOCUS_39330 562 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39330 1218 1227 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1257 1595 gene locus_tag LOCUS_39340 1257 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39340 1609 2706 gene locus_tag LOCUS_39350 1609 2706 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253048.1 protein_id gnl|my_center|LOCUS_39350 3115 2780 gene locus_tag LOCUS_39360 3115 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39360 3810 3082 gene locus_tag LOCUS_39370 3810 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39370 3146 3155 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4893 3859 gene locus_tag LOCUS_39380 4893 3859 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402582.1 protein_id gnl|my_center|LOCUS_39380 5854 4907 gene locus_tag LOCUS_39390 5854 4907 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402612.1 protein_id gnl|my_center|LOCUS_39390 5933 6688 gene locus_tag LOCUS_39400 5933 6688 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973552.1 protein_id gnl|my_center|LOCUS_39400 6702 7193 gene locus_tag LOCUS_39410 6702 7193 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243734.1 protein_id gnl|my_center|LOCUS_39410 7190 8071 gene locus_tag LOCUS_39420 7190 8071 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243735.1 protein_id gnl|my_center|LOCUS_39420 8068 8409 gene locus_tag LOCUS_39430 8068 8409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388253.1 protein_id gnl|my_center|LOCUS_39430 9662 8769 gene locus_tag LOCUS_39440 9662 8769 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061386.1 protein_id gnl|my_center|LOCUS_39440 9870 10265 gene locus_tag LOCUS_39450 9870 10265 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973783.1 protein_id gnl|my_center|LOCUS_39450 10296 11312 gene locus_tag LOCUS_39460 10296 11312 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089272.1 protein_id gnl|my_center|LOCUS_39460 11851 11324 gene locus_tag LOCUS_39470 11851 11324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 11960 14296 gene locus_tag LOCUS_39480 11960 14296 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529222.1 protein_id gnl|my_center|LOCUS_39480 14572 14318 gene locus_tag LOCUS_39490 14572 14318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 15329 14598 gene locus_tag LOCUS_39500 15329 14598 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529219.1 protein_id gnl|my_center|LOCUS_39500 14909 14918 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16585 15335 gene locus_tag LOCUS_39510 gene ispG 16585 15335 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502967.1 protein_id gnl|my_center|LOCUS_39510 17100 16921 gene locus_tag LOCUS_39520 17100 16921 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529217.1 protein_id gnl|my_center|LOCUS_39520 17342 17545 gene locus_tag LOCUS_39530 17342 17545 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529216.1 protein_id gnl|my_center|LOCUS_39530 18367 17576 gene locus_tag LOCUS_39540 18367 17576 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975583.1 protein_id gnl|my_center|LOCUS_39540 18483 19364 gene locus_tag LOCUS_39550 18483 19364 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396234.1 protein_id gnl|my_center|LOCUS_39550 19462 20127 gene locus_tag LOCUS_39560 19462 20127 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104187.1 protein_id gnl|my_center|LOCUS_39560 20129 20779 gene locus_tag LOCUS_39570 20129 20779 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061481.1 protein_id gnl|my_center|LOCUS_39570 20781 21578 gene locus_tag LOCUS_39580 20781 21578 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332090.1 protein_id gnl|my_center|LOCUS_39580 21672 22133 gene locus_tag LOCUS_39590 21672 22133 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_39590 22160 23350 gene locus_tag LOCUS_39600 22160 23350 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_39600 >Feature sequence087 1287 4 gene locus_tag LOCUS_39610 gene mtaB 1287 4 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528840.1 protein_id gnl|my_center|LOCUS_39610 2171 1287 gene locus_tag LOCUS_39620 gene dapF 2171 1287 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528841.1 protein_id gnl|my_center|LOCUS_39620 2526 2365 gene locus_tag LOCUS_39630 2526 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 3617 2607 gene locus_tag LOCUS_39640 3617 2607 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528843.1 protein_id gnl|my_center|LOCUS_39640 3775 5199 gene locus_tag LOCUS_39650 3775 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 5248 5685 gene locus_tag LOCUS_39660 5248 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 5902 6441 gene locus_tag LOCUS_39670 5902 6441 CDS product protease inhibitor Inh/omp19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528844.1 protein_id gnl|my_center|LOCUS_39670 6551 7753 gene locus_tag LOCUS_39680 gene zapE 6551 7753 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528845.1 protein_id gnl|my_center|LOCUS_39680 8084 9052 gene locus_tag LOCUS_39690 gene mdh 8084 9052 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528846.1 protein_id gnl|my_center|LOCUS_39690 9082 10275 gene locus_tag LOCUS_39700 gene sucC 9082 10275 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528847.1 protein_id gnl|my_center|LOCUS_39700 10280 10837 gene locus_tag LOCUS_39710 10280 10837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 10881 11252 gene locus_tag LOCUS_39720 10881 11252 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528848.1 protein_id gnl|my_center|LOCUS_39720 11256 11753 gene locus_tag LOCUS_39730 11256 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 11832 12128 gene locus_tag LOCUS_39740 11832 12128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 12055 12471 gene locus_tag LOCUS_39750 12055 12471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 12499 13404 gene locus_tag LOCUS_39760 gene sucD 12499 13404 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528849.1 protein_id gnl|my_center|LOCUS_39760 13551 16538 gene locus_tag LOCUS_39770 13551 16538 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528850.1 protein_id gnl|my_center|LOCUS_39770 16793 16802 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16813 17820 gene locus_tag LOCUS_39780 gene odhB 16813 17820 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528851.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39780 17838 18623 gene locus_tag LOCUS_39790 17838 18623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 18623 19132 gene locus_tag LOCUS_39800 18623 19132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528852.1 protein_id gnl|my_center|LOCUS_39800 19129 19884 gene locus_tag LOCUS_39810 19129 19884 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528853.1 protein_id gnl|my_center|LOCUS_39810 19908 21314 gene locus_tag LOCUS_39820 gene lpdA 19908 21314 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528854.1 protein_id gnl|my_center|LOCUS_39820 21708 21418 gene locus_tag LOCUS_39830 21708 21418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 23052 21988 gene locus_tag LOCUS_39840 23052 21988 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528856.1 protein_id gnl|my_center|LOCUS_39840 >Feature sequence088 1696 725 gene locus_tag LOCUS_39850 1696 725 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530250.1 protein_id gnl|my_center|LOCUS_39850 2845 1706 gene locus_tag LOCUS_39860 2845 1706 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530249.1 protein_id gnl|my_center|LOCUS_39860 4237 3140 gene locus_tag LOCUS_39870 4237 3140 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530248.1 protein_id gnl|my_center|LOCUS_39870 5482 4598 gene locus_tag LOCUS_39880 5482 4598 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530247.1 protein_id gnl|my_center|LOCUS_39880 6634 5732 gene locus_tag LOCUS_39890 6634 5732 CDS product DUF2167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035601.1 protein_id gnl|my_center|LOCUS_39890 8245 6845 gene locus_tag LOCUS_39900 8245 6845 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530246.1 protein_id gnl|my_center|LOCUS_39900 6936 6945 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8496 9785 gene locus_tag LOCUS_39910 gene aceA 8496 9785 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530245.1 protein_id gnl|my_center|LOCUS_39910 9851 10093 gene locus_tag LOCUS_39920 9851 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006202762.1 protein_id gnl|my_center|LOCUS_39920 10315 10794 gene locus_tag LOCUS_39930 10315 10794 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162284.1 protein_id gnl|my_center|LOCUS_39930 11546 10833 gene locus_tag LOCUS_39940 11546 10833 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 protein_id gnl|my_center|LOCUS_39940 11795 13144 gene locus_tag LOCUS_39950 11795 13144 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027035719.1 protein_id gnl|my_center|LOCUS_39950 13299 13541 gene locus_tag LOCUS_39960 13299 13541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39960 13605 14891 gene locus_tag LOCUS_39970 13605 14891 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530240.1 protein_id gnl|my_center|LOCUS_39970 15223 16041 gene locus_tag LOCUS_39980 15223 16041 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173772.1 protein_id gnl|my_center|LOCUS_39980 17341 16025 gene locus_tag LOCUS_39990 17341 16025 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_39990 18198 17437 gene locus_tag LOCUS_40000 18198 17437 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 protein_id gnl|my_center|LOCUS_40000 18505 19974 gene locus_tag LOCUS_40010 gene zwf 18505 19974 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530236.1 protein_id gnl|my_center|LOCUS_40010 19971 20669 gene locus_tag LOCUS_40020 gene pgl 19971 20669 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530235.1 protein_id gnl|my_center|LOCUS_40020 20736 22559 gene locus_tag LOCUS_40030 gene edd 20736 22559 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530234.1 protein_id gnl|my_center|LOCUS_40030 <23660 22633 gene locus_tag LOCUS_40040 <23660 22633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530233.1:VWA domain-containing protein >Feature sequence089 1251 118 gene locus_tag LOCUS_40050 1251 118 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528113.1 protein_id gnl|my_center|LOCUS_40050 1754 1906 gene locus_tag LOCUS_40060 1754 1906 CDS product lasso peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010913078.1 protein_id gnl|my_center|LOCUS_40060 2121 2420 gene locus_tag LOCUS_40070 2121 2420 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528114.1 protein_id gnl|my_center|LOCUS_40070 2404 2820 gene locus_tag LOCUS_40080 2404 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40080 2824 4740 gene locus_tag LOCUS_40090 2824 4740 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_40090 4737 5729 gene locus_tag LOCUS_40100 4737 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528117.1 protein_id gnl|my_center|LOCUS_40100 5738 7588 gene locus_tag LOCUS_40110 5738 7588 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528118.1 protein_id gnl|my_center|LOCUS_40110 7971 7624 gene locus_tag LOCUS_40120 7971 7624 CDS product exopolysaccharide production repressor ExoX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528119.1 protein_id gnl|my_center|LOCUS_40120 8505 9182 gene locus_tag LOCUS_40130 8505 9182 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528120.1 protein_id gnl|my_center|LOCUS_40130 9158 10576 gene locus_tag LOCUS_40140 9158 10576 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170136761.1 protein_id gnl|my_center|LOCUS_40140 10691 11773 gene locus_tag LOCUS_40150 10691 11773 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784109.1 protein_id gnl|my_center|LOCUS_40150 13053 11803 gene locus_tag LOCUS_40160 13053 11803 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528122.1 protein_id gnl|my_center|LOCUS_40160 13539 13991 gene locus_tag LOCUS_40170 13539 13991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 14024 15337 gene locus_tag LOCUS_40180 14024 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 16418 15435 gene locus_tag LOCUS_40190 16418 15435 CDS product glycosyltransferase family 10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203562.1 protein_id gnl|my_center|LOCUS_40190 17108 16518 gene locus_tag LOCUS_40200 17108 16518 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528144.1 protein_id gnl|my_center|LOCUS_40200 16707 16716 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18589 17150 gene locus_tag LOCUS_40210 18589 17150 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528145.1 protein_id gnl|my_center|LOCUS_40210 19248 18763 gene locus_tag LOCUS_40220 19248 18763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528152.1 protein_id gnl|my_center|LOCUS_40220 20265 19372 gene locus_tag LOCUS_40230 20265 19372 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529342.1 protein_id gnl|my_center|LOCUS_40230 21664 20282 gene locus_tag LOCUS_40240 21664 20282 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529338.1 protein_id gnl|my_center|LOCUS_40240 22443 21661 gene locus_tag LOCUS_40250 22443 21661 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529337.1 protein_id gnl|my_center|LOCUS_40250 >Feature sequence090 746 423 gene locus_tag LOCUS_40260 746 423 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081705261.1 protein_id gnl|my_center|LOCUS_40260 2238 1012 gene locus_tag LOCUS_40270 2238 1012 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532418.1 protein_id gnl|my_center|LOCUS_40270 2497 2252 gene locus_tag LOCUS_40280 2497 2252 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532417.1 protein_id gnl|my_center|LOCUS_40280 2750 4945 gene locus_tag LOCUS_40290 2750 4945 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532416.1 protein_id gnl|my_center|LOCUS_40290 4942 6477 gene locus_tag LOCUS_40300 gene ppx 4942 6477 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532415.1 protein_id gnl|my_center|LOCUS_40300 6904 6482 gene locus_tag LOCUS_40310 6904 6482 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532414.1 protein_id gnl|my_center|LOCUS_40310 7539 7117 gene locus_tag LOCUS_40320 7539 7117 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532413.1 protein_id gnl|my_center|LOCUS_40320 8225 7653 gene locus_tag LOCUS_40330 8225 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40330 9067 8276 gene locus_tag LOCUS_40340 9067 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40340 8287 8296 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10106 9330 gene locus_tag LOCUS_40350 10106 9330 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532409.1 protein_id gnl|my_center|LOCUS_40350 10809 10195 gene locus_tag LOCUS_40360 gene betI 10809 10195 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532408.1 protein_id gnl|my_center|LOCUS_40360 10920 11858 gene locus_tag LOCUS_40370 gene choX 10920 11858 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532407.1 protein_id gnl|my_center|LOCUS_40370 11870 12376 gene locus_tag LOCUS_40380 11870 12376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40380 12258 12713 gene locus_tag LOCUS_40390 12258 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40390 12268 12277 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13352 12714 gene locus_tag LOCUS_40400 13352 12714 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532405.1 protein_id gnl|my_center|LOCUS_40400 12807 12816 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13483 14166 gene locus_tag LOCUS_40410 13483 14166 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532404.1 protein_id gnl|my_center|LOCUS_40410 15530 14331 gene locus_tag LOCUS_40420 15530 14331 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577599.1 protein_id gnl|my_center|LOCUS_40420 16497 15910 gene locus_tag LOCUS_40430 16497 15910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532403.1 protein_id gnl|my_center|LOCUS_40430 16674 17753 gene locus_tag LOCUS_40440 16674 17753 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173636.1 protein_id gnl|my_center|LOCUS_40440 17853 18512 gene locus_tag LOCUS_40450 17853 18512 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171830.1 protein_id gnl|my_center|LOCUS_40450 18598 18903 gene locus_tag LOCUS_40460 18598 18903 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226515.1 protein_id gnl|my_center|LOCUS_40460 18918 19697 gene locus_tag LOCUS_40470 18918 19697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 19991 20245 gene locus_tag LOCUS_40480 19991 20245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532399.1 protein_id gnl|my_center|LOCUS_40480 20245 20652 gene locus_tag LOCUS_40490 20245 20652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532398.1 protein_id gnl|my_center|LOCUS_40490 20654 20812 gene locus_tag LOCUS_40500 20654 20812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 20818 21294 gene locus_tag LOCUS_40510 20818 21294 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532396.1 protein_id gnl|my_center|LOCUS_40510 21291 21902 gene locus_tag LOCUS_40520 21291 21902 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532395.1 protein_id gnl|my_center|LOCUS_40520 22183 21899 gene locus_tag LOCUS_40530 22183 21899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40530 22419 22210 gene locus_tag LOCUS_40540 22419 22210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40540 23439 22762 gene locus_tag LOCUS_40550 23439 22762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 >Feature sequence091 892 170 gene locus_tag LOCUS_40560 892 170 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532941.1 protein_id gnl|my_center|LOCUS_40560 1707 889 gene locus_tag LOCUS_40570 1707 889 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532942.1 protein_id gnl|my_center|LOCUS_40570 2525 1707 gene locus_tag LOCUS_40580 2525 1707 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532943.1 protein_id gnl|my_center|LOCUS_40580 3601 2525 gene locus_tag LOCUS_40590 3601 2525 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532944.1 protein_id gnl|my_center|LOCUS_40590 4478 3606 gene locus_tag LOCUS_40600 4478 3606 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532945.1 protein_id gnl|my_center|LOCUS_40600 5332 4490 gene locus_tag LOCUS_40610 5332 4490 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532946.1 protein_id gnl|my_center|LOCUS_40610 6234 5338 gene locus_tag LOCUS_40620 6234 5338 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532947.1 protein_id gnl|my_center|LOCUS_40620 7668 6367 gene locus_tag LOCUS_40630 7668 6367 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532948.1 protein_id gnl|my_center|LOCUS_40630 8871 7726 gene locus_tag LOCUS_40640 8871 7726 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532949.1 protein_id gnl|my_center|LOCUS_40640 9811 8852 gene locus_tag LOCUS_40650 9811 8852 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532950.1 protein_id gnl|my_center|LOCUS_40650 10597 9815 gene locus_tag LOCUS_40660 10597 9815 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532951.1 protein_id gnl|my_center|LOCUS_40660 10796 12535 gene locus_tag LOCUS_40670 10796 12535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 12356 12365 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12496 12936 gene locus_tag LOCUS_40680 12496 12936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40680 13980 12964 gene locus_tag LOCUS_40690 13980 12964 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532955.1 protein_id gnl|my_center|LOCUS_40690 14779 14240 gene locus_tag LOCUS_40700 14779 14240 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532925.1 protein_id gnl|my_center|LOCUS_40700 14858 16018 gene locus_tag LOCUS_40710 14858 16018 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532926.1 protein_id gnl|my_center|LOCUS_40710 16080 16508 gene locus_tag LOCUS_40720 16080 16508 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532936.1 protein_id gnl|my_center|LOCUS_40720 17578 16427 gene locus_tag LOCUS_40730 17578 16427 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532935.1 protein_id gnl|my_center|LOCUS_40730 16656 16665 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17803 18618 gene locus_tag LOCUS_40740 17803 18618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 18396 18405 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18750 19601 gene locus_tag LOCUS_40750 18750 19601 CDS product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528557.1 protein_id gnl|my_center|LOCUS_40750 19685 20776 gene locus_tag LOCUS_40760 19685 20776 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528558.1 protein_id gnl|my_center|LOCUS_40760 21058 20699 gene locus_tag LOCUS_40770 21058 20699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 21209 21218 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21274 21474 gene locus_tag LOCUS_40780 21274 21474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40780 21633 22649 gene locus_tag LOCUS_40790 21633 22649 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530313.1 protein_id gnl|my_center|LOCUS_40790 <23383 22862 gene locus_tag LOCUS_40800 <23383 22862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528547.1:2-oxo-hepta-3-ene-1,7-dioic acid hydratase >Feature sequence092 390 1052 gene locus_tag LOCUS_40810 390 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 1108 1281 gene locus_tag LOCUS_40820 1108 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 2066 1791 gene locus_tag LOCUS_40830 2066 1791 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120709219.1 protein_id gnl|my_center|LOCUS_40830 3201 2197 gene locus_tag LOCUS_40840 3201 2197 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242607.1 protein_id gnl|my_center|LOCUS_40840 3309 3671 gene locus_tag LOCUS_40850 3309 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40850 3728 4267 gene locus_tag LOCUS_40860 3728 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40860 4626 4285 gene locus_tag LOCUS_40870 4626 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 5137 4874 gene locus_tag LOCUS_40880 5137 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 5932 5141 gene locus_tag LOCUS_40890 5932 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 6336 5929 gene locus_tag LOCUS_40900 6336 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 7415 6333 gene locus_tag LOCUS_40910 7415 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 7341 7715 gene locus_tag LOCUS_40920 7341 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 7654 7663 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7726 8763 gene locus_tag LOCUS_40930 7726 8763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 10060 9521 gene locus_tag LOCUS_40940 10060 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 10295 13756 gene locus_tag LOCUS_40950 10295 13756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 14522 13875 gene locus_tag LOCUS_40960 14522 13875 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020479965.1 protein_id gnl|my_center|LOCUS_40960 15059 15502 gene locus_tag LOCUS_40970 15059 15502 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528917.1 protein_id gnl|my_center|LOCUS_40970 16014 16613 gene locus_tag LOCUS_40980 16014 16613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 17016 19139 gene locus_tag LOCUS_40990 17016 19139 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491196.1 protein_id gnl|my_center|LOCUS_40990 19136 20686 gene locus_tag LOCUS_41000 19136 20686 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_41000 20500 20509 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20652 20840 gene locus_tag LOCUS_41010 20652 20840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 20837 22081 gene locus_tag LOCUS_41020 20837 22081 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384502.1 protein_id gnl|my_center|LOCUS_41020 22116 23156 gene locus_tag LOCUS_41030 22116 23156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 >Feature sequence093 505 146 gene locus_tag LOCUS_41040 505 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 2427 1015 gene locus_tag LOCUS_41050 2427 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 3213 2437 gene locus_tag LOCUS_41060 3213 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 3797 3465 gene locus_tag LOCUS_41070 3797 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 4744 3956 gene locus_tag LOCUS_41080 4744 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 5793 4741 gene locus_tag LOCUS_41090 5793 4741 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037025.1 protein_id gnl|my_center|LOCUS_41090 6156 8171 gene locus_tag LOCUS_41100 6156 8171 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101804821.1 protein_id gnl|my_center|LOCUS_41100 8353 10236 gene locus_tag LOCUS_41110 8353 10236 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101804821.1 protein_id gnl|my_center|LOCUS_41110 12287 10257 gene locus_tag LOCUS_41120 12287 10257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 13547 12288 gene locus_tag LOCUS_41130 13547 12288 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957839.1 protein_id gnl|my_center|LOCUS_41130 14440 13682 gene locus_tag LOCUS_41140 14440 13682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 14812 16494 gene locus_tag LOCUS_41150 14812 16494 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403374.1 protein_id gnl|my_center|LOCUS_41150 17330 16491 gene locus_tag LOCUS_41160 17330 16491 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 protein_id gnl|my_center|LOCUS_41160 18457 17327 gene locus_tag LOCUS_41170 18457 17327 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061500.1 protein_id gnl|my_center|LOCUS_41170 18694 19971 gene locus_tag LOCUS_41180 18694 19971 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_41180 20112 21023 gene locus_tag LOCUS_41190 20112 21023 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_41190 21074 21868 gene locus_tag LOCUS_41200 21074 21868 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 protein_id gnl|my_center|LOCUS_41200 >Feature sequence094 347 841 gene locus_tag LOCUS_41210 347 841 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531271.1 protein_id gnl|my_center|LOCUS_41210 918 1406 gene locus_tag LOCUS_41220 918 1406 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391513.1 protein_id gnl|my_center|LOCUS_41220 2270 1476 gene locus_tag LOCUS_41230 2270 1476 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531267.1 protein_id gnl|my_center|LOCUS_41230 4636 2285 gene locus_tag LOCUS_41240 4636 2285 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531266.1 protein_id gnl|my_center|LOCUS_41240 5261 4761 gene locus_tag LOCUS_41250 5261 4761 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531265.1 protein_id gnl|my_center|LOCUS_41250 5476 6711 gene locus_tag LOCUS_41260 5476 6711 CDS product FIST signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050580471.1 protein_id gnl|my_center|LOCUS_41260 6727 8070 gene locus_tag LOCUS_41270 6727 8070 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531263.1 protein_id gnl|my_center|LOCUS_41270 8085 8339 gene locus_tag LOCUS_41280 8085 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 8353 8781 gene locus_tag LOCUS_41290 8353 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 9555 8872 gene locus_tag LOCUS_41300 9555 8872 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503826.1 protein_id gnl|my_center|LOCUS_41300 9879 10577 gene locus_tag LOCUS_41310 9879 10577 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531256.1 protein_id gnl|my_center|LOCUS_41310 10582 11232 gene locus_tag LOCUS_41320 gene maiA 10582 11232 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531255.1 protein_id gnl|my_center|LOCUS_41320 11268 11462 gene locus_tag LOCUS_41330 11268 11462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41330 11428 11437 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11459 12283 gene locus_tag LOCUS_41340 11459 12283 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531254.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41340 13192 12299 gene locus_tag LOCUS_41350 13192 12299 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531253.1 protein_id gnl|my_center|LOCUS_41350 13496 13505 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13559 14713 gene locus_tag LOCUS_41360 13559 14713 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531252.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41360 15660 14719 gene locus_tag LOCUS_41370 15660 14719 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531250.1 protein_id gnl|my_center|LOCUS_41370 15759 17201 gene locus_tag LOCUS_41380 15759 17201 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531249.1 protein_id gnl|my_center|LOCUS_41380 17638 17198 gene locus_tag LOCUS_41390 17638 17198 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531248.1 protein_id gnl|my_center|LOCUS_41390 18343 17915 gene locus_tag LOCUS_41400 18343 17915 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531247.1 protein_id gnl|my_center|LOCUS_41400 19706 18411 gene locus_tag LOCUS_41410 19706 18411 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531246.1 protein_id gnl|my_center|LOCUS_41410 19908 20369 gene locus_tag LOCUS_41420 gene rirA 19908 20369 CDS product iron-responsive transcriptional regulator RirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531245.1 protein_id gnl|my_center|LOCUS_41420 21171 20383 gene locus_tag LOCUS_41430 21171 20383 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531244.1 protein_id gnl|my_center|LOCUS_41430 21433 21179 gene locus_tag LOCUS_41440 21433 21179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41440 21399 21554 gene locus_tag LOCUS_41450 21399 21554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 21459 21468 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21753 21974 gene locus_tag LOCUS_41460 21753 21974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 <22965 22271 gene locus_tag LOCUS_41470 <22965 22271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531242.1:hemin ABC transporter substrate-binding protein >Feature sequence095 411 1985 gene locus_tag LOCUS_41480 411 1985 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 protein_id gnl|my_center|LOCUS_41480 2075 2764 gene locus_tag LOCUS_41490 2075 2764 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531177.1 protein_id gnl|my_center|LOCUS_41490 2869 3600 gene locus_tag LOCUS_41500 2869 3600 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531180.1 protein_id gnl|my_center|LOCUS_41500 3784 4335 gene locus_tag LOCUS_41510 3784 4335 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531188.1 protein_id gnl|my_center|LOCUS_41510 4338 4820 gene locus_tag LOCUS_41520 4338 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 4695 4704 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4736 6127 gene locus_tag LOCUS_41530 4736 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 6219 6228 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6511 6798 gene locus_tag LOCUS_41540 6511 6798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 7833 6817 gene locus_tag LOCUS_41550 gene bmt 7833 6817 CDS product betaine--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173709.1 protein_id gnl|my_center|LOCUS_41550 8854 8012 gene locus_tag LOCUS_41560 8854 8012 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531192.1 protein_id gnl|my_center|LOCUS_41560 9143 10093 gene locus_tag LOCUS_41570 9143 10093 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160493.1 protein_id gnl|my_center|LOCUS_41570 10121 10987 gene locus_tag LOCUS_41580 10121 10987 CDS product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531194.1 protein_id gnl|my_center|LOCUS_41580 12328 10976 gene locus_tag LOCUS_41590 12328 10976 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 protein_id gnl|my_center|LOCUS_41590 13868 12348 gene locus_tag LOCUS_41600 13868 12348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 16522 13952 gene locus_tag LOCUS_41610 16522 13952 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531196.1 protein_id gnl|my_center|LOCUS_41610 18186 16609 gene locus_tag LOCUS_41620 18186 16609 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 protein_id gnl|my_center|LOCUS_41620 18390 20297 gene locus_tag LOCUS_41630 18390 20297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 20325 20576 gene locus_tag LOCUS_41640 20325 20576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 20599 21759 gene locus_tag LOCUS_41650 20599 21759 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531199.1 protein_id gnl|my_center|LOCUS_41650 >Feature sequence096 707 1054 gene locus_tag LOCUS_41660 707 1054 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529502.1 protein_id gnl|my_center|LOCUS_41660 1970 1062 gene locus_tag LOCUS_41670 1970 1062 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328848.1 protein_id gnl|my_center|LOCUS_41670 2052 2654 gene locus_tag LOCUS_41680 2052 2654 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397132.1 protein_id gnl|my_center|LOCUS_41680 3889 2675 gene locus_tag LOCUS_41690 3889 2675 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969796.1 protein_id gnl|my_center|LOCUS_41690 4062 5039 gene locus_tag LOCUS_41700 4062 5039 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109658674.1 protein_id gnl|my_center|LOCUS_41700 5145 5576 gene locus_tag LOCUS_41710 5145 5576 CDS product DUF4437 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529500.1 protein_id gnl|my_center|LOCUS_41710 6712 5630 gene locus_tag LOCUS_41720 6712 5630 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529499.1 protein_id gnl|my_center|LOCUS_41720 7818 6712 gene locus_tag LOCUS_41730 7818 6712 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529498.1 protein_id gnl|my_center|LOCUS_41730 8036 7815 gene locus_tag LOCUS_41740 8036 7815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529497.1 protein_id gnl|my_center|LOCUS_41740 8989 8033 gene locus_tag LOCUS_41750 8989 8033 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970662.1 protein_id gnl|my_center|LOCUS_41750 9896 8991 gene locus_tag LOCUS_41760 9896 8991 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970661.1 protein_id gnl|my_center|LOCUS_41760 11278 9962 gene locus_tag LOCUS_41770 11278 9962 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967707.1 protein_id gnl|my_center|LOCUS_41770 11756 11547 gene locus_tag LOCUS_41780 11756 11547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 12226 11639 gene locus_tag LOCUS_41790 12226 11639 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529493.1 protein_id gnl|my_center|LOCUS_41790 12423 13619 gene locus_tag LOCUS_41800 12423 13619 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529492.1 protein_id gnl|my_center|LOCUS_41800 13631 14497 gene locus_tag LOCUS_41810 13631 14497 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529491.1 protein_id gnl|my_center|LOCUS_41810 14502 14918 gene locus_tag LOCUS_41820 14502 14918 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529490.1 protein_id gnl|my_center|LOCUS_41820 16279 15092 gene locus_tag LOCUS_41830 16279 15092 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529489.1 protein_id gnl|my_center|LOCUS_41830 16664 18274 gene locus_tag LOCUS_41840 16664 18274 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529488.1 protein_id gnl|my_center|LOCUS_41840 18530 19471 gene locus_tag LOCUS_41850 18530 19471 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529487.1 protein_id gnl|my_center|LOCUS_41850 19513 20343 gene locus_tag LOCUS_41860 19513 20343 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529486.1 protein_id gnl|my_center|LOCUS_41860 20340 21347 gene locus_tag LOCUS_41870 20340 21347 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167391096.1 protein_id gnl|my_center|LOCUS_41870 21344 22123 gene locus_tag LOCUS_41880 21344 22123 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529483.1 protein_id gnl|my_center|LOCUS_41880 >Feature sequence097 1547 588 gene locus_tag LOCUS_41890 1547 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 664 673 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2637 1558 gene locus_tag LOCUS_41900 2637 1558 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356447.1 protein_id gnl|my_center|LOCUS_41900 3449 2793 gene locus_tag LOCUS_41910 3449 2793 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532271.1 protein_id gnl|my_center|LOCUS_41910 3652 4824 gene locus_tag LOCUS_41920 3652 4824 CDS product OpgC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532270.1 protein_id gnl|my_center|LOCUS_41920 5907 4831 gene locus_tag LOCUS_41930 5907 4831 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532269.1 protein_id gnl|my_center|LOCUS_41930 6085 6228 gene locus_tag LOCUS_41940 6085 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532268.1 protein_id gnl|my_center|LOCUS_41940 6287 6436 gene locus_tag LOCUS_41950 6287 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 6820 6446 gene locus_tag LOCUS_41960 6820 6446 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532266.1 protein_id gnl|my_center|LOCUS_41960 7259 6879 gene locus_tag LOCUS_41970 7259 6879 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975151.1 protein_id gnl|my_center|LOCUS_41970 8544 7291 gene locus_tag LOCUS_41980 8544 7291 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532265.1 protein_id gnl|my_center|LOCUS_41980 8660 9340 gene locus_tag LOCUS_41990 8660 9340 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532264.1 protein_id gnl|my_center|LOCUS_41990 9233 9242 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9487 10458 gene locus_tag LOCUS_42000 9487 10458 CDS product glycosyl transferase family 90 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108791.1 protein_id gnl|my_center|LOCUS_42000 11516 10473 gene locus_tag LOCUS_42010 11516 10473 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532261.1 protein_id gnl|my_center|LOCUS_42010 11760 12680 gene locus_tag LOCUS_42020 gene ppk2 11760 12680 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532260.1 protein_id gnl|my_center|LOCUS_42020 13515 12868 gene locus_tag LOCUS_42030 13515 12868 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532259.1 protein_id gnl|my_center|LOCUS_42030 14620 13643 gene locus_tag LOCUS_42040 14620 13643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 15658 14627 gene locus_tag LOCUS_42050 gene hemB 15658 14627 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532258.1 protein_id gnl|my_center|LOCUS_42050 16573 15776 gene locus_tag LOCUS_42060 16573 15776 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532257.1 protein_id gnl|my_center|LOCUS_42060 16738 17286 gene locus_tag LOCUS_42070 16738 17286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 17405 18448 gene locus_tag LOCUS_42080 17405 18448 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532256.1 protein_id gnl|my_center|LOCUS_42080 18445 18867 gene locus_tag LOCUS_42090 18445 18867 CDS product DUF6163 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532255.1 protein_id gnl|my_center|LOCUS_42090 19105 19620 gene locus_tag LOCUS_42100 19105 19620 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008875359.1 protein_id gnl|my_center|LOCUS_42100 19796 19608 gene locus_tag LOCUS_42110 19796 19608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 19830 20228 gene locus_tag LOCUS_42120 19830 20228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 20615 21868 gene locus_tag LOCUS_42130 20615 21868 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532254.1 protein_id gnl|my_center|LOCUS_42130 >Feature sequence098 <1 1148 gene locus_tag LOCUS_42140 <1 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528581.1:malonyl-CoA synthase 2533 1376 gene locus_tag LOCUS_42150 gene nagA 2533 1376 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528579.1 protein_id gnl|my_center|LOCUS_42150 3237 2530 gene locus_tag LOCUS_42160 3237 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42160 3300 3309 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4354 3575 gene locus_tag LOCUS_42170 4354 3575 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528577.1 protein_id gnl|my_center|LOCUS_42170 5232 4351 gene locus_tag LOCUS_42180 5232 4351 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528576.1 protein_id gnl|my_center|LOCUS_42180 5433 6341 gene locus_tag LOCUS_42190 5433 6341 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528575.1 protein_id gnl|my_center|LOCUS_42190 6394 7653 gene locus_tag LOCUS_42200 6394 7653 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528574.1 protein_id gnl|my_center|LOCUS_42200 7897 8826 gene locus_tag LOCUS_42210 7897 8826 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528573.1 protein_id gnl|my_center|LOCUS_42210 8835 9674 gene locus_tag LOCUS_42220 8835 9674 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528572.1 protein_id gnl|my_center|LOCUS_42220 9671 10732 gene locus_tag LOCUS_42230 9671 10732 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528570.1 protein_id gnl|my_center|LOCUS_42230 10959 11957 gene locus_tag LOCUS_42240 10959 11957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173499.1 protein_id gnl|my_center|LOCUS_42240 13002 12157 gene locus_tag LOCUS_42250 13002 12157 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528568.1 protein_id gnl|my_center|LOCUS_42250 13928 13197 gene locus_tag LOCUS_42260 13928 13197 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528567.1 protein_id gnl|my_center|LOCUS_42260 16486 14111 gene locus_tag LOCUS_42270 16486 14111 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528566.1 protein_id gnl|my_center|LOCUS_42270 17600 16539 gene locus_tag LOCUS_42280 gene deoC 17600 16539 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528565.1 protein_id gnl|my_center|LOCUS_42280 18633 17806 gene locus_tag LOCUS_42290 18633 17806 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528564.1 protein_id gnl|my_center|LOCUS_42290 18854 20230 gene locus_tag LOCUS_42300 18854 20230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42300 19925 19934 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20118 20900 gene locus_tag LOCUS_42310 20118 20900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42310 >Feature sequence099 162 1205 gene locus_tag LOCUS_42320 gene holA 162 1205 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528740.1 protein_id gnl|my_center|LOCUS_42320 2019 1219 gene locus_tag LOCUS_42330 2019 1219 CDS product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528739.1 protein_id gnl|my_center|LOCUS_42330 2439 2029 gene locus_tag LOCUS_42340 2439 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 3959 3075 gene locus_tag LOCUS_42350 3959 3075 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528737.1 protein_id gnl|my_center|LOCUS_42350 4802 4005 gene locus_tag LOCUS_42360 4802 4005 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528736.1 protein_id gnl|my_center|LOCUS_42360 5251 4820 gene locus_tag LOCUS_42370 5251 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 5132 5413 gene locus_tag LOCUS_42380 5132 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 7332 5458 gene locus_tag LOCUS_42390 gene mnmG 7332 5458 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528734.1 protein_id gnl|my_center|LOCUS_42390 8712 7501 gene locus_tag LOCUS_42400 gene mnmE 8712 7501 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528733.1 protein_id gnl|my_center|LOCUS_42400 8765 10918 gene locus_tag LOCUS_42410 8765 10918 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 protein_id gnl|my_center|LOCUS_42410 10963 10972 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12430 11174 gene locus_tag LOCUS_42420 gene rho 12430 11174 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528732.1 protein_id gnl|my_center|LOCUS_42420 13138 12608 gene locus_tag LOCUS_42430 gene hemJ 13138 12608 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528731.1 protein_id gnl|my_center|LOCUS_42430 14151 13138 gene locus_tag LOCUS_42440 gene hemE 14151 13138 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528730.1 protein_id gnl|my_center|LOCUS_42440 14572 15393 gene locus_tag LOCUS_42450 14572 15393 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528729.1 protein_id gnl|my_center|LOCUS_42450 15681 16280 gene locus_tag LOCUS_42460 15681 16280 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528728.1 protein_id gnl|my_center|LOCUS_42460 16273 17112 gene locus_tag LOCUS_42470 16273 17112 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528727.1 protein_id gnl|my_center|LOCUS_42470 17126 17731 gene locus_tag LOCUS_42480 gene coaE 17126 17731 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528726.1 protein_id gnl|my_center|LOCUS_42480 17806 18528 gene locus_tag LOCUS_42490 gene dnaQ 17806 18528 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528725.1 protein_id gnl|my_center|LOCUS_42490 19108 18602 gene locus_tag LOCUS_42500 gene secB 19108 18602 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528724.1 protein_id gnl|my_center|LOCUS_42500 18710 18719 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19780 19283 gene locus_tag LOCUS_42510 gene fxsA 19780 19283 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528723.1 protein_id gnl|my_center|LOCUS_42510 19932 20690 gene locus_tag LOCUS_42520 19932 20690 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528722.1 protein_id gnl|my_center|LOCUS_42520 >Feature sequence100 1180 1629 gene locus_tag LOCUS_42530 1180 1629 CDS product host attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529560.1 protein_id gnl|my_center|LOCUS_42530 1807 3615 gene locus_tag LOCUS_42540 gene ybaL 1807 3615 CDS product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529559.1 protein_id gnl|my_center|LOCUS_42540 4450 3644 gene locus_tag LOCUS_42550 4450 3644 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529558.1 protein_id gnl|my_center|LOCUS_42550 4589 5509 gene locus_tag LOCUS_42560 4589 5509 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529557.1 protein_id gnl|my_center|LOCUS_42560 6283 5534 gene locus_tag LOCUS_42570 6283 5534 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529556.1 protein_id gnl|my_center|LOCUS_42570 6731 6348 gene locus_tag LOCUS_42580 6731 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42580 8523 6685 gene locus_tag LOCUS_42590 8523 6685 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529554.