>Feature sequence001 17 6790 gene locus_tag LOCUS_00010 17 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 7327 6797 gene locus_tag LOCUS_00020 7327 6797 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_00020 7652 8002 gene locus_tag LOCUS_00030 7652 8002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 8168 8317 gene locus_tag LOCUS_00040 8168 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 8325 9416 gene locus_tag LOCUS_00050 8325 9416 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546088.1 protein_id gnl|my_center|LOCUS_00050 9817 10488 gene locus_tag LOCUS_00060 9817 10488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 10498 11127 gene locus_tag LOCUS_00070 10498 11127 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496597.1 protein_id gnl|my_center|LOCUS_00070 11233 12660 gene locus_tag LOCUS_00080 11233 12660 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016159.1 protein_id gnl|my_center|LOCUS_00080 13057 12737 gene locus_tag LOCUS_00090 13057 12737 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545882.1 protein_id gnl|my_center|LOCUS_00090 14005 13319 gene locus_tag LOCUS_00100 14005 13319 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066452.1 protein_id gnl|my_center|LOCUS_00100 14457 15155 gene locus_tag LOCUS_00110 14457 15155 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392941.1 protein_id gnl|my_center|LOCUS_00110 15175 15978 gene locus_tag LOCUS_00120 15175 15978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15962 17029 gene locus_tag LOCUS_00130 15962 17029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249113.1 protein_id gnl|my_center|LOCUS_00130 17053 18333 gene locus_tag LOCUS_00140 17053 18333 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023992.1 protein_id gnl|my_center|LOCUS_00140 18337 19140 gene locus_tag LOCUS_00150 18337 19140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19145 20263 gene locus_tag LOCUS_00160 19145 20263 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868536.1 protein_id gnl|my_center|LOCUS_00160 22126 20750 gene locus_tag LOCUS_00170 22126 20750 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660573.1 protein_id gnl|my_center|LOCUS_00170 <23594 22150 gene locus_tag LOCUS_00180 <23594 22150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249656.1:NADP-dependent glyceraldehyde-3-phosphate dehydrogenase >Feature sequence002 46 1410 gene locus_tag LOCUS_00190 46 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 1432 1716 gene locus_tag LOCUS_00200 1432 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 1976 2281 gene locus_tag LOCUS_00210 1976 2281 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_00210 2793 3017 gene locus_tag LOCUS_00220 2793 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 3300 3133 gene locus_tag LOCUS_00230 3300 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00230 3849 4457 gene locus_tag LOCUS_00240 3849 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 4450 5013 gene locus_tag LOCUS_00250 4450 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 5003 5281 gene locus_tag LOCUS_00260 5003 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 6533 5370 gene locus_tag LOCUS_00270 6533 5370 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065645.1 protein_id gnl|my_center|LOCUS_00270 7251 6559 gene locus_tag LOCUS_00280 7251 6559 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021673.1 protein_id gnl|my_center|LOCUS_00280 8410 7244 gene locus_tag LOCUS_00290 8410 7244 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022460.1 protein_id gnl|my_center|LOCUS_00290 9595 8432 gene locus_tag LOCUS_00300 9595 8432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065645.1 protein_id gnl|my_center|LOCUS_00300 10764 9601 gene locus_tag LOCUS_00310 10764 9601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022462.1 protein_id gnl|my_center|LOCUS_00310 11183 10764 gene locus_tag LOCUS_00320 11183 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 11652 13532 gene locus_tag LOCUS_00330 gene cooS 11652 13532 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272665.1 protein_id gnl|my_center|LOCUS_00330 14173 14382 gene locus_tag LOCUS_00340 14173 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 14383 15363 gene locus_tag LOCUS_00350 14383 15363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 15387 15680 gene locus_tag LOCUS_00360 15387 15680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 >Feature sequence003 <1 1832 gene locus_tag LOCUS_00370 <1 1832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065380.1:AAA family ATPase 2235 1918 gene locus_tag LOCUS_00380 2235 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 2392 3696 gene locus_tag LOCUS_00390 2392 3696 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023751.1 protein_id gnl|my_center|LOCUS_00390 3734 4171 gene locus_tag LOCUS_00400 3734 4171 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023752.1 protein_id gnl|my_center|LOCUS_00400 5201 4179 gene locus_tag LOCUS_00410 5201 4179 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545362.1 protein_id gnl|my_center|LOCUS_00410 5416 5222 gene locus_tag LOCUS_00420 5416 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 6203 5403 gene locus_tag LOCUS_00430 gene lsrF 6203 5403 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774178.1 protein_id gnl|my_center|LOCUS_00430 6472 7194 gene locus_tag LOCUS_00440 6472 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 7164 7802 gene locus_tag LOCUS_00450 7164 7802 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020593.1 protein_id gnl|my_center|LOCUS_00450 7929 9110 gene locus_tag LOCUS_00460 7929 9110 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023953.1 protein_id gnl|my_center|LOCUS_00460 9138 9548 gene locus_tag LOCUS_00470 9138 9548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 9457 9816 gene locus_tag LOCUS_00480 9457 9816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00480 10558 9866 gene locus_tag LOCUS_00490 gene aqpZ 10558 9866 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140371.1 protein_id gnl|my_center|LOCUS_00490 11003 11914 gene locus_tag LOCUS_00500 gene trxB 11003 11914 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_00500 11924 12559 gene locus_tag LOCUS_00510 gene nth 11924 12559 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546206.1 protein_id gnl|my_center|LOCUS_00510 12736 13368 gene locus_tag LOCUS_00520 12736 13368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 13381 13674 gene locus_tag LOCUS_00530 13381 13674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 13671 14048 gene locus_tag LOCUS_00540 13671 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 14055 14231 gene locus_tag LOCUS_00550 14055 14231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 14266 14715 gene locus_tag LOCUS_00560 gene nifU 14266 14715 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_00560 14729 15091 gene locus_tag LOCUS_00570 14729 15091 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065940.1 protein_id gnl|my_center|LOCUS_00570 15057 15191 gene locus_tag LOCUS_00580 15057 15191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 15416 16204 gene locus_tag LOCUS_00590 15416 16204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 >Feature sequence004 1024 257 gene locus_tag LOCUS_00600 1024 257 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496768.1 protein_id gnl|my_center|LOCUS_00600 1129 2670 gene locus_tag LOCUS_00610 gene lysS 1129 2670 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066108.1 protein_id gnl|my_center|LOCUS_00610 3403 2648 gene locus_tag LOCUS_00620 3403 2648 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065998.1 protein_id gnl|my_center|LOCUS_00620 3517 3601 gene locus_tag LOCUS_t00010 3517 3601 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3614 4204 gene locus_tag LOCUS_00630 3614 4204 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903191.1 protein_id gnl|my_center|LOCUS_00630 4456 4235 gene locus_tag LOCUS_00640 4456 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 5743 4640 gene locus_tag LOCUS_00650 5743 4640 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020134.1 protein_id gnl|my_center|LOCUS_00650 7878 5971 gene locus_tag LOCUS_00660 7878 5971 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024230.1 protein_id gnl|my_center|LOCUS_00660 11142 7918 gene locus_tag LOCUS_00670 