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42590 6747 6756 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8408 8614 gene locus_tag LOCUS_42600 8408 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 9525 8836 gene locus_tag LOCUS_42610 9525 8836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 10432 9488 gene locus_tag LOCUS_42620 10432 9488 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139584.1 protein_id gnl|my_center|LOCUS_42620 10813 10436 gene locus_tag LOCUS_42630 10813 10436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 12099 10816 gene locus_tag LOCUS_42640 12099 10816 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082330.1 protein_id gnl|my_center|LOCUS_42640 12988 12668 gene locus_tag LOCUS_42650 12988 12668 CDS product protamine-2 (modular protein) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109666726.1 protein_id gnl|my_center|LOCUS_42650 13340 13194 gene locus_tag LOCUS_42660 13340 13194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529552.1 protein_id gnl|my_center|LOCUS_42660 13727 13473 gene locus_tag LOCUS_42670 13727 13473 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529551.1 protein_id gnl|my_center|LOCUS_42670 14211 14011 gene locus_tag LOCUS_42680 14211 14011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529550.1 protein_id gnl|my_center|LOCUS_42680 14849 14229 gene locus_tag LOCUS_42690 14849 14229 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529549.1 protein_id gnl|my_center|LOCUS_42690 16322 14937 gene locus_tag LOCUS_42700 16322 14937 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529548.1 protein_id gnl|my_center|LOCUS_42700 16768 19731 gene locus_tag LOCUS_42710 gene polA 16768 19731 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173101.1 protein_id gnl|my_center|LOCUS_42710 19733 20362 gene locus_tag LOCUS_42720 19733 20362 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919879.1 protein_id gnl|my_center|LOCUS_42720 20916 20512 gene locus_tag LOCUS_42730 20916 20512 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529546.1 protein_id gnl|my_center|LOCUS_42730 >Feature sequence101 1317 595 gene locus_tag LOCUS_42740 1317 595 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390306.1 protein_id gnl|my_center|LOCUS_42740 1550 2038 gene locus_tag LOCUS_42750 1550 2038 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531406.1 protein_id gnl|my_center|LOCUS_42750 2143 2589 gene locus_tag LOCUS_42760 2143 2589 CDS product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531407.1 protein_id gnl|my_center|LOCUS_42760 2661 2736 gene locus_tag LOCUS_t00290 2661 2736 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3106 3309 gene locus_tag LOCUS_42770 gene secE 3106 3309 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531408.1 protein_id gnl|my_center|LOCUS_42770 3337 3864 gene locus_tag LOCUS_42780 gene nusG 3337 3864 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531409.1 protein_id gnl|my_center|LOCUS_42780 4061 4489 gene locus_tag LOCUS_42790 gene rplK 4061 4489 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531410.1 protein_id gnl|my_center|LOCUS_42790 4495 5193 gene locus_tag LOCUS_42800 gene rplA 4495 5193 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531411.1 protein_id gnl|my_center|LOCUS_42800 5591 6109 gene locus_tag LOCUS_42810 gene rplJ 5591 6109 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531412.1 protein_id gnl|my_center|LOCUS_42810 6158 6544 gene locus_tag LOCUS_42820 gene rplL 6158 6544 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531413.1 protein_id gnl|my_center|LOCUS_42820 6548 6557 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6772 10908 gene locus_tag LOCUS_42830 gene rpoB 6772 10908 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531414.1 protein_id gnl|my_center|LOCUS_42830 10999 15234 gene locus_tag LOCUS_42840 gene rpoC 10999 15234 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531415.1 protein_id gnl|my_center|LOCUS_42840 15306 15974 gene locus_tag LOCUS_42850 15306 15974 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705602.1 protein_id gnl|my_center|LOCUS_42850 15988 16143 gene locus_tag LOCUS_42860 15988 16143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 17320 16385 gene locus_tag LOCUS_42870 17320 16385 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531419.1 protein_id gnl|my_center|LOCUS_42870 17675 17394 gene locus_tag LOCUS_42880 17675 17394 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531420.1 protein_id gnl|my_center|LOCUS_42880 17592 17900 gene locus_tag LOCUS_42890 17592 17900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 18150 18521 gene locus_tag LOCUS_42900 gene rpsL 18150 18521 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006333356.1 protein_id gnl|my_center|LOCUS_42900 18586 19056 gene locus_tag LOCUS_42910 gene rpsG 18586 19056 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008875664.1 protein_id gnl|my_center|LOCUS_42910 19086 21176 gene locus_tag LOCUS_42920 gene fusA 19086 21176 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531421.1 protein_id gnl|my_center|LOCUS_42920 >Feature sequence102 1991 1284 gene locus_tag LOCUS_42930 1991 1284 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528275.1 protein_id gnl|my_center|LOCUS_42930 1600 1609 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2725 1991 gene locus_tag LOCUS_42940 2725 1991 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528274.1 protein_id gnl|my_center|LOCUS_42940 3846 2740 gene locus_tag LOCUS_42950 3846 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528272.1 protein_id gnl|my_center|LOCUS_42950 4274 3843 gene locus_tag LOCUS_42960 4274 3843 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528271.1 protein_id gnl|my_center|LOCUS_42960 5526 4417 gene locus_tag LOCUS_42970 5526 4417 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528270.1 protein_id gnl|my_center|LOCUS_42970 6842 5595 gene locus_tag LOCUS_42980 6842 5595 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528269.1 protein_id gnl|my_center|LOCUS_42980 7666 7875 gene locus_tag LOCUS_42990 7666 7875 CDS product DUF680 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528268.1 protein_id gnl|my_center|LOCUS_42990 7957 8196 gene locus_tag LOCUS_43000 7957 8196 CDS product DUF680 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528266.1 protein_id gnl|my_center|LOCUS_43000 9404 8292 gene locus_tag LOCUS_43010 gene ugpC 9404 8292 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528265.1 protein_id gnl|my_center|LOCUS_43010 11101 9437 gene locus_tag LOCUS_43020 11101 9437 CDS product alpha glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528264.1 protein_id gnl|my_center|LOCUS_43020 12260 11106 gene locus_tag LOCUS_43030 12260 11106 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528263.1 protein_id gnl|my_center|LOCUS_43030 13275 12262 gene locus_tag LOCUS_43040 13275 12262 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528262.1 protein_id gnl|my_center|LOCUS_43040 14922 13567 gene locus_tag LOCUS_43050 14922 13567 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528261.1 protein_id gnl|my_center|LOCUS_43050 15681 15690 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15696 16322 gene locus_tag LOCUS_43060 15696 16322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43060 16724 16536 gene locus_tag LOCUS_43070 16724 16536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 16948 16721 gene locus_tag LOCUS_43080 16948 16721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 18229 17171 gene locus_tag LOCUS_43090 18229 17171 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528524.1 protein_id gnl|my_center|LOCUS_43090 19900 18575 gene locus_tag LOCUS_43100 19900 18575 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528256.1 protein_id gnl|my_center|LOCUS_43100 20558 19890 gene locus_tag LOCUS_43110 20558 19890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528255.1 protein_id gnl|my_center|LOCUS_43110 21121 20555 gene locus_tag LOCUS_43120 21121 20555 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528254.1 protein_id gnl|my_center|LOCUS_43120 >Feature sequence103 1623 643 gene locus_tag LOCUS_43130 1623 643 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257467.1 protein_id gnl|my_center|LOCUS_43130 1934 3253 gene locus_tag LOCUS_43140 1934 3253 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257469.1 protein_id gnl|my_center|LOCUS_43140 3444 4214 gene locus_tag LOCUS_43150 3444 4214 CDS product galactitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972809.1 protein_id gnl|my_center|LOCUS_43150 4239 5252 gene locus_tag LOCUS_43160 4239 5252 CDS product D-altritol 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972808.1 protein_id gnl|my_center|LOCUS_43160 5376 6404 gene locus_tag LOCUS_43170 5376 6404 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532415.1 protein_id gnl|my_center|LOCUS_43170 7419 6412 gene locus_tag LOCUS_43180 7419 6412 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530761.1 protein_id gnl|my_center|LOCUS_43180 7642 7911 gene locus_tag LOCUS_43190 7642 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43190 9277 8780 gene locus_tag LOCUS_43200 9277 8780 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438748.1 protein_id gnl|my_center|LOCUS_43200 9606 10868 gene locus_tag LOCUS_43210 9606 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43210 10648 10657 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10837 11217 gene locus_tag LOCUS_43220 10837 11217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43220 11328 11552 gene locus_tag LOCUS_43230 11328 11552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530613.1 protein_id gnl|my_center|LOCUS_43230 11800 14301 gene locus_tag LOCUS_43240 gene ligD 11800 14301 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530614.1 protein_id gnl|my_center|LOCUS_43240 14931 15839 gene locus_tag LOCUS_43250 14931 15839 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530615.1 protein_id gnl|my_center|LOCUS_43250 15836 16969 gene locus_tag LOCUS_43260 15836 16969 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530616.1 protein_id gnl|my_center|LOCUS_43260 17041 17050 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17152 17805 gene locus_tag LOCUS_43270 17152 17805 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530617.1 protein_id gnl|my_center|LOCUS_43270 17979 18755 gene locus_tag LOCUS_43280 17979 18755 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530618.1 protein_id gnl|my_center|LOCUS_43280 18843 19559 gene locus_tag LOCUS_43290 18843 19559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43290 19487 20023 gene locus_tag LOCUS_43300 19487 20023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43300 >Feature sequence104 211 220 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 841 554 gene locus_tag LOCUS_43310 841 554 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528591.1 protein_id gnl|my_center|LOCUS_43310 1571 864 gene locus_tag LOCUS_43320 gene pyrF 1571 864 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528590.1 protein_id gnl|my_center|LOCUS_43320 2164 1568 gene locus_tag LOCUS_43330 2164 1568 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 protein_id gnl|my_center|LOCUS_43330 2929 2324 gene locus_tag LOCUS_43340 2929 2324 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528588.1 protein_id gnl|my_center|LOCUS_43340 4186 3056 gene locus_tag LOCUS_43350 gene dnaJ 4186 3056 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528587.1 protein_id gnl|my_center|LOCUS_43350 6293 4377 gene locus_tag LOCUS_43360 gene dnaK 6293 4377 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502156.1 protein_id gnl|my_center|LOCUS_43360 7378 6281 gene locus_tag LOCUS_43370 7378 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 8460 7462 gene locus_tag LOCUS_43380 8460 7462 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528459.1 protein_id gnl|my_center|LOCUS_43380 9291 8464 gene locus_tag LOCUS_43390 9291 8464 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640272.1 protein_id gnl|my_center|LOCUS_43390 10547 9375 gene locus_tag LOCUS_43400 10547 9375 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528460.1 protein_id gnl|my_center|LOCUS_43400 11722 10667 gene locus_tag LOCUS_43410 11722 10667 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 protein_id gnl|my_center|LOCUS_43410 11955 12389 gene locus_tag LOCUS_43420 11955 12389 CDS product DUF6481 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528462.1 protein_id gnl|my_center|LOCUS_43420 12777 12463 gene locus_tag LOCUS_43430 gene sugE 12777 12463 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528463.1 protein_id gnl|my_center|LOCUS_43430 13131 13006 gene locus_tag LOCUS_43440 13131 13006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 13408 14838 gene locus_tag LOCUS_43450 13408 14838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 14347 14356 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16096 14846 gene locus_tag LOCUS_43460 gene rmuC 16096 14846 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528468.1 protein_id gnl|my_center|LOCUS_43460 16200 16730 gene locus_tag LOCUS_43470 gene def 16200 16730 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528469.1 protein_id gnl|my_center|LOCUS_43470 16796 17077 gene locus_tag LOCUS_43480 16796 17077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528470.1 protein_id gnl|my_center|LOCUS_43480 17074 17499 gene locus_tag LOCUS_43490 17074 17499 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051418.1 protein_id gnl|my_center|LOCUS_43490 17530 18465 gene locus_tag LOCUS_43500 gene fmt 17530 18465 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528471.1 protein_id gnl|my_center|LOCUS_43500 18462 18968 gene locus_tag LOCUS_43510 18462 18968 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528472.1 protein_id gnl|my_center|LOCUS_43510 18988 19743 gene locus_tag LOCUS_43520 gene truA 18988 19743 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528473.1 protein_id gnl|my_center|LOCUS_43520 20345 19740 gene locus_tag LOCUS_43530 20345 19740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528474.1 protein_id gnl|my_center|LOCUS_43530 <21077 20332 gene locus_tag LOCUS_43540 <21077 20332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528475.1:succinyl-diaminopimelate desuccinylase >Feature sequence105 2606 138 gene locus_tag LOCUS_43550 gene clpA 2606 138 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531774.1 protein_id gnl|my_center|LOCUS_43550 2996 2613 gene locus_tag LOCUS_43560 gene clpS 2996 2613 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023812950.1 protein_id gnl|my_center|LOCUS_43560 3537 3208 gene locus_tag LOCUS_43570 3537 3208 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531776.1 protein_id gnl|my_center|LOCUS_43570 3826 5226 gene locus_tag LOCUS_43580 3826 5226 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531777.1 protein_id gnl|my_center|LOCUS_43580 5967 5269 gene locus_tag LOCUS_43590 5967 5269 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531778.1 protein_id gnl|my_center|LOCUS_43590 6734 5967 gene locus_tag LOCUS_43600 6734 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173673.1 protein_id gnl|my_center|LOCUS_43600 7243 6806 gene locus_tag LOCUS_43610 7243 6806 CDS product DUF1489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531780.1 protein_id gnl|my_center|LOCUS_43610 8722 7319 gene locus_tag LOCUS_43620 8722 7319 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531781.1 protein_id gnl|my_center|LOCUS_43620 9396 9602 gene locus_tag LOCUS_43630 9396 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 9645 10382 gene locus_tag LOCUS_43640 9645 10382 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531782.1 protein_id gnl|my_center|LOCUS_43640 11128 10337 gene locus_tag LOCUS_43650 11128 10337 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531783.1 protein_id gnl|my_center|LOCUS_43650 12067 11258 gene locus_tag LOCUS_43660 12067 11258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43660 12836 11997 gene locus_tag LOCUS_43670 12836 11997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43670 12140 12149 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13294 12836 gene locus_tag LOCUS_43680 13294 12836 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531786.1 protein_id gnl|my_center|LOCUS_43680 13589 13302 gene locus_tag LOCUS_43690 gene gatC 13589 13302 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531787.1 protein_id gnl|my_center|LOCUS_43690 14093 13677 gene locus_tag LOCUS_43700 14093 13677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827391.1 protein_id gnl|my_center|LOCUS_43700 14853 14146 gene locus_tag LOCUS_43710 14853 14146 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531789.1 protein_id gnl|my_center|LOCUS_43710 15026 15463 gene locus_tag LOCUS_43720 gene ruvX 15026 15463 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531790.1 protein_id gnl|my_center|LOCUS_43720 15722 15396 gene locus_tag LOCUS_43730 15722 15396 CDS product DUF6105 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531791.1 protein_id gnl|my_center|LOCUS_43730 16282 15722 gene locus_tag LOCUS_43740 16282 15722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531792.1 protein_id gnl|my_center|LOCUS_43740 18062 16434 gene locus_tag LOCUS_43750 18062 16434 CDS product DNA alkylation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531793.1 protein_id gnl|my_center|LOCUS_43750 18221 19186 gene locus_tag LOCUS_43760 18221 19186 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531794.1 protein_id gnl|my_center|LOCUS_43760 19183 20469 gene locus_tag LOCUS_43770 19183 20469 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531795.1 protein_id gnl|my_center|LOCUS_43770 >Feature sequence106 <1 681 gene locus_tag LOCUS_43780 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529914.1:HugZ family protein 841 1179 gene locus_tag LOCUS_43790 841 1179 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529913.1 protein_id gnl|my_center|LOCUS_43790 1291 2088 gene locus_tag LOCUS_43800 1291 2088 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529912.1 protein_id gnl|my_center|LOCUS_43800 2365 2036 gene locus_tag LOCUS_43810 2365 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 3444 2407 gene locus_tag LOCUS_43820 3444 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529911.1 protein_id gnl|my_center|LOCUS_43820 3468 3477 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4222 3641 gene locus_tag LOCUS_43830 4222 3641 CDS product DUF1134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529910.1 protein_id gnl|my_center|LOCUS_43830 4585 5214 gene locus_tag LOCUS_43840 4585 5214 CDS product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529909.1 protein_id gnl|my_center|LOCUS_43840 5403 5831 gene locus_tag LOCUS_43850 5403 5831 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529908.1 protein_id gnl|my_center|LOCUS_43850 6611 5916 gene locus_tag LOCUS_43860 gene ctrA 6611 5916 CDS product cell cycle two-component system response regulator CtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203583.1 protein_id gnl|my_center|LOCUS_43860 7061 7438 gene locus_tag LOCUS_43870 7061 7438 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529907.1 protein_id gnl|my_center|LOCUS_43870 7910 7506 gene locus_tag LOCUS_43880 7910 7506 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529906.1 protein_id gnl|my_center|LOCUS_43880 8000 8926 gene locus_tag LOCUS_43890 8000 8926 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529905.1 protein_id gnl|my_center|LOCUS_43890 9270 8995 gene locus_tag LOCUS_43900 9270 8995 CDS product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529904.1 protein_id gnl|my_center|LOCUS_43900 9693 9505 gene locus_tag LOCUS_43910 9693 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 9705 10739 gene locus_tag LOCUS_43920 gene mnmA 9705 10739 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529903.1 protein_id gnl|my_center|LOCUS_43920 9712 9721 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11747 10782 gene locus_tag LOCUS_43930 11747 10782 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529902.1 protein_id gnl|my_center|LOCUS_43930 11988 12064 gene locus_tag LOCUS_t00300 11988 12064 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12787 12485 gene locus_tag LOCUS_43940 12787 12485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 13372 13184 gene locus_tag LOCUS_43950 13372 13184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 13404 13413 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13470 14222 gene locus_tag LOCUS_43960 13470 14222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43960 15163 14285 gene locus_tag LOCUS_43970 15163 14285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 15296 20116 gene locus_tag LOCUS_43980 15296 20116 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123147513.1 protein_id gnl|my_center|LOCUS_43980 <20908 20165 gene locus_tag LOCUS_43990 <20908 20165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061606.1:NAD-dependent succinate-semialdehyde dehydrogenase >Feature sequence107 1287 481 gene locus_tag LOCUS_44000 1287 481 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529629.1 protein_id gnl|my_center|LOCUS_44000 1679 1287 gene locus_tag LOCUS_44010 gene cdd 1679 1287 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529630.1 protein_id gnl|my_center|LOCUS_44010 2706 1735 gene locus_tag LOCUS_44020 2706 1735 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529631.1 protein_id gnl|my_center|LOCUS_44020 3847 2708 gene locus_tag LOCUS_44030 3847 2708 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529632.1 protein_id gnl|my_center|LOCUS_44030 5376 3844 gene locus_tag LOCUS_44040 5376 3844 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529633.1 protein_id gnl|my_center|LOCUS_44040 5583 5792 gene locus_tag LOCUS_44050 5583 5792 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529634.1 protein_id gnl|my_center|LOCUS_44050 5809 6297 gene locus_tag LOCUS_44060 5809 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 6086 6095 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7300 6311 gene locus_tag LOCUS_44070 7300 6311 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529637.1 protein_id gnl|my_center|LOCUS_44070 7836 7540 gene locus_tag LOCUS_44080 7836 7540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 7552 7561 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8671 7952 gene locus_tag LOCUS_44090 8671 7952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173080.1 protein_id gnl|my_center|LOCUS_44090 8054 8063 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9021 9110 gene locus_tag LOCUS_t00310 9021 9110 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9531 11279 gene locus_tag LOCUS_44100 9531 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 11727 13445 gene locus_tag LOCUS_44110 11727 13445 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095484220.1 protein_id gnl|my_center|LOCUS_44110 14678 13749 gene locus_tag LOCUS_44120 14678 13749 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532410.1 protein_id gnl|my_center|LOCUS_44120 14795 15253 gene locus_tag LOCUS_44130 14795 15253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 15714 16733 gene locus_tag LOCUS_44140 15714 16733 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168991739.1 protein_id gnl|my_center|LOCUS_44140 17202 16765 gene locus_tag LOCUS_44150 17202 16765 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061352.1 protein_id gnl|my_center|LOCUS_44150 17416 17796 gene locus_tag LOCUS_44160 17416 17796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531523.1 protein_id gnl|my_center|LOCUS_44160 18406 17942 gene locus_tag LOCUS_44170 18406 17942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531527.1 protein_id gnl|my_center|LOCUS_44170 18615 18830 gene locus_tag LOCUS_44180 18615 18830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 18940 19170 gene locus_tag LOCUS_44190 18940 19170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 19289 19477 gene locus_tag LOCUS_44200 19289 19477 CDS product DUF3606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526775.1 protein_id gnl|my_center|LOCUS_44200 19985 19500 gene locus_tag LOCUS_44210 19985 19500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528751.1 protein_id gnl|my_center|LOCUS_44210 20174 20539 gene locus_tag LOCUS_44220 20174 20539 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528752.1 protein_id gnl|my_center|LOCUS_44220 >Feature sequence108 2730 13 gene locus_tag LOCUS_44230 2730 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 3064 2735 gene locus_tag LOCUS_44240 gene nirD 3064 2735 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530461.1 protein_id gnl|my_center|LOCUS_44240 5753 3303 gene locus_tag LOCUS_44250 gene nirB 5753 3303 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530460.1 protein_id gnl|my_center|LOCUS_44250 7015 5774 gene locus_tag LOCUS_44260 7015 5774 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525898.1 protein_id gnl|my_center|LOCUS_44260 7323 7126 gene locus_tag LOCUS_44270 7323 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 8523 7726 gene locus_tag LOCUS_44280 8523 7726 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530459.1 protein_id gnl|my_center|LOCUS_44280 9121 8534 gene locus_tag LOCUS_44290 9121 8534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44290 9354 9115 gene locus_tag LOCUS_44300 9354 9115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44300 9149 9158 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10803 9487 gene locus_tag LOCUS_44310 10803 9487 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530457.1 protein_id gnl|my_center|LOCUS_44310 12274 11381 gene locus_tag LOCUS_44320 12274 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 13620 12379 gene locus_tag LOCUS_44330 13620 12379 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160926.1 protein_id gnl|my_center|LOCUS_44330 14225 13623 gene locus_tag LOCUS_44340 14225 13623 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530455.1 protein_id gnl|my_center|LOCUS_44340 15791 15015 gene locus_tag LOCUS_44350 15791 15015 CDS product type-2 restriction enzyme DpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418960.1 protein_id gnl|my_center|LOCUS_44350 15873 16154 gene locus_tag LOCUS_44360 15873 16154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 17690 16257 gene locus_tag LOCUS_44370 17690 16257 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530546.1 protein_id gnl|my_center|LOCUS_44370 17988 18629 gene locus_tag LOCUS_44380 17988 18629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44380 18420 18429 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18547 19038 gene locus_tag LOCUS_44390 18547 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44390 19586 19089 gene locus_tag LOCUS_44400 19586 19089 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530535.1 protein_id gnl|my_center|LOCUS_44400 20299 19691 gene locus_tag LOCUS_44410 20299 19691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 >Feature sequence109 <1 1493 gene locus_tag LOCUS_44420 <1 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000446981.1:glycosyltransferase family 2 protein 1720 2007 gene locus_tag LOCUS_44430 1720 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 3047 2043 gene locus_tag LOCUS_44440 3047 2043 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984085.1 protein_id gnl|my_center|LOCUS_44440 3189 4592 gene locus_tag LOCUS_44450 3189 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 4476 4485 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4486 6483 gene locus_tag LOCUS_44460 4486 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 6567 7343 gene locus_tag LOCUS_44470 6567 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 8609 7395 gene locus_tag LOCUS_44480 8609 7395 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337698.1 protein_id gnl|my_center|LOCUS_44480 9856 8606 gene locus_tag LOCUS_44490 9856 8606 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007445862.1 protein_id gnl|my_center|LOCUS_44490 9437 9446 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10225 9905 gene locus_tag LOCUS_44500 10225 9905 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530552.1 protein_id gnl|my_center|LOCUS_44500 10364 10966 gene locus_tag LOCUS_44510 10364 10966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085872.1 protein_id gnl|my_center|LOCUS_44510 11414 10992 gene locus_tag LOCUS_44520 gene arsC 11414 10992 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530551.1 protein_id gnl|my_center|LOCUS_44520 12094 11411 gene locus_tag LOCUS_44530 12094 11411 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398893.1 protein_id gnl|my_center|LOCUS_44530 12452 12120 gene locus_tag LOCUS_44540 12452 12120 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530549.1 protein_id gnl|my_center|LOCUS_44540 13143 12463 gene locus_tag LOCUS_44550 13143 12463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 13616 13248 gene locus_tag LOCUS_44560 13616 13248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 13712 14188 gene locus_tag LOCUS_44570 13712 14188 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095485158.1 protein_id gnl|my_center|LOCUS_44570 14432 15544 gene locus_tag LOCUS_44580 14432 15544 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 protein_id gnl|my_center|LOCUS_44580 16606 15590 gene locus_tag LOCUS_44590 16606 15590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 17748 16603 gene locus_tag LOCUS_44600 17748 16603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957428.1 protein_id gnl|my_center|LOCUS_44600 18299 17745 gene locus_tag LOCUS_44610 18299 17745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44610 18397 18406 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18986 18420 gene locus_tag LOCUS_44620 18986 18420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44620 19819 18983 gene locus_tag LOCUS_44630 19819 18983 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037580.1 protein_id gnl|my_center|LOCUS_44630 <20685 19816 gene locus_tag LOCUS_44640 <20685 19816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011837707.1:NAD(P)-dependent oxidoreductase >Feature sequence110 215 224 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2080 962 gene locus_tag LOCUS_44650 2080 962 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976291.1 protein_id gnl|my_center|LOCUS_44650 2943 2086 gene locus_tag LOCUS_44660 2943 2086 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331590.1 protein_id gnl|my_center|LOCUS_44660 3873 2953 gene locus_tag LOCUS_44670 3873 2953 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976293.1 protein_id gnl|my_center|LOCUS_44670 5468 4026 gene locus_tag LOCUS_44680 5468 4026 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254855.1 protein_id gnl|my_center|LOCUS_44680 6488 5514 gene locus_tag LOCUS_44690 6488 5514 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393170.1 protein_id gnl|my_center|LOCUS_44690 6692 7417 gene locus_tag LOCUS_44700 6692 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 8447 7446 gene locus_tag LOCUS_44710 8447 7446 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467385.1 protein_id gnl|my_center|LOCUS_44710 10678 8375 gene locus_tag LOCUS_44720 10678 8375 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029876.1 protein_id gnl|my_center|LOCUS_44720 11557 10682 gene locus_tag LOCUS_44730 11557 10682 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44730 11775 11446 gene locus_tag LOCUS_44740 11775 11446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44740 11561 11570 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13222 11795 gene locus_tag LOCUS_44750 13222 11795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 13084 13093 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14619 13219 gene locus_tag LOCUS_44760 14619 13219 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850841.1 protein_id gnl|my_center|LOCUS_44760 16154 14763 gene locus_tag LOCUS_44770 16154 14763 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113030.1 protein_id gnl|my_center|LOCUS_44770 16305 17057 gene locus_tag LOCUS_44780 16305 17057 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528553.1 protein_id gnl|my_center|LOCUS_44780 17338 17505 gene locus_tag LOCUS_44790 17338 17505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 17601 18710 gene locus_tag LOCUS_44800 17601 18710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 18674 18683 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence111 3461 2736 gene locus_tag LOCUS_44810 gene phbB 3461 2736 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529183.1 protein_id gnl|my_center|LOCUS_44810 4764 3580 gene locus_tag LOCUS_44820 4764 3580 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529184.1 protein_id gnl|my_center|LOCUS_44820 5066 5677 gene locus_tag LOCUS_44830 gene phaR 5066 5677 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529185.1 protein_id gnl|my_center|LOCUS_44830 6931 5777 gene locus_tag LOCUS_44840 6931 5777 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529186.1 protein_id gnl|my_center|LOCUS_44840 7029 8132 gene locus_tag LOCUS_44850 7029 8132 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529187.1 protein_id gnl|my_center|LOCUS_44850 8341 9471 gene locus_tag LOCUS_44860 8341 9471 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529189.1 protein_id gnl|my_center|LOCUS_44860 10221 9499 gene locus_tag LOCUS_44870 10221 9499 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529190.1 protein_id gnl|my_center|LOCUS_44870 10220 10681 gene locus_tag LOCUS_44880 10220 10681 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529191.1 protein_id gnl|my_center|LOCUS_44880 10684 12957 gene locus_tag LOCUS_44890 10684 12957 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529192.1 protein_id gnl|my_center|LOCUS_44890 12972 13562 gene locus_tag LOCUS_44900 12972 13562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529193.1 protein_id gnl|my_center|LOCUS_44900 13808 14896 gene locus_tag LOCUS_44910 13808 14896 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529194.1 protein_id gnl|my_center|LOCUS_44910 14970 18140 gene locus_tag LOCUS_44920 14970 18140 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529195.1 protein_id gnl|my_center|LOCUS_44920 18238 18396 gene locus_tag LOCUS_44930 18238 18396 CDS product DUF3309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529196.1 protein_id gnl|my_center|LOCUS_44930 19404 18445 gene locus_tag LOCUS_44940 19404 18445 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529197.1 protein_id gnl|my_center|LOCUS_44940 19070 19079 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence112 1122 2048 gene locus_tag LOCUS_44950 1122 2048 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528681.1 protein_id gnl|my_center|LOCUS_44950 2045 2806 gene locus_tag LOCUS_44960 2045 2806 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528680.1 protein_id gnl|my_center|LOCUS_44960 3852 2815 gene locus_tag LOCUS_44970 3852 2815 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528679.1 protein_id gnl|my_center|LOCUS_44970 4117 4608 gene locus_tag LOCUS_44980 4117 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 4605 5285 gene locus_tag LOCUS_44990 4605 5285 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967556.1 protein_id gnl|my_center|LOCUS_44990 5637 5413 gene locus_tag LOCUS_45000 5637 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528677.1 protein_id gnl|my_center|LOCUS_45000 7786 5783 gene locus_tag LOCUS_45010 7786 5783 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528676.1 protein_id gnl|my_center|LOCUS_45010 8133 8471 gene locus_tag LOCUS_45020 8133 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528672.1 protein_id gnl|my_center|LOCUS_45020 8488 9189 gene locus_tag LOCUS_45030 8488 9189 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528671.1 protein_id gnl|my_center|LOCUS_45030 9281 9550 gene locus_tag LOCUS_45040 9281 9550 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528670.1 protein_id gnl|my_center|LOCUS_45040 9680 11383 gene locus_tag LOCUS_45050 9680 11383 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528669.1 protein_id gnl|my_center|LOCUS_45050 12087 11428 gene locus_tag LOCUS_45060 12087 11428 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528668.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45060 12400 13197 gene locus_tag LOCUS_45070 12400 13197 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528667.1 protein_id gnl|my_center|LOCUS_45070 13999 13199 gene locus_tag LOCUS_45080 13999 13199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 protein_id gnl|my_center|LOCUS_45080 14990 14049 gene locus_tag LOCUS_45090 14990 14049 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528660.1 protein_id gnl|my_center|LOCUS_45090 15460 14987 gene locus_tag LOCUS_45100 15460 14987 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528659.1 protein_id gnl|my_center|LOCUS_45100 15552 16295 gene locus_tag LOCUS_45110 15552 16295 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528658.1 protein_id gnl|my_center|LOCUS_45110 16292 17245 gene locus_tag LOCUS_45120 16292 17245 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528657.1 protein_id gnl|my_center|LOCUS_45120 17242 18162 gene locus_tag LOCUS_45130 17242 18162 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528656.1 protein_id gnl|my_center|LOCUS_45130 18171 19307 gene locus_tag LOCUS_45140 18171 19307 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528655.1 protein_id gnl|my_center|LOCUS_45140 >Feature sequence113 685 449 gene locus_tag LOCUS_45150 685 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 859 1842 gene locus_tag LOCUS_45160 859 1842 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528652.1 protein_id gnl|my_center|LOCUS_45160 2196 1852 gene locus_tag LOCUS_45170 2196 1852 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528651.1 protein_id gnl|my_center|LOCUS_45170 2561 2193 gene locus_tag LOCUS_45180 2561 2193 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528650.1 protein_id gnl|my_center|LOCUS_45180 2734 3408 gene locus_tag LOCUS_45190 2734 3408 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528648.1 protein_id gnl|my_center|LOCUS_45190 4955 3423 gene locus_tag LOCUS_45200 4955 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45200 5949 4891 gene locus_tag LOCUS_45210 5949 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45210 5116 5125 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6825 5962 gene locus_tag LOCUS_45220 6825 5962 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528646.1 protein_id gnl|my_center|LOCUS_45220 7189 7335 gene locus_tag LOCUS_45230 7189 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528645.1 protein_id gnl|my_center|LOCUS_45230 7515 7967 gene locus_tag LOCUS_45240 7515 7967 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528644.1 protein_id gnl|my_center|LOCUS_45240 8183 8542 gene locus_tag LOCUS_45250 8183 8542 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528640.1 protein_id gnl|my_center|LOCUS_45250 8550 9581 gene locus_tag LOCUS_45260 8550 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45260 9544 9804 gene locus_tag LOCUS_45270 9544 9804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45270 10584 9964 gene locus_tag LOCUS_45280 10584 9964 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528638.1 protein_id gnl|my_center|LOCUS_45280 11697 10717 gene locus_tag LOCUS_45290 gene cysK 11697 10717 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528637.1 protein_id gnl|my_center|LOCUS_45290 12506 11889 gene locus_tag LOCUS_45300 12506 11889 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528636.1 protein_id gnl|my_center|LOCUS_45300 13983 12643 gene locus_tag LOCUS_45310 13983 12643 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528635.1 protein_id gnl|my_center|LOCUS_45310 14303 14106 gene locus_tag LOCUS_45320 14303 14106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528634.1 protein_id gnl|my_center|LOCUS_45320 15532 14450 gene locus_tag LOCUS_45330 gene hrcA 15532 14450 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528633.1 protein_id gnl|my_center|LOCUS_45330 15675 16391 gene locus_tag LOCUS_45340 gene rph 15675 16391 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528632.1 protein_id gnl|my_center|LOCUS_45340 16575 16985 gene locus_tag LOCUS_45350 16575 16985 CDS product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528631.1 protein_id gnl|my_center|LOCUS_45350 16985 17632 gene locus_tag LOCUS_45360 gene rdgB 16985 17632 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528630.1 protein_id gnl|my_center|LOCUS_45360 17634 18791 gene locus_tag LOCUS_45370 gene hemW 17634 18791 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528629.1 protein_id gnl|my_center|LOCUS_45370 18844 19164 gene locus_tag LOCUS_45380 18844 19164 CDS product low molecular weight protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528628.1 protein_id gnl|my_center|LOCUS_45380 19407 19219 gene locus_tag LOCUS_45390 19407 19219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 19609 19415 gene locus_tag LOCUS_45400 19609 19415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 >Feature sequence114 2158 197 gene locus_tag LOCUS_45410 2158 197 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173803.1 protein_id gnl|my_center|LOCUS_45410 2554 2653 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3263 3529 gene locus_tag LOCUS_45420 3263 3529 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529470.1 protein_id gnl|my_center|LOCUS_45420 3561 3848 gene locus_tag LOCUS_45430 3561 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 4456 5937 gene locus_tag LOCUS_r00010 4456 5937 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 6260 6336 gene locus_tag LOCUS_t00320 6260 6336 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 6382 6457 gene locus_tag LOCUS_t00330 6382 6457 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6876 9667 gene locus_tag LOCUS_r00020 6876 9667 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 9858 9967 gene locus_tag LOCUS_r00030 9858 9967 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 10122 10198 gene locus_tag LOCUS_t00340 10122 10198 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10344 10985 gene locus_tag LOCUS_45440 10344 10985 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067164.1 protein_id gnl|my_center|LOCUS_45440 11542 11192 gene locus_tag LOCUS_45450 11542 11192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969816.1 protein_id gnl|my_center|LOCUS_45450 12470 12000 gene locus_tag LOCUS_45460 12470 12000 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173672.1 protein_id gnl|my_center|LOCUS_45460 13974 12619 gene locus_tag LOCUS_45470 13974 12619 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532930.1 protein_id gnl|my_center|LOCUS_45470 14927 14229 gene locus_tag LOCUS_45480 14927 14229 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114140.1 protein_id gnl|my_center|LOCUS_45480 15869 15087 gene locus_tag LOCUS_45490 15869 15087 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530311.1 protein_id gnl|my_center|LOCUS_45490 16045 17229 gene locus_tag LOCUS_45500 gene uxuA 16045 17229 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530312.1 protein_id gnl|my_center|LOCUS_45500 19110 17278 gene locus_tag LOCUS_45510 gene atzF 19110 17278 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243176.1 protein_id gnl|my_center|LOCUS_45510 17338 17347 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19457 19107 gene locus_tag LOCUS_45520 19457 19107 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243177.1 protein_id gnl|my_center|LOCUS_45520 >Feature sequence115 258 926 gene locus_tag LOCUS_45530 258 926 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532377.1 protein_id gnl|my_center|LOCUS_45530 953 1873 gene locus_tag LOCUS_45540 953 1873 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532378.1 protein_id gnl|my_center|LOCUS_45540 2584 2375 gene locus_tag LOCUS_45550 2584 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 2865 3059 gene locus_tag LOCUS_45560 2865 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 3316 3119 gene locus_tag LOCUS_45570 3316 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530624.1 protein_id gnl|my_center|LOCUS_45570 3693 3394 gene locus_tag LOCUS_45580 3693 3394 CDS product DUF1236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525105.1 protein_id gnl|my_center|LOCUS_45580 4178 4471 gene locus_tag LOCUS_45590 4178 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531582.1 protein_id gnl|my_center|LOCUS_45590 4614 4823 gene locus_tag LOCUS_45600 4614 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 5846 4908 gene locus_tag LOCUS_45610 5846 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 6165 6404 gene locus_tag LOCUS_45620 6165 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 6434 6667 gene locus_tag LOCUS_45630 6434 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 8693 6687 gene locus_tag LOCUS_45640 8693 6687 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530759.1 protein_id gnl|my_center|LOCUS_45640 9398 8856 gene locus_tag LOCUS_45650 9398 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457970.1 protein_id gnl|my_center|LOCUS_45650 9956 9603 gene locus_tag LOCUS_45660 9956 9603 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529346.1 protein_id gnl|my_center|LOCUS_45660 10335 12311 gene locus_tag LOCUS_45670 10335 12311 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530593.1 protein_id gnl|my_center|LOCUS_45670 13087 12413 gene locus_tag LOCUS_45680 13087 12413 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967809.1 protein_id gnl|my_center|LOCUS_45680 13457 14995 gene locus_tag LOCUS_45690 13457 14995 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965761.1 protein_id gnl|my_center|LOCUS_45690 15274 15588 gene locus_tag LOCUS_45700 15274 15588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 15941 16318 gene locus_tag LOCUS_45710 15941 16318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 16589 17332 gene locus_tag LOCUS_45720 16589 17332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45720 17249 17258 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17268 17882 gene locus_tag LOCUS_45730 17268 17882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45730 18057 18602 gene locus_tag LOCUS_45740 18057 18602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45740 18568 18855 gene locus_tag LOCUS_45750 18568 18855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 19561 18965 gene locus_tag LOCUS_45760 19561 18965 CDS product DUF6456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530588.1 protein_id gnl|my_center|LOCUS_45760 >Feature sequence116 442 1335 gene locus_tag LOCUS_45770 442 1335 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529359.1 protein_id gnl|my_center|LOCUS_45770 2927 1377 gene locus_tag LOCUS_45780 2927 1377 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529360.1 protein_id gnl|my_center|LOCUS_45780 4252 2939 gene locus_tag LOCUS_45790 4252 2939 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529361.1 protein_id gnl|my_center|LOCUS_45790 6219 4270 gene locus_tag LOCUS_45800 6219 4270 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529362.1 protein_id gnl|my_center|LOCUS_45800 6136 6390 gene locus_tag LOCUS_45810 6136 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 6583 7395 gene locus_tag LOCUS_45820 6583 7395 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529363.1 protein_id gnl|my_center|LOCUS_45820 7552 9105 gene locus_tag LOCUS_45830 7552 9105 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529364.1 protein_id gnl|my_center|LOCUS_45830 9431 9129 gene locus_tag LOCUS_45840 9431 9129 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529365.1 protein_id gnl|my_center|LOCUS_45840 9611 10240 gene locus_tag LOCUS_45850 9611 10240 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529366.1 protein_id gnl|my_center|LOCUS_45850 10364 11350 gene locus_tag LOCUS_45860 gene cobS 10364 11350 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529367.1 protein_id gnl|my_center|LOCUS_45860 11361 11831 gene locus_tag LOCUS_45870 11361 11831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109671609.1 protein_id gnl|my_center|LOCUS_45870 11841 13739 gene locus_tag LOCUS_45880 gene cobT 11841 13739 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529369.1 protein_id gnl|my_center|LOCUS_45880 13745 14758 gene locus_tag LOCUS_45890 13745 14758 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529370.1 protein_id gnl|my_center|LOCUS_45890 15379 14768 gene locus_tag LOCUS_45900 15379 14768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529371.1 protein_id gnl|my_center|LOCUS_45900 16179 15499 gene locus_tag LOCUS_45910 16179 15499 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529372.1 protein_id gnl|my_center|LOCUS_45910 16616 16320 gene locus_tag LOCUS_45920 gene rpmB 16616 16320 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529373.1 protein_id gnl|my_center|LOCUS_45920 16867 17673 gene locus_tag LOCUS_45930 16867 17673 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529374.1 protein_id gnl|my_center|LOCUS_45930 17702 18589 gene locus_tag LOCUS_45940 17702 18589 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529375.1 protein_id gnl|my_center|LOCUS_45940 18586 19257 gene locus_tag LOCUS_45950 18586 19257 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529376.1 protein_id gnl|my_center|LOCUS_45950 19520 19254 gene locus_tag LOCUS_45960 19520 19254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 >Feature sequence117 335 344 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 362 994 gene locus_tag LOCUS_45970 362 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45970 1096 2418 gene locus_tag LOCUS_45980 1096 2418 CDS product ActS/PrrB/RegB family redox-sensitive histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528073.1 protein_id gnl|my_center|LOCUS_45980 2565 3101 gene locus_tag LOCUS_45990 2565 3101 CDS product ActR/PrrA/RegA family redox response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528072.1 protein_id gnl|my_center|LOCUS_45990 3450 4637 gene locus_tag LOCUS_46000 gene nhaA 3450 4637 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528071.1 protein_id gnl|my_center|LOCUS_46000 5668 4634 gene locus_tag LOCUS_46010 5668 4634 CDS product RNA polymerase subunit sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203909262.1 protein_id gnl|my_center|LOCUS_46010 6457 5711 gene locus_tag LOCUS_46020 6457 5711 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141228.1 protein_id gnl|my_center|LOCUS_46020 7409 6897 gene locus_tag LOCUS_46030 7409 6897 CDS product MmcB family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050596417.1 protein_id gnl|my_center|LOCUS_46030 7533 7460 gene locus_tag LOCUS_t00350 7533 7460 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 8372 8590 gene locus_tag LOCUS_46040 8372 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 8895 8629 gene locus_tag LOCUS_46050 8895 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46050 9731 9315 gene locus_tag LOCUS_46060 gene cueR 9731 9315 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 protein_id gnl|my_center|LOCUS_46060 9959 10576 gene locus_tag LOCUS_46070 9959 10576 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528066.1 protein_id gnl|my_center|LOCUS_46070 11307 10738 gene locus_tag LOCUS_46080 11307 10738 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528064.1 protein_id gnl|my_center|LOCUS_46080 12075 11584 gene locus_tag LOCUS_46090 12075 11584 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528063.1 protein_id gnl|my_center|LOCUS_46090 12621 12178 gene locus_tag LOCUS_46100 12621 12178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46100 13238 12618 gene locus_tag LOCUS_46110 13238 12618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46110 12626 12635 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15220 13622 gene locus_tag LOCUS_46120 gene murJ 15220 13622 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528061.1 protein_id gnl|my_center|LOCUS_46120 18062 15261 gene locus_tag LOCUS_46130 18062 15261 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528060.1 protein_id gnl|my_center|LOCUS_46130 >Feature sequence118 764 324 gene locus_tag LOCUS_46140 764 324 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529580.1 protein_id gnl|my_center|LOCUS_46140 1141 761 gene locus_tag LOCUS_46150 1141 761 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529579.1 protein_id gnl|my_center|LOCUS_46150 1932 1234 gene locus_tag LOCUS_46160 1932 1234 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529578.1 protein_id gnl|my_center|LOCUS_46160 2663 2046 gene locus_tag LOCUS_46170 gene prfH 2663 2046 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107793.1 protein_id gnl|my_center|LOCUS_46170 3873 2650 gene locus_tag LOCUS_46180 3873 2650 CDS product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074621948.1 protein_id gnl|my_center|LOCUS_46180 4156 5241 gene locus_tag LOCUS_46190 4156 5241 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529577.1 protein_id gnl|my_center|LOCUS_46190 5242 6090 gene locus_tag LOCUS_46200 5242 6090 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529576.1 protein_id gnl|my_center|LOCUS_46200 6159 6641 gene locus_tag LOCUS_46210 gene lspA 6159 6641 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529575.1 protein_id gnl|my_center|LOCUS_46210 6696 7685 gene locus_tag LOCUS_46220 6696 7685 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529574.1 protein_id gnl|my_center|LOCUS_46220 7761 10064 gene locus_tag LOCUS_46230 7761 10064 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529573.1 protein_id gnl|my_center|LOCUS_46230 10247 11134 gene locus_tag LOCUS_46240 10247 11134 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529572.1 protein_id gnl|my_center|LOCUS_46240 11846 11214 gene locus_tag LOCUS_46250 11846 11214 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529571.1 protein_id gnl|my_center|LOCUS_46250 12586 11951 gene locus_tag LOCUS_46260 gene grpE 12586 11951 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529570.1 protein_id gnl|my_center|LOCUS_46260 12815 13015 gene locus_tag LOCUS_46270 12815 13015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529569.1 protein_id gnl|my_center|LOCUS_46270 13796 13176 gene locus_tag LOCUS_46280 13796 13176 CDS product DJ-1/PfpI/YhbO family deglycase/protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535280.1 protein_id gnl|my_center|LOCUS_46280 15594 13987 gene locus_tag LOCUS_46290 15594 13987 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 protein_id gnl|my_center|LOCUS_46290 16216 15683 gene locus_tag LOCUS_46300 16216 15683 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529565.1 protein_id gnl|my_center|LOCUS_46300 17125 16361 gene locus_tag LOCUS_46310 17125 16361 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529564.1 protein_id gnl|my_center|LOCUS_46310 18770 17100 gene locus_tag LOCUS_46320 18770 17100 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529563.1 protein_id gnl|my_center|LOCUS_46320 19119 18814 gene locus_tag LOCUS_46330 19119 18814 CDS product DUF2849 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529562.1 protein_id gnl|my_center|LOCUS_46330 >Feature sequence119 1893 373 gene locus_tag LOCUS_46340 1893 373 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531714.1 protein_id gnl|my_center|LOCUS_46340 1969 2592 gene locus_tag LOCUS_46350 1969 2592 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063167987.1 protein_id gnl|my_center|LOCUS_46350 2623 3234 gene locus_tag LOCUS_46360 2623 3234 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_46360 3242 3859 gene locus_tag LOCUS_46370 3242 3859 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531711.1 protein_id gnl|my_center|LOCUS_46370 4005 4496 gene locus_tag LOCUS_46380 4005 4496 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205209.1 protein_id gnl|my_center|LOCUS_46380 5118 4549 gene locus_tag LOCUS_46390 5118 4549 CDS product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531710.1 protein_id gnl|my_center|LOCUS_46390 5551 5165 gene locus_tag LOCUS_46400 5551 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 6407 5703 gene locus_tag LOCUS_46410 6407 5703 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531709.1 protein_id gnl|my_center|LOCUS_46410 7284 6415 gene locus_tag LOCUS_46420 7284 6415 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531708.1 protein_id gnl|my_center|LOCUS_46420 8228 7398 gene locus_tag LOCUS_46430 8228 7398 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531707.1 protein_id gnl|my_center|LOCUS_46430 8938 8225 gene locus_tag LOCUS_46440 8938 8225 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531706.1 protein_id gnl|my_center|LOCUS_46440 9017 9026 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9832 9050 gene locus_tag LOCUS_46450 9832 9050 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531705.1 protein_id gnl|my_center|LOCUS_46450 10553 10044 gene locus_tag LOCUS_46460 gene mobB 10553 10044 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531704.1 protein_id gnl|my_center|LOCUS_46460 11176 10550 gene locus_tag LOCUS_46470 gene mobA 11176 10550 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531703.1 protein_id gnl|my_center|LOCUS_46470 12162 11233 gene locus_tag LOCUS_46480 12162 11233 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531702.1 protein_id gnl|my_center|LOCUS_46480 12630 12274 gene locus_tag LOCUS_46490 12630 12274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531701.1 protein_id gnl|my_center|LOCUS_46490 13225 12752 gene locus_tag LOCUS_46500 13225 12752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531700.1 protein_id gnl|my_center|LOCUS_46500 14275 13280 gene locus_tag LOCUS_46510 gene moaA 14275 13280 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531699.1 protein_id gnl|my_center|LOCUS_46510 14486 14839 gene locus_tag LOCUS_46520 14486 14839 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531698.1 protein_id gnl|my_center|LOCUS_46520 14913 15524 gene locus_tag LOCUS_46530 14913 15524 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531697.1 protein_id gnl|my_center|LOCUS_46530 16111 15659 gene locus_tag LOCUS_46540 16111 15659 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531696.1 protein_id gnl|my_center|LOCUS_46540 16159 17070 gene locus_tag LOCUS_46550 16159 17070 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531695.1 protein_id gnl|my_center|LOCUS_46550 17425 17078 gene locus_tag LOCUS_46560 17425 17078 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531694.1 protein_id gnl|my_center|LOCUS_46560 17427 17436 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence120 1124 267 gene locus_tag LOCUS_46570 1124 267 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532833.1 protein_id gnl|my_center|LOCUS_46570 1174 2037 gene locus_tag LOCUS_46580 1174 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 1352 1361 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2270 2046 gene locus_tag LOCUS_46590 2270 2046 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532831.1 protein_id gnl|my_center|LOCUS_46590 2423 3448 gene locus_tag LOCUS_46600 2423 3448 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532830.1 protein_id gnl|my_center|LOCUS_46600 3751 5523 gene locus_tag LOCUS_46610 3751 5523 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532826.1 protein_id gnl|my_center|LOCUS_46610 6036 5575 gene locus_tag LOCUS_46620 6036 5575 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532825.1 protein_id gnl|my_center|LOCUS_46620 6186 7130 gene locus_tag LOCUS_46630 6186 7130 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038645360.1 protein_id gnl|my_center|LOCUS_46630 7675 8712 gene locus_tag LOCUS_46640 7675 8712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 8671 8680 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8685 9728 gene locus_tag LOCUS_46650 8685 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 9895 10191 gene locus_tag LOCUS_46660 9895 10191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 10672 10283 gene locus_tag LOCUS_46670 10672 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502648.1 protein_id gnl|my_center|LOCUS_46670 11301 10807 gene locus_tag LOCUS_46680 11301 10807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532820.1 protein_id gnl|my_center|LOCUS_46680 11466 12449 gene locus_tag LOCUS_46690 11466 12449 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171643.1 protein_id gnl|my_center|LOCUS_46690 11952 11961 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12470 13912 gene locus_tag LOCUS_46700 12470 13912 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532818.1 protein_id gnl|my_center|LOCUS_46700 14097 14663 gene locus_tag LOCUS_46710 14097 14663 CDS product DUF6101 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532817.1 protein_id gnl|my_center|LOCUS_46710 15863 14880 gene locus_tag LOCUS_46720 gene ubiA 15863 14880 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173619.1 protein_id gnl|my_center|LOCUS_46720 16153 17451 gene locus_tag LOCUS_46730 gene purD 16153 17451 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532813.1 protein_id gnl|my_center|LOCUS_46730 18818 17448 gene locus_tag LOCUS_46740 18818 17448 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530194.1 protein_id gnl|my_center|LOCUS_46740 >Feature sequence121 1313 429 gene locus_tag LOCUS_46750 gene pdxY 1313 429 CDS product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528990.1 protein_id gnl|my_center|LOCUS_46750 1577 1326 gene locus_tag LOCUS_46760 1577 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528991.1 protein_id gnl|my_center|LOCUS_46760 1742 2380 gene locus_tag LOCUS_46770 1742 2380 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528992.1 protein_id gnl|my_center|LOCUS_46770 2607 3395 gene locus_tag LOCUS_46780 2607 3395 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528993.1 protein_id gnl|my_center|LOCUS_46780 3401 4039 gene locus_tag LOCUS_46790 3401 4039 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528995.1 protein_id gnl|my_center|LOCUS_46790 4159 4665 gene locus_tag LOCUS_46800 4159 4665 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528996.1 protein_id gnl|my_center|LOCUS_46800 4770 5312 gene locus_tag LOCUS_46810 gene ppa 4770 5312 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528997.1 protein_id gnl|my_center|LOCUS_46810 5952 5320 gene locus_tag LOCUS_46820 5952 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528998.1 protein_id gnl|my_center|LOCUS_46820 6573 5956 gene locus_tag LOCUS_46830 6573 5956 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528999.1 protein_id gnl|my_center|LOCUS_46830 6651 7952 gene locus_tag LOCUS_46840 6651 7952 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504198.1 protein_id gnl|my_center|LOCUS_46840 7699 7708 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8179 9789 gene locus_tag LOCUS_46850 8179 9789 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529001.1 protein_id gnl|my_center|LOCUS_46850 10238 9960 gene locus_tag LOCUS_46860 10238 9960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173302.1 protein_id gnl|my_center|LOCUS_46860 10371 12269 gene locus_tag LOCUS_46870 gene typA 10371 12269 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529003.1 protein_id gnl|my_center|LOCUS_46870 12952 12326 gene locus_tag LOCUS_46880 12952 12326 CDS product DUF1062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529004.1 protein_id gnl|my_center|LOCUS_46880 13370 13984 gene locus_tag LOCUS_46890 13370 13984 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529005.1 protein_id gnl|my_center|LOCUS_46890 14312 13989 gene locus_tag LOCUS_46900 14312 13989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529006.1 protein_id gnl|my_center|LOCUS_46900 15048 14461 gene locus_tag LOCUS_46910 15048 14461 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529007.1 protein_id gnl|my_center|LOCUS_46910 >Feature sequence122 1774 485 gene locus_tag LOCUS_46920 1774 485 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391726.1 protein_id gnl|my_center|LOCUS_46920 1391 1400 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1956 2762 gene locus_tag LOCUS_46930 1956 2762 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529089.1 protein_id gnl|my_center|LOCUS_46930 3039 3905 gene locus_tag LOCUS_46940 3039 3905 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090306.1 protein_id gnl|my_center|LOCUS_46940 3902 5128 gene locus_tag LOCUS_46950 3902 5128 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965997.1 protein_id gnl|my_center|LOCUS_46950 6366 5209 gene locus_tag LOCUS_46960 6366 5209 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086149.1 protein_id gnl|my_center|LOCUS_46960 6661 7023 gene locus_tag LOCUS_46970 6661 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 7002 7011 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7020 8141 gene locus_tag LOCUS_46980 7020 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 9221 8127 gene locus_tag LOCUS_46990 9221 8127 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086145.1 protein_id gnl|my_center|LOCUS_46990 10645 9218 gene locus_tag LOCUS_47000 10645 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 10868 13021 gene locus_tag LOCUS_47010 10868 13021 CDS product GumC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086146.1 protein_id gnl|my_center|LOCUS_47010 13025 14161 gene locus_tag LOCUS_47020 13025 14161 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965991.1 protein_id gnl|my_center|LOCUS_47020 14222 15751 gene locus_tag LOCUS_47030 14222 15751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 16696 15818 gene locus_tag LOCUS_47040 16696 15818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083777.1 protein_id gnl|my_center|LOCUS_47040 18067 16964 gene locus_tag LOCUS_47050 18067 16964 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063665.1 protein_id gnl|my_center|LOCUS_47050 18399 18408 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence123 280 289 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2408 1362 gene locus_tag LOCUS_47060 2408 1362 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975043.1 protein_id gnl|my_center|LOCUS_47060 3251 2424 gene locus_tag LOCUS_47070 3251 2424 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543285.1 protein_id gnl|my_center|LOCUS_47070 4114 3248 gene locus_tag LOCUS_47080 4114 3248 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197717.1 protein_id gnl|my_center|LOCUS_47080 4746 4222 gene locus_tag LOCUS_47090 4746 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47090 4646 5431 gene locus_tag LOCUS_47100 4646 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 4721 4730 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6649 5732 gene locus_tag LOCUS_47110 6649 5732 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432420.1 protein_id gnl|my_center|LOCUS_47110 6858 8261 gene locus_tag LOCUS_47120 6858 8261 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528421.1 protein_id gnl|my_center|LOCUS_47120 9108 8305 gene locus_tag LOCUS_47130 9108 8305 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525654.1 protein_id gnl|my_center|LOCUS_47130 9959 9105 gene locus_tag LOCUS_47140 9959 9105 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066630.1 protein_id gnl|my_center|LOCUS_47140 10993 9956 gene locus_tag LOCUS_47150 10993 9956 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329326.1 protein_id gnl|my_center|LOCUS_47150 12157 11069 gene locus_tag LOCUS_47160 12157 11069 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969978.1 protein_id gnl|my_center|LOCUS_47160 12875 12228 gene locus_tag LOCUS_47170 12875 12228 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528435.1 protein_id gnl|my_center|LOCUS_47170 13540 12872 gene locus_tag LOCUS_47180 13540 12872 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528436.1 protein_id gnl|my_center|LOCUS_47180 14452 13649 gene locus_tag LOCUS_47190 14452 13649 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528437.1 protein_id gnl|my_center|LOCUS_47190 15650 14532 gene locus_tag LOCUS_47200 gene speB 15650 14532 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528438.1 protein_id gnl|my_center|LOCUS_47200 15801 16775 gene locus_tag LOCUS_47210 gene gcvA 15801 16775 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528439.1 protein_id gnl|my_center|LOCUS_47210 16952 18256 gene locus_tag LOCUS_47220 gene pncB 16952 18256 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528440.1 protein_id gnl|my_center|LOCUS_47220 18350 18574 gene locus_tag LOCUS_47230 18350 18574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47230 >Feature sequence124 <1 2915 gene locus_tag LOCUS_47240 <1 2915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531051.1:efflux RND transporter permease subunit 2986 3591 gene locus_tag LOCUS_47250 gene nthA 2986 3591 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531052.1 protein_id gnl|my_center|LOCUS_47250 3605 4264 gene locus_tag LOCUS_47260 gene nthB 3605 4264 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531053.1 protein_id gnl|my_center|LOCUS_47260 4251 4604 gene locus_tag LOCUS_47270 4251 4604 CDS product nitrile hydratase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531054.1 protein_id gnl|my_center|LOCUS_47270 4613 5506 gene locus_tag LOCUS_47280 4613 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 5625 6800 gene locus_tag LOCUS_47290 5625 6800 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531055.1 protein_id gnl|my_center|LOCUS_47290 7214 6810 gene locus_tag LOCUS_47300 7214 6810 CDS product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531056.1 protein_id gnl|my_center|LOCUS_47300 7296 8069 gene locus_tag LOCUS_47310 7296 8069 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531057.1 protein_id gnl|my_center|LOCUS_47310 8173 8985 gene locus_tag LOCUS_47320 8173 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47320 8949 8958 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8979 10052 gene locus_tag LOCUS_47330 8979 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47330 10455 10111 gene locus_tag LOCUS_47340 10455 10111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47340 10969 10346 gene locus_tag LOCUS_47350 10969 10346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47350 11107 11517 gene locus_tag LOCUS_47360 11107 11517 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531060.1 protein_id gnl|my_center|LOCUS_47360 12682 11777 gene locus_tag LOCUS_47370 12682 11777 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531062.1 protein_id gnl|my_center|LOCUS_47370 12989 12684 gene locus_tag LOCUS_47380 12989 12684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 13088 13546 gene locus_tag LOCUS_47390 13088 13546 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531063.1 protein_id gnl|my_center|LOCUS_47390 13700 14362 gene locus_tag LOCUS_47400 13700 14362 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173714.1 protein_id gnl|my_center|LOCUS_47400 14493 15512 gene locus_tag LOCUS_47410 gene ilvC 14493 15512 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531065.1 protein_id gnl|my_center|LOCUS_47410 16115 15831 gene locus_tag LOCUS_47420 16115 15831 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532019.1 protein_id gnl|my_center|LOCUS_47420 16852 16277 gene locus_tag LOCUS_47430 16852 16277 CDS product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531066.1 protein_id gnl|my_center|LOCUS_47430 17020 18132 gene locus_tag LOCUS_47440 17020 18132 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531067.1 protein_id gnl|my_center|LOCUS_47440 >Feature sequence125 179 1231 gene locus_tag LOCUS_47450 179 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 1274 1939 gene locus_tag LOCUS_47460 1274 1939 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528838.1 protein_id gnl|my_center|LOCUS_47460 2009 2629 gene locus_tag LOCUS_47470 2009 2629 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528837.1 protein_id gnl|my_center|LOCUS_47470 2623 3195 gene locus_tag LOCUS_47480 2623 3195 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528836.1 protein_id gnl|my_center|LOCUS_47480 3334 3215 gene locus_tag LOCUS_47490 3334 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47490 3771 3349 gene locus_tag LOCUS_47500 3771 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47500 3459 3468 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4141 3839 gene locus_tag LOCUS_47510 4141 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47510 3847 3856 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4428 4595 gene locus_tag LOCUS_47520 4428 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528833.1 protein_id gnl|my_center|LOCUS_47520 5340 4756 gene locus_tag LOCUS_47530 5340 4756 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528832.1 protein_id gnl|my_center|LOCUS_47530 5552 5337 gene locus_tag LOCUS_47540 5552 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 6312 5647 gene locus_tag LOCUS_47550 gene ccmB 6312 5647 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528830.1 protein_id gnl|my_center|LOCUS_47550 7180 6524 gene locus_tag LOCUS_47560 gene ccmA 7180 6524 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528829.1 protein_id gnl|my_center|LOCUS_47560 7417 10107 gene locus_tag LOCUS_47570 gene acnA 7417 10107 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528828.1 protein_id gnl|my_center|LOCUS_47570 10874 10146 gene locus_tag LOCUS_47580 10874 10146 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528827.1 protein_id gnl|my_center|LOCUS_47580 11060 11833 gene locus_tag LOCUS_47590 11060 11833 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528826.1 protein_id gnl|my_center|LOCUS_47590 12223 12612 gene locus_tag LOCUS_47600 12223 12612 CDS product DUF2794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528825.1 protein_id gnl|my_center|LOCUS_47600 13352 12774 gene locus_tag LOCUS_47610 13352 12774 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528824.1 protein_id gnl|my_center|LOCUS_47610 14237 13458 gene locus_tag LOCUS_47620 14237 13458 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528823.1 protein_id gnl|my_center|LOCUS_47620 17527 14468 gene locus_tag LOCUS_47630 17527 14468 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528822.1 protein_id gnl|my_center|LOCUS_47630 17030 17039 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17658 18302 gene locus_tag LOCUS_47640 17658 18302 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528820.1 protein_id gnl|my_center|LOCUS_47640 >Feature sequence126 <1 646 gene locus_tag LOCUS_47650 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530111.1:metallophosphoesterase family protein 855 1691 gene locus_tag LOCUS_47660 855 1691 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173777.1 protein_id gnl|my_center|LOCUS_47660 1930 5433 gene locus_tag LOCUS_47670 gene carB 1930 5433 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530109.1 protein_id gnl|my_center|LOCUS_47670 5876 5484 gene locus_tag LOCUS_47680 5876 5484 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530107.1 protein_id gnl|my_center|LOCUS_47680 6428 5964 gene locus_tag LOCUS_47690 6428 5964 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086784.1 protein_id gnl|my_center|LOCUS_47690 7241 6690 gene locus_tag LOCUS_47700 7241 6690 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530103.1 protein_id gnl|my_center|LOCUS_47700 7385 7723 gene locus_tag LOCUS_47710 7385 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530101.1 protein_id gnl|my_center|LOCUS_47710 8450 7968 gene locus_tag LOCUS_47720 8450 7968 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530097.1 protein_id gnl|my_center|LOCUS_47720 9376 8456 gene locus_tag LOCUS_47730 9376 8456 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530096.1 protein_id gnl|my_center|LOCUS_47730 9552 10121 gene locus_tag LOCUS_47740 9552 10121 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530095.1 protein_id gnl|my_center|LOCUS_47740 10575 10135 gene locus_tag LOCUS_47750 10575 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530641.1 protein_id gnl|my_center|LOCUS_47750 11060 10734 gene locus_tag LOCUS_47760 11060 10734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530090.1 protein_id gnl|my_center|LOCUS_47760 11353 11565 gene locus_tag LOCUS_47770 11353 11565 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910991.1 protein_id gnl|my_center|LOCUS_47770 12519 11911 gene locus_tag LOCUS_47780 12519 11911 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530087.1 protein_id gnl|my_center|LOCUS_47780 13455 12595 gene locus_tag LOCUS_47790 13455 12595 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530086.1 protein_id gnl|my_center|LOCUS_47790 14351 13452 gene locus_tag LOCUS_47800 14351 13452 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530085.1 protein_id gnl|my_center|LOCUS_47800 14564 15766 gene locus_tag LOCUS_47810 14564 15766 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530084.1 protein_id gnl|my_center|LOCUS_47810 16204 15809 gene locus_tag LOCUS_47820 16204 15809 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530082.1 protein_id gnl|my_center|LOCUS_47820 16917 16366 gene locus_tag LOCUS_47830 16917 16366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 17066 17926 gene locus_tag LOCUS_47840 17066 17926 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530214.1 protein_id gnl|my_center|LOCUS_47840 >Feature sequence127 <1 660 gene locus_tag LOCUS_47850 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528556.1:aldehyde dehydrogenase 1234 668 gene locus_tag LOCUS_47860 1234 668 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530512.1 protein_id gnl|my_center|LOCUS_47860 1485 1267 gene locus_tag LOCUS_47870 1485 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 1367 2152 gene locus_tag LOCUS_47880 1367 2152 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530513.1 protein_id gnl|my_center|LOCUS_47880 2219 3220 gene locus_tag LOCUS_47890 2219 3220 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530514.1 protein_id gnl|my_center|LOCUS_47890 4453 3305 gene locus_tag LOCUS_47900 4453 3305 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530516.1 protein_id gnl|my_center|LOCUS_47900 5001 4546 gene locus_tag LOCUS_47910 5001 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 5270 6130 gene locus_tag LOCUS_47920 5270 6130 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530648.1 protein_id gnl|my_center|LOCUS_47920 6130 6606 gene locus_tag LOCUS_47930 6130 6606 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_47930 6608 8872 gene locus_tag LOCUS_47940 6608 8872 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_47940 8938 9183 gene locus_tag LOCUS_47950 8938 9183 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530645.1 protein_id gnl|my_center|LOCUS_47950 9900 9310 gene locus_tag LOCUS_47960 9900 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 11170 10754 gene locus_tag LOCUS_47970 11170 10754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 12249 11359 gene locus_tag LOCUS_47980 12249 11359 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530665.1 protein_id gnl|my_center|LOCUS_47980 12650 13009 gene locus_tag LOCUS_47990 12650 13009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530642.1 protein_id gnl|my_center|LOCUS_47990 13142 13996 gene locus_tag LOCUS_48000 13142 13996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 14007 14915 gene locus_tag LOCUS_48010 14007 14915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 16145 14943 gene locus_tag LOCUS_48020 16145 14943 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966466.1 protein_id gnl|my_center|LOCUS_48020 16782 16165 gene locus_tag LOCUS_48030 16782 16165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 16938 17939 gene locus_tag LOCUS_48040 16938 17939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 >Feature sequence128 94 513 gene locus_tag LOCUS_48050 94 513 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528202.1 protein_id gnl|my_center|LOCUS_48050 515 1912 gene locus_tag LOCUS_48060 515 1912 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528201.1 protein_id gnl|my_center|LOCUS_48060 2452 1991 gene locus_tag LOCUS_48070 2452 1991 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528454.1 protein_id gnl|my_center|LOCUS_48070 3033 2449 gene locus_tag LOCUS_48080 3033 2449 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528453.1 protein_id gnl|my_center|LOCUS_48080 3907 3026 gene locus_tag LOCUS_48090 3907 3026 CDS product thiamine biosynthesis protein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528452.1 protein_id gnl|my_center|LOCUS_48090 5448 3907 gene locus_tag LOCUS_48100 5448 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528451.1 protein_id gnl|my_center|LOCUS_48100 8240 5445 gene locus_tag LOCUS_48110 8240 5445 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528450.1 protein_id gnl|my_center|LOCUS_48110 9097 8237 gene locus_tag LOCUS_48120 9097 8237 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528449.1 protein_id gnl|my_center|LOCUS_48120 9348 9962 gene locus_tag LOCUS_48130 gene pncA 9348 9962 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528448.1 protein_id gnl|my_center|LOCUS_48130 10096 11421 gene locus_tag LOCUS_48140 10096 11421 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528447.1 protein_id gnl|my_center|LOCUS_48140 11511 12113 gene locus_tag LOCUS_48150 11511 12113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48150 12188 12466 gene locus_tag LOCUS_48160 12188 12466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 13191 12472 gene locus_tag LOCUS_48170 13191 12472 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528446.1 protein_id gnl|my_center|LOCUS_48170 13912 13184 gene locus_tag LOCUS_48180 13912 13184 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528445.1 protein_id gnl|my_center|LOCUS_48180 14871 13909 gene locus_tag LOCUS_48190 14871 13909 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528444.1 protein_id gnl|my_center|LOCUS_48190 15749 14868 gene locus_tag LOCUS_48200 15749 14868 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528443.1 protein_id gnl|my_center|LOCUS_48200 17268 15964 gene locus_tag LOCUS_48210 17268 15964 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528442.1 protein_id gnl|my_center|LOCUS_48210 >Feature sequence129 155 1186 gene locus_tag LOCUS_48220 155 1186 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528476.1 protein_id gnl|my_center|LOCUS_48220 1862 1161 gene locus_tag LOCUS_48230 1862 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528477.1 protein_id gnl|my_center|LOCUS_48230 2281 1832 gene locus_tag LOCUS_48240 2281 1832 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109667275.1 protein_id gnl|my_center|LOCUS_48240 1905 1914 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2621 2259 gene locus_tag LOCUS_48250 2621 2259 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528479.1 protein_id gnl|my_center|LOCUS_48250 3548 2694 gene locus_tag LOCUS_48260 gene dapD 3548 2694 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528480.1 protein_id gnl|my_center|LOCUS_48260 3799 4629 gene locus_tag LOCUS_48270 3799 4629 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528481.1 protein_id gnl|my_center|LOCUS_48270 5421 4780 gene locus_tag LOCUS_48280 5421 4780 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_48280 5635 5453 gene locus_tag LOCUS_48290 5635 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 6431 5751 gene locus_tag LOCUS_48300 6431 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 6723 7139 gene locus_tag LOCUS_48310 6723 7139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 7518 7700 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcggcgccttcaacggcaac 7814 8227 gene locus_tag LOCUS_48320 7814 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 8991 8284 gene locus_tag LOCUS_48330 8991 8284 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528482.1 protein_id gnl|my_center|LOCUS_48330 9152 9913 gene locus_tag LOCUS_48340 9152 9913 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528483.1 protein_id gnl|my_center|LOCUS_48340 10108 10263 gene locus_tag LOCUS_48350 10108 10263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528484.1 protein_id gnl|my_center|LOCUS_48350 10260 11699 gene locus_tag LOCUS_48360 10260 11699 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528485.1 protein_id gnl|my_center|LOCUS_48360 12007 11840 gene locus_tag LOCUS_48370 12007 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 12142 12594 gene locus_tag LOCUS_48380 12142 12594 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230886.1 protein_id gnl|my_center|LOCUS_48380 13649 12816 gene locus_tag LOCUS_48390 gene phhA 13649 12816 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528486.1 protein_id gnl|my_center|LOCUS_48390 13792 14268 gene locus_tag LOCUS_48400 13792 14268 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528487.1 protein_id gnl|my_center|LOCUS_48400 14381 15940 gene locus_tag LOCUS_48410 gene bchE 14381 15940 CDS product magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528488.1 protein_id gnl|my_center|LOCUS_48410 16877 15984 gene locus_tag LOCUS_48420 gene argB 16877 15984 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528489.1 protein_id gnl|my_center|LOCUS_48420 <17788 16980 gene locus_tag LOCUS_48430 <17788 16980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017586463.1:amidase >Feature sequence130 <1 519 gene locus_tag LOCUS_48440 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531937.1:DNA polymerase IV 1043 540 gene locus_tag LOCUS_48450 1043 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531938.1 protein_id gnl|my_center|LOCUS_48450 1361 1143 gene locus_tag LOCUS_48460 1361 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 1261 2103 gene locus_tag LOCUS_48470 1261 2103 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531939.1 protein_id gnl|my_center|LOCUS_48470 3131 2157 gene locus_tag LOCUS_48480 3131 2157 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_48480 6735 3208 gene locus_tag LOCUS_48490 gene dnaE 6735 3208 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531941.1 protein_id gnl|my_center|LOCUS_48490 8840 6828 gene locus_tag LOCUS_48500 8840 6828 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531942.1 protein_id gnl|my_center|LOCUS_48500 9102 10229 gene locus_tag LOCUS_48510 9102 10229 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531943.1 protein_id gnl|my_center|LOCUS_48510 9957 10040 gene locus_tag LOCUS_t00360 9957 10040 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10293 10862 gene locus_tag LOCUS_48520 gene gfa 10293 10862 CDS product S-(hydroxymethyl)glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034856926.1 protein_id gnl|my_center|LOCUS_48520 10927 11394 gene locus_tag LOCUS_48530 10927 11394 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531944.1 protein_id gnl|my_center|LOCUS_48530 11420 12097 gene locus_tag LOCUS_48540 11420 12097 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531945.1 protein_id gnl|my_center|LOCUS_48540 12185 13063 gene locus_tag LOCUS_48550 12185 13063 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531946.1 protein_id gnl|my_center|LOCUS_48550 13065 13856 gene locus_tag LOCUS_48560 13065 13856 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531947.1 protein_id gnl|my_center|LOCUS_48560 15050 14049 gene locus_tag LOCUS_48570 15050 14049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531951.1 protein_id gnl|my_center|LOCUS_48570 15476 16576 gene locus_tag LOCUS_48580 gene gcvT 15476 16576 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531952.1 protein_id gnl|my_center|LOCUS_48580 16583 16951 gene locus_tag LOCUS_48590 gene gcvH 16583 16951 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531953.1 protein_id gnl|my_center|LOCUS_48590 >Feature sequence131 1602 931 gene locus_tag LOCUS_48600 1602 931 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027164300.1 protein_id gnl|my_center|LOCUS_48600 2444 1572 gene locus_tag LOCUS_48610 2444 1572 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 protein_id gnl|my_center|LOCUS_48610 2653 3471 gene locus_tag LOCUS_48620 2653 3471 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528188.1 protein_id gnl|my_center|LOCUS_48620 3529 4323 gene locus_tag LOCUS_48630 3529 4323 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528189.1 protein_id gnl|my_center|LOCUS_48630 4491 5201 gene locus_tag LOCUS_48640 4491 5201 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199489663.1 protein_id gnl|my_center|LOCUS_48640 5201 6010 gene locus_tag LOCUS_48650 5201 6010 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528191.1 protein_id gnl|my_center|LOCUS_48650 6122 7126 gene locus_tag LOCUS_48660 6122 7126 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501902.1 protein_id gnl|my_center|LOCUS_48660 7530 7982 gene locus_tag LOCUS_48670 7530 7982 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528194.1 protein_id gnl|my_center|LOCUS_48670 8007 9077 gene locus_tag LOCUS_48680 8007 9077 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528195.1 protein_id gnl|my_center|LOCUS_48680 10471 9098 gene locus_tag LOCUS_48690 10471 9098 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528196.1 protein_id gnl|my_center|LOCUS_48690 10790 10799 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10914 11216 gene locus_tag LOCUS_48700 10914 11216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48700 11302 12378 gene locus_tag LOCUS_48710 11302 12378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 12353 12362 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12539 13912 gene locus_tag LOCUS_48720 12539 13912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 14074 16545 gene locus_tag LOCUS_48730 gene gyrB 14074 16545 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528198.1 protein_id gnl|my_center|LOCUS_48730 <17395 16660 gene locus_tag LOCUS_48740 <17395 16660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528562.1:hydantoinase B/oxoprolinase family protein >Feature sequence132 747 313 gene locus_tag LOCUS_48750 747 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531661.1 protein_id gnl|my_center|LOCUS_48750 1336 3222 gene locus_tag LOCUS_48760 1336 3222 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172144.1 protein_id gnl|my_center|LOCUS_48760 3517 4881 gene locus_tag LOCUS_48770 gene mgtE 3517 4881 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531663.1 protein_id gnl|my_center|LOCUS_48770 6313 4925 gene locus_tag LOCUS_48780 gene gor 6313 4925 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531664.1 protein_id gnl|my_center|LOCUS_48780 7035 6433 gene locus_tag LOCUS_48790 7035 6433 CDS product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531665.1 protein_id gnl|my_center|LOCUS_48790 7753 7022 gene locus_tag LOCUS_48800 gene rpiA 7753 7022 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531666.1 protein_id gnl|my_center|LOCUS_48800 7926 8606 gene locus_tag LOCUS_48810 7926 8606 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531667.1 protein_id gnl|my_center|LOCUS_48810 8737 8811 gene locus_tag LOCUS_t00370 8737 8811 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9094 8867 gene locus_tag LOCUS_48820 9094 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 8975 9661 gene locus_tag LOCUS_48830 8975 9661 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088801.1 protein_id gnl|my_center|LOCUS_48830 13913 9783 gene locus_tag LOCUS_48840 13913 9783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 10233 10242 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15856 14042 gene locus_tag LOCUS_48850 15856 14042 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171602985.1 protein_id gnl|my_center|LOCUS_48850 16241 16507 gene locus_tag LOCUS_48860 16241 16507 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531689.1 protein_id gnl|my_center|LOCUS_48860 16698 17132 gene locus_tag LOCUS_48870 16698 17132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063167997.1 protein_id gnl|my_center|LOCUS_48870 >Feature sequence133 265 2 gene locus_tag LOCUS_48880 265 2 CDS product glycine zipper domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528799.1 protein_id gnl|my_center|LOCUS_48880 919 395 gene locus_tag LOCUS_48890 gene kdpF 919 395 CDS product K(+)-transporting ATPase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089904.1 protein_id gnl|my_center|LOCUS_48890 1349 939 gene locus_tag LOCUS_48900 1349 939 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528798.1 protein_id gnl|my_center|LOCUS_48900 1986 1495 gene locus_tag LOCUS_48910 1986 1495 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993326.1 protein_id gnl|my_center|LOCUS_48910 2384 2040 gene locus_tag LOCUS_48920 2384 2040 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529430.1 protein_id gnl|my_center|LOCUS_48920 3429 2524 gene locus_tag LOCUS_48930 3429 2524 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528797.1 protein_id gnl|my_center|LOCUS_48930 3619 4026 gene locus_tag LOCUS_48940 3619 4026 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528796.1 protein_id gnl|my_center|LOCUS_48940 4112 4121 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5259 4225 gene locus_tag LOCUS_48950 5259 4225 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528795.1 protein_id gnl|my_center|LOCUS_48950 5839 7863 gene locus_tag LOCUS_48960 5839 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 7113 7122 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8056 8766 gene locus_tag LOCUS_48970 8056 8766 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528793.1 protein_id gnl|my_center|LOCUS_48970 8956 8768 gene locus_tag LOCUS_48980 8956 8768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 10208 9105 gene locus_tag LOCUS_48990 gene leuB 10208 9105 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528791.1 protein_id gnl|my_center|LOCUS_48990 10641 10288 gene locus_tag LOCUS_49000 10641 10288 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528790.1 protein_id gnl|my_center|LOCUS_49000 11077 10694 gene locus_tag LOCUS_49010 11077 10694 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528789.1 protein_id gnl|my_center|LOCUS_49010 12308 11373 gene locus_tag LOCUS_49020 12308 11373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528788.1 protein_id gnl|my_center|LOCUS_49020 12600 12382 gene locus_tag LOCUS_49030 12600 12382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49030 12739 12748 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13084 13572 gene locus_tag LOCUS_49040 13084 13572 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528786.1 protein_id gnl|my_center|LOCUS_49040 13672 13986 gene locus_tag LOCUS_49050 13672 13986 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090094.1 protein_id gnl|my_center|LOCUS_49050 13983 14435 gene locus_tag LOCUS_49060 13983 14435 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090095.1 protein_id gnl|my_center|LOCUS_49060 14471 14980 gene locus_tag LOCUS_49070 14471 14980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 16157 14991 gene locus_tag LOCUS_49080 16157 14991 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528785.1 protein_id gnl|my_center|LOCUS_49080 <17082 16188 gene locus_tag LOCUS_49090 <17082 16188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528784.1:ATP-binding protein >Feature sequence134 1099 668 gene locus_tag LOCUS_49100 1099 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49100 1851 1087 gene locus_tag LOCUS_49110 1851 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49110 1130 1139 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2022 3020 gene locus_tag LOCUS_49120 2022 3020 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530225.1 protein_id gnl|my_center|LOCUS_49120 2989 4308 gene locus_tag LOCUS_49130 2989 4308 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530224.1 protein_id gnl|my_center|LOCUS_49130 4381 5196 gene locus_tag LOCUS_49140 gene proC 4381 5196 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530223.1 protein_id gnl|my_center|LOCUS_49140 6513 5203 gene locus_tag LOCUS_49150 6513 5203 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530222.1 protein_id gnl|my_center|LOCUS_49150 7283 8740 gene locus_tag LOCUS_49160 7283 8740 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529844.1 protein_id gnl|my_center|LOCUS_49160 8769 10901 gene locus_tag LOCUS_49170 8769 10901 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529845.1 protein_id gnl|my_center|LOCUS_49170 10916 12205 gene locus_tag LOCUS_49180 10916 12205 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529846.1 protein_id gnl|my_center|LOCUS_49180 12195 12836 gene locus_tag LOCUS_49190 12195 12836 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502654.1 protein_id gnl|my_center|LOCUS_49190 13849 12860 gene locus_tag LOCUS_49200 13849 12860 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529848.1 protein_id gnl|my_center|LOCUS_49200 >Feature sequence135 315 740 gene locus_tag LOCUS_49210 315 740 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531833.1 protein_id gnl|my_center|LOCUS_49210 1387 758 gene locus_tag LOCUS_49220 1387 758 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531832.1 protein_id gnl|my_center|LOCUS_49220 1859 1482 gene locus_tag LOCUS_49230 1859 1482 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086574.1 protein_id gnl|my_center|LOCUS_49230 2422 1898 gene locus_tag LOCUS_49240 2422 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531831.1 protein_id gnl|my_center|LOCUS_49240 2482 3354 gene locus_tag LOCUS_49250 2482 3354 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531830.1 protein_id gnl|my_center|LOCUS_49250 2884 2893 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3599 6385 gene locus_tag LOCUS_49260 gene gyrA 3599 6385 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531829.1 protein_id gnl|my_center|LOCUS_49260 6600 6457 gene locus_tag LOCUS_49270 6600 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531828.1 protein_id gnl|my_center|LOCUS_49270 6792 7292 gene locus_tag LOCUS_49280 gene coaD 6792 7292 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531827.1 protein_id gnl|my_center|LOCUS_49280 7309 7896 gene locus_tag LOCUS_49290 7309 7896 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027161524.1 protein_id gnl|my_center|LOCUS_49290 7925 8437 gene locus_tag LOCUS_49300 7925 8437 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531825.1 protein_id gnl|my_center|LOCUS_49300 8452 8901 gene locus_tag LOCUS_49310 8452 8901 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531824.1 protein_id gnl|my_center|LOCUS_49310 8901 9992 gene locus_tag LOCUS_49320 gene queA 8901 9992 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531823.1 protein_id gnl|my_center|LOCUS_49320 9982 10251 gene locus_tag LOCUS_49330 9982 10251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531822.1 protein_id gnl|my_center|LOCUS_49330 10244 11374 gene locus_tag LOCUS_49340 gene tgt 10244 11374 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531821.1 protein_id gnl|my_center|LOCUS_49340 11799 11380 gene locus_tag LOCUS_49350 11799 11380 CDS product DUF4864 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531820.1 protein_id gnl|my_center|LOCUS_49350 12020 12256 gene locus_tag LOCUS_49360 12020 12256 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909609.1 protein_id gnl|my_center|LOCUS_49360 12447 13841 gene locus_tag LOCUS_49370 12447 13841 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503502.1 protein_id gnl|my_center|LOCUS_49370 13933 14874 gene locus_tag LOCUS_49380 13933 14874 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531818.1 protein_id gnl|my_center|LOCUS_49380 14905 15699 gene locus_tag LOCUS_49390 14905 15699 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531817.1 protein_id gnl|my_center|LOCUS_49390 15730 16461 gene locus_tag LOCUS_49400 15730 16461 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531816.1 protein_id gnl|my_center|LOCUS_49400 >Feature sequence136 >Feature sequence137 1829 810 gene locus_tag LOCUS_49410 1829 810 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171096.1 protein_id gnl|my_center|LOCUS_49410 2940 1954 gene locus_tag LOCUS_49420 gene dhaK 2940 1954 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528089.1 protein_id gnl|my_center|LOCUS_49420 3445 3023 gene locus_tag LOCUS_49430 3445 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528088.1 protein_id gnl|my_center|LOCUS_49430 5064 3460 gene locus_tag LOCUS_49440 gene ptsP 5064 3460 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528087.1 protein_id gnl|my_center|LOCUS_49440 5402 5076 gene locus_tag LOCUS_49450 5402 5076 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528086.1 protein_id gnl|my_center|LOCUS_49450 5788 5399 gene locus_tag LOCUS_49460 gene dhaM 5788 5399 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528085.1 protein_id gnl|my_center|LOCUS_49460 6387 5788 gene locus_tag LOCUS_49470 gene dhaL 6387 5788 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528084.1 protein_id gnl|my_center|LOCUS_49470 6523 6398 gene locus_tag LOCUS_49480 6523 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49480 6550 6559 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7888 6647 gene locus_tag LOCUS_49490 7888 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49490 6950 6959 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8961 7948 gene locus_tag LOCUS_49500 8961 7948 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528082.1 protein_id gnl|my_center|LOCUS_49500 10060 8954 gene locus_tag LOCUS_49510 10060 8954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528081.1 protein_id gnl|my_center|LOCUS_49510 10268 10065 gene locus_tag LOCUS_49520 10268 10065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528080.1 protein_id gnl|my_center|LOCUS_49520 11409 10459 gene locus_tag LOCUS_49530 11409 10459 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528079.1 protein_id gnl|my_center|LOCUS_49530 12353 11406 gene locus_tag LOCUS_49540 12353 11406 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528078.1 protein_id gnl|my_center|LOCUS_49540 13792 12461 gene locus_tag LOCUS_49550 13792 12461 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528077.1 protein_id gnl|my_center|LOCUS_49550 14715 14026 gene locus_tag LOCUS_49560 14715 14026 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528076.1 protein_id gnl|my_center|LOCUS_49560 14751 15641 gene locus_tag LOCUS_49570 14751 15641 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528075.1 protein_id gnl|my_center|LOCUS_49570 >Feature sequence138 <1 562 gene locus_tag LOCUS_49580 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525215.1:aldehyde dehydrogenase 627 1631 gene locus_tag LOCUS_49590 627 1631 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525216.1 protein_id gnl|my_center|LOCUS_49590 1659 1668 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1741 2568 gene locus_tag LOCUS_49600 1741 2568 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525217.1 protein_id gnl|my_center|LOCUS_49600 2568 3368 gene locus_tag LOCUS_49610 2568 3368 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525218.1 protein_id gnl|my_center|LOCUS_49610 3365 4441 gene locus_tag LOCUS_49620 3365 4441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525219.1 protein_id gnl|my_center|LOCUS_49620 5385 4591 gene locus_tag LOCUS_49630 gene otsB 5385 4591 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032898633.1 protein_id gnl|my_center|LOCUS_49630 7046 5382 gene locus_tag LOCUS_49640 7046 5382 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530900.1 protein_id gnl|my_center|LOCUS_49640 9546 7384 gene locus_tag LOCUS_49650 9546 7384 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530899.1 protein_id gnl|my_center|LOCUS_49650 10654 9593 gene locus_tag LOCUS_49660 10654 9593 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530898.1 protein_id gnl|my_center|LOCUS_49660 11906 10722 gene locus_tag LOCUS_49670 11906 10722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537581.1 protein_id gnl|my_center|LOCUS_49670 12950 11940 gene locus_tag LOCUS_49680 12950 11940 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086752.1 protein_id gnl|my_center|LOCUS_49680 13304 12960 gene locus_tag LOCUS_49690 13304 12960 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086753.1 protein_id gnl|my_center|LOCUS_49690 14087 13341 gene locus_tag LOCUS_49700 14087 13341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49700 14616 14014 gene locus_tag LOCUS_49710 14616 14014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49710 14154 14163 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14682 15623 gene locus_tag LOCUS_49720 14682 15623 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113699.1 protein_id gnl|my_center|LOCUS_49720 <16354 15597 gene locus_tag LOCUS_49730 <16354 15597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974943.1:ABC transporter permease >Feature sequence139 1109 1966 gene locus_tag LOCUS_49740 1109 1966 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165691322.1 protein_id gnl|my_center|LOCUS_49740 2245 2607 gene locus_tag LOCUS_49750 2245 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531688.1 protein_id gnl|my_center|LOCUS_49750 2993 2820 gene locus_tag LOCUS_49760 2993 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720023.1 protein_id gnl|my_center|LOCUS_49760 4154 3027 gene locus_tag LOCUS_49770 4154 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337806.1 protein_id gnl|my_center|LOCUS_49770 4477 4169 gene locus_tag LOCUS_49780 4477 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 4857 4489 gene locus_tag LOCUS_49790 4857 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337805.1 protein_id gnl|my_center|LOCUS_49790 4759 5025 gene locus_tag LOCUS_49800 4759 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 5419 5234 gene locus_tag LOCUS_49810 5419 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 5520 7187 gene locus_tag LOCUS_49820 5520 7187 CDS product aromatic/alkene/methane monooxygenase hydroxylase/oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920568.1 protein_id gnl|my_center|LOCUS_49820 7238 7432 gene locus_tag LOCUS_49830 7238 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 7429 8487 gene locus_tag LOCUS_49840 7429 8487 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337803.1 protein_id gnl|my_center|LOCUS_49840 8540 9598 gene locus_tag LOCUS_49850 8540 9598 CDS product aromatic/alkene monooxygenase hydroxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720017.1 protein_id gnl|my_center|LOCUS_49850 9616 9984 gene locus_tag LOCUS_49860 9616 9984 CDS product MmoB/DmpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720016.1 protein_id gnl|my_center|LOCUS_49860 10070 11092 gene locus_tag LOCUS_49870 10070 11092 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337802.1 protein_id gnl|my_center|LOCUS_49870 11098 11895 gene locus_tag LOCUS_49880 11098 11895 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337801.1 protein_id gnl|my_center|LOCUS_49880 11972 13603 gene locus_tag LOCUS_49890 11972 13603 CDS product molecular chaperone GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337800.1 protein_id gnl|my_center|LOCUS_49890 13642 14685 gene locus_tag LOCUS_49900 13642 14685 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337799.1 protein_id gnl|my_center|LOCUS_49900 14756 15445 gene locus_tag LOCUS_49910 14756 15445 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719935.1 protein_id gnl|my_center|LOCUS_49910 <16275 15527 gene locus_tag LOCUS_49920 <16275 15527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337798.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence140 293 679 gene locus_tag LOCUS_49930 293 679 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529181.1 protein_id gnl|my_center|LOCUS_49930 828 1166 gene locus_tag LOCUS_49940 828 1166 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529180.1 protein_id gnl|my_center|LOCUS_49940 1597 2178 gene locus_tag LOCUS_49950 1597 2178 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529179.1 protein_id gnl|my_center|LOCUS_49950 3010 2240 gene locus_tag LOCUS_49960 3010 2240 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529175.1 protein_id gnl|my_center|LOCUS_49960 3687 3007 gene locus_tag LOCUS_49970 3687 3007 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529174.1 protein_id gnl|my_center|LOCUS_49970 4627 3854 gene locus_tag LOCUS_49980 4627 3854 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529173.1 protein_id gnl|my_center|LOCUS_49980 4965 5468 gene locus_tag LOCUS_49990 4965 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49990 5393 5402 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5468 5833 gene locus_tag LOCUS_50000 5468 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50000 7419 5851 gene locus_tag LOCUS_50010 7419 5851 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502938.1 protein_id gnl|my_center|LOCUS_50010 8358 7600 gene locus_tag LOCUS_50020 gene thiQ 8358 7600 CDS product thiamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529170.1 protein_id gnl|my_center|LOCUS_50020 9965 8355 gene locus_tag LOCUS_50030 gene thiP 9965 8355 CDS product thiamine/thiamine pyrophosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529169.1 protein_id gnl|my_center|LOCUS_50030 11200 10196 gene locus_tag LOCUS_50040 gene thiB 11200 10196 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529168.1 protein_id gnl|my_center|LOCUS_50040 11460 12104 gene locus_tag LOCUS_50050 11460 12104 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529167.1 protein_id gnl|my_center|LOCUS_50050 12106 13890 gene locus_tag LOCUS_50060 12106 13890 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529166.1 protein_id gnl|my_center|LOCUS_50060 13124 13133 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14851 13913 gene locus_tag LOCUS_50070 14851 13913 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391305.1 protein_id gnl|my_center|LOCUS_50070 14995 15177 gene locus_tag LOCUS_50080 14995 15177 CDS product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529165.1 protein_id gnl|my_center|LOCUS_50080 >Feature sequence141 263 1192 gene locus_tag LOCUS_50090 263 1192 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530525.1 protein_id gnl|my_center|LOCUS_50090 1192 2049 gene locus_tag LOCUS_50100 1192 2049 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530524.1 protein_id gnl|my_center|LOCUS_50100 2093 4072 gene locus_tag LOCUS_50110 2093 4072 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530523.1 protein_id gnl|my_center|LOCUS_50110 4879 4082 gene locus_tag LOCUS_50120 4879 4082 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529834.1 protein_id gnl|my_center|LOCUS_50120 6364 4904 gene locus_tag LOCUS_50130 6364 4904 CDS product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529835.1 protein_id gnl|my_center|LOCUS_50130 9540 6640 gene locus_tag LOCUS_50140 9540 6640 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967298.1 protein_id gnl|my_center|LOCUS_50140 10645 9551 gene locus_tag LOCUS_50150 10645 9551 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967297.1 protein_id gnl|my_center|LOCUS_50150 11224 10982 gene locus_tag LOCUS_50160 11224 10982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 11260 11269 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12055 11306 gene locus_tag LOCUS_50170 12055 11306 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530710.1 protein_id gnl|my_center|LOCUS_50170 12166 13386 gene locus_tag LOCUS_50180 12166 13386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241289.1 protein_id gnl|my_center|LOCUS_50180 13468 14124 gene locus_tag LOCUS_50190 13468 14124 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974561.1 protein_id gnl|my_center|LOCUS_50190 14820 14251 gene locus_tag LOCUS_50200 gene efp 14820 14251 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532351.1 protein_id gnl|my_center|LOCUS_50200 >Feature sequence142 <1 609 gene locus_tag LOCUS_50210 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531036.1:tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA 713 1528 gene locus_tag LOCUS_50220 713 1528 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531037.1 protein_id gnl|my_center|LOCUS_50220 3539 1710 gene locus_tag LOCUS_50230 3539 1710 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531038.1 protein_id gnl|my_center|LOCUS_50230 3756 4259 gene locus_tag LOCUS_50240 3756 4259 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531039.1 protein_id gnl|my_center|LOCUS_50240 4410 4571 gene locus_tag LOCUS_50250 4410 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50250 4938 5177 gene locus_tag LOCUS_50260 4938 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50260 6011 5148 gene locus_tag LOCUS_50270 6011 5148 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531042.1 protein_id gnl|my_center|LOCUS_50270 6130 7296 gene locus_tag LOCUS_50280 6130 7296 CDS product gamma-butyrobetaine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531043.1 protein_id gnl|my_center|LOCUS_50280 7293 7883 gene locus_tag LOCUS_50290 7293 7883 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531044.1 protein_id gnl|my_center|LOCUS_50290 8173 9318 gene locus_tag LOCUS_50300 8173 9318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 9479 10618 gene locus_tag LOCUS_50310 9479 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531046.1 protein_id gnl|my_center|LOCUS_50310 10891 12672 gene locus_tag LOCUS_50320 10891 12672 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827432.1 protein_id gnl|my_center|LOCUS_50320 12757 13329 gene locus_tag LOCUS_50330 gene ilvN 12757 13329 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531048.1 protein_id gnl|my_center|LOCUS_50330 13476 14072 gene locus_tag LOCUS_50340 13476 14072 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531049.1 protein_id gnl|my_center|LOCUS_50340 14403 15677 gene locus_tag LOCUS_50350 14403 15677 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531050.1 protein_id gnl|my_center|LOCUS_50350 >Feature sequence143 <1 762 gene locus_tag LOCUS_50360 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965178.1:EAL domain-containing protein 920 2971 gene locus_tag LOCUS_50370 920 2971 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530081.1 protein_id gnl|my_center|LOCUS_50370 3643 4140 gene locus_tag LOCUS_50380 3643 4140 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530080.1 protein_id gnl|my_center|LOCUS_50380 5091 4195 gene locus_tag LOCUS_50390 5091 4195 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530079.1 protein_id gnl|my_center|LOCUS_50390 6140 5166 gene locus_tag LOCUS_50400 gene trxB 6140 5166 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530078.1 protein_id gnl|my_center|LOCUS_50400 6388 6858 gene locus_tag LOCUS_50410 6388 6858 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530077.1 protein_id gnl|my_center|LOCUS_50410 7504 6830 gene locus_tag LOCUS_50420 7504 6830 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530075.1 protein_id gnl|my_center|LOCUS_50420 8069 7497 gene locus_tag LOCUS_50430 8069 7497 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530074.1 protein_id gnl|my_center|LOCUS_50430 9561 8077 gene locus_tag LOCUS_50440 gene rfaE1 9561 8077 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530073.1 protein_id gnl|my_center|LOCUS_50440 10348 9713 gene locus_tag LOCUS_50450 10348 9713 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530072.1 protein_id gnl|my_center|LOCUS_50450 10773 10375 gene locus_tag LOCUS_50460 10773 10375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 10896 11846 gene locus_tag LOCUS_50470 gene rfaD 10896 11846 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530069.1 protein_id gnl|my_center|LOCUS_50470 11870 12826 gene locus_tag LOCUS_50480 gene waaF 11870 12826 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530068.1 protein_id gnl|my_center|LOCUS_50480 12823 13671 gene locus_tag LOCUS_50490 gene waaC 12823 13671 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530067.1 protein_id gnl|my_center|LOCUS_50490 13616 13625 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14345 13872 gene locus_tag LOCUS_50500 gene greA 14345 13872 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530066.1 protein_id gnl|my_center|LOCUS_50500 15162 14629 gene locus_tag LOCUS_50510 15162 14629 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530065.1 protein_id gnl|my_center|LOCUS_50510 >Feature sequence144 1231 482 gene locus_tag LOCUS_50520 gene lepB 1231 482 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532585.1 protein_id gnl|my_center|LOCUS_50520 1721 1308 gene locus_tag LOCUS_50530 gene acpS 1721 1308 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532586.1 protein_id gnl|my_center|LOCUS_50530 2311 1718 gene locus_tag LOCUS_50540 2311 1718 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532587.1 protein_id gnl|my_center|LOCUS_50540 3204 2620 gene locus_tag LOCUS_50550 gene pyrE 3204 2620 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532589.1 protein_id gnl|my_center|LOCUS_50550 2693 2702 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5538 3310 gene locus_tag LOCUS_50560 5538 3310 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532590.1 protein_id gnl|my_center|LOCUS_50560 6063 5662 gene locus_tag LOCUS_50570 gene rpoZ 6063 5662 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532591.1 protein_id gnl|my_center|LOCUS_50570 6368 6949 gene locus_tag LOCUS_50580 6368 6949 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010915096.1 protein_id gnl|my_center|LOCUS_50580 6946 7617 gene locus_tag LOCUS_50590 6946 7617 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532592.1 protein_id gnl|my_center|LOCUS_50590 8332 7586 gene locus_tag LOCUS_50600 8332 7586 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532593.1 protein_id gnl|my_center|LOCUS_50600 8893 8414 gene locus_tag LOCUS_50610 gene smpB 8893 8414 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532594.1 protein_id gnl|my_center|LOCUS_50610 9889 9026 gene locus_tag LOCUS_50620 9889 9026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 9259 9268 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10181 11611 gene locus_tag LOCUS_50630 10181 11611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50630 11343 11352 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11608 12243 gene locus_tag LOCUS_50640 11608 12243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50640 12359 13249 gene locus_tag LOCUS_50650 12359 13249 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532597.1 protein_id gnl|my_center|LOCUS_50650 14453 13407 gene locus_tag LOCUS_50660 14453 13407 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532598.1 protein_id gnl|my_center|LOCUS_50660 <15747 14724 gene locus_tag LOCUS_50670 <15747 14724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532599.1:porin >Feature sequence145 407 817 gene locus_tag LOCUS_50680 407 817 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531932.1 protein_id gnl|my_center|LOCUS_50680 845 2218 gene locus_tag LOCUS_50690 845 2218 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531931.1 protein_id gnl|my_center|LOCUS_50690 2802 2635 gene locus_tag LOCUS_50700 gene rpmG 2802 2635 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006201775.1 protein_id gnl|my_center|LOCUS_50700 3447 2989 gene locus_tag LOCUS_50710 3447 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531921.1 protein_id gnl|my_center|LOCUS_50710 4701 3526 gene locus_tag LOCUS_50720 4701 3526 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531920.1 protein_id gnl|my_center|LOCUS_50720 5470 4718 gene locus_tag LOCUS_50730 5470 4718 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531919.1 protein_id gnl|my_center|LOCUS_50730 6082 5630 gene locus_tag LOCUS_50740 6082 5630 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503574.1 protein_id gnl|my_center|LOCUS_50740 6798 6082 gene locus_tag LOCUS_50750 6798 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 8398 6743 gene locus_tag LOCUS_50760 8398 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50760 7071 7080 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10971 8404 gene locus_tag LOCUS_50770 gene topA 10971 8404 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531916.1 protein_id gnl|my_center|LOCUS_50770 11690 11313 gene locus_tag LOCUS_50780 11690 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531915.1 protein_id gnl|my_center|LOCUS_50780 11873 12619 gene locus_tag LOCUS_50790 11873 12619 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531914.1 protein_id gnl|my_center|LOCUS_50790 14568 12736 gene locus_tag LOCUS_50800 14568 12736 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090391.1 protein_id gnl|my_center|LOCUS_50800 >Feature sequence146 377 1990 gene locus_tag LOCUS_50810 377 1990 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456393.1 protein_id gnl|my_center|LOCUS_50810 1987 2523 gene locus_tag LOCUS_50820 1987 2523 CDS product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148745001.1 protein_id gnl|my_center|LOCUS_50820 3345 4478 gene locus_tag LOCUS_50830 3345 4478 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391834.1 protein_id gnl|my_center|LOCUS_50830 4456 6693 gene locus_tag LOCUS_50840 4456 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 7253 6699 gene locus_tag LOCUS_50850 7253 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 7594 7250 gene locus_tag LOCUS_50860 7594 7250 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224021.1 protein_id gnl|my_center|LOCUS_50860 7724 7993 gene locus_tag LOCUS_50870 7724 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 8010 9140 gene locus_tag LOCUS_50880 8010 9140 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459849.1 protein_id gnl|my_center|LOCUS_50880 9137 9559 gene locus_tag LOCUS_50890 9137 9559 CDS product DUF6527 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105776.1 protein_id gnl|my_center|LOCUS_50890 10211 9600 gene locus_tag LOCUS_50900 10211 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963497.1 protein_id gnl|my_center|LOCUS_50900 11888 10422 gene locus_tag LOCUS_50910 11888 10422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 12132 11896 gene locus_tag LOCUS_50920 12132 11896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 12281 12123 gene locus_tag LOCUS_50930 12281 12123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 12453 12638 gene locus_tag LOCUS_50940 12453 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 12943 12659 gene locus_tag LOCUS_50950 12943 12659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 13040 13231 gene locus_tag LOCUS_50960 13040 13231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 13238 13651 gene locus_tag LOCUS_50970 13238 13651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 14379 13984 gene locus_tag LOCUS_50980 14379 13984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 14636 14376 gene locus_tag LOCUS_50990 14636 14376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 <15617 14905 gene locus_tag LOCUS_51000 <15617 14905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525335.1:SMC-Scp complex subunit ScpB >Feature sequence147 222 1262 gene locus_tag LOCUS_51010 222 1262 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393144.1 protein_id gnl|my_center|LOCUS_51010 1297 2805 gene locus_tag LOCUS_51020 1297 2805 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533070.1 protein_id gnl|my_center|LOCUS_51020 2775 3878 gene locus_tag LOCUS_51030 2775 3878 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529336.1 protein_id gnl|my_center|LOCUS_51030 3959 4900 gene locus_tag LOCUS_51040 3959 4900 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533069.1 protein_id gnl|my_center|LOCUS_51040 6017 4953 gene locus_tag LOCUS_51050 gene fba 6017 4953 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532928.1 protein_id gnl|my_center|LOCUS_51050 6285 7055 gene locus_tag LOCUS_51060 6285 7055 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969785.1 protein_id gnl|my_center|LOCUS_51060 7060 7827 gene locus_tag LOCUS_51070 7060 7827 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533068.1 protein_id gnl|my_center|LOCUS_51070 7856 8296 gene locus_tag LOCUS_51080 7856 8296 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976279.1 protein_id gnl|my_center|LOCUS_51080 8931 8293 gene locus_tag LOCUS_51090 gene dhaL 8931 8293 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533066.1 protein_id gnl|my_center|LOCUS_51090 9955 8942 gene locus_tag LOCUS_51100 9955 8942 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533065.1 protein_id gnl|my_center|LOCUS_51100 10497 10024 gene locus_tag LOCUS_51110 10497 10024 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532927.1 protein_id gnl|my_center|LOCUS_51110 11590 10796 gene locus_tag LOCUS_51120 11590 10796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_51120 11556 11565 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11964 11590 gene locus_tag LOCUS_51130 11964 11590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51130 13235 11961 gene locus_tag LOCUS_51140 gene mtnK 13235 11961 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532923.1 protein_id gnl|my_center|LOCUS_51140 13372 14892 gene locus_tag LOCUS_51150 13372 14892 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532922.1 protein_id gnl|my_center|LOCUS_51150 14289 14298 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence148 132 1058 gene locus_tag LOCUS_51160 gene hemC 132 1058 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528908.1 protein_id gnl|my_center|LOCUS_51160 1060 1776 gene locus_tag LOCUS_51170 1060 1776 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528909.1 protein_id gnl|my_center|LOCUS_51170 1985 3436 gene locus_tag LOCUS_51180 1985 3436 CDS product COG4223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528910.1 protein_id gnl|my_center|LOCUS_51180 3447 5021 gene locus_tag LOCUS_51190 3447 5021 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528911.1 protein_id gnl|my_center|LOCUS_51190 5058 5537 gene locus_tag LOCUS_51200 5058 5537 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528912.1 protein_id gnl|my_center|LOCUS_51200 5611 6288 gene locus_tag LOCUS_51210 5611 6288 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528913.1 protein_id gnl|my_center|LOCUS_51210 6995 6321 gene locus_tag LOCUS_51220 6995 6321 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088698.1 protein_id gnl|my_center|LOCUS_51220 7397 7627 gene locus_tag LOCUS_51230 7397 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528523.1 protein_id gnl|my_center|LOCUS_51230 8234 7962 gene locus_tag LOCUS_51240 8234 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51240 8430 8684 gene locus_tag LOCUS_51250 8430 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51250 9963 8725 gene locus_tag LOCUS_51260 9963 8725 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528915.1 protein_id gnl|my_center|LOCUS_51260 11208 10123 gene locus_tag LOCUS_51270 11208 10123 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528916.1 protein_id gnl|my_center|LOCUS_51270 11465 11809 gene locus_tag LOCUS_51280 11465 11809 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141437.1 protein_id gnl|my_center|LOCUS_51280 11809 12327 gene locus_tag LOCUS_51290 11809 12327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 12929 12471 gene locus_tag LOCUS_51300 12929 12471 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528917.1 protein_id gnl|my_center|LOCUS_51300 13751 13047 gene locus_tag LOCUS_51310 13751 13047 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 protein_id gnl|my_center|LOCUS_51310 15146 13770 gene locus_tag LOCUS_51320 gene zwf 15146 13770 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 protein_id gnl|my_center|LOCUS_51320 >Feature sequence149 1011 232 gene locus_tag LOCUS_51330 1011 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51330 284 293 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1121 1594 gene locus_tag LOCUS_51340 1121 1594 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328737.1 protein_id gnl|my_center|LOCUS_51340 2312 1605 gene locus_tag LOCUS_51350 2312 1605 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_51350 2605 2907 gene locus_tag LOCUS_51360 2605 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 3810 3118 gene locus_tag LOCUS_51370 gene modA 3810 3118 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090881.1 protein_id gnl|my_center|LOCUS_51370 4527 3931 gene locus_tag LOCUS_51380 4527 3931 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530637.1 protein_id gnl|my_center|LOCUS_51380 5503 4601 gene locus_tag LOCUS_51390 5503 4601 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530631.1 protein_id gnl|my_center|LOCUS_51390 5729 6598 gene locus_tag LOCUS_51400 gene yghU 5729 6598 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530630.1 protein_id gnl|my_center|LOCUS_51400 7189 6641 gene locus_tag LOCUS_51410 gene ybcL 7189 6641 CDS product Raf kinase inhibitor-like protein YbcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313946.1 protein_id gnl|my_center|LOCUS_51410 7597 7334 gene locus_tag LOCUS_51420 7597 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 8907 7702 gene locus_tag LOCUS_51430 8907 7702 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172575.1 protein_id gnl|my_center|LOCUS_51430 9329 9643 gene locus_tag LOCUS_51440 9329 9643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 9667 9963 gene locus_tag LOCUS_51450 9667 9963 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329228.1 protein_id gnl|my_center|LOCUS_51450 10787 11170 gene locus_tag LOCUS_51460 10787 11170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51460 11556 11068 gene locus_tag LOCUS_51470 11556 11068 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969632.1 protein_id gnl|my_center|LOCUS_51470 12150 11608 gene locus_tag LOCUS_51480 12150 11608 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530623.1 protein_id gnl|my_center|LOCUS_51480 14295 12277 gene locus_tag LOCUS_51490 14295 12277 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530502.1 protein_id gnl|my_center|LOCUS_51490 <15443 14401 gene locus_tag LOCUS_51500 <15443 14401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_168992253.1:WD40 repeat domain-containing protein >Feature sequence150 301 310 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 984 547 gene locus_tag LOCUS_51510 984 547 CDS product DUF3085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974881.1 protein_id gnl|my_center|LOCUS_51510 622 631 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1597 995 gene locus_tag LOCUS_51520 1597 995 CDS product DUF1419 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974880.1 protein_id gnl|my_center|LOCUS_51520 2691 1777 gene locus_tag LOCUS_51530 2691 1777 CDS product DUF3991 and toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974798.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51530 2951 3199 gene locus_tag LOCUS_51540 2951 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 3934 3695 gene locus_tag LOCUS_51550 3934 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 4506 4177 gene locus_tag LOCUS_51560 4506 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 4841 5302 gene locus_tag LOCUS_51570 4841 5302 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533377.1 protein_id gnl|my_center|LOCUS_51570 5324 5503 gene locus_tag LOCUS_51580 5324 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 5885 7846 gene locus_tag LOCUS_51590 5885 7846 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085181.1 protein_id gnl|my_center|LOCUS_51590 9557 9354 gene locus_tag LOCUS_51600 9557 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 9448 10200 gene locus_tag LOCUS_51610 9448 10200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51610 10477 10731 gene locus_tag LOCUS_51620 10477 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 11190 11633 gene locus_tag LOCUS_51630 11190 11633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 11898 11704 gene locus_tag LOCUS_51640 11898 11704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 12482 12694 gene locus_tag LOCUS_51650 12482 12694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 13472 13098 gene locus_tag LOCUS_51660 13472 13098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 14638 14099 gene locus_tag LOCUS_51670 14638 14099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 >Feature sequence151 1334 510 gene locus_tag LOCUS_51680 1334 510 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720158.1 protein_id gnl|my_center|LOCUS_51680 2248 1331 gene locus_tag LOCUS_51690 2248 1331 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565322.1 protein_id gnl|my_center|LOCUS_51690 2558 3976 gene locus_tag LOCUS_51700 2558 3976 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339390.1 protein_id gnl|my_center|LOCUS_51700 5338 4136 gene locus_tag LOCUS_51710 5338 4136 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920958.1 protein_id gnl|my_center|LOCUS_51710 5837 6256 gene locus_tag LOCUS_51720 5837 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529299.1 protein_id gnl|my_center|LOCUS_51720 8521 6461 gene locus_tag LOCUS_51730 8521 6461 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173187.1 protein_id gnl|my_center|LOCUS_51730 9552 8773 gene locus_tag LOCUS_51740 9552 8773 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299078.1 protein_id gnl|my_center|LOCUS_51740 9599 10285 gene locus_tag LOCUS_51750 9599 10285 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529302.1 protein_id gnl|my_center|LOCUS_51750 10517 10350 gene locus_tag LOCUS_51760 10517 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529303.1 protein_id gnl|my_center|LOCUS_51760 10881 10549 gene locus_tag LOCUS_51770 10881 10549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529304.1 protein_id gnl|my_center|LOCUS_51770 11232 11690 gene locus_tag LOCUS_51780 11232 11690 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529305.1 protein_id gnl|my_center|LOCUS_51780 14925 11842 gene locus_tag LOCUS_51790 14925 11842 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529306.1 protein_id gnl|my_center|LOCUS_51790 >Feature sequence152 1147 50 gene locus_tag LOCUS_51800 1147 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51800 1564 1190 gene locus_tag LOCUS_51810 1564 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51810 1943 1758 gene locus_tag LOCUS_51820 1943 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 2251 2084 gene locus_tag LOCUS_51830 2251 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51830 2529 2738 gene locus_tag LOCUS_51840 2529 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 5110 2648 gene locus_tag LOCUS_51850 5110 2648 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531133.1 protein_id gnl|my_center|LOCUS_51850 5364 5107 gene locus_tag LOCUS_51860 5364 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 6080 5466 gene locus_tag LOCUS_51870 6080 5466 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082103.1 protein_id gnl|my_center|LOCUS_51870 6988 6107 gene locus_tag LOCUS_51880 gene dapA 6988 6107 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919078.1 protein_id gnl|my_center|LOCUS_51880 8197 7007 gene locus_tag LOCUS_51890 8197 7007 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 protein_id gnl|my_center|LOCUS_51890 8498 9406 gene locus_tag LOCUS_51900 8498 9406 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844087.1 protein_id gnl|my_center|LOCUS_51900 9803 10495 gene locus_tag LOCUS_51910 9803 10495 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531175.1 protein_id gnl|my_center|LOCUS_51910 11131 10748 gene locus_tag LOCUS_51920 11131 10748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 12440 12012 gene locus_tag LOCUS_51930 12440 12012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 14360 12777 gene locus_tag LOCUS_51940 14360 12777 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095694375.1 protein_id gnl|my_center|LOCUS_51940 14736 14491 gene locus_tag LOCUS_51950 14736 14491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 >Feature sequence153 76 690 gene locus_tag LOCUS_51960 76 690 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529516.1 protein_id gnl|my_center|LOCUS_51960 795 1505 gene locus_tag LOCUS_51970 795 1505 CDS product DUF1868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970661.1 protein_id gnl|my_center|LOCUS_51970 1688 2545 gene locus_tag LOCUS_51980 gene phnC 1688 2545 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529515.1 protein_id gnl|my_center|LOCUS_51980 2709 3617 gene locus_tag LOCUS_51990 gene phnD 2709 3617 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529514.1 protein_id gnl|my_center|LOCUS_51990 3660 4628 gene locus_tag LOCUS_52000 gene phnE 3660 4628 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529513.1 protein_id gnl|my_center|LOCUS_52000 4694 6061 gene locus_tag LOCUS_52010 gene phnE 4694 6061 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529512.1 protein_id gnl|my_center|LOCUS_52010 7144 6293 gene locus_tag LOCUS_52020 7144 6293 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529511.1 protein_id gnl|my_center|LOCUS_52020 8398 7211 gene locus_tag LOCUS_52030 8398 7211 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529510.1 protein_id gnl|my_center|LOCUS_52030 9601 8546 gene locus_tag LOCUS_52040 9601 8546 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529509.1 protein_id gnl|my_center|LOCUS_52040 10002 10889 gene locus_tag LOCUS_52050 10002 10889 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529508.1 protein_id gnl|my_center|LOCUS_52050 10944 12113 gene locus_tag LOCUS_52060 10944 12113 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529507.1 protein_id gnl|my_center|LOCUS_52060 12116 12832 gene locus_tag LOCUS_52070 12116 12832 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529506.1 protein_id gnl|my_center|LOCUS_52070 12898 13878 gene locus_tag LOCUS_52080 12898 13878 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529505.1 protein_id gnl|my_center|LOCUS_52080 13880 14299 gene locus_tag LOCUS_52090 13880 14299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529504.1 protein_id gnl|my_center|LOCUS_52090 >Feature sequence154 <1 552 gene locus_tag LOCUS_52100 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529246.1:fructose-bisphosphate aldolase class I 711 1451 gene locus_tag LOCUS_52110 711 1451 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529245.1 protein_id gnl|my_center|LOCUS_52110 1507 2235 gene locus_tag LOCUS_52120 1507 2235 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529244.1 protein_id gnl|my_center|LOCUS_52120 2443 2264 gene locus_tag LOCUS_52130 2443 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529243.1 protein_id gnl|my_center|LOCUS_52130 2626 2793 gene locus_tag LOCUS_52140 2626 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529241.1 protein_id gnl|my_center|LOCUS_52140 3008 3418 gene locus_tag LOCUS_52150 3008 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529239.1 protein_id gnl|my_center|LOCUS_52150 3493 4212 gene locus_tag LOCUS_52160 3493 4212 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529238.1 protein_id gnl|my_center|LOCUS_52160 4971 4276 gene locus_tag LOCUS_52170 4971 4276 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529237.1 protein_id gnl|my_center|LOCUS_52170 5437 5246 gene locus_tag LOCUS_52180 5437 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 6775 5765 gene locus_tag LOCUS_52190 6775 5765 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529235.1 protein_id gnl|my_center|LOCUS_52190 6887 7081 gene locus_tag LOCUS_52200 6887 7081 CDS product DUF1192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529234.1 protein_id gnl|my_center|LOCUS_52200 7165 8412 gene locus_tag LOCUS_52210 7165 8412 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529233.1 protein_id gnl|my_center|LOCUS_52210 8444 8719 gene locus_tag LOCUS_52220 8444 8719 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529232.1 protein_id gnl|my_center|LOCUS_52220 8801 9190 gene locus_tag LOCUS_52230 8801 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 9904 9248 gene locus_tag LOCUS_52240 9904 9248 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529231.1 protein_id gnl|my_center|LOCUS_52240 10846 9983 gene locus_tag LOCUS_52250 10846 9983 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529230.1 protein_id gnl|my_center|LOCUS_52250 10945 11457 gene locus_tag LOCUS_52260 10945 11457 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529229.1 protein_id gnl|my_center|LOCUS_52260 11564 11995 gene locus_tag LOCUS_52270 11564 11995 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529227.1 protein_id gnl|my_center|LOCUS_52270 12442 12041 gene locus_tag LOCUS_52280 12442 12041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529226.1 protein_id gnl|my_center|LOCUS_52280 12899 12717 gene locus_tag LOCUS_52290 gene rpmF 12899 12717 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008834724.1 protein_id gnl|my_center|LOCUS_52290 13761 13054 gene locus_tag LOCUS_52300 13761 13054 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529225.1 protein_id gnl|my_center|LOCUS_52300 >Feature sequence155 713 480 gene locus_tag LOCUS_52310 713 480 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909092.1 protein_id gnl|my_center|LOCUS_52310 3032 810 gene locus_tag LOCUS_52320 gene purL 3032 810 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532135.1 protein_id gnl|my_center|LOCUS_52320 1206 1215 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4583 3174 gene locus_tag LOCUS_52330 4583 3174 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532134.1 protein_id gnl|my_center|LOCUS_52330 4675 4923 gene locus_tag LOCUS_52340 4675 4923 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532133.1 protein_id gnl|my_center|LOCUS_52340 5589 4960 gene locus_tag LOCUS_52350 5589 4960 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532132.1 protein_id gnl|my_center|LOCUS_52350 6004 5594 gene locus_tag LOCUS_52360 6004 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532131.1 protein_id gnl|my_center|LOCUS_52360 6718 6050 gene locus_tag LOCUS_52370 gene purQ 6718 6050 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532129.1 protein_id gnl|my_center|LOCUS_52370 6958 6719 gene locus_tag LOCUS_52380 gene purS 6958 6719 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532128.1 protein_id gnl|my_center|LOCUS_52380 7820 7026 gene locus_tag LOCUS_52390 7820 7026 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532127.1 protein_id gnl|my_center|LOCUS_52390 8098 8418 gene locus_tag LOCUS_52400 8098 8418 CDS product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 protein_id gnl|my_center|LOCUS_52400 8576 9349 gene locus_tag LOCUS_52410 8576 9349 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532125.1 protein_id gnl|my_center|LOCUS_52410 9937 9371 gene locus_tag LOCUS_52420 9937 9371 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532123.1 protein_id gnl|my_center|LOCUS_52420 10170 10982 gene locus_tag LOCUS_52430 10170 10982 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532122.1 protein_id gnl|my_center|LOCUS_52430 12488 11181 gene locus_tag LOCUS_52440 gene purB 12488 11181 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532121.1 protein_id gnl|my_center|LOCUS_52440 13073 12549 gene locus_tag LOCUS_52450 13073 12549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532120.1 protein_id gnl|my_center|LOCUS_52450 13795 13070 gene locus_tag LOCUS_52460 13795 13070 CDS product DUF2259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532119.1 protein_id gnl|my_center|LOCUS_52460 13928 14182 gene locus_tag LOCUS_52470 13928 14182 CDS product DUF2171 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532118.1 protein_id gnl|my_center|LOCUS_52470 >Feature sequence156 858 1448 gene locus_tag LOCUS_52480 858 1448 CDS product NodA family N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533527.1 protein_id gnl|my_center|LOCUS_52480 1445 2104 gene locus_tag LOCUS_52490 gene nodB 1445 2104 CDS product chitooligosaccharide deacetylase NodB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875356.1 protein_id gnl|my_center|LOCUS_52490 2120 3445 gene locus_tag LOCUS_52500 gene nodC 2120 3445 CDS product chitooligosaccharide synthase NodC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533535.1 protein_id gnl|my_center|LOCUS_52500 3706 4620 gene locus_tag LOCUS_52510 gene nodI 3706 4620 CDS product nodulation factor ABC transporter ATP-binding protein NodI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533536.1 protein_id gnl|my_center|LOCUS_52510 4624 5412 gene locus_tag LOCUS_52520 4624 5412 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533537.1 protein_id gnl|my_center|LOCUS_52520 5700 6461 gene locus_tag LOCUS_52530 5700 6461 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970900.1 protein_id gnl|my_center|LOCUS_52530 6847 8133 gene locus_tag LOCUS_52540 6847 8133 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049802419.1 protein_id gnl|my_center|LOCUS_52540 8633 8349 gene locus_tag LOCUS_52550 8633 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 8715 9473 gene locus_tag LOCUS_52560 8715 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 9638 10441 gene locus_tag LOCUS_52570 9638 10441 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533525.1 protein_id gnl|my_center|LOCUS_52570 11407 10490 gene locus_tag LOCUS_52580 11407 10490 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533526.1 protein_id gnl|my_center|LOCUS_52580 12080 13609 gene locus_tag LOCUS_52590 12080 13609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 >Feature sequence157 625 1425 gene locus_tag LOCUS_52600 625 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 1704 1435 gene locus_tag LOCUS_52610 1704 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530503.1 protein_id gnl|my_center|LOCUS_52610 2628 1810 gene locus_tag LOCUS_52620 2628 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 3860 2946 gene locus_tag LOCUS_52630 3860 2946 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529480.1 protein_id gnl|my_center|LOCUS_52630 3973 4611 gene locus_tag LOCUS_52640 3973 4611 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529481.1 protein_id gnl|my_center|LOCUS_52640 4649 5257 gene locus_tag LOCUS_52650 4649 5257 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529482.1 protein_id gnl|my_center|LOCUS_52650 5487 6125 gene locus_tag LOCUS_52660 5487 6125 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529878.1 protein_id gnl|my_center|LOCUS_52660 6487 9468 gene locus_tag LOCUS_52670 6487 9468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 9597 11360 gene locus_tag LOCUS_52680 9597 11360 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529876.1 protein_id gnl|my_center|LOCUS_52680 11464 12795 gene locus_tag LOCUS_52690 11464 12795 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529875.1 protein_id gnl|my_center|LOCUS_52690 >Feature sequence158 157 834 gene locus_tag LOCUS_52700 157 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_52700 831 2153 gene locus_tag LOCUS_52710 831 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52710 2170 2307 gene locus_tag LOCUS_52720 2170 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 2317 2544 gene locus_tag LOCUS_52730 2317 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 2582 4093 gene locus_tag LOCUS_52740 2582 4093 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192488.1 protein_id gnl|my_center|LOCUS_52740 4199 5470 gene locus_tag LOCUS_52750 4199 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52750 4326 4335 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5446 5829 gene locus_tag LOCUS_52760 5446 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52760 5829 6953 gene locus_tag LOCUS_52770 5829 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122840.1 protein_id gnl|my_center|LOCUS_52770 6953 7333 gene locus_tag LOCUS_52780 6953 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 8532 7825 gene locus_tag LOCUS_52790 8532 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 9552 8755 gene locus_tag LOCUS_52800 9552 8755 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173829.1 protein_id gnl|my_center|LOCUS_52800 11436 9910 gene locus_tag LOCUS_52810 11436 9910 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089709.1 protein_id gnl|my_center|LOCUS_52810 13155 11440 gene locus_tag LOCUS_52820 13155 11440 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478308.1 protein_id gnl|my_center|LOCUS_52820 >Feature sequence159 550 626 gene locus_tag LOCUS_t00380 550 626 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 726 1214 gene locus_tag LOCUS_52830 726 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 1835 1413 gene locus_tag LOCUS_52840 1835 1413 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160608.1 protein_id gnl|my_center|LOCUS_52840 2086 1832 gene locus_tag LOCUS_52850 2086 1832 CDS product Arc family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974671.1 protein_id gnl|my_center|LOCUS_52850 2871 2167 gene locus_tag LOCUS_52860 gene hdaA 2871 2167 CDS product DnaA regulatory inactivator HdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532442.1 protein_id gnl|my_center|LOCUS_52860 4080 2878 gene locus_tag LOCUS_52870 4080 2878 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532443.1 protein_id gnl|my_center|LOCUS_52870 4609 4052 gene locus_tag LOCUS_52880 4609 4052 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_52880 4860 5087 gene locus_tag LOCUS_52890 4860 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52890 4993 5952 gene locus_tag LOCUS_52900 gene purM 4993 5952 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532445.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52900 5053 5062 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5949 6656 gene locus_tag LOCUS_52910 gene purN 5949 6656 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532446.1 protein_id gnl|my_center|LOCUS_52910 6672 7187 gene locus_tag LOCUS_52920 6672 7187 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 protein_id gnl|my_center|LOCUS_52920 7614 7387 gene locus_tag LOCUS_52930 7614 7387 CDS product DUF680 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532448.1 protein_id gnl|my_center|LOCUS_52930 8314 8051 gene locus_tag LOCUS_52940 8314 8051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 8225 8848 gene locus_tag LOCUS_52950 8225 8848 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532452.1 protein_id gnl|my_center|LOCUS_52950 8838 10190 gene locus_tag LOCUS_52960 8838 10190 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532453.1 protein_id gnl|my_center|LOCUS_52960 11080 10202 gene locus_tag LOCUS_52970 11080 10202 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532454.1 protein_id gnl|my_center|LOCUS_52970 12032 11178 gene locus_tag LOCUS_52980 12032 11178 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532455.1 protein_id gnl|my_center|LOCUS_52980 13210 12197 gene locus_tag LOCUS_52990 13210 12197 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532456.1 protein_id gnl|my_center|LOCUS_52990 >Feature sequence160 1 621 gene locus_tag LOCUS_53000 1 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 1040 618 gene locus_tag LOCUS_53010 1040 618 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531210.1 protein_id gnl|my_center|LOCUS_53010 1896 1132 gene locus_tag LOCUS_53020 1896 1132 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531211.1 protein_id gnl|my_center|LOCUS_53020 2248 2060 gene locus_tag LOCUS_53030 2248 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531212.1 protein_id gnl|my_center|LOCUS_53030 3067 2282 gene locus_tag LOCUS_53040 3067 2282 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531213.1 protein_id gnl|my_center|LOCUS_53040 3182 3613 gene locus_tag LOCUS_53050 3182 3613 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531214.1 protein_id gnl|my_center|LOCUS_53050 5269 3647 gene locus_tag LOCUS_53060 5269 3647 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531215.1 protein_id gnl|my_center|LOCUS_53060 6135 5266 gene locus_tag LOCUS_53070 6135 5266 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531216.1 protein_id gnl|my_center|LOCUS_53070 6533 6132 gene locus_tag LOCUS_53080 6533 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53080 6514 6523 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8830 7352 gene locus_tag LOCUS_53090 8830 7352 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 protein_id gnl|my_center|LOCUS_53090 10240 8960 gene locus_tag LOCUS_53100 10240 8960 CDS product acetylornithine deacetylase/succinyl-diaminopimelate desuccinylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531219.1 protein_id gnl|my_center|LOCUS_53100 10481 10894 gene locus_tag LOCUS_53110 10481 10894 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531220.1 protein_id gnl|my_center|LOCUS_53110 11053 11892 gene locus_tag LOCUS_53120 11053 11892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 13019 12030 gene locus_tag LOCUS_53130 13019 12030 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531221.1 protein_id gnl|my_center|LOCUS_53130 <13831 13025 gene locus_tag LOCUS_53140 <13831 13025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531222.1:zinc-binding dehydrogenase >Feature sequence161 447 97 gene locus_tag LOCUS_53150 447 97 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173552.1 protein_id gnl|my_center|LOCUS_53150 616 1053 gene locus_tag LOCUS_53160 616 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533615.1 protein_id gnl|my_center|LOCUS_53160 1154 1813 gene locus_tag LOCUS_53170 1154 1813 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533614.1 protein_id gnl|my_center|LOCUS_53170 2515 1859 gene locus_tag LOCUS_53180 2515 1859 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082920.1 protein_id gnl|my_center|LOCUS_53180 2609 3241 gene locus_tag LOCUS_53190 2609 3241 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112419.1 protein_id gnl|my_center|LOCUS_53190 6713 3396 gene locus_tag LOCUS_53200 6713 3396 CDS product PAS-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173555.1 protein_id gnl|my_center|LOCUS_53200 3414 3423 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6958 7380 gene locus_tag LOCUS_53210 gene mscL 6958 7380 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533610.1 protein_id gnl|my_center|LOCUS_53210 7488 8654 gene locus_tag LOCUS_53220 7488 8654 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533609.1 protein_id gnl|my_center|LOCUS_53220 10225 8948 gene locus_tag LOCUS_53230 gene hemA 10225 8948 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533608.1 protein_id gnl|my_center|LOCUS_53230 10500 11495 gene locus_tag LOCUS_53240 gene galE 10500 11495 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533607.1 protein_id gnl|my_center|LOCUS_53240 11648 11657 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11672 12910 gene locus_tag LOCUS_53250 11672 12910 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533606.1 protein_id gnl|my_center|LOCUS_53250 >Feature sequence162 556 41 gene locus_tag LOCUS_53260 556 41 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191763.1 protein_id gnl|my_center|LOCUS_53260 1677 1198 gene locus_tag LOCUS_53270 1677 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 3215 2427 gene locus_tag LOCUS_53280 3215 2427 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222556.1 protein_id gnl|my_center|LOCUS_53280 4062 3253 gene locus_tag LOCUS_53290 4062 3253 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930042.1 protein_id gnl|my_center|LOCUS_53290 5467 4184 gene locus_tag LOCUS_53300 5467 4184 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_53300 7674 5485 gene locus_tag LOCUS_53310 7674 5485 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528128.1 protein_id gnl|my_center|LOCUS_53310 8447 7692 gene locus_tag LOCUS_53320 8447 7692 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086233.1 protein_id gnl|my_center|LOCUS_53320 9241 8459 gene locus_tag LOCUS_53330 gene fabG 9241 8459 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918744.1 protein_id gnl|my_center|LOCUS_53330 10566 9838 gene locus_tag LOCUS_53340 10566 9838 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812272.1 protein_id gnl|my_center|LOCUS_53340 11877 10762 gene locus_tag LOCUS_53350 11877 10762 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139584.1 protein_id gnl|my_center|LOCUS_53350 12915 11932 gene locus_tag LOCUS_53360 gene rbsC 12915 11932 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664522.1 protein_id gnl|my_center|LOCUS_53360 <13552 12912 gene locus_tag LOCUS_53370 <13552 12912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528166.1:sugar ABC transporter ATP-binding protein >Feature sequence163 116 2050 gene locus_tag LOCUS_53380 116 2050 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490278.1 protein_id gnl|my_center|LOCUS_53380 2773 4011 gene locus_tag LOCUS_53390 gene repC 2773 4011 CDS product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252962.1 protein_id gnl|my_center|LOCUS_53390 4011 4526 gene locus_tag LOCUS_53400 4011 4526 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162991803.1 protein_id gnl|my_center|LOCUS_53400 4923 5255 gene locus_tag LOCUS_53410 4923 5255 CDS product DUF736 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095689859.1 protein_id gnl|my_center|LOCUS_53410 5376 5582 gene locus_tag LOCUS_53420 5376 5582 CDS product antitoxin VbhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969888.1 protein_id gnl|my_center|LOCUS_53420 5637 6224 gene locus_tag LOCUS_53430 5637 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53430 6152 6706 gene locus_tag LOCUS_53440 6152 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53440 6936 7823 gene locus_tag LOCUS_53450 6936 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 8091 9284 gene locus_tag LOCUS_53460 gene repA 8091 9284 CDS product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969718.1 protein_id gnl|my_center|LOCUS_53460 9284 10300 gene locus_tag LOCUS_53470 gene repB 9284 10300 CDS product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243826.1 protein_id gnl|my_center|LOCUS_53470 10499 11662 gene locus_tag LOCUS_53480 gene repC 10499 11662 CDS product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525330.1 protein_id gnl|my_center|LOCUS_53480 11749 12180 gene locus_tag LOCUS_53490 11749 12180 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145161531.1 protein_id gnl|my_center|LOCUS_53490 12177 12659 gene locus_tag LOCUS_53500 12177 12659 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145161534.1 protein_id gnl|my_center|LOCUS_53500 >Feature sequence164 1098 562 gene locus_tag LOCUS_53510 1098 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 2308 1250 gene locus_tag LOCUS_53520 2308 1250 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171909.1 protein_id gnl|my_center|LOCUS_53520 3483 5246 gene locus_tag LOCUS_53530 3483 5246 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 protein_id gnl|my_center|LOCUS_53530 5573 5941 gene locus_tag LOCUS_53540 5573 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53540 6739 6293 gene locus_tag LOCUS_53550 6739 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53550 7069 7458 gene locus_tag LOCUS_53560 7069 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53560 7458 8276 gene locus_tag LOCUS_53570 7458 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 8367 9602 gene locus_tag LOCUS_53580 8367 9602 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764772.1 protein_id gnl|my_center|LOCUS_53580 9599 10543 gene locus_tag LOCUS_53590 9599 10543 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764770.1 protein_id gnl|my_center|LOCUS_53590 10540 10752 gene locus_tag LOCUS_53600 10540 10752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53600 11015 11533 gene locus_tag LOCUS_53610 11015 11533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53610 11878 12882 gene locus_tag LOCUS_53620 11878 12882 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108412.1 protein_id gnl|my_center|LOCUS_53620 >Feature sequence165 <1 1583 gene locus_tag LOCUS_53630 <1 1583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531594.1:phage tail tip lysozyme 1583 3703 gene locus_tag LOCUS_53640 1583 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531593.1 protein_id gnl|my_center|LOCUS_53640 3886 3638 gene locus_tag LOCUS_53650 3886 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143747802.1 protein_id gnl|my_center|LOCUS_53650 4476 4213 gene locus_tag LOCUS_53660 4476 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 4766 5134 gene locus_tag LOCUS_53670 4766 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 5491 5189 gene locus_tag LOCUS_53680 5491 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532437.1 protein_id gnl|my_center|LOCUS_53680 5853 6122 gene locus_tag LOCUS_53690 5853 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53690 6244 6104 gene locus_tag LOCUS_53700 6244 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 6555 6244 gene locus_tag LOCUS_53710 6555 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53710 6775 6563 gene locus_tag LOCUS_53720 6775 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 7031 6807 gene locus_tag LOCUS_53730 7031 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53730 8019 7168 gene locus_tag LOCUS_53740 8019 7168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53740 8629 8138 gene locus_tag LOCUS_53750 8629 8138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53750 8865 8626 gene locus_tag LOCUS_53760 8865 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53760 8988 9680 gene locus_tag LOCUS_53770 8988 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183464203.1 protein_id gnl|my_center|LOCUS_53770 9683 10132 gene locus_tag LOCUS_53780 9683 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 10132 10419 gene locus_tag LOCUS_53790 10132 10419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 12522 13274 gene locus_tag LOCUS_53800 12522 13274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 >Feature sequence166 325 41 gene locus_tag LOCUS_53810 325 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 945 589 gene locus_tag LOCUS_53820 945 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53820 1286 1080 gene locus_tag LOCUS_53830 1286 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53830 2545 1565 gene locus_tag LOCUS_53840 2545 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53840 2984 3961 gene locus_tag LOCUS_53850 2984 3961 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195013.1 protein_id gnl|my_center|LOCUS_53850 4055 4537 gene locus_tag LOCUS_53860 4055 4537 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230138.1 protein_id gnl|my_center|LOCUS_53860 5965 4709 gene locus_tag LOCUS_53870 5965 4709 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133034483.1 protein_id gnl|my_center|LOCUS_53870 7323 5962 gene locus_tag LOCUS_53880 7323 5962 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532099.1 protein_id gnl|my_center|LOCUS_53880 8624 7401 gene locus_tag LOCUS_53890 8624 7401 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_53890 10382 9645 gene locus_tag LOCUS_53900 10382 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53900 11121 10375 gene locus_tag LOCUS_53910 11121 10375 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967496.1 protein_id gnl|my_center|LOCUS_53910 11120 11260 gene locus_tag LOCUS_53920 11120 11260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 12401 11286 gene locus_tag LOCUS_53930 12401 11286 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394854.1 protein_id gnl|my_center|LOCUS_53930 >Feature sequence167 184 1266 gene locus_tag LOCUS_53940 184 1266 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531811.1 protein_id gnl|my_center|LOCUS_53940 1267 2133 gene locus_tag LOCUS_53950 1267 2133 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531810.1 protein_id gnl|my_center|LOCUS_53950 2135 3049 gene locus_tag LOCUS_53960 2135 3049 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531809.1 protein_id gnl|my_center|LOCUS_53960 3052 3339 gene locus_tag LOCUS_53970 3052 3339 CDS product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503495.1 protein_id gnl|my_center|LOCUS_53970 3416 5143 gene locus_tag LOCUS_53980 3416 5143 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531807.1 protein_id gnl|my_center|LOCUS_53980 5238 6731 gene locus_tag LOCUS_53990 gene glpK 5238 6731 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531806.1 protein_id gnl|my_center|LOCUS_53990 6764 7240 gene locus_tag LOCUS_54000 6764 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240467.1 protein_id gnl|my_center|LOCUS_54000 7788 7333 gene locus_tag LOCUS_54010 7788 7333 CDS product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531805.1 protein_id gnl|my_center|LOCUS_54010 8084 8159 gene locus_tag LOCUS_t00390 8084 8159 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 9084 8788 gene locus_tag LOCUS_54020 9084 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 9414 9953 gene locus_tag LOCUS_54030 9414 9953 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528603.1 protein_id gnl|my_center|LOCUS_54030 10058 10273 gene locus_tag LOCUS_54040 10058 10273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530769.1 protein_id gnl|my_center|LOCUS_54040 10372 11514 gene locus_tag LOCUS_54050 10372 11514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530290.1 protein_id gnl|my_center|LOCUS_54050 12389 11511 gene locus_tag LOCUS_54060 12389 11511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54060 >Feature sequence168 <1 1432 gene locus_tag LOCUS_54070 <1 1432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037398965.1:sensor histidine kinase 1434 2789 gene locus_tag LOCUS_54080 gene dctD 1434 2789 CDS product C4-dicarboxylate transport transcriptional regulatory protein DctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529421.1 protein_id gnl|my_center|LOCUS_54080 2958 3305 gene locus_tag LOCUS_54090 2958 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235983998.1 protein_id gnl|my_center|LOCUS_54090 3406 3239 gene locus_tag LOCUS_54100 3406 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 4128 3406 gene locus_tag LOCUS_54110 4128 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 5981 4689 gene locus_tag LOCUS_54120 gene rhaI 5981 4689 CDS product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533596.1 protein_id gnl|my_center|LOCUS_54120 8170 6068 gene locus_tag LOCUS_54130 8170 6068 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533597.1 protein_id gnl|my_center|LOCUS_54130 8335 9165 gene locus_tag LOCUS_54140 8335 9165 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533598.1 protein_id gnl|my_center|LOCUS_54140 9214 10209 gene locus_tag LOCUS_54150 gene rhaS 9214 10209 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533599.1 protein_id gnl|my_center|LOCUS_54150 10294 11850 gene locus_tag LOCUS_54160 10294 11850 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533600.1 protein_id gnl|my_center|LOCUS_54160 11847 12824 gene locus_tag LOCUS_54170 11847 12824 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533601.1 protein_id gnl|my_center|LOCUS_54170 >Feature sequence169 <1 538 gene locus_tag LOCUS_54180 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532006.1:DNA repair protein RadC 678 1499 gene locus_tag LOCUS_54190 678 1499 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392177.1 protein_id gnl|my_center|LOCUS_54190 1266 1275 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1594 2466 gene locus_tag LOCUS_54200 1594 2466 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969990.1 protein_id gnl|my_center|LOCUS_54200 2488 4257 gene locus_tag LOCUS_54210 gene ctaD 2488 4257 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577418.1 protein_id gnl|my_center|LOCUS_54210 4254 4958 gene locus_tag LOCUS_54220 4254 4958 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086564.1 protein_id gnl|my_center|LOCUS_54220 4969 5691 gene locus_tag LOCUS_54230 4969 5691 CDS product heme-copper oxidase subunit III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086563.1 protein_id gnl|my_center|LOCUS_54230 5718 6116 gene locus_tag LOCUS_54240 5718 6116 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966245.1 protein_id gnl|my_center|LOCUS_54240 6251 6724 gene locus_tag LOCUS_54250 6251 6724 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327119.1 protein_id gnl|my_center|LOCUS_54250 7687 6869 gene locus_tag LOCUS_54260 7687 6869 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532367.1 protein_id gnl|my_center|LOCUS_54260 8983 8054 gene locus_tag LOCUS_54270 8983 8054 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532778.1 protein_id gnl|my_center|LOCUS_54270 9398 9018 gene locus_tag LOCUS_54280 9398 9018 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532062.1 protein_id gnl|my_center|LOCUS_54280 10108 9584 gene locus_tag LOCUS_54290 10108 9584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532008.1 protein_id gnl|my_center|LOCUS_54290 11802 10288 gene locus_tag LOCUS_54300 gene tig 11802 10288 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532009.1 protein_id gnl|my_center|LOCUS_54300 12122 12204 gene locus_tag LOCUS_t00400 12122 12204 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <12785 12236 gene locus_tag LOCUS_54310 <12785 12236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531318.1:aromatic amino acid lyase >Feature sequence170 416 664 gene locus_tag LOCUS_54320 416 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 1030 2094 gene locus_tag LOCUS_54330 1030 2094 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525333.1 protein_id gnl|my_center|LOCUS_54330 2494 2736 gene locus_tag LOCUS_54340 2494 2736 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034522604.1 protein_id gnl|my_center|LOCUS_54340 2736 3152 gene locus_tag LOCUS_54350 2736 3152 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971025.1 protein_id gnl|my_center|LOCUS_54350 3142 4311 gene locus_tag LOCUS_54360 3142 4311 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970303.1 protein_id gnl|my_center|LOCUS_54360 5637 4345 gene locus_tag LOCUS_54370 gene repC 5637 4345 CDS product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974840.1 protein_id gnl|my_center|LOCUS_54370 6717 5848 gene locus_tag LOCUS_54380 gene repB 6717 5848 CDS product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525329.1 protein_id gnl|my_center|LOCUS_54380 8115 6910 gene locus_tag LOCUS_54390 gene repA 8115 6910 CDS product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858029.1 protein_id gnl|my_center|LOCUS_54390 8639 8962 gene locus_tag LOCUS_54400 8639 8962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 9234 9470 gene locus_tag LOCUS_54410 9234 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 10768 9617 gene locus_tag LOCUS_54420 10768 9617 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525333.1 protein_id gnl|my_center|LOCUS_54420 11239 11511 gene locus_tag LOCUS_54430 11239 11511 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971026.1 protein_id gnl|my_center|LOCUS_54430 11498 11941 gene locus_tag LOCUS_54440 11498 11941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 >Feature sequence171 <1 935 gene locus_tag LOCUS_54450 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532871.1:LacI family DNA-binding transcriptional regulator 2123 1275 gene locus_tag LOCUS_54460 2123 1275 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494169.1 protein_id gnl|my_center|LOCUS_54460 2707 2123 gene locus_tag LOCUS_54470 2707 2123 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532873.1 protein_id gnl|my_center|LOCUS_54470 2950 3207 gene locus_tag LOCUS_54480 2950 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532874.1 protein_id gnl|my_center|LOCUS_54480 3201 6383 gene locus_tag LOCUS_54490 3201 6383 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532875.1 protein_id gnl|my_center|LOCUS_54490 6419 7573 gene locus_tag LOCUS_54500 6419 7573 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532876.1 protein_id gnl|my_center|LOCUS_54500 8139 8831 gene locus_tag LOCUS_54510 8139 8831 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532877.1 protein_id gnl|my_center|LOCUS_54510 8859 9965 gene locus_tag LOCUS_54520 8859 9965 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 protein_id gnl|my_center|LOCUS_54520 10086 10601 gene locus_tag LOCUS_54530 10086 10601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54530 10958 12280 gene locus_tag LOCUS_54540 10958 12280 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530222.1 protein_id gnl|my_center|LOCUS_54540 >Feature sequence172 673 185 gene locus_tag LOCUS_54550 673 185 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240736.1 protein_id gnl|my_center|LOCUS_54550 2177 678 gene locus_tag LOCUS_54560 gene gatB 2177 678 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531347.1 protein_id gnl|my_center|LOCUS_54560 2775 2344 gene locus_tag LOCUS_54570 2775 2344 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531344.1 protein_id gnl|my_center|LOCUS_54570 3612 2881 gene locus_tag LOCUS_54580 3612 2881 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531343.1 protein_id gnl|my_center|LOCUS_54580 4083 5615 gene locus_tag LOCUS_54590 4083 5615 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164830060.1 protein_id gnl|my_center|LOCUS_54590 5612 6625 gene locus_tag LOCUS_54600 5612 6625 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970689.1 protein_id gnl|my_center|LOCUS_54600 6790 7869 gene locus_tag LOCUS_54610 6790 7869 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_54610 7878 8171 gene locus_tag LOCUS_54620 7878 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 9385 8342 gene locus_tag LOCUS_54630 9385 8342 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532920.1 protein_id gnl|my_center|LOCUS_54630 10040 10678 gene locus_tag LOCUS_54640 10040 10678 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531342.1 protein_id gnl|my_center|LOCUS_54640 10807 11424 gene locus_tag LOCUS_54650 10807 11424 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531341.1 protein_id gnl|my_center|LOCUS_54650 11689 12294 gene locus_tag LOCUS_54660 11689 12294 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531340.1 protein_id gnl|my_center|LOCUS_54660 >Feature sequence173 1089 211 gene locus_tag LOCUS_54670 1089 211 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528596.1 protein_id gnl|my_center|LOCUS_54670 1727 1089 gene locus_tag LOCUS_54680 1727 1089 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528597.1 protein_id gnl|my_center|LOCUS_54680 2659 1724 gene locus_tag LOCUS_54690 2659 1724 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063169669.1 protein_id gnl|my_center|LOCUS_54690 3423 2656 gene locus_tag LOCUS_54700 3423 2656 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528599.1 protein_id gnl|my_center|LOCUS_54700 4926 3577 gene locus_tag LOCUS_54710 4926 3577 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528600.1 protein_id gnl|my_center|LOCUS_54710 6841 5027 gene locus_tag LOCUS_54720 6841 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 7323 6922 gene locus_tag LOCUS_54730 7323 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54730 8555 7320 gene locus_tag LOCUS_54740 8555 7320 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_54740 8772 9713 gene locus_tag LOCUS_54750 gene gshB 8772 9713 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528601.1 protein_id gnl|my_center|LOCUS_54750 11053 9770 gene locus_tag LOCUS_54760 11053 9770 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386813.1 protein_id gnl|my_center|LOCUS_54760 10077 10086 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence174 251 259 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2617 440 gene locus_tag LOCUS_54770 2617 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 731 740 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3116 3580 gene locus_tag LOCUS_54780 3116 3580 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533661.1 protein_id gnl|my_center|LOCUS_54780 3819 5615 gene locus_tag LOCUS_54790 3819 5615 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533660.1 protein_id gnl|my_center|LOCUS_54790 5735 6178 gene locus_tag LOCUS_54800 5735 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54800 6175 7344 gene locus_tag LOCUS_54810 6175 7344 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533659.1 protein_id gnl|my_center|LOCUS_54810 7378 8586 gene locus_tag LOCUS_54820 7378 8586 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533658.1 protein_id gnl|my_center|LOCUS_54820 8601 10820 gene locus_tag LOCUS_54830 8601 10820 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533657.1 protein_id gnl|my_center|LOCUS_54830 10833 11375 gene locus_tag LOCUS_54840 10833 11375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 11471 12115 gene locus_tag LOCUS_54850 11471 12115 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533656.1 protein_id gnl|my_center|LOCUS_54850 >Feature sequence175 11 757 gene locus_tag LOCUS_54860 gene urtD 11 757 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531846.1 protein_id gnl|my_center|LOCUS_54860 828 1523 gene locus_tag LOCUS_54870 gene urtE 828 1523 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531845.1 protein_id gnl|my_center|LOCUS_54870 1948 2121 gene locus_tag LOCUS_54880 1948 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531844.1 protein_id gnl|my_center|LOCUS_54880 3292 2141 gene locus_tag LOCUS_54890 3292 2141 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531843.1 protein_id gnl|my_center|LOCUS_54890 4212 3406 gene locus_tag LOCUS_54900 4212 3406 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531842.1 protein_id gnl|my_center|LOCUS_54900 4705 4241 gene locus_tag LOCUS_54910 4705 4241 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531841.1 protein_id gnl|my_center|LOCUS_54910 7661 4740 gene locus_tag LOCUS_54920 gene uvrA 7661 4740 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531840.1 protein_id gnl|my_center|LOCUS_54920 8514 9227 gene locus_tag LOCUS_54930 8514 9227 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092159.1 protein_id gnl|my_center|LOCUS_54930 9646 9290 gene locus_tag LOCUS_54940 9646 9290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531839.1 protein_id gnl|my_center|LOCUS_54940 10248 9643 gene locus_tag LOCUS_54950 10248 9643 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531838.1 protein_id gnl|my_center|LOCUS_54950 10755 10273 gene locus_tag LOCUS_54960 10755 10273 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531837.1 protein_id gnl|my_center|LOCUS_54960 11066 10752 gene locus_tag LOCUS_54970 11066 10752 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531836.1 protein_id gnl|my_center|LOCUS_54970 11511 11110 gene locus_tag LOCUS_54980 11511 11110 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111546447.1 protein_id gnl|my_center|LOCUS_54980 >Feature sequence176 499 122 gene locus_tag LOCUS_54990 499 122 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528007.1 protein_id gnl|my_center|LOCUS_54990 724 2103 gene locus_tag LOCUS_55000 724 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55000 1680 1689 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2477 4282 gene locus_tag LOCUS_55010 2477 4282 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528004.1 protein_id gnl|my_center|LOCUS_55010 4790 4371 gene locus_tag LOCUS_55020 4790 4371 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529433.1 protein_id gnl|my_center|LOCUS_55020 4957 5355 gene locus_tag LOCUS_55030 4957 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528001.1 protein_id gnl|my_center|LOCUS_55030 6879 5371 gene locus_tag LOCUS_55040 6879 5371 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527999.1 protein_id gnl|my_center|LOCUS_55040 8672 7179 gene locus_tag LOCUS_55050 8672 7179 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 protein_id gnl|my_center|LOCUS_55050 8917 8753 gene locus_tag LOCUS_55060 8917 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 9115 10776 gene locus_tag LOCUS_55070 gene pgi 9115 10776 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527997.1 protein_id gnl|my_center|LOCUS_55070 9448 9457 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10782 11504 gene locus_tag LOCUS_55080 10782 11504 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527996.1 protein_id gnl|my_center|LOCUS_55080 >Feature sequence177 1170 3005 gene locus_tag LOCUS_55090 1170 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 3008 5155 gene locus_tag LOCUS_55100 3008 5155 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_55100 5347 6195 gene locus_tag LOCUS_55110 5347 6195 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 protein_id gnl|my_center|LOCUS_55110 6241 8229 gene locus_tag LOCUS_55120 6241 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 8279 9082 gene locus_tag LOCUS_55130 8279 9082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55130 10303 9263 gene locus_tag LOCUS_55140 10303 9263 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253027.1 protein_id gnl|my_center|LOCUS_55140 <11465 10316 gene locus_tag LOCUS_55150 <11465 10316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117635.1:SctV family type III secretion system export apparatus subunit LcrD >Feature sequence178 1301 1026 gene locus_tag LOCUS_55160 1301 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528891.1 protein_id gnl|my_center|LOCUS_55160 2976 1630 gene locus_tag LOCUS_55170 2976 1630 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163308.1 protein_id gnl|my_center|LOCUS_55170 3346 3008 gene locus_tag LOCUS_55180 3346 3008 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528889.1 protein_id gnl|my_center|LOCUS_55180 4467 3604 gene locus_tag LOCUS_55190 gene tesB 4467 3604 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528888.1 protein_id gnl|my_center|LOCUS_55190 4633 5895 gene locus_tag LOCUS_55200 4633 5895 CDS product ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163307.1 protein_id gnl|my_center|LOCUS_55200 6647 6117 gene locus_tag LOCUS_55210 6647 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528886.1 protein_id gnl|my_center|LOCUS_55210 7003 8022 gene locus_tag LOCUS_55220 7003 8022 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312895.1 protein_id gnl|my_center|LOCUS_55220 8092 9618 gene locus_tag LOCUS_55230 8092 9618 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973400.1 protein_id gnl|my_center|LOCUS_55230 9615 10631 gene locus_tag LOCUS_55240 9615 10631 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973399.1 protein_id gnl|my_center|LOCUS_55240 10439 10448 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10633 11316 gene locus_tag LOCUS_55250 10633 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 >Feature sequence179 668 450 gene locus_tag LOCUS_55260 668 450 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531295.1 protein_id gnl|my_center|LOCUS_55260 1604 849 gene locus_tag LOCUS_55270 gene scpB 1604 849 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531294.1 protein_id gnl|my_center|LOCUS_55270 2443 1601 gene locus_tag LOCUS_55280 2443 1601 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531293.1 protein_id gnl|my_center|LOCUS_55280 3484 2465 gene locus_tag LOCUS_55290 gene nagZ 3484 2465 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531292.1 protein_id gnl|my_center|LOCUS_55290 7148 3612 gene locus_tag LOCUS_55300 7148 3612 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531291.1 protein_id gnl|my_center|LOCUS_55300 9060 7252 gene locus_tag LOCUS_55310 gene argS 9060 7252 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531290.1 protein_id gnl|my_center|LOCUS_55310 10303 9074 gene locus_tag LOCUS_55320 10303 9074 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531289.1 protein_id gnl|my_center|LOCUS_55320 10374 10721 gene locus_tag LOCUS_55330 gene erpA 10374 10721 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531288.1 protein_id gnl|my_center|LOCUS_55330 10732 11136 gene locus_tag LOCUS_55340 10732 11136 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531287.1 protein_id gnl|my_center|LOCUS_55340 >Feature sequence180 923 2179 gene locus_tag LOCUS_55350 gene ilvA 923 2179 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531325.1 protein_id gnl|my_center|LOCUS_55350 2176 2733 gene locus_tag LOCUS_55360 2176 2733 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531326.1 protein_id gnl|my_center|LOCUS_55360 3035 2745 gene locus_tag LOCUS_55370 3035 2745 CDS product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531327.1 protein_id gnl|my_center|LOCUS_55370 3607 3167 gene locus_tag LOCUS_55380 gene gloA 3607 3167 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531328.1 protein_id gnl|my_center|LOCUS_55380 3906 4502 gene locus_tag LOCUS_55390 3906 4502 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531329.1 protein_id gnl|my_center|LOCUS_55390 4527 5090 gene locus_tag LOCUS_55400 4527 5090 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531330.1 protein_id gnl|my_center|LOCUS_55400 5110 5877 gene locus_tag LOCUS_55410 5110 5877 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172307.1 protein_id gnl|my_center|LOCUS_55410 5897 6397 gene locus_tag LOCUS_55420 5897 6397 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969353.1 protein_id gnl|my_center|LOCUS_55420 7064 6465 gene locus_tag LOCUS_55430 7064 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531332.1 protein_id gnl|my_center|LOCUS_55430 7188 8036 gene locus_tag LOCUS_55440 gene cysE 7188 8036 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531333.1 protein_id gnl|my_center|LOCUS_55440 8177 8380 gene locus_tag LOCUS_55450 8177 8380 CDS product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531334.1 protein_id gnl|my_center|LOCUS_55450 9189 8458 gene locus_tag LOCUS_55460 9189 8458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531335.1 protein_id gnl|my_center|LOCUS_55460 9317 9661 gene locus_tag LOCUS_55470 9317 9661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531336.1 protein_id gnl|my_center|LOCUS_55470 9681 10208 gene locus_tag LOCUS_55480 9681 10208 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531337.1 protein_id gnl|my_center|LOCUS_55480 10803 10240 gene locus_tag LOCUS_55490 10803 10240 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531338.1 protein_id gnl|my_center|LOCUS_55490 >Feature sequence181 935 300 gene locus_tag LOCUS_55500 935 300 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528367.1 protein_id gnl|my_center|LOCUS_55500 1062 1763 gene locus_tag LOCUS_55510 1062 1763 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528368.1 protein_id gnl|my_center|LOCUS_55510 3241 2132 gene locus_tag LOCUS_55520 3241 2132 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528369.1 protein_id gnl|my_center|LOCUS_55520 3471 4337 gene locus_tag LOCUS_55530 3471 4337 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502014.1 protein_id gnl|my_center|LOCUS_55530 4494 6422 gene locus_tag LOCUS_55540 gene iolC 4494 6422 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528371.1 protein_id gnl|my_center|LOCUS_55540 6459 8303 gene locus_tag LOCUS_55550 gene iolD 6459 8303 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528372.1 protein_id gnl|my_center|LOCUS_55550 8345 9259 gene locus_tag LOCUS_55560 gene iolE 8345 9259 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528373.1 protein_id gnl|my_center|LOCUS_55560 9325 9537 gene locus_tag LOCUS_55570 9325 9537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528374.1 protein_id gnl|my_center|LOCUS_55570 9552 10364 gene locus_tag LOCUS_55580 gene iolB 9552 10364 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528375.1 protein_id gnl|my_center|LOCUS_55580 >Feature sequence182 <1 1450 gene locus_tag LOCUS_55590 <1 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530998.1:glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase 1734 1585 gene locus_tag LOCUS_55600 1734 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55600 2662 1868 gene locus_tag LOCUS_55610 2662 1868 CDS product 27-O-demethylrifamycin SV methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222580.1 protein_id gnl|my_center|LOCUS_55610 4097 2673 gene locus_tag LOCUS_55620 4097 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 5209 4274 gene locus_tag LOCUS_55630 5209 4274 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531004.1 protein_id gnl|my_center|LOCUS_55630 5324 5785 gene locus_tag LOCUS_55640 5324 5785 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531005.1 protein_id gnl|my_center|LOCUS_55640 6082 5885 gene locus_tag LOCUS_55650 6082 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531006.1 protein_id gnl|my_center|LOCUS_55650 6714 6229 gene locus_tag LOCUS_55660 6714 6229 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531007.1 protein_id gnl|my_center|LOCUS_55660 7435 6743 gene locus_tag LOCUS_55670 7435 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 7651 9069 gene locus_tag LOCUS_55680 7651 9069 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531008.1 protein_id gnl|my_center|LOCUS_55680 9072 9569 gene locus_tag LOCUS_55690 9072 9569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141565.1 protein_id gnl|my_center|LOCUS_55690 >Feature sequence183 141 668 gene locus_tag LOCUS_55700 141 668 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528720.1 protein_id gnl|my_center|LOCUS_55700 693 1061 gene locus_tag LOCUS_55710 693 1061 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528719.1 protein_id gnl|my_center|LOCUS_55710 1483 1148 gene locus_tag LOCUS_55720 1483 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55720 2197 1580 gene locus_tag LOCUS_55730 2197 1580 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528717.1 protein_id gnl|my_center|LOCUS_55730 3657 2380 gene locus_tag LOCUS_55740 3657 2380 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528715.1 protein_id gnl|my_center|LOCUS_55740 4250 3891 gene locus_tag LOCUS_55750 4250 3891 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528714.1 protein_id gnl|my_center|LOCUS_55750 4560 4745 gene locus_tag LOCUS_55760 4560 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230646.1 protein_id gnl|my_center|LOCUS_55760 4961 6403 gene locus_tag LOCUS_55770 4961 6403 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528703.1 protein_id gnl|my_center|LOCUS_55770 6400 7575 gene locus_tag LOCUS_55780 6400 7575 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528702.1 protein_id gnl|my_center|LOCUS_55780 7714 8823 gene locus_tag LOCUS_55790 7714 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 8981 10222 gene locus_tag LOCUS_55800 8981 10222 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531949.1 protein_id gnl|my_center|LOCUS_55800 10232 10241 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence184 <1 1287 gene locus_tag LOCUS_55810 <1 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531860.1:ATP-binding protein 1487 2233 gene locus_tag LOCUS_55820 1487 2233 CDS product DeoD-type purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531859.1 protein_id gnl|my_center|LOCUS_55820 2637 2332 gene locus_tag LOCUS_55830 2637 2332 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531854.1 protein_id gnl|my_center|LOCUS_55830 2916 3290 gene locus_tag LOCUS_55840 2916 3290 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531853.1 protein_id gnl|my_center|LOCUS_55840 3371 3901 gene locus_tag LOCUS_55850 3371 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531852.1 protein_id gnl|my_center|LOCUS_55850 4079 4088 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4174 5523 gene locus_tag LOCUS_55860 4174 5523 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531851.1 protein_id gnl|my_center|LOCUS_55860 5983 5588 gene locus_tag LOCUS_55870 5983 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531850.1 protein_id gnl|my_center|LOCUS_55870 6318 7595 gene locus_tag LOCUS_55880 gene urtA 6318 7595 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531849.1 protein_id gnl|my_center|LOCUS_55880 7716 9329 gene locus_tag LOCUS_55890 gene urtB 7716 9329 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531848.1 protein_id gnl|my_center|LOCUS_55890 >Feature sequence185 1196 390 gene locus_tag LOCUS_55900 gene virB9 1196 390 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971094.1 protein_id gnl|my_center|LOCUS_55900 1888 1196 gene locus_tag LOCUS_55910 1888 1196 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971093.1 protein_id gnl|my_center|LOCUS_55910 2958 1927 gene locus_tag LOCUS_55920 2958 1927 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971092.1 protein_id gnl|my_center|LOCUS_55920 3198 2974 gene locus_tag LOCUS_55930 3198 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971091.1 protein_id gnl|my_center|LOCUS_55930 3892 3188 gene locus_tag LOCUS_55940 3892 3188 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971090.1 protein_id gnl|my_center|LOCUS_55940 4989 3904 gene locus_tag LOCUS_55950 4989 3904 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971089.1 protein_id gnl|my_center|LOCUS_55950 7397 4986 gene locus_tag LOCUS_55960 7397 4986 CDS product VirB4 family type IV secretion/conjugal transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971088.1 protein_id gnl|my_center|LOCUS_55960 7700 7401 gene locus_tag LOCUS_55970 7700 7401 CDS product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971087.1 protein_id gnl|my_center|LOCUS_55970 8047 7703 gene locus_tag LOCUS_55980 8047 7703 CDS product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971086.1 protein_id gnl|my_center|LOCUS_55980 8941 8060 gene locus_tag LOCUS_55990 8941 8060 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160470.1 protein_id gnl|my_center|LOCUS_55990 9139 9774 gene locus_tag LOCUS_56000 9139 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971084.1 protein_id gnl|my_center|LOCUS_56000 9771 10313 gene locus_tag LOCUS_56010 9771 10313 CDS product succinoglycan biosynthesis protein exoi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971083.1 protein_id gnl|my_center|LOCUS_56010 >Feature sequence186 1223 294 gene locus_tag LOCUS_56020 1223 294 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531363.1 protein_id gnl|my_center|LOCUS_56020 2382 1234 gene locus_tag LOCUS_56030 2382 1234 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531362.1 protein_id gnl|my_center|LOCUS_56030 2589 3926 gene locus_tag LOCUS_56040 2589 3926 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531361.1 protein_id gnl|my_center|LOCUS_56040 3987 4793 gene locus_tag LOCUS_56050 3987 4793 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531360.1 protein_id gnl|my_center|LOCUS_56050 4939 5373 gene locus_tag LOCUS_56060 gene aroQ 4939 5373 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531359.1 protein_id gnl|my_center|LOCUS_56060 5400 5864 gene locus_tag LOCUS_56070 gene accB 5400 5864 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531358.1 protein_id gnl|my_center|LOCUS_56070 5873 7216 gene locus_tag LOCUS_56080 gene accC 5873 7216 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531357.1 protein_id gnl|my_center|LOCUS_56080 7245 7862 gene locus_tag LOCUS_56090 gene aat 7245 7862 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531356.1 protein_id gnl|my_center|LOCUS_56090 8281 7874 gene locus_tag LOCUS_56100 8281 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531355.1 protein_id gnl|my_center|LOCUS_56100 8859 8347 gene locus_tag LOCUS_56110 8859 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 8762 9037 gene locus_tag LOCUS_56120 8762 9037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56120 9408 9010 gene locus_tag LOCUS_56130 9408 9010 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531353.1 protein_id gnl|my_center|LOCUS_56130 >Feature sequence187 180 476 gene locus_tag LOCUS_56140 180 476 CDS product YciI-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528905.1 protein_id gnl|my_center|LOCUS_56140 586 1011 gene locus_tag LOCUS_56150 586 1011 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528904.1 protein_id gnl|my_center|LOCUS_56150 1008 1664 gene locus_tag LOCUS_56160 1008 1664 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564970.1 protein_id gnl|my_center|LOCUS_56160 1746 2162 gene locus_tag LOCUS_56170 1746 2162 CDS product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528902.1 protein_id gnl|my_center|LOCUS_56170 3221 2301 gene locus_tag LOCUS_56180 gene gcvA 3221 2301 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528901.1 protein_id gnl|my_center|LOCUS_56180 3352 3627 gene locus_tag LOCUS_56190 3352 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528900.1 protein_id gnl|my_center|LOCUS_56190 4180 3665 gene locus_tag LOCUS_56200 4180 3665 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083833212.1 protein_id gnl|my_center|LOCUS_56200 4346 5029 gene locus_tag LOCUS_56210 4346 5029 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528898.1 protein_id gnl|my_center|LOCUS_56210 5254 5709 gene locus_tag LOCUS_56220 5254 5709 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528897.1 protein_id gnl|my_center|LOCUS_56220 5795 6889 gene locus_tag LOCUS_56230 5795 6889 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528896.1 protein_id gnl|my_center|LOCUS_56230 7761 6955 gene locus_tag LOCUS_56240 7761 6955 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528894.1 protein_id gnl|my_center|LOCUS_56240 8714 8049 gene locus_tag LOCUS_56250 8714 8049 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528893.1 protein_id gnl|my_center|LOCUS_56250 <10330 8860 gene locus_tag LOCUS_56260 <10330 8860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528892.1:DNA translocase FtsK >Feature sequence188 3 461 gene locus_tag LOCUS_56270 3 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 644 2158 gene locus_tag LOCUS_56280 644 2158 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529831.1 protein_id gnl|my_center|LOCUS_56280 3164 2298 gene locus_tag LOCUS_56290 3164 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502664.1 protein_id gnl|my_center|LOCUS_56290 3308 3517 gene locus_tag LOCUS_56300 3308 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 4190 3477 gene locus_tag LOCUS_56310 4190 3477 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972919.1 protein_id gnl|my_center|LOCUS_56310 4452 5366 gene locus_tag LOCUS_56320 4452 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56320 5285 5515 gene locus_tag LOCUS_56330 5285 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56330 5549 6838 gene locus_tag LOCUS_56340 5549 6838 CDS product PotD/PotF family extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242231.1 protein_id gnl|my_center|LOCUS_56340 6910 7821 gene locus_tag LOCUS_56350 6910 7821 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972745.1 protein_id gnl|my_center|LOCUS_56350 7826 8644 gene locus_tag LOCUS_56360 7826 8644 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972744.1 protein_id gnl|my_center|LOCUS_56360 8656 9402 gene locus_tag LOCUS_56370 8656 9402 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972743.1 protein_id gnl|my_center|LOCUS_56370 >Feature sequence189 <1 831 gene locus_tag LOCUS_56380 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966765.1:HlyD family type I secretion periplasmic adaptor subunit 1331 3637 gene locus_tag LOCUS_56390 1331 3637 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532683.1 protein_id gnl|my_center|LOCUS_56390 5798 4422 gene locus_tag LOCUS_56400 5798 4422 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086907.1 protein_id gnl|my_center|LOCUS_56400 6027 7187 gene locus_tag LOCUS_56410 6027 7187 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197192.1 protein_id gnl|my_center|LOCUS_56410 7344 9056 gene locus_tag LOCUS_56420 7344 9056 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531566.1 protein_id gnl|my_center|LOCUS_56420 <9801 9084 gene locus_tag LOCUS_56430 <9801 9084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532753.1:chromosome segregation protein SMC >Feature sequence190 806 1711 gene locus_tag LOCUS_56440 806 1711 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445527.1 protein_id gnl|my_center|LOCUS_56440 2717 1908 gene locus_tag LOCUS_56450 2717 1908 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972999.1 protein_id gnl|my_center|LOCUS_56450 2856 3965 gene locus_tag LOCUS_56460 2856 3965 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527856.1 protein_id gnl|my_center|LOCUS_56460 3955 5034 gene locus_tag LOCUS_56470 3955 5034 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061357.1 protein_id gnl|my_center|LOCUS_56470 5028 5867 gene locus_tag LOCUS_56480 5028 5867 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396373.1 protein_id gnl|my_center|LOCUS_56480 7589 5934 gene locus_tag LOCUS_56490 7589 5934 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146502312.1 protein_id gnl|my_center|LOCUS_56490 8138 7779 gene locus_tag LOCUS_56500 8138 7779 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062370183.1 protein_id gnl|my_center|LOCUS_56500 8372 9094 gene locus_tag LOCUS_56510 8372 9094 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_56510 >Feature sequence191 <1 1107 gene locus_tag LOCUS_56520 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530885.1:ABC transporter ATP-binding protein 1698 1141 gene locus_tag LOCUS_56530 1698 1141 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530886.1 protein_id gnl|my_center|LOCUS_56530 1945 3492 gene locus_tag LOCUS_56540 1945 3492 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501515.1 protein_id gnl|my_center|LOCUS_56540 3730 6156 gene locus_tag LOCUS_56550 3730 6156 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 protein_id gnl|my_center|LOCUS_56550 6574 6182 gene locus_tag LOCUS_56560 6574 6182 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530889.1 protein_id gnl|my_center|LOCUS_56560 6886 7278 gene locus_tag LOCUS_56570 6886 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56570 6917 6926 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8067 7288 gene locus_tag LOCUS_56580 8067 7288 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530891.1 protein_id gnl|my_center|LOCUS_56580 8242 8976 gene locus_tag LOCUS_56590 8242 8976 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530892.1 protein_id gnl|my_center|LOCUS_56590 >Feature sequence192 88 1599 gene locus_tag LOCUS_56600 88 1599 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528956.1 protein_id gnl|my_center|LOCUS_56600 1603 1842 gene locus_tag LOCUS_56610 1603 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56610 1842 2891 gene locus_tag LOCUS_56620 1842 2891 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528957.1 protein_id gnl|my_center|LOCUS_56620 2888 3832 gene locus_tag LOCUS_56630 2888 3832 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_56630 4668 3901 gene locus_tag LOCUS_56640 4668 3901 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528959.1 protein_id gnl|my_center|LOCUS_56640 4950 5099 gene locus_tag LOCUS_56650 4950 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528960.1 protein_id gnl|my_center|LOCUS_56650 5231 6172 gene locus_tag LOCUS_56660 5231 6172 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528961.1 protein_id gnl|my_center|LOCUS_56660 6855 6181 gene locus_tag LOCUS_56670 6855 6181 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528962.1 protein_id gnl|my_center|LOCUS_56670 7083 7901 gene locus_tag LOCUS_56680 7083 7901 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173821.1 protein_id gnl|my_center|LOCUS_56680 7919 8863 gene locus_tag LOCUS_56690 gene exbB 7919 8863 CDS product tonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528968.1 protein_id gnl|my_center|LOCUS_56690 8870 9370 gene locus_tag LOCUS_56700 gene exbD 8870 9370 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528969.1 protein_id gnl|my_center|LOCUS_56700 >Feature sequence193 227 236 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 423 1220 gene locus_tag LOCUS_56710 423 1220 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528807.1 protein_id gnl|my_center|LOCUS_56710 1790 1323 gene locus_tag LOCUS_56720 1790 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56720 2599 2021 gene locus_tag LOCUS_56730 2599 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 4012 2789 gene locus_tag LOCUS_56740 4012 2789 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528809.1 protein_id gnl|my_center|LOCUS_56740 4666 4190 gene locus_tag LOCUS_56750 4666 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528811.1 protein_id gnl|my_center|LOCUS_56750 5898 4663 gene locus_tag LOCUS_56760 gene rlmN 5898 4663 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528813.1 protein_id gnl|my_center|LOCUS_56760 6190 5882 gene locus_tag LOCUS_56770 6190 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56770 6165 6536 gene locus_tag LOCUS_56780 6165 6536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56780 6637 7152 gene locus_tag LOCUS_56790 6637 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56790 7402 7154 gene locus_tag LOCUS_56800 7402 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56800 7919 7416 gene locus_tag LOCUS_56810 7919 7416 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528815.1 protein_id gnl|my_center|LOCUS_56810 8531 8169 gene locus_tag LOCUS_56820 8531 8169 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528816.1 protein_id gnl|my_center|LOCUS_56820 8913 8617 gene locus_tag LOCUS_56830 8913 8617 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528817.1 protein_id gnl|my_center|LOCUS_56830 8998 9540 gene locus_tag LOCUS_56840 8998 9540 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528818.1 protein_id gnl|my_center|LOCUS_56840 >Feature sequence194 2018 198 gene locus_tag LOCUS_56850 2018 198 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531659.1 protein_id gnl|my_center|LOCUS_56850 2298 2924 gene locus_tag LOCUS_56860 2298 2924 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531658.1 protein_id gnl|my_center|LOCUS_56860 3317 2994 gene locus_tag LOCUS_56870 gene hspQ 3317 2994 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027161605.1 protein_id gnl|my_center|LOCUS_56870 4826 3540 gene locus_tag LOCUS_56880 4826 3540 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531655.1 protein_id gnl|my_center|LOCUS_56880 4854 5750 gene locus_tag LOCUS_56890 4854 5750 CDS product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531654.1 protein_id gnl|my_center|LOCUS_56890 5766 6380 gene locus_tag LOCUS_56900 5766 6380 CDS product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531653.1 protein_id gnl|my_center|LOCUS_56900 6377 7207 gene locus_tag LOCUS_56910 6377 7207 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503276.1 protein_id gnl|my_center|LOCUS_56910 7260 8237 gene locus_tag LOCUS_56920 7260 8237 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531651.1 protein_id gnl|my_center|LOCUS_56920 >Feature sequence195 117 596 gene locus_tag LOCUS_56930 117 596 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528017.1 protein_id gnl|my_center|LOCUS_56930 681 1043 gene locus_tag LOCUS_56940 681 1043 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528018.1 protein_id gnl|my_center|LOCUS_56940 1176 1490 gene locus_tag LOCUS_56950 1176 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528019.1 protein_id gnl|my_center|LOCUS_56950 2260 1559 gene locus_tag LOCUS_56960 2260 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56960 3881 2454 gene locus_tag LOCUS_56970 3881 2454 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528020.1 protein_id gnl|my_center|LOCUS_56970 4803 3988 gene locus_tag LOCUS_56980 4803 3988 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528021.1 protein_id gnl|my_center|LOCUS_56980 5761 4793 gene locus_tag LOCUS_56990 5761 4793 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210183137.1 protein_id gnl|my_center|LOCUS_56990 6756 5758 gene locus_tag LOCUS_57000 6756 5758 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528023.1 protein_id gnl|my_center|LOCUS_57000 8115 6961 gene locus_tag LOCUS_57010 8115 6961 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528024.1 protein_id gnl|my_center|LOCUS_57010 9249 8338 gene locus_tag LOCUS_57020 9249 8338 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528025.1 protein_id gnl|my_center|LOCUS_57020 >Feature sequence196 1133 63 gene locus_tag LOCUS_57030 1133 63 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532862.1 protein_id gnl|my_center|LOCUS_57030 1997 1164 gene locus_tag LOCUS_57040 1997 1164 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532863.1 protein_id gnl|my_center|LOCUS_57040 2815 1994 gene locus_tag LOCUS_57050 2815 1994 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532864.1 protein_id gnl|my_center|LOCUS_57050 4260 2980 gene locus_tag LOCUS_57060 4260 2980 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532865.1 protein_id gnl|my_center|LOCUS_57060 4457 5614 gene locus_tag LOCUS_57070 4457 5614 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532866.1 protein_id gnl|my_center|LOCUS_57070 5665 6141 gene locus_tag LOCUS_57080 5665 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57080 6315 7247 gene locus_tag LOCUS_57090 6315 7247 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532868.1 protein_id gnl|my_center|LOCUS_57090 7453 8439 gene locus_tag LOCUS_57100 7453 8439 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532869.1 protein_id gnl|my_center|LOCUS_57100 8443 9237 gene locus_tag LOCUS_57110 8443 9237 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532870.1 protein_id gnl|my_center|LOCUS_57110 >Feature sequence197 1011 46 gene locus_tag LOCUS_57120 1011 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 2507 1008 gene locus_tag LOCUS_57130 2507 1008 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530864.1 protein_id gnl|my_center|LOCUS_57130 3587 2535 gene locus_tag LOCUS_57140 3587 2535 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969741.1 protein_id gnl|my_center|LOCUS_57140 3823 4620 gene locus_tag LOCUS_57150 3823 4620 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018012046.1 protein_id gnl|my_center|LOCUS_57150 5306 8053 gene locus_tag LOCUS_57160 5306 8053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57160 6230 6326 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence198 735 1322 gene locus_tag LOCUS_57170 735 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57170 2107 1460 gene locus_tag LOCUS_57180 2107 1460 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528674.1 protein_id gnl|my_center|LOCUS_57180 3477 2104 gene locus_tag LOCUS_57190 3477 2104 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528673.1 protein_id gnl|my_center|LOCUS_57190 4299 3589 gene locus_tag LOCUS_57200 4299 3589 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969688.1 protein_id gnl|my_center|LOCUS_57200 5052 7856 gene locus_tag LOCUS_57210 5052 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57210 >Feature sequence199 1087 449 gene locus_tag LOCUS_57220 1087 449 CDS product dimethylsulfonioproprionate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531208.1 protein_id gnl|my_center|LOCUS_57220 1202 2368 gene locus_tag LOCUS_57230 1202 2368 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531207.1 protein_id gnl|my_center|LOCUS_57230 2394 3278 gene locus_tag LOCUS_57240 gene mmsB 2394 3278 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531206.1 protein_id gnl|my_center|LOCUS_57240 6090 3652 gene locus_tag LOCUS_57250 6090 3652 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531205.1 protein_id gnl|my_center|LOCUS_57250 7660 6281 gene locus_tag LOCUS_57260 7660 6281 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531202.1 protein_id gnl|my_center|LOCUS_57260 <9189 7902 gene locus_tag LOCUS_57270 <9189 7902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531200.1:prolyl oligopeptidase family protein >Feature sequence200 286 1080 gene locus_tag LOCUS_57280 gene modA 286 1080 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531023.1 protein_id gnl|my_center|LOCUS_57280 1097 1801 gene locus_tag LOCUS_57290 gene modB 1097 1801 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531024.1 protein_id gnl|my_center|LOCUS_57290 1798 2910 gene locus_tag LOCUS_57300 gene modC 1798 2910 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531025.1 protein_id gnl|my_center|LOCUS_57300 2990 3331 gene locus_tag LOCUS_57310 2990 3331 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531026.1 protein_id gnl|my_center|LOCUS_57310 4129 3356 gene locus_tag LOCUS_57320 gene cobF 4129 3356 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531027.1 protein_id gnl|my_center|LOCUS_57320 4385 5413 gene locus_tag LOCUS_57330 4385 5413 CDS product DUF4424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531028.1 protein_id gnl|my_center|LOCUS_57330 5413 5931 gene locus_tag LOCUS_57340 5413 5931 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531029.1 protein_id gnl|my_center|LOCUS_57340 6101 7216 gene locus_tag LOCUS_57350 gene hflK 6101 7216 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531030.1 protein_id gnl|my_center|LOCUS_57350 7216 8157 gene locus_tag LOCUS_57360 7216 8157 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531031.1 protein_id gnl|my_center|LOCUS_57360 8164 8349 gene locus_tag LOCUS_57370 8164 8349 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531032.1 protein_id gnl|my_center|LOCUS_57370 >Feature sequence201 6 410 gene locus_tag LOCUS_57380 6 410 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531079.1 protein_id gnl|my_center|LOCUS_57380 407 1171 gene locus_tag LOCUS_57390 gene cobM 407 1171 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531078.1 protein_id gnl|my_center|LOCUS_57390 1168 1983 gene locus_tag LOCUS_57400 gene cobA 1168 1983 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531077.1 protein_id gnl|my_center|LOCUS_57400 1980 3314 gene locus_tag LOCUS_57410 1980 3314 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531076.1 protein_id gnl|my_center|LOCUS_57410 2475 2484 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3318 4094 gene locus_tag LOCUS_57420 gene cobS 3318 4094 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531075.1 protein_id gnl|my_center|LOCUS_57420 4119 5129 gene locus_tag LOCUS_57430 gene cobT 4119 5129 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531074.1 protein_id gnl|my_center|LOCUS_57430 5154 5894 gene locus_tag LOCUS_57440 5154 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57440 6041 5966 gene locus_tag LOCUS_t00410 6041 5966 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7143 6238 gene locus_tag LOCUS_57450 7143 6238 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531073.1 protein_id gnl|my_center|LOCUS_57450 7245 8531 gene locus_tag LOCUS_57460 7245 8531 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531072.1 protein_id gnl|my_center|LOCUS_57460 >Feature sequence202 607 110 gene locus_tag LOCUS_57470 607 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 209 218 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1017 604 gene locus_tag LOCUS_57480 1017 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57480 1442 1014 gene locus_tag LOCUS_57490 1442 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815731.1 protein_id gnl|my_center|LOCUS_57490 3295 1442 gene locus_tag LOCUS_57500 3295 1442 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815730.1 protein_id gnl|my_center|LOCUS_57500 3333 3342 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4685 3525 gene locus_tag LOCUS_57510 4685 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57510 6294 4939 gene locus_tag LOCUS_57520 6294 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57520 8263 6542 gene locus_tag LOCUS_57530 gene glmS 8263 6542 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531911.1 protein_id gnl|my_center|LOCUS_57530 8233 8242 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8561 8893 gene locus_tag LOCUS_57540 8561 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975153.1 protein_id gnl|my_center|LOCUS_57540 >Feature sequence203 1642 2103 gene locus_tag LOCUS_57550 1642 2103 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531233.1 protein_id gnl|my_center|LOCUS_57550 3313 2105 gene locus_tag LOCUS_57560 3313 2105 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531232.1 protein_id gnl|my_center|LOCUS_57560 3764 3321 gene locus_tag LOCUS_57570 3764 3321 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503807.1 protein_id gnl|my_center|LOCUS_57570 3973 4893 gene locus_tag LOCUS_57580 3973 4893 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531230.1 protein_id gnl|my_center|LOCUS_57580 6090 5062 gene locus_tag LOCUS_57590 6090 5062 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531229.1 protein_id gnl|my_center|LOCUS_57590 7644 6187 gene locus_tag LOCUS_57600 7644 6187 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531228.1 protein_id gnl|my_center|LOCUS_57600 8770 7820 gene locus_tag LOCUS_57610 8770 7820 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531227.1 protein_id gnl|my_center|LOCUS_57610 >Feature sequence204 <1 691 gene locus_tag LOCUS_57620 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529462.1:peptide chain release factor N(5)-glutamine methyltransferase 1021 1968 gene locus_tag LOCUS_57630 1021 1968 CDS product DUF4167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529463.1 protein_id gnl|my_center|LOCUS_57630 2191 4797 gene locus_tag LOCUS_57640 gene clpB 2191 4797 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529464.1 protein_id gnl|my_center|LOCUS_57640 4868 5224 gene locus_tag LOCUS_57650 4868 5224 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529465.1 protein_id gnl|my_center|LOCUS_57650 5358 6845 gene locus_tag LOCUS_57660 5358 6845 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529466.1 protein_id gnl|my_center|LOCUS_57660 7344 7078 gene locus_tag LOCUS_57670 7344 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_57670 >Feature sequence205 289 1308 gene locus_tag LOCUS_57680 289 1308 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528618.1 protein_id gnl|my_center|LOCUS_57680 1434 3290 gene locus_tag LOCUS_57690 1434 3290 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528617.1 protein_id gnl|my_center|LOCUS_57690 3444 4112 gene locus_tag LOCUS_57700 gene dapB 3444 4112 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528616.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57700 3449 3458 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4152 4772 gene locus_tag LOCUS_57710 4152 4772 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528615.1 protein_id gnl|my_center|LOCUS_57710 5019 5103 gene locus_tag LOCUS_t00420 5019 5103 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5215 5634 gene locus_tag LOCUS_57720 5215 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57720 6364 5834 gene locus_tag LOCUS_57730 6364 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57730 6617 6626 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6630 7454 gene locus_tag LOCUS_57740 6630 7454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57740 7454 7759 gene locus_tag LOCUS_57750 7454 7759 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528614.1 protein_id gnl|my_center|LOCUS_57750 8208 8035 gene locus_tag LOCUS_57760 8208 8035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528612.1 protein_id gnl|my_center|LOCUS_57760 >Feature sequence206 <1 742 gene locus_tag LOCUS_57770 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528336.1:sensor histidine kinase 757 1218 gene locus_tag LOCUS_57780 757 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528335.1 protein_id gnl|my_center|LOCUS_57780 1383 1784 gene locus_tag LOCUS_57790 1383 1784 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010912939.1 protein_id gnl|my_center|LOCUS_57790 1781 2077 gene locus_tag LOCUS_57800 1781 2077 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528333.1 protein_id gnl|my_center|LOCUS_57800 2369 3769 gene locus_tag LOCUS_57810 gene ahcY 2369 3769 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528332.1 protein_id gnl|my_center|LOCUS_57810 3959 6520 gene locus_tag LOCUS_57820 3959 6520 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528331.1 protein_id gnl|my_center|LOCUS_57820 6529 8034 gene locus_tag LOCUS_57830 6529 8034 CDS product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528330.1 protein_id gnl|my_center|LOCUS_57830 >Feature sequence207 922 47 gene locus_tag LOCUS_57840 922 47 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528546.1 protein_id gnl|my_center|LOCUS_57840 2144 1164 gene locus_tag LOCUS_57850 gene hpaD 2144 1164 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528545.1 protein_id gnl|my_center|LOCUS_57850 3676 2159 gene locus_tag LOCUS_57860 gene hpaE 3676 2159 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392284.1 protein_id gnl|my_center|LOCUS_57860 4081 3704 gene locus_tag LOCUS_57870 4081 3704 CDS product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528543.1 protein_id gnl|my_center|LOCUS_57870 4334 4711 gene locus_tag LOCUS_57880 gene hpaR 4334 4711 CDS product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528542.1 protein_id gnl|my_center|LOCUS_57880 5393 4884 gene locus_tag LOCUS_57890 5393 4884 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528541.1 protein_id gnl|my_center|LOCUS_57890 6949 5405 gene locus_tag LOCUS_57900 6949 5405 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392289.1 protein_id gnl|my_center|LOCUS_57900 7002 7913 gene locus_tag LOCUS_57910 7002 7913 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528539.1 protein_id gnl|my_center|LOCUS_57910 8242 8000 gene locus_tag LOCUS_57920 8242 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57920 8311 8320 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence208 605 1543 gene locus_tag LOCUS_57930 605 1543 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173806.1 protein_id gnl|my_center|LOCUS_57930 2000 1617 gene locus_tag LOCUS_57940 2000 1617 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503765.1 protein_id gnl|my_center|LOCUS_57940 2625 2083 gene locus_tag LOCUS_57950 gene hpt 2625 2083 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529401.1 protein_id gnl|my_center|LOCUS_57950 3371 2730 gene locus_tag LOCUS_57960 3371 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529400.1 protein_id gnl|my_center|LOCUS_57960 3567 4226 gene locus_tag LOCUS_57970 gene ftsE 3567 4226 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010911739.1 protein_id gnl|my_center|LOCUS_57970 4219 5208 gene locus_tag LOCUS_57980 4219 5208 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529399.1 protein_id gnl|my_center|LOCUS_57980 5346 6098 gene locus_tag LOCUS_57990 5346 6098 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529398.1 protein_id gnl|my_center|LOCUS_57990 6711 6088 gene locus_tag LOCUS_58000 6711 6088 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529397.1 protein_id gnl|my_center|LOCUS_58000 6817 7722 gene locus_tag LOCUS_58010 6817 7722 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529395.1 protein_id gnl|my_center|LOCUS_58010 >Feature sequence209 264 3203 gene locus_tag LOCUS_58020 264 3203 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142489.1 protein_id gnl|my_center|LOCUS_58020 3125 3376 gene locus_tag LOCUS_58030 3125 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58030 3474 4940 gene locus_tag LOCUS_58040 3474 4940 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 protein_id gnl|my_center|LOCUS_58040 5037 5723 gene locus_tag LOCUS_58050 5037 5723 CDS product aspartyl/asparaginyl beta-hydroxylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194984.1 protein_id gnl|my_center|LOCUS_58050 5774 6133 gene locus_tag LOCUS_58060 5774 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328250.1 protein_id gnl|my_center|LOCUS_58060 6457 6161 gene locus_tag LOCUS_58070 6457 6161 CDS product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532001.1 protein_id gnl|my_center|LOCUS_58070 7066 6779 gene locus_tag LOCUS_58080 7066 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58080 6991 7000 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7365 8192 gene locus_tag LOCUS_58090 gene map 7365 8192 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532002.1 protein_id gnl|my_center|LOCUS_58090 >Feature sequence210 1706 1362 gene locus_tag LOCUS_58100 1706 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58100 3439 1703 gene locus_tag LOCUS_58110 3439 1703 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965811.1 protein_id gnl|my_center|LOCUS_58110 2742 2751 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3690 4358 gene locus_tag LOCUS_58120 3690 4358 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174804.1 protein_id gnl|my_center|LOCUS_58120 5524 4367 gene locus_tag LOCUS_58130 5524 4367 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395362.1 protein_id gnl|my_center|LOCUS_58130 6858 5662 gene locus_tag LOCUS_58140 6858 5662 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969965.1 protein_id gnl|my_center|LOCUS_58140 8207 7011 gene locus_tag LOCUS_58150 8207 7011 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_58150 7189 7198 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence211 168 2390 gene locus_tag LOCUS_58160 168 2390 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532541.1 protein_id gnl|my_center|LOCUS_58160 3213 2395 gene locus_tag LOCUS_58170 3213 2395 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532542.1 protein_id gnl|my_center|LOCUS_58170 3915 3217 gene locus_tag LOCUS_58180 3915 3217 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532543.1 protein_id gnl|my_center|LOCUS_58180 4103 4996 gene locus_tag LOCUS_58190 4103 4996 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_58190 5316 4975 gene locus_tag LOCUS_58200 5316 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532546.1 protein_id gnl|my_center|LOCUS_58200 7426 5546 gene locus_tag LOCUS_58210 7426 5546 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532547.1 protein_id gnl|my_center|LOCUS_58210 7789 7445 gene locus_tag LOCUS_58220 7789 7445 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532548.1 protein_id gnl|my_center|LOCUS_58220 >Feature sequence212 <1 810 gene locus_tag LOCUS_58230 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525289.1:type VI secretion system-associated FHA domain protein TagH 1098 2603 gene locus_tag LOCUS_58240 gene tssL 1098 2603 CDS product type VI secretion system protein TssL, long form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525288.1 protein_id gnl|my_center|LOCUS_58240 2626 6156 gene locus_tag LOCUS_58250 gene tssM 2626 6156 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525287.1 protein_id gnl|my_center|LOCUS_58250 6316 7098 gene locus_tag LOCUS_58260 6316 7098 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525286.1 protein_id gnl|my_center|LOCUS_58260 >Feature sequence213 <1 708 gene locus_tag LOCUS_58270 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063173723.1:M15 family metallopeptidase 938 1966 gene locus_tag LOCUS_58280 938 1966 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530876.1 protein_id gnl|my_center|LOCUS_58280 2042 2893 gene locus_tag LOCUS_58290 gene cysT 2042 2893 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530875.1 protein_id gnl|my_center|LOCUS_58290 2886 3770 gene locus_tag LOCUS_58300 gene cysW 2886 3770 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530874.1 protein_id gnl|my_center|LOCUS_58300 3838 4896 gene locus_tag LOCUS_58310 3838 4896 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530873.1 protein_id gnl|my_center|LOCUS_58310 5046 6032 gene locus_tag LOCUS_58320 5046 6032 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530872.1 protein_id gnl|my_center|LOCUS_58320 6295 6744 gene locus_tag LOCUS_58330 6295 6744 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530871.1 protein_id gnl|my_center|LOCUS_58330 6881 8029 gene locus_tag LOCUS_58340 6881 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530868.1 protein_id gnl|my_center|LOCUS_58340 >Feature sequence214 1296 55 gene locus_tag LOCUS_58350 1296 55 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530526.1 protein_id gnl|my_center|LOCUS_58350 2395 1355 gene locus_tag LOCUS_58360 2395 1355 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530527.1 protein_id gnl|my_center|LOCUS_58360 2651 3829 gene locus_tag LOCUS_58370 2651 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58370 3826 4647 gene locus_tag LOCUS_58380 3826 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58380 5135 4701 gene locus_tag LOCUS_58390 5135 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58390 5793 5314 gene locus_tag LOCUS_58400 5793 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58400 7742 6546 gene locus_tag LOCUS_58410 7742 6546 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533246.1 protein_id gnl|my_center|LOCUS_58410 >Feature sequence215 1784 573 gene locus_tag LOCUS_58420 1784 573 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532148.1 protein_id gnl|my_center|LOCUS_58420 1991 2905 gene locus_tag LOCUS_58430 1991 2905 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532146.1 protein_id gnl|my_center|LOCUS_58430 2898 3683 gene locus_tag LOCUS_58440 gene murI 2898 3683 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532145.1 protein_id gnl|my_center|LOCUS_58440 3744 3932 gene locus_tag LOCUS_58450 3744 3932 CDS product DUF3008 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532144.1 protein_id gnl|my_center|LOCUS_58450 4272 4889 gene locus_tag LOCUS_58460 gene rpsD 4272 4889 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532142.1 protein_id gnl|my_center|LOCUS_58460 5050 5907 gene locus_tag LOCUS_58470 gene ttcA 5050 5907 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532141.1 protein_id gnl|my_center|LOCUS_58470 5918 6745 gene locus_tag LOCUS_58480 5918 6745 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532140.1 protein_id gnl|my_center|LOCUS_58480 <7960 6761 gene locus_tag LOCUS_58490 <7960 6761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532138.1:multidrug effflux MFS transporter >Feature sequence216 1639 1331 gene locus_tag LOCUS_58500 1639 1331 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529201.1 protein_id gnl|my_center|LOCUS_58500 2459 1662 gene locus_tag LOCUS_58510 2459 1662 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529202.1 protein_id gnl|my_center|LOCUS_58510 2831 2601 gene locus_tag LOCUS_58520 2831 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 2728 3198 gene locus_tag LOCUS_58530 2728 3198 CDS product DUF1036 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529203.1 protein_id gnl|my_center|LOCUS_58530 3195 4637 gene locus_tag LOCUS_58540 gene pyk 3195 4637 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529204.1 protein_id gnl|my_center|LOCUS_58540 5704 4643 gene locus_tag LOCUS_58550 5704 4643 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529205.1 protein_id gnl|my_center|LOCUS_58550 6458 5847 gene locus_tag LOCUS_58560 6458 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529206.1 protein_id gnl|my_center|LOCUS_58560 6748 6623 gene locus_tag LOCUS_58570 gene ykgO 6748 6623 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203764.1 protein_id gnl|my_center|LOCUS_58570 6993 7415 gene locus_tag LOCUS_58580 6993 7415 CDS product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529207.1 protein_id gnl|my_center|LOCUS_58580 >Feature sequence217 1447 500 gene locus_tag LOCUS_58590 1447 500 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528929.1 protein_id gnl|my_center|LOCUS_58590 2332 1451 gene locus_tag LOCUS_58600 2332 1451 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168991878.1 protein_id gnl|my_center|LOCUS_58600 2298 2456 gene locus_tag LOCUS_58610 2298 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58610 3950 2436 gene locus_tag LOCUS_58620 3950 2436 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528927.1 protein_id gnl|my_center|LOCUS_58620 5010 3997 gene locus_tag LOCUS_58630 5010 3997 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528926.1 protein_id gnl|my_center|LOCUS_58630 5993 5106 gene locus_tag LOCUS_58640 5993 5106 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173824.1 protein_id gnl|my_center|LOCUS_58640 6187 5993 gene locus_tag LOCUS_58650 6187 5993 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528835.1 protein_id gnl|my_center|LOCUS_58650 7057 6317 gene locus_tag LOCUS_58660 7057 6317 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528923.1 protein_id gnl|my_center|LOCUS_58660 <7924 7057 gene locus_tag LOCUS_58670 <7924 7057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528922.1:histidine kinase >Feature sequence218 1129 815 gene locus_tag LOCUS_58680 1129 815 CDS product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528015.1 protein_id gnl|my_center|LOCUS_58680 1850 1119 gene locus_tag LOCUS_58690 gene fdhD 1850 1119 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528014.1 protein_id gnl|my_center|LOCUS_58690 2164 1946 gene locus_tag LOCUS_58700 2164 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58700 5164 2252 gene locus_tag LOCUS_58710 gene fdhF 5164 2252 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528013.1 protein_id gnl|my_center|LOCUS_58710 6731 5175 gene locus_tag LOCUS_58720 6731 5175 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528012.1 protein_id gnl|my_center|LOCUS_58720 7207 6728 gene locus_tag LOCUS_58730 7207 6728 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528011.1 protein_id gnl|my_center|LOCUS_58730 7913 7401 gene locus_tag LOCUS_58740 7913 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58740 >Feature sequence219 1003 83 gene locus_tag LOCUS_58750 1003 83 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532538.1 protein_id gnl|my_center|LOCUS_58750 1235 978 gene locus_tag LOCUS_58760 1235 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58760 1588 2013 gene locus_tag LOCUS_58770 1588 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58770 3603 2098 gene locus_tag LOCUS_58780 3603 2098 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532536.1 protein_id gnl|my_center|LOCUS_58780 3860 4366 gene locus_tag LOCUS_58790 3860 4366 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532532.1 protein_id gnl|my_center|LOCUS_58790 4590 4369 gene locus_tag LOCUS_58800 4590 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532531.1 protein_id gnl|my_center|LOCUS_58800 5280 4726 gene locus_tag LOCUS_58810 5280 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532530.1 protein_id gnl|my_center|LOCUS_58810 5206 5433 gene locus_tag LOCUS_58820 5206 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58820 6246 5491 gene locus_tag LOCUS_58830 6246 5491 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532529.1 protein_id gnl|my_center|LOCUS_58830 6720 6274 gene locus_tag LOCUS_58840 6720 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58840 6801 6810 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7304 7738 gene locus_tag LOCUS_58850 7304 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58850 >Feature sequence220 499 2 gene locus_tag LOCUS_58860 499 2 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529393.1 protein_id gnl|my_center|LOCUS_58860 1553 606 gene locus_tag LOCUS_58870 1553 606 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529392.1 protein_id gnl|my_center|LOCUS_58870 2211 1675 gene locus_tag LOCUS_58880 2211 1675 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529391.1 protein_id gnl|my_center|LOCUS_58880 2327 3325 gene locus_tag LOCUS_58890 2327 3325 CDS product DUF2125 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529390.1 protein_id gnl|my_center|LOCUS_58890 3414 4325 gene locus_tag LOCUS_58900 3414 4325 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529389.1 protein_id gnl|my_center|LOCUS_58900 5291 4353 gene locus_tag LOCUS_58910 5291 4353 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162911.1 protein_id gnl|my_center|LOCUS_58910 6406 5297 gene locus_tag LOCUS_58920 gene hisC 6406 5297 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529387.1 protein_id gnl|my_center|LOCUS_58920 >Feature sequence221 927 34 gene locus_tag LOCUS_58930 927 34 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532338.1 protein_id gnl|my_center|LOCUS_58930 1057 1944 gene locus_tag LOCUS_58940 1057 1944 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532339.1 protein_id gnl|my_center|LOCUS_58940 2667 2900 gene locus_tag LOCUS_58950 2667 2900 CDS product DUF2093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532341.1 protein_id gnl|my_center|LOCUS_58950 3932 2907 gene locus_tag LOCUS_58960 gene lpxK 3932 2907 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532342.1 protein_id gnl|my_center|LOCUS_58960 5250 3934 gene locus_tag LOCUS_58970 gene waaA 5250 3934 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532343.1 protein_id gnl|my_center|LOCUS_58970 6029 5247 gene locus_tag LOCUS_58980 6029 5247 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532344.1 protein_id gnl|my_center|LOCUS_58980 6280 6035 gene locus_tag LOCUS_58990 6280 6035 CDS product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532345.1 protein_id gnl|my_center|LOCUS_58990 7161 6355 gene locus_tag LOCUS_59000 7161 6355 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532346.1 protein_id gnl|my_center|LOCUS_59000 7783 7148 gene locus_tag LOCUS_59010 7783 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59010 >Feature sequence222 846 1883 gene locus_tag LOCUS_59020 846 1883 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967956.1 protein_id gnl|my_center|LOCUS_59020 2976 1936 gene locus_tag LOCUS_59030 2976 1936 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088245.1 protein_id gnl|my_center|LOCUS_59030 3042 3788 gene locus_tag LOCUS_59040 3042 3788 CDS product dimethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871852.1 protein_id gnl|my_center|LOCUS_59040 3781 4791 gene locus_tag LOCUS_59050 3781 4791 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035278.1 protein_id gnl|my_center|LOCUS_59050 4924 4933 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5031 5600 gene locus_tag LOCUS_59060 5031 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59060 5634 6950 gene locus_tag LOCUS_59070 5634 6950 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212064.1 protein_id gnl|my_center|LOCUS_59070 7032 7418 gene locus_tag LOCUS_59080 7032 7418 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084059.1 protein_id gnl|my_center|LOCUS_59080 >Feature sequence223 646 1791 gene locus_tag LOCUS_59090 646 1791 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529734.1 protein_id gnl|my_center|LOCUS_59090 1740 2402 gene locus_tag LOCUS_59100 1740 2402 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529733.1 protein_id gnl|my_center|LOCUS_59100 2419 2709 gene locus_tag LOCUS_59110 2419 2709 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211043.1 protein_id gnl|my_center|LOCUS_59110 2706 3632 gene locus_tag LOCUS_59120 2706 3632 CDS product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173040.1 protein_id gnl|my_center|LOCUS_59120 3764 5209 gene locus_tag LOCUS_59130 3764 5209 CDS product homospermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529731.1 protein_id gnl|my_center|LOCUS_59130 5491 5865 gene locus_tag LOCUS_59140 5491 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529730.1 protein_id gnl|my_center|LOCUS_59140 >Feature sequence224 <1 1242 gene locus_tag LOCUS_59150 <1 1242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974882.1:lactate dehydrogenase 2134 3123 gene locus_tag LOCUS_59160 2134 3123 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971076.1 protein_id gnl|my_center|LOCUS_59160 3606 3196 gene locus_tag LOCUS_59170 gene arsC 3606 3196 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085868.1 protein_id gnl|my_center|LOCUS_59170 4247 3603 gene locus_tag LOCUS_59180 4247 3603 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398893.1 protein_id gnl|my_center|LOCUS_59180 4320 4329 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4712 4362 gene locus_tag LOCUS_59190 4712 4362 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398909.1 protein_id gnl|my_center|LOCUS_59190 5134 6822 gene locus_tag LOCUS_59200 5134 6822 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974797.1 protein_id gnl|my_center|LOCUS_59200 6913 7383 gene locus_tag LOCUS_59210 6913 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974883.1 protein_id gnl|my_center|LOCUS_59210 >Feature sequence225 942 565 gene locus_tag LOCUS_59220 942 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59220 835 1080 gene locus_tag LOCUS_59230 835 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59230 1264 1494 gene locus_tag LOCUS_59240 1264 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59240 2340 2564 gene locus_tag LOCUS_59250 2340 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_59250 3076 2828 gene locus_tag LOCUS_59260 3076 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59260 3288 3073 gene locus_tag LOCUS_59270 3288 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59270 3938 4669 gene locus_tag LOCUS_59280 3938 4669 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330118.1 protein_id gnl|my_center|LOCUS_59280 6142 7536 gene locus_tag LOCUS_59290 6142 7536 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269247.1 protein_id gnl|my_center|LOCUS_59290 >Feature sequence226 412 1056 gene locus_tag LOCUS_59300 412 1056 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528988.1 protein_id gnl|my_center|LOCUS_59300 1065 1478 gene locus_tag LOCUS_59310 1065 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528987.1 protein_id gnl|my_center|LOCUS_59310 1562 3610 gene locus_tag LOCUS_59320 1562 3610 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528986.1 protein_id gnl|my_center|LOCUS_59320 3662 3671 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5189 3717 gene locus_tag LOCUS_59330 5189 3717 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528985.1 protein_id gnl|my_center|LOCUS_59330 5434 6204 gene locus_tag LOCUS_59340 5434 6204 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528981.1 protein_id gnl|my_center|LOCUS_59340 6207 6464 gene locus_tag LOCUS_59350 6207 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59350 6476 7357 gene locus_tag LOCUS_59360 6476 7357 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528979.1 protein_id gnl|my_center|LOCUS_59360 >Feature sequence227 54 1052 gene locus_tag LOCUS_59370 54 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59370 933 942 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 955 1863 gene locus_tag LOCUS_59380 955 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59380 1926 2171 gene locus_tag LOCUS_59390 1926 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59390 3050 4138 gene locus_tag LOCUS_59400 3050 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59400 4230 4736 gene locus_tag LOCUS_59410 4230 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59410 4748 5257 gene locus_tag LOCUS_59420 4748 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 5640 5930 gene locus_tag LOCUS_59430 5640 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528608.1 protein_id gnl|my_center|LOCUS_59430 6229 6600 gene locus_tag LOCUS_59440 6229 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528607.1 protein_id gnl|my_center|LOCUS_59440 6839 7267 gene locus_tag LOCUS_59450 6839 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59450 7204 7213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence228 972 781 gene locus_tag LOCUS_59460 972 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59460 1390 1136 gene locus_tag LOCUS_59470 1390 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59470 3573 2041 gene locus_tag LOCUS_59480 3573 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59480 4675 4418 gene locus_tag LOCUS_59490 4675 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59490 5744 5091 gene locus_tag LOCUS_59500 5744 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59500 6305 6553 gene locus_tag LOCUS_59510 6305 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59510 6550 7086 gene locus_tag LOCUS_59520 6550 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_59520 >Feature sequence229 603 908 gene locus_tag LOCUS_59530 603 908 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532440.1 protein_id gnl|my_center|LOCUS_59530 964 1040 gene locus_tag LOCUS_t00430 964 1040 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1824 1126 gene locus_tag LOCUS_59540 1824 1126 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172604.1 protein_id gnl|my_center|LOCUS_59540 2241 1996 gene locus_tag LOCUS_59550 2241 1996 CDS product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530762.1 protein_id gnl|my_center|LOCUS_59550 2668 3039 gene locus_tag LOCUS_59560 2668 3039 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529913.1 protein_id gnl|my_center|LOCUS_59560 3913 3194 gene locus_tag LOCUS_59570 3913 3194 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086436.1 protein_id gnl|my_center|LOCUS_59570 4829 4023 gene locus_tag LOCUS_59580 4829 4023 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532643.1 protein_id gnl|my_center|LOCUS_59580 5667 4834 gene locus_tag LOCUS_59590 5667 4834 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532644.1 protein_id gnl|my_center|LOCUS_59590 6802 5690 gene locus_tag LOCUS_59600 6802 5690 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532645.1 protein_id gnl|my_center|LOCUS_59600 7487 6870 gene locus_tag LOCUS_59610 7487 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59610 >Feature sequence230 1568 570 gene locus_tag LOCUS_59620 1568 570 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530232.1 protein_id gnl|my_center|LOCUS_59620 2484 1585 gene locus_tag LOCUS_59630 gene folD 2484 1585 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530231.1 protein_id gnl|my_center|LOCUS_59630 4251 2695 gene locus_tag LOCUS_59640 4251 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59640 4220 4229 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4679 4921 gene locus_tag LOCUS_59650 4679 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59650 4833 4842 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5244 6539 gene locus_tag LOCUS_59660 5244 6539 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530229.1 protein_id gnl|my_center|LOCUS_59660 <7432 6551 gene locus_tag LOCUS_59670 <7432 6551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530228.1:DUF6492 family protein >Feature sequence231 177 1742 gene locus_tag LOCUS_59680 177 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59680 2463 1813 gene locus_tag LOCUS_59690 gene yihA 2463 1813 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528497.1 protein_id gnl|my_center|LOCUS_59690 3101 2463 gene locus_tag LOCUS_59700 3101 2463 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027161114.1 protein_id gnl|my_center|LOCUS_59700 3191 3200 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5182 3380 gene locus_tag LOCUS_59710 gene yidC 5182 3380 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528504.1 protein_id gnl|my_center|LOCUS_59710 4937 4946 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5549 5196 gene locus_tag LOCUS_59720 gene rnpA 5549 5196 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528505.1 protein_id gnl|my_center|LOCUS_59720 5700 5566 gene locus_tag LOCUS_59730 5700 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59730 >Feature sequence232 312 1199 gene locus_tag LOCUS_59740 gene serB 312 1199 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531035.1 protein_id gnl|my_center|LOCUS_59740 1196 1786 gene locus_tag LOCUS_59750 1196 1786 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531034.1 protein_id gnl|my_center|LOCUS_59750 3410 1815 gene locus_tag LOCUS_59760 3410 1815 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531033.1 protein_id gnl|my_center|LOCUS_59760 3989 3531 gene locus_tag LOCUS_59770 3989 3531 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532633.1 protein_id gnl|my_center|LOCUS_59770 5977 3986 gene locus_tag LOCUS_59780 5977 3986 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532634.1 protein_id gnl|my_center|LOCUS_59780 6420 5977 gene locus_tag LOCUS_59790 gene ccmE 6420 5977 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532635.1 protein_id gnl|my_center|LOCUS_59790 <7076 6424 gene locus_tag LOCUS_59800 <7076 6424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532636.1:c-type cytochrome biogenesis protein CcmI >Feature sequence233 <1 1185 gene locus_tag LOCUS_59810 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530844.1:VWA domain-containing protein 1185 2072 gene locus_tag LOCUS_59820 1185 2072 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173724.1 protein_id gnl|my_center|LOCUS_59820 3632 2184 gene locus_tag LOCUS_59830 3632 2184 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530836.1 protein_id gnl|my_center|LOCUS_59830 3745 4746 gene locus_tag LOCUS_59840 3745 4746 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222366.1 protein_id gnl|my_center|LOCUS_59840 4818 6224 gene locus_tag LOCUS_59850 4818 6224 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530835.1 protein_id gnl|my_center|LOCUS_59850 <6925 6300 gene locus_tag LOCUS_59860 <6925 6300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530808.1:ABC transporter ATP-binding protein >Feature sequence234 1592 861 gene locus_tag LOCUS_59870 1592 861 CDS product DUF2270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530519.1 protein_id gnl|my_center|LOCUS_59870 2571 1705 gene locus_tag LOCUS_59880 2571 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59880 2963 2565 gene locus_tag LOCUS_59890 2963 2565 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529998.1 protein_id gnl|my_center|LOCUS_59890 3090 3932 gene locus_tag LOCUS_59900 3090 3932 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529999.1 protein_id gnl|my_center|LOCUS_59900 4745 3996 gene locus_tag LOCUS_59910 4745 3996 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974643.1 protein_id gnl|my_center|LOCUS_59910 6203 4959 gene locus_tag LOCUS_59920 6203 4959 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170320.1 protein_id gnl|my_center|LOCUS_59920 >Feature sequence235 1156 29 gene locus_tag LOCUS_59930 1156 29 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243182.1 protein_id gnl|my_center|LOCUS_59930 1447 2148 gene locus_tag LOCUS_59940 1447 2148 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162273439.1 protein_id gnl|my_center|LOCUS_59940 2938 2126 gene locus_tag LOCUS_59950 2938 2126 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528931.1 protein_id gnl|my_center|LOCUS_59950 3050 4186 gene locus_tag LOCUS_59960 3050 4186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528932.1 protein_id gnl|my_center|LOCUS_59960 4167 5330 gene locus_tag LOCUS_59970 4167 5330 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528933.1 protein_id gnl|my_center|LOCUS_59970 5327 6271 gene locus_tag LOCUS_59980 5327 6271 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528934.1 protein_id gnl|my_center|LOCUS_59980 >Feature sequence236 2000 612 gene locus_tag LOCUS_59990 2000 612 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299062.1 protein_id gnl|my_center|LOCUS_59990 2858 2184 gene locus_tag LOCUS_60000 2858 2184 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531278.1 protein_id gnl|my_center|LOCUS_60000 3024 2951 gene locus_tag LOCUS_t00440 3024 2951 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3436 3179 gene locus_tag LOCUS_60010 3436 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503836.1 protein_id gnl|my_center|LOCUS_60010 3653 3727 gene locus_tag LOCUS_t00450 3653 3727 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4213 4392 gene locus_tag LOCUS_60020 4213 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60020 4541 4708 gene locus_tag LOCUS_60030 4541 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60030 4860 5039 gene locus_tag LOCUS_60040 4860 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60040 5220 5648 gene locus_tag LOCUS_60050 5220 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60050 6110 5655 gene locus_tag LOCUS_60060 6110 5655 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090535.1 protein_id gnl|my_center|LOCUS_60060 >Feature sequence237 217 226 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 501 1040 gene locus_tag LOCUS_60070 501 1040 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528490.1 protein_id gnl|my_center|LOCUS_60070 1037 1741 gene locus_tag LOCUS_60080 1037 1741 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528491.1 protein_id gnl|my_center|LOCUS_60080 1967 2524 gene locus_tag LOCUS_60090 1967 2524 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528492.1 protein_id gnl|my_center|LOCUS_60090 2729 3232 gene locus_tag LOCUS_60100 gene msrB 2729 3232 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528493.1 protein_id gnl|my_center|LOCUS_60100 3729 3241 gene locus_tag LOCUS_60110 3729 3241 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920736.1 protein_id gnl|my_center|LOCUS_60110 5009 3729 gene locus_tag LOCUS_60120 5009 3729 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920737.1 protein_id gnl|my_center|LOCUS_60120 6632 5187 gene locus_tag LOCUS_60130 6632 5187 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528494.1 protein_id gnl|my_center|LOCUS_60130 6471 6480 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence238 1725 700 gene locus_tag LOCUS_60140 1725 700 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_60140 4154 4369 gene locus_tag LOCUS_60150 4154 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_60150 4409 5020 gene locus_tag LOCUS_60160 4409 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_60160 5329 5338 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5352 6251 gene locus_tag LOCUS_60170 5352 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60170 >Feature sequence239 404 1510 gene locus_tag LOCUS_60180 404 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60180 2906 1518 gene locus_tag LOCUS_60190 gene sthA 2906 1518 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532272.1 protein_id gnl|my_center|LOCUS_60190 3095 3565 gene locus_tag LOCUS_60200 3095 3565 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532273.1 protein_id gnl|my_center|LOCUS_60200 3705 4469 gene locus_tag LOCUS_60210 3705 4469 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532274.1 protein_id gnl|my_center|LOCUS_60210 4572 5552 gene locus_tag LOCUS_60220 4572 5552 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532275.1 protein_id gnl|my_center|LOCUS_60220 <6654 5540 gene locus_tag LOCUS_60230 <6654 5540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532277.1:AI-2E family transporter >Feature sequence240 374 1486 gene locus_tag LOCUS_60240 374 1486 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531324.1 protein_id gnl|my_center|LOCUS_60240 1595 2776 gene locus_tag LOCUS_60250 1595 2776 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531323.1 protein_id gnl|my_center|LOCUS_60250 4612 2795 gene locus_tag LOCUS_60260 gene ade 4612 2795 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531322.1 protein_id gnl|my_center|LOCUS_60260 4761 5612 gene locus_tag LOCUS_60270 4761 5612 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531321.1 protein_id gnl|my_center|LOCUS_60270 5666 5878 gene locus_tag LOCUS_60280 5666 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60280 5970 6617 gene locus_tag LOCUS_60290 5970 6617 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531320.1 protein_id gnl|my_center|LOCUS_60290 >Feature sequence241 228 1151 gene locus_tag LOCUS_60300 228 1151 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970456.1 protein_id gnl|my_center|LOCUS_60300 1176 1529 gene locus_tag LOCUS_60310 1176 1529 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970455.1 protein_id gnl|my_center|LOCUS_60310 1673 2575 gene locus_tag LOCUS_60320 1673 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60320 2436 2445 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2590 3141 gene locus_tag LOCUS_60330 2590 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60330 3224 4195 gene locus_tag LOCUS_60340 3224 4195 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066869097.1 protein_id gnl|my_center|LOCUS_60340 4213 5670 gene locus_tag LOCUS_60350 4213 5670 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027998733.1 protein_id gnl|my_center|LOCUS_60350 <6633 5736 gene locus_tag LOCUS_60360 <6633 5736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064240990.1:FAD-binding oxidoreductase >Feature sequence242 298 615 gene locus_tag LOCUS_60370 298 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60370 612 944 gene locus_tag LOCUS_60380 612 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974796.1 protein_id gnl|my_center|LOCUS_60380 1422 2009 gene locus_tag LOCUS_60390 1422 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974366.1 protein_id gnl|my_center|LOCUS_60390 2567 2094 gene locus_tag LOCUS_60400 2567 2094 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252921.1 protein_id gnl|my_center|LOCUS_60400 2995 2564 gene locus_tag LOCUS_60410 2995 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60410 3083 3295 gene locus_tag LOCUS_60420 3083 3295 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167484192.1 protein_id gnl|my_center|LOCUS_60420 4043 3858 gene locus_tag LOCUS_60430 4043 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60430 4588 4271 gene locus_tag LOCUS_60440 4588 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60440 4804 4813 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4942 5868 gene locus_tag LOCUS_60450 4942 5868 CDS product ArdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974367.1 protein_id gnl|my_center|LOCUS_60450 6061 5885 gene locus_tag LOCUS_60460 6061 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60460 >Feature sequence243 1316 198 gene locus_tag LOCUS_60470 1316 198 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532116.1 protein_id gnl|my_center|LOCUS_60470 1446 1940 gene locus_tag LOCUS_60480 1446 1940 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532115.1 protein_id gnl|my_center|LOCUS_60480 1972 2901 gene locus_tag LOCUS_60490 1972 2901 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532114.1 protein_id gnl|my_center|LOCUS_60490 2906 4156 gene locus_tag LOCUS_60500 2906 4156 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532113.1 protein_id gnl|my_center|LOCUS_60500 4226 4621 gene locus_tag LOCUS_60510 4226 4621 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031693.1 protein_id gnl|my_center|LOCUS_60510 4676 5014 gene locus_tag LOCUS_60520 4676 5014 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532112.1 protein_id gnl|my_center|LOCUS_60520 5080 5784 gene locus_tag LOCUS_60530 5080 5784 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532111.1 protein_id gnl|my_center|LOCUS_60530 >Feature sequence244 <1 830 gene locus_tag LOCUS_60540 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530881.1:translocation/assembly module TamB domain-containing protein note possible pseudo, frameshifted 699 708 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 827 967 gene locus_tag LOCUS_60550 827 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60550 1240 2892 gene locus_tag LOCUS_60560 1240 2892 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530882.1 protein_id gnl|my_center|LOCUS_60560 3117 4151 gene locus_tag LOCUS_60570 3117 4151 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530883.1 protein_id gnl|my_center|LOCUS_60570 4164 5321 gene locus_tag LOCUS_60580 4164 5321 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530884.1 protein_id gnl|my_center|LOCUS_60580 >Feature sequence245 <1 2930 gene locus_tag LOCUS_60590 <1 2930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088688.1:caspase family protein 3014 3562 gene locus_tag LOCUS_60600 3014 3562 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531226.1 protein_id gnl|my_center|LOCUS_60600 3854 3929 gene locus_tag LOCUS_t00460 3854 3929 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4286 5428 gene locus_tag LOCUS_60610 4286 5428 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531225.1 protein_id gnl|my_center|LOCUS_60610 5605 5886 gene locus_tag LOCUS_60620 5605 5886 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909964.1 protein_id gnl|my_center|LOCUS_60620 >Feature sequence246 250 1254 gene locus_tag LOCUS_60630 250 1254 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528683.1 protein_id gnl|my_center|LOCUS_60630 2156 1422 gene locus_tag LOCUS_60640 gene msrA 2156 1422 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528688.1 protein_id gnl|my_center|LOCUS_60640 2564 2238 gene locus_tag LOCUS_60650 2564 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60650 3355 2648 gene locus_tag LOCUS_60660 3355 2648 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528690.1 protein_id gnl|my_center|LOCUS_60660 4548 3484 gene locus_tag LOCUS_60670 4548 3484 CDS product Tad domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525006.1 protein_id gnl|my_center|LOCUS_60670 4849 6261 gene locus_tag LOCUS_60680 gene lpdA 4849 6261 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528744.1 protein_id gnl|my_center|LOCUS_60680 >Feature sequence247 2025 1774 gene locus_tag LOCUS_60690 2025 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60690 2066 2236 gene locus_tag LOCUS_60700 2066 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60700 3173 2301 gene locus_tag LOCUS_60710 3173 2301 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532353.1 protein_id gnl|my_center|LOCUS_60710 4519 3200 gene locus_tag LOCUS_60720 4519 3200 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532354.1 protein_id gnl|my_center|LOCUS_60720 5952 4597 gene locus_tag LOCUS_60730 5952 4597 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532355.1 protein_id gnl|my_center|LOCUS_60730 >Feature sequence248 1797 148 gene locus_tag LOCUS_60740 1797 148 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532331.1 protein_id gnl|my_center|LOCUS_60740 3389 1839 gene locus_tag LOCUS_60750 3389 1839 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532332.1 protein_id gnl|my_center|LOCUS_60750 3481 4383 gene locus_tag LOCUS_60760 3481 4383 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532333.1 protein_id gnl|my_center|LOCUS_60760 >Feature sequence249 917 926 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 937 1713 gene locus_tag LOCUS_60770 937 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60770 2028 1744 gene locus_tag LOCUS_60780 2028 1744 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525351.1 protein_id gnl|my_center|LOCUS_60780 2198 4309 gene locus_tag LOCUS_60790 2198 4309 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528580.1 protein_id gnl|my_center|LOCUS_60790 4311 4526 gene locus_tag LOCUS_60800 4311 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60800 4556 5203 gene locus_tag LOCUS_60810 4556 5203 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528525.1 protein_id gnl|my_center|LOCUS_60810 >Feature sequence250 <1 706 gene locus_tag LOCUS_60820 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525274.1:FAD-binding oxidoreductase 729 1322 gene locus_tag LOCUS_60830 729 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60830 1307 1612 gene locus_tag LOCUS_60840 1307 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60840 1721 2758 gene locus_tag LOCUS_60850 1721 2758 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965528.1 protein_id gnl|my_center|LOCUS_60850 2854 3669 gene locus_tag LOCUS_60860 2854 3669 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640300.1 protein_id gnl|my_center|LOCUS_60860 3682 4293 gene locus_tag LOCUS_60870 3682 4293 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209604823.1 protein_id gnl|my_center|LOCUS_60870 4855 4373 gene locus_tag LOCUS_60880 4855 4373 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525198.1 protein_id gnl|my_center|LOCUS_60880 5103 4855 gene locus_tag LOCUS_60890 5103 4855 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173989.1 protein_id gnl|my_center|LOCUS_60890 5709 5633 gene locus_tag LOCUS_t00470 5709 5633 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence251 <1 694 gene locus_tag LOCUS_60900 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531286.1:exodeoxyribonuclease III 774 1067 gene locus_tag LOCUS_60910 774 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531285.1 protein_id gnl|my_center|LOCUS_60910 1842 1099 gene locus_tag LOCUS_60920 1842 1099 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531284.1 protein_id gnl|my_center|LOCUS_60920 3634 1910 gene locus_tag LOCUS_60930 gene ilvD 3634 1910 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531283.1 protein_id gnl|my_center|LOCUS_60930 5201 3936 gene locus_tag LOCUS_60940 5201 3936 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531282.1 protein_id gnl|my_center|LOCUS_60940 >Feature sequence252 771 139 gene locus_tag LOCUS_60950 771 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60950 208 217 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2274 829 gene locus_tag LOCUS_60960 2274 829 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528554.1 protein_id gnl|my_center|LOCUS_60960 2450 3214 gene locus_tag LOCUS_60970 2450 3214 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528553.1 protein_id gnl|my_center|LOCUS_60970 3244 4497 gene locus_tag LOCUS_60980 3244 4497 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528552.1 protein_id gnl|my_center|LOCUS_60980 4494 5189 gene locus_tag LOCUS_60990 4494 5189 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528551.1 protein_id gnl|my_center|LOCUS_60990 >Feature sequence253 1379 2557 gene locus_tag LOCUS_61000 1379 2557 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019995458.1 protein_id gnl|my_center|LOCUS_61000 2554 3609 gene locus_tag LOCUS_61010 2554 3609 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188909205.1 protein_id gnl|my_center|LOCUS_61010 3618 4904 gene locus_tag LOCUS_61020 3618 4904 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626293.1 protein_id gnl|my_center|LOCUS_61020 3698 3707 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence254 <1 641 gene locus_tag LOCUS_61030 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531011.1:AsmA family protein 868 638 gene locus_tag LOCUS_61040 868 638 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531014.1 protein_id gnl|my_center|LOCUS_61040 1075 878 gene locus_tag LOCUS_61050 1075 878 CDS product DUF4169 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531015.1 protein_id gnl|my_center|LOCUS_61050 1660 1094 gene locus_tag LOCUS_61060 1660 1094 CDS product SspB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531016.1 protein_id gnl|my_center|LOCUS_61060 2436 1747 gene locus_tag LOCUS_61070 2436 1747 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531017.1 protein_id gnl|my_center|LOCUS_61070 2621 3826 gene locus_tag LOCUS_61080 2621 3826 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531018.1 protein_id gnl|my_center|LOCUS_61080 4532 4843 gene locus_tag LOCUS_61090 4532 4843 CDS product DUF2853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531020.1 protein_id gnl|my_center|LOCUS_61090 >Feature sequence255 <1 967 gene locus_tag LOCUS_61100 <1 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528208.1:indolepyruvate ferredoxin oxidoreductase family protein 1060 3375 gene locus_tag LOCUS_61110 1060 3375 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528207.1 protein_id gnl|my_center|LOCUS_61110 3609 4295 gene locus_tag LOCUS_61120 3609 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528206.1 protein_id gnl|my_center|LOCUS_61120 4356 4616 gene locus_tag LOCUS_61130 4356 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61130 4747 4971 gene locus_tag LOCUS_61140 4747 4971 CDS product aa3-type cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528204.1 protein_id gnl|my_center|LOCUS_61140 >Feature sequence256 1358 636 gene locus_tag LOCUS_61150 1358 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61150 1436 1445 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1892 1901 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3088 2270 gene locus_tag LOCUS_61160 gene lptB 3088 2270 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529586.1 protein_id gnl|my_center|LOCUS_61160 3672 3088 gene locus_tag LOCUS_61170 3672 3088 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529585.1 protein_id gnl|my_center|LOCUS_61170 4372 3659 gene locus_tag LOCUS_61180 gene lptC 4372 3659 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529584.1 protein_id gnl|my_center|LOCUS_61180 >Feature sequence257 1128 34 gene locus_tag LOCUS_61190 1128 34 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449629.1 protein_id gnl|my_center|LOCUS_61190 1513 2619 gene locus_tag LOCUS_61200 1513 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61200 3415 2708 gene locus_tag LOCUS_61210 3415 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61210 3786 3412 gene locus_tag LOCUS_61220 3786 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61220 >Feature sequence258 2586 748 gene locus_tag LOCUS_61230 2586 748 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173037.1 protein_id gnl|my_center|LOCUS_61230 2766 4256 gene locus_tag LOCUS_61240 2766 4256 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529737.1 protein_id gnl|my_center|LOCUS_61240 >Feature sequence259 1672 1046 gene locus_tag LOCUS_61250 1672 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61250 1959 1558 gene locus_tag LOCUS_61260 1959 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61260 1750 1759 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3110 1956 gene locus_tag LOCUS_61270 gene queG 3110 1956 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528621.1 protein_id gnl|my_center|LOCUS_61270 3849 3091 gene locus_tag LOCUS_61280 3849 3091 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528622.1 protein_id gnl|my_center|LOCUS_61280 3938 4744 gene locus_tag LOCUS_61290 3938 4744 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528623.1 protein_id gnl|my_center|LOCUS_61290 5127 4750 gene locus_tag LOCUS_61300 5127 4750 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210328395.1 protein_id gnl|my_center|LOCUS_61300 5145 5154 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence260 329 3607 gene locus_tag LOCUS_61310 329 3607 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528776.1 protein_id gnl|my_center|LOCUS_61310 3994 3752 gene locus_tag LOCUS_61320 3994 3752 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528775.1 protein_id gnl|my_center|LOCUS_61320 4835 4164 gene locus_tag LOCUS_61330 4835 4164 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528774.1 protein_id gnl|my_center|LOCUS_61330 >Feature sequence261 <1 1314 gene locus_tag LOCUS_61340 <1 1314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976308.1:dicarboxylate/amino acid:cation symporter 1450 2031 gene locus_tag LOCUS_61350 1450 2031 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530566.1 protein_id gnl|my_center|LOCUS_61350 2954 2196 gene locus_tag LOCUS_61360 2954 2196 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530568.1 protein_id gnl|my_center|LOCUS_61360 3160 4077 gene locus_tag LOCUS_61370 3160 4077 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533593.1 protein_id gnl|my_center|LOCUS_61370 4895 4904 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence262 2230 1061 gene locus_tag LOCUS_61380 2230 1061 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530677.1 protein_id gnl|my_center|LOCUS_61380 3872 2871 gene locus_tag LOCUS_61390 3872 2871 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173331.1 protein_id gnl|my_center|LOCUS_61390 4132 3872 gene locus_tag LOCUS_61400 4132 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61400 4244 4588 gene locus_tag LOCUS_61410 4244 4588 CDS product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525103.1 protein_id gnl|my_center|LOCUS_61410 >Feature sequence263 400 852 gene locus_tag LOCUS_61420 400 852 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532358.1 protein_id gnl|my_center|LOCUS_61420 1704 934 gene locus_tag LOCUS_61430 1704 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532359.1 protein_id gnl|my_center|LOCUS_61430 4833 1858 gene locus_tag LOCUS_61440 gene ileS 4833 1858 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532360.1 protein_id gnl|my_center|LOCUS_61440 >Feature sequence264 40 654 gene locus_tag LOCUS_61450 gene metW 40 654 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_61450 651 1427 gene locus_tag LOCUS_61460 651 1427 CDS product Stf0 family sulphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969658.1 protein_id gnl|my_center|LOCUS_61460 1551 2543 gene locus_tag LOCUS_61470 1551 2543 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529384.1 protein_id gnl|my_center|LOCUS_61470 2721 3656 gene locus_tag LOCUS_61480 2721 3656 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529382.1 protein_id gnl|my_center|LOCUS_61480 4585 3785 gene locus_tag LOCUS_61490 4585 3785 CDS product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173807.1 protein_id gnl|my_center|LOCUS_61490 <5263 4752 gene locus_tag LOCUS_61500 <5263 4752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529380.1:ABC transporter ATP-binding protein/permease >Feature sequence265 499 1596 gene locus_tag LOCUS_61510 499 1596 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528805.1 protein_id gnl|my_center|LOCUS_61510 1661 2269 gene locus_tag LOCUS_61520 1661 2269 CDS product DUF1236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528804.1 protein_id gnl|my_center|LOCUS_61520 2435 3403 gene locus_tag LOCUS_61530 2435 3403 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528803.1 protein_id gnl|my_center|LOCUS_61530 3403 4344 gene locus_tag LOCUS_61540 3403 4344 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759755.1 protein_id gnl|my_center|LOCUS_61540 >Feature sequence266 1109 300 gene locus_tag LOCUS_61550 gene speB 1109 300 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_61550 3320 1200 gene locus_tag LOCUS_61560 3320 1200 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532465.1 protein_id gnl|my_center|LOCUS_61560 4674 3532 gene locus_tag LOCUS_61570 4674 3532 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900904.1 protein_id gnl|my_center|LOCUS_61570 >Feature sequence267 <1 1021 gene locus_tag LOCUS_61580 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532632.1:Do family serine endopeptidase 868 877 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1018 1692 gene locus_tag LOCUS_61590 1018 1692 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023812818.1 protein_id gnl|my_center|LOCUS_61590 1701 3176 gene locus_tag LOCUS_61600 1701 3176 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532630.1 protein_id gnl|my_center|LOCUS_61600 3176 4051 gene locus_tag LOCUS_61610 3176 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61610 3996 4005 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence268 2273 1035 gene locus_tag LOCUS_61620 2273 1035 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653868.1 protein_id gnl|my_center|LOCUS_61620 3583 2453 gene locus_tag LOCUS_61630 3583 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61630 3606 3615 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence269 3725 1425 gene locus_tag LOCUS_61640 3725 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61640 <5030 3712 gene locus_tag LOCUS_61650 <5030 3712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530879.1:alpha-2-macroglobulin family protein note possible pseudo, frameshifted >Feature sequence270 506 1534 gene locus_tag LOCUS_61660 506 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61660 1873 1559 gene locus_tag LOCUS_61670 1873 1559 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531236.1 protein_id gnl|my_center|LOCUS_61670 2951 1908 gene locus_tag LOCUS_61680 2951 1908 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173706.1 protein_id gnl|my_center|LOCUS_61680 3420 2992 gene locus_tag LOCUS_61690 3420 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531238.1 protein_id gnl|my_center|LOCUS_61690 <5012 3426 gene locus_tag LOCUS_61700 <5012 3426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531239.1:TonB-dependent hemoglobin/transferrin/lactoferrin family receptor >Feature sequence271 1574 348 gene locus_tag LOCUS_61710 1574 348 CDS product DUF459 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529720.1 protein_id gnl|my_center|LOCUS_61710 2824 1601 gene locus_tag LOCUS_61720 2824 1601 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529721.1 protein_id gnl|my_center|LOCUS_61720 3035 3940 gene locus_tag LOCUS_61730 gene galU 3035 3940 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529722.1 protein_id gnl|my_center|LOCUS_61730 <4925 3987 gene locus_tag LOCUS_61740 <4925 3987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063173044.1:outer membrane beta-barrel protein >Feature sequence272 124 1188 gene locus_tag LOCUS_61750 gene hemH 124 1188 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529728.1 protein_id gnl|my_center|LOCUS_61750 1326 2273 gene locus_tag LOCUS_61760 1326 2273 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529726.1 protein_id gnl|my_center|LOCUS_61760 2565 2780 gene locus_tag LOCUS_61770 2565 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61770 3934 2933 gene locus_tag LOCUS_61780 3934 2933 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529724.1 protein_id gnl|my_center|LOCUS_61780 4629 4638 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence273 <1 2346 gene locus_tag LOCUS_61790 <1 2346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975826.1:adenylate/guanylate cyclase domain-containing protein 3110 2463 gene locus_tag LOCUS_61800 3110 2463 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971750.1 protein_id gnl|my_center|LOCUS_61800 3311 4204 gene locus_tag LOCUS_61810 3311 4204 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992396.1 protein_id gnl|my_center|LOCUS_61810 4360 4647 gene locus_tag LOCUS_61820 4360 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61820 >Feature sequence274 <1 720 gene locus_tag LOCUS_61830 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530934.1:methylenetetrahydrofolate reductase [NAD(P)H] 2138 1218 gene locus_tag LOCUS_61840 2138 1218 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530935.1 protein_id gnl|my_center|LOCUS_61840 2358 3578 gene locus_tag LOCUS_61850 2358 3578 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530936.1 protein_id gnl|my_center|LOCUS_61850 3979 3596 gene locus_tag LOCUS_61860 3979 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61860 <4715 4010 gene locus_tag LOCUS_61870 <4715 4010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530937.1:lytic murein transglycosylase >Feature sequence275 1574 915 gene locus_tag LOCUS_61880 1574 915 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531300.1 protein_id gnl|my_center|LOCUS_61880 2329 1571 gene locus_tag LOCUS_61890 gene surE 2329 1571 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531299.1 protein_id gnl|my_center|LOCUS_61890 3633 2329 gene locus_tag LOCUS_61900 gene serS 3633 2329 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531298.1 protein_id gnl|my_center|LOCUS_61900 4605 3730 gene locus_tag LOCUS_61910 gene tatC 4605 3730 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531297.1 protein_id gnl|my_center|LOCUS_61910 >Feature sequence276 259 1572 gene locus_tag LOCUS_61920 259 1572 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532252.1 protein_id gnl|my_center|LOCUS_61920 1655 2281 gene locus_tag LOCUS_61930 1655 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171896.1 protein_id gnl|my_center|LOCUS_61930 2303 2632 gene locus_tag LOCUS_61940 2303 2632 CDS product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170280.1 protein_id gnl|my_center|LOCUS_61940 2718 3197 gene locus_tag LOCUS_61950 gene nrdR 2718 3197 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532250.1 protein_id gnl|my_center|LOCUS_61950 3200 4327 gene locus_tag LOCUS_61960 gene ribD 3200 4327 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532249.1 protein_id gnl|my_center|LOCUS_61960 >Feature sequence277 3044 1155 gene locus_tag LOCUS_61970 3044 1155 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529248.1 protein_id gnl|my_center|LOCUS_61970 4263 3253 gene locus_tag LOCUS_61980 gene gap 4263 3253 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529249.1 protein_id gnl|my_center|LOCUS_61980 >Feature sequence278 64 549 gene locus_tag LOCUS_61990 64 549 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530198.1 protein_id gnl|my_center|LOCUS_61990 592 1002 gene locus_tag LOCUS_62000 592 1002 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530197.1 protein_id gnl|my_center|LOCUS_62000 1200 1418 gene locus_tag LOCUS_62010 gene infA 1200 1418 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006200926.1 protein_id gnl|my_center|LOCUS_62010 1438 2064 gene locus_tag LOCUS_62020 1438 2064 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530196.1 protein_id gnl|my_center|LOCUS_62020 2061 2279 gene locus_tag LOCUS_62030 gene yacG 2061 2279 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530195.1 protein_id gnl|my_center|LOCUS_62030 2453 2528 gene locus_tag LOCUS_t00480 2453 2528 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2590 3141 gene locus_tag LOCUS_62040 2590 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62040 3440 3234 gene locus_tag LOCUS_62050 3440 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62050 3612 3809 gene locus_tag LOCUS_62060 3612 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62060 >Feature sequence279 303 1277 gene locus_tag LOCUS_62070 303 1277 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530804.1 protein_id gnl|my_center|LOCUS_62070 1317 2378 gene locus_tag LOCUS_62080 1317 2378 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530805.1 protein_id gnl|my_center|LOCUS_62080 2408 3277 gene locus_tag LOCUS_62090 2408 3277 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530806.1 protein_id gnl|my_center|LOCUS_62090 3277 4065 gene locus_tag LOCUS_62100 3277 4065 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530807.1 protein_id gnl|my_center|LOCUS_62100 >Feature sequence280 1105 1710 gene locus_tag LOCUS_62110 1105 1710 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532373.1 protein_id gnl|my_center|LOCUS_62110 1707 3518 gene locus_tag LOCUS_62120 1707 3518 CDS product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564966.1 protein_id gnl|my_center|LOCUS_62120 >Feature sequence281 1457 201 gene locus_tag LOCUS_62130 1457 201 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533665.1 protein_id gnl|my_center|LOCUS_62130 2423 1623 gene locus_tag LOCUS_62140 2423 1623 CDS product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533664.1 protein_id gnl|my_center|LOCUS_62140 2377 2386 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3346 2423 gene locus_tag LOCUS_62150 3346 2423 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533663.1 protein_id gnl|my_center|LOCUS_62150 <4396 3539 gene locus_tag LOCUS_62160 <4396 3539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533662.1:peptidoglycan-binding protein >Feature sequence282 3413 483 gene locus_tag LOCUS_62170 3413 483 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171192.1 protein_id gnl|my_center|LOCUS_62170 >Feature sequence283 441 1325 gene locus_tag LOCUS_62180 441 1325 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529788.1 protein_id gnl|my_center|LOCUS_62180 1458 3269 gene locus_tag LOCUS_62190 gene fliF 1458 3269 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529786.1 protein_id gnl|my_center|LOCUS_62190 2976 2985 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3266 3760 gene locus_tag LOCUS_62200 3266 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529785.1 protein_id gnl|my_center|LOCUS_62200 >Feature sequence284 823 2781 gene locus_tag LOCUS_62210 823 2781 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530253.1 protein_id gnl|my_center|LOCUS_62210 <4289 3031 gene locus_tag LOCUS_62220 <4289 3031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530254.1:PAS domain S-box protein >Feature sequence285 <1 826 gene locus_tag LOCUS_62230 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064243181.1:ABC transporter permease 826 1752 gene locus_tag LOCUS_62240 826 1752 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243444.1 protein_id gnl|my_center|LOCUS_62240 1790 2491 gene locus_tag LOCUS_62250 1790 2491 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606634.1 protein_id gnl|my_center|LOCUS_62250 2502 4034 gene locus_tag LOCUS_62260 2502 4034 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243179.1 protein_id gnl|my_center|LOCUS_62260 >Feature sequence286 1580 1104 gene locus_tag LOCUS_62270 1580 1104 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123150961.1 protein_id gnl|my_center|LOCUS_62270 >Feature sequence287 1207 467 gene locus_tag LOCUS_62280 1207 467 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533369.1 protein_id gnl|my_center|LOCUS_62280 2697 3431 gene locus_tag LOCUS_62290 2697 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62290 3454 3897 gene locus_tag LOCUS_62300 3454 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62300 >Feature sequence288 1414 98 gene locus_tag LOCUS_62310 1414 98 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528743.1 protein_id gnl|my_center|LOCUS_62310 2442 1429 gene locus_tag LOCUS_62320 2442 1429 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528742.1 protein_id gnl|my_center|LOCUS_62320 3677 2445 gene locus_tag LOCUS_62330 3677 2445 CDS product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528741.1 protein_id gnl|my_center|LOCUS_62330 >Feature sequence289 1825 2097 gene locus_tag LOCUS_62340 1825 2097 CDS product DUF4164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529251.1 protein_id gnl|my_center|LOCUS_62340 2102 2467 gene locus_tag LOCUS_62350 2102 2467 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529252.1 protein_id gnl|my_center|LOCUS_62350 2640 3299 gene locus_tag LOCUS_62360 2640 3299 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529253.1 protein_id gnl|my_center|LOCUS_62360 3493 3885 gene locus_tag LOCUS_62370 3493 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62370 >Feature sequence290 261 16 gene locus_tag LOCUS_62380 261 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62380 516 980 gene locus_tag LOCUS_62390 516 980 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532958.1 protein_id gnl|my_center|LOCUS_62390 1732 1115 gene locus_tag LOCUS_62400 1732 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62400 1140 1149 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1964 2764 gene locus_tag LOCUS_62410 1964 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62410 3743 2817 gene locus_tag LOCUS_62420 gene era 3743 2817 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532583.1 protein_id gnl|my_center|LOCUS_62420 >Feature sequence291 <1 3055 gene locus_tag LOCUS_62430 <1 3055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531086.1:cobaltochelatase subunit CobN >Feature sequence292 1853 327 gene locus_tag LOCUS_62440 gene glpD 1853 327 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531813.1 protein_id gnl|my_center|LOCUS_62440 2748 1981 gene locus_tag LOCUS_62450 2748 1981 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531814.1 protein_id gnl|my_center|LOCUS_62450 3473 2871 gene locus_tag LOCUS_62460 3473 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62460 3515 3524 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence293 1454 153 gene locus_tag LOCUS_62470 1454 153 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528950.1 protein_id gnl|my_center|LOCUS_62470 2842 1457 gene locus_tag LOCUS_62480 2842 1457 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528949.1 protein_id gnl|my_center|LOCUS_62480 <3741 2847 gene locus_tag LOCUS_62490 <3741 2847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528948.1:glycosyltransferase >Feature sequence294 971 48 gene locus_tag LOCUS_62500 971 48 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528945.1 protein_id gnl|my_center|LOCUS_62500 2053 992 gene locus_tag LOCUS_62510 2053 992 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528946.1 protein_id gnl|my_center|LOCUS_62510 2286 3224 gene locus_tag LOCUS_62520 2286 3224 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528947.1 protein_id gnl|my_center|LOCUS_62520 >Feature sequence295 2259 502 gene locus_tag LOCUS_62530 2259 502 CDS product YaiO family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525348.1 protein_id gnl|my_center|LOCUS_62530 2717 2259 gene locus_tag LOCUS_62540 2717 2259 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525347.1 protein_id gnl|my_center|LOCUS_62540 3294 2914 gene locus_tag LOCUS_62550 3294 2914 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082826795.1 protein_id gnl|my_center|LOCUS_62550 >Feature sequence296 1374 241 gene locus_tag LOCUS_62560 gene menC 1374 241 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883950.1 protein_id gnl|my_center|LOCUS_62560 2751 2629 gene locus_tag LOCUS_62570 2751 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62570 >Feature sequence297 <1 954 gene locus_tag LOCUS_62580 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533602.1:ABC transporter permease 954 1268 gene locus_tag LOCUS_62590 gene rhaM 954 1268 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533603.1 protein_id gnl|my_center|LOCUS_62590 1265 2635 gene locus_tag LOCUS_62600 1265 2635 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533604.1 protein_id gnl|my_center|LOCUS_62600 >Feature sequence298 1232 129 gene locus_tag LOCUS_62610 1232 129 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531080.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62610 267 276 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1234 2001 gene locus_tag LOCUS_62620 1234 2001 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531081.1 protein_id gnl|my_center|LOCUS_62620 2729 1965 gene locus_tag LOCUS_62630 2729 1965 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531082.1 protein_id gnl|my_center|LOCUS_62630 3475 2726 gene locus_tag LOCUS_62640 3475 2726 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531083.1 protein_id gnl|my_center|LOCUS_62640 >Feature sequence299 7 2556 gene locus_tag LOCUS_62650 7 2556 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532578.1 protein_id gnl|my_center|LOCUS_62650 2698 3216 gene locus_tag LOCUS_62660 2698 3216 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532577.1 protein_id gnl|my_center|LOCUS_62660 >Feature sequence300 1143 55 gene locus_tag LOCUS_62670 1143 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62670 1160 1169 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1220 1693 gene locus_tag LOCUS_62680 1220 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62680 1766 2173 gene locus_tag LOCUS_62690 1766 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62690 2417 2728 gene locus_tag LOCUS_62700 2417 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62700 <3514 2825 gene locus_tag LOCUS_62710 <3514 2825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089034.1:heparin lyase I family protein >Feature sequence301 1843 1124 gene locus_tag LOCUS_62720 1843 1124 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528337.1 protein_id gnl|my_center|LOCUS_62720 >Feature sequence302 649 446 gene locus_tag LOCUS_62730 649 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530681.1 protein_id gnl|my_center|LOCUS_62730 855 864 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1657 2379 gene locus_tag LOCUS_62740 1657 2379 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530679.1 protein_id gnl|my_center|LOCUS_62740 >Feature sequence303 331 110 gene locus_tag LOCUS_62750 331 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62750 1101 328 gene locus_tag LOCUS_62760 gene istB 1101 328 CDS product IS21-like element ISMac3 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021079.1 protein_id gnl|my_center|LOCUS_62760 2170 1094 gene locus_tag LOCUS_62770 2170 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62770 2589 2170 gene locus_tag LOCUS_62780 2589 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62780 >Feature sequence304 1190 1636 gene locus_tag LOCUS_62790 1190 1636 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530173.1 protein_id gnl|my_center|LOCUS_62790 1858 2241 gene locus_tag LOCUS_62800 1858 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530174.1 protein_id gnl|my_center|LOCUS_62800 3142 2423 gene locus_tag LOCUS_62810 3142 2423 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530175.1 protein_id gnl|my_center|LOCUS_62810 3276 3351 gene locus_tag LOCUS_t00490 3276 3351 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence305 1707 772 gene locus_tag LOCUS_62820 1707 772 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577656.1 protein_id gnl|my_center|LOCUS_62820 2815 2015 gene locus_tag LOCUS_62830 2815 2015 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532085.1 protein_id gnl|my_center|LOCUS_62830 2980 3315 gene locus_tag LOCUS_62840 gene grxD 2980 3315 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532137.1 protein_id gnl|my_center|LOCUS_62840 >Feature sequence306 2872 2881 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence307 2416 821 gene locus_tag LOCUS_62850 2416 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62850 1251 1260 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3102 2623 gene locus_tag LOCUS_62860 3102 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528209.1 protein_id gnl|my_center|LOCUS_62860 3124 3285 gene locus_tag LOCUS_62870 3124 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62870 >Feature sequence308 1674 1066 gene locus_tag LOCUS_62880 1674 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530003.1 protein_id gnl|my_center|LOCUS_62880 2880 1729 gene locus_tag LOCUS_62890 2880 1729 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530004.1 protein_id gnl|my_center|LOCUS_62890 >Feature sequence309 <1 968 gene locus_tag LOCUS_62900 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530172.1:OmpA family protein 1162 1171 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1256 1771 gene locus_tag LOCUS_62910 1256 1771 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530171.1 protein_id gnl|my_center|LOCUS_62910 2656 1790 gene locus_tag LOCUS_62920 2656 1790 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530170.1 protein_id gnl|my_center|LOCUS_62920 >Feature sequence310 259 2670 gene locus_tag LOCUS_62930 259 2670 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528921.1 protein_id gnl|my_center|LOCUS_62930 >Feature sequence311 115 990 gene locus_tag LOCUS_62940 115 990 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504050.1 protein_id gnl|my_center|LOCUS_62940 1033 1239 gene locus_tag LOCUS_62950 1033 1239 CDS product DUF1737 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528780.1 protein_id gnl|my_center|LOCUS_62950 1760 1329 gene locus_tag LOCUS_62960 1760 1329 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528779.1 protein_id gnl|my_center|LOCUS_62960 1898 2530 gene locus_tag LOCUS_62970 1898 2530 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400784.1 protein_id gnl|my_center|LOCUS_62970 >Feature sequence312 2988 826 gene locus_tag LOCUS_62980 2988 826 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528604.1 protein_id gnl|my_center|LOCUS_62980 >Feature sequence313 214 223 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1520 381 gene locus_tag LOCUS_62990 1520 381 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527919.1 protein_id gnl|my_center|LOCUS_62990 1771 3060 gene locus_tag LOCUS_63000 1771 3060 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527918.1 protein_id gnl|my_center|LOCUS_63000 >Feature sequence314 62 1312 gene locus_tag LOCUS_63010 62 1312 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532349.1 protein_id gnl|my_center|LOCUS_63010 1450 2019 gene locus_tag LOCUS_63020 1450 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63020 1713 1722 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2059 2208 gene locus_tag LOCUS_63030 2059 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63030 2831 2244 gene locus_tag LOCUS_63040 2831 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63040 2875 2884 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence315 538 1230 gene locus_tag LOCUS_63050 538 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63050 1534 1962 gene locus_tag LOCUS_63060 1534 1962 CDS product DUF1636 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531088.1 protein_id gnl|my_center|LOCUS_63060 1965 2936 gene locus_tag LOCUS_63070 gene cobW 1965 2936 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531087.1 protein_id gnl|my_center|LOCUS_63070 2838 2847 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence316 313 1860 gene locus_tag LOCUS_63080 313 1860 CDS product DUF4173 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528782.1 protein_id gnl|my_center|LOCUS_63080 1864 2556 gene locus_tag LOCUS_63090 1864 2556 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528783.1 protein_id gnl|my_center|LOCUS_63090 >Feature sequence317 1373 582 gene locus_tag LOCUS_63100 1373 582 CDS product tail fiber domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531595.1 protein_id gnl|my_center|LOCUS_63100 1839 1378 gene locus_tag LOCUS_63110 1839 1378 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167391323.1 protein_id gnl|my_center|LOCUS_63110 >Feature sequence318 368 144 gene locus_tag LOCUS_63120 368 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63120 1816 665 gene locus_tag LOCUS_63130 1816 665 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532712.1 protein_id gnl|my_center|LOCUS_63130 <2971 2160 gene locus_tag LOCUS_63140 <2971 2160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056091.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence319 2184 1408 gene locus_tag LOCUS_63150 2184 1408 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529379.1 protein_id gnl|my_center|LOCUS_63150 >Feature sequence320 1231 386 gene locus_tag LOCUS_63160 1231 386 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528056.1 protein_id gnl|my_center|LOCUS_63160 1717 1325 gene locus_tag LOCUS_63170 1717 1325 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528057.1 protein_id gnl|my_center|LOCUS_63170 2877 1762 gene locus_tag LOCUS_63180 2877 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63180 >Feature sequence321 482 491 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 532 753 gene locus_tag LOCUS_63190 532 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63190 755 2356 gene locus_tag LOCUS_63200 755 2356 CDS product cisplatin damage response ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527948.1 protein_id gnl|my_center|LOCUS_63200 >Feature sequence322 631 1218 gene locus_tag LOCUS_63210 631 1218 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531936.1 protein_id gnl|my_center|LOCUS_63210 1300 2841 gene locus_tag LOCUS_63220 1300 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531935.1 protein_id gnl|my_center|LOCUS_63220 >Feature sequence323 1643 993 gene locus_tag LOCUS_63230 1643 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63230 2082 1660 gene locus_tag LOCUS_63240 2082 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63240 >Feature sequence324 49 405 gene locus_tag LOCUS_63250 49 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63250 562 1272 gene locus_tag LOCUS_63260 562 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533431.1 protein_id gnl|my_center|LOCUS_63260 1640 1960 gene locus_tag LOCUS_63270 1640 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63270 1938 2141 gene locus_tag LOCUS_63280 1938 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63280 2175 2747 gene locus_tag LOCUS_63290 2175 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63290 >Feature sequence325 587 1726 gene locus_tag LOCUS_63300 587 1726 CDS product acetyl-CoA carboxylase biotin carboxylase subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082908189.1 protein_id gnl|my_center|LOCUS_63300 2039 2686 gene locus_tag LOCUS_63310 2039 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63310 >Feature sequence326 <1 680 gene locus_tag LOCUS_63320 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_138390505.1:tyrosine-type recombinase/integrase 584 1159 gene locus_tag LOCUS_63330 584 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63330 1156 1644 gene locus_tag LOCUS_63340 1156 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63340 2395 2571 gene locus_tag LOCUS_63350 2395 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63350 >Feature sequence327 1075 1791 gene locus_tag LOCUS_63360 1075 1791 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528496.1 protein_id gnl|my_center|LOCUS_63360 >Feature sequence328 >Feature sequence329 589 831 gene locus_tag LOCUS_63370 589 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531069.1 protein_id gnl|my_center|LOCUS_63370 1332 859 gene locus_tag LOCUS_63380 1332 859 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971051.1 protein_id gnl|my_center|LOCUS_63380 1480 2550 gene locus_tag LOCUS_63390 1480 2550 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971052.1 protein_id gnl|my_center|LOCUS_63390 >Feature sequence330 1773 733 gene locus_tag LOCUS_63400 1773 733 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532176.1 protein_id gnl|my_center|LOCUS_63400 2577 1813 gene locus_tag LOCUS_63410 2577 1813 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532175.1 protein_id gnl|my_center|LOCUS_63410 >Feature sequence331 1567 1157 gene locus_tag LOCUS_63420 1567 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63420 1706 1554 gene locus_tag LOCUS_63430 1706 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63430 >Feature sequence332 <1 899 gene locus_tag LOCUS_63440 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528930.1:3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein note possible pseudo, frameshifted 773 782 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 829 1278 gene locus_tag LOCUS_63450 829 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63450 1263 2447 gene locus_tag LOCUS_63460 1263 2447 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528955.1 protein_id gnl|my_center|LOCUS_63460 >Feature sequence333 1361 1017 gene locus_tag LOCUS_63470 gene tnpB 1361 1017 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061711.1 protein_id gnl|my_center|LOCUS_63470 1600 1358 gene locus_tag LOCUS_63480 1600 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63480 >Feature sequence334 >Feature sequence335 480 145 gene locus_tag LOCUS_63490 480 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63490 286 295 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 727 1230 gene locus_tag LOCUS_63500 727 1230 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531863.1 protein_id gnl|my_center|LOCUS_63500 1969 1978 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence336 <1 628 gene locus_tag LOCUS_63510 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529784.1:MotB family protein >Feature sequence337 810 181 gene locus_tag LOCUS_63520 gene phnN 810 181 CDS product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170982.1 protein_id gnl|my_center|LOCUS_63520 1946 807 gene locus_tag LOCUS_63530 1946 807 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528377.1 protein_id gnl|my_center|LOCUS_63530 >Feature sequence338 412 421 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 787 1041 gene locus_tag LOCUS_63540 gene hemP 787 1041 CDS product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531240.1 protein_id gnl|my_center|LOCUS_63540 1078 2139 gene locus_tag LOCUS_63550 1078 2139 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531241.1 protein_id gnl|my_center|LOCUS_63550 >Feature sequence339 444 2072 gene locus_tag LOCUS_63560 444 2072 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529694.1 protein_id gnl|my_center|LOCUS_63560 >Feature sequence340 <1 1489 gene locus_tag LOCUS_63570 <1 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529406.1:TIGR02302 family protein 1518 1892 gene locus_tag LOCUS_63580 1518 1892 CDS product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529405.1 protein_id gnl|my_center|LOCUS_63580 >Feature sequence341 419 637 gene locus_tag LOCUS_63590 419 637 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530653.1 protein_id gnl|my_center|LOCUS_63590 1683 760 gene locus_tag LOCUS_63600 1683 760 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528834.1 protein_id gnl|my_center|LOCUS_63600 >Feature sequence342 <1 695 gene locus_tag LOCUS_63610 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532505.1:leucyl aminopeptidase 715 1164 gene locus_tag LOCUS_63620 715 1164 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532504.1 protein_id gnl|my_center|LOCUS_63620 >Feature sequence343 382 89 gene locus_tag LOCUS_63630 382 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63630 494 1360 gene locus_tag LOCUS_63640 494 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63640 1360 2160 gene locus_tag LOCUS_63650 gene istB 1360 2160 CDS product IS21-like element ISSme2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970475.1 protein_id gnl|my_center|LOCUS_63650 >Feature sequence344 <1 1076 gene locus_tag LOCUS_63660 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525285.1:serine/threonine-protein kinase 1088 1594 gene locus_tag LOCUS_63670 1088 1594 CDS product DUF1036 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504491.1 protein_id gnl|my_center|LOCUS_63670 >Feature sequence345 <1 1152 gene locus_tag LOCUS_63680 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_114715230.1:Xaa-Pro peptidase family protein 1211 1966 gene locus_tag LOCUS_63690 1211 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533431.1 protein_id gnl|my_center|LOCUS_63690 >Feature sequence346 1460 939 gene locus_tag LOCUS_63700 1460 939 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529160.1 protein_id gnl|my_center|LOCUS_63700 >Feature sequence347 1637 225 gene locus_tag LOCUS_63710 1637 225 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529010.1 protein_id gnl|my_center|LOCUS_63710 >Feature sequence348 <1840 1080 gene locus_tag LOCUS_63720 <1840 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531404.1:elongation factor Tu >Feature sequence349 <1 1028 gene locus_tag LOCUS_63730 <1 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528802.1:signal recognition particle protein 1036 1362 gene locus_tag LOCUS_63740 1036 1362 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528801.1 protein_id gnl|my_center|LOCUS_63740 1413 1814 gene locus_tag LOCUS_63750 gene rpsP 1413 1814 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528800.1 protein_id gnl|my_center|LOCUS_63750 >Feature sequence350 >Feature sequence351 799 128 gene locus_tag LOCUS_63760 799 128 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968360.1 protein_id gnl|my_center|LOCUS_63760 >Feature sequence352 1 267 gene locus_tag LOCUS_63770 1 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63770 264 1031 gene locus_tag LOCUS_63780 264 1031 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532982.1 protein_id gnl|my_center|LOCUS_63780 >Feature sequence353 349 11 gene locus_tag LOCUS_63790 349 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63790 <1727 349 gene locus_tag LOCUS_63800 <1727 349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530880.1:autotransporter assembly complex family protein >Feature sequence354 >Feature sequence355 157 1428 gene locus_tag LOCUS_63810 157 1428 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531223.1 protein_id gnl|my_center|LOCUS_63810 >Feature sequence356 2 217 gene locus_tag LOCUS_63820 2 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63820 279 743 gene locus_tag LOCUS_63830 gene ptsN 279 743 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529589.1 protein_id gnl|my_center|LOCUS_63830 1071 814 gene locus_tag LOCUS_63840 1071 814 CDS product DUF1150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529590.1 protein_id gnl|my_center|LOCUS_63840 1561 1136 gene locus_tag LOCUS_63850 1561 1136 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529591.1 protein_id gnl|my_center|LOCUS_63850 >Feature sequence357 808 1500 gene locus_tag LOCUS_63860 gene istB 808 1500 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967409.1 protein_id gnl|my_center|LOCUS_63860 >Feature sequence358 <1 562 gene locus_tag LOCUS_63870 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531121.1:adenosylcobinamide-phosphate synthase CbiB 1177 563 gene locus_tag LOCUS_63880 gene cobO 1177 563 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531120.1 protein_id gnl|my_center|LOCUS_63880 >Feature sequence359 379 1431 gene locus_tag LOCUS_63890 379 1431 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532920.1 protein_id gnl|my_center|LOCUS_63890 >Feature sequence360 485 144 gene locus_tag LOCUS_63900 485 144 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528978.1 protein_id gnl|my_center|LOCUS_63900 784 482 gene locus_tag LOCUS_63910 784 482 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528977.1 protein_id gnl|my_center|LOCUS_63910 926 1001 gene locus_tag LOCUS_t00500 926 1001 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence361 651 124 gene locus_tag LOCUS_63920 651 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63920 <1443 792 gene locus_tag LOCUS_63930 <1443 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530743.1:EAL domain-containing protein >Feature sequence362 >Feature sequence363 694 912 gene locus_tag LOCUS_63940 694 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63940 >Feature sequence364 <1380 161 gene locus_tag LOCUS_63950 <1380 161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941815.1:leukotoxin LktA family filamentous adhesin note possible pseudo, internal stop codon, frameshifted 238 247 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence365 744 523 gene locus_tag LOCUS_63960 744 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63960 >Feature sequence366 1240 389 gene locus_tag LOCUS_63970 1240 389 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529334.1 protein_id gnl|my_center|LOCUS_63970 >Feature sequence367 69 1259 gene locus_tag LOCUS_63980 69 1259 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112131468.1 protein_id gnl|my_center|LOCUS_63980 >Feature sequence368 >Feature sequence369 >Feature sequence370 >Feature sequence371 966 37 gene locus_tag LOCUS_63990 966 37 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095491983.1 protein_id gnl|my_center|LOCUS_63990 >Feature sequence372 >Feature sequence373 <1 890 gene locus_tag LOCUS_64000 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970433.1:MFS transporter note possible pseudo, frameshifted >Feature sequence374 <1 951 gene locus_tag LOCUS_64010 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529008.1:NAD-glutamate dehydrogenase >Feature sequence375 442 849 gene locus_tag LOCUS_64020 442 849 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532540.1 protein_id gnl|my_center|LOCUS_64020 >Feature sequence376 >Feature sequence377 >Feature sequence378 >Feature sequence379 >Feature sequence380 >Feature sequence381 >Feature sequence382 <859 225 gene locus_tag LOCUS_64030 <859 225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529718.1:glutamate synthase large subunit >Feature sequence383 <843 238 gene locus_tag LOCUS_64040 <843 238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530006.1:class I SAM-dependent methyltransferase >Feature sequence384 675 334 gene locus_tag LOCUS_64050 675 334 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529582.1 protein_id gnl|my_center|LOCUS_64050 >Feature sequence385 532 269 gene locus_tag LOCUS_64060 532 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64060 578 587 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence386 >Feature sequence387 456 546 gene locus_tag LOCUS_t00510 456 546 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence388 >Feature sequence389 >Feature sequence390 >Feature sequence391 >Feature sequence392 >Feature sequence393 >Feature sequence394 670 347 gene locus_tag LOCUS_64070 670 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64070 >Feature sequence395 >Feature sequence396 >Feature sequence397 >Feature sequence398 >Feature sequence399 >Feature sequence400 >Feature sequence401 >Feature sequence402 >Feature sequence403 >Feature sequence404 >Feature sequence405 >Feature sequence406 >Feature sequence407 >Feature sequence408 >Feature sequence409 >Feature sequence410 107 292 gene locus_tag LOCUS_64080 107 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_64080 >Feature sequence411 >Feature sequence412 >Feature sequence413 >Feature sequence414 >Feature sequence415 >Feature sequence416 >Feature sequence417 >Feature sequence418 >Feature sequence419 >Feature sequence420 >Feature sequence421 >Feature sequence422 >Feature sequence423 >Feature sequence424 >Feature sequence425 >Feature sequence426 >Feature sequence427 >Feature sequence428 >Feature sequence429 >Feature sequence430 >Feature sequence431 >Feature sequence432 >Feature sequence433 >Feature sequence434 >Feature sequence435 >Feature sequence436 >Feature sequence437 >Feature sequence438 >Feature sequence439 >Feature sequence440 >Feature sequence441 >Feature sequence442 >Feature sequence443 >Feature sequence444 >Feature sequence445 >Feature sequence446 >Feature sequence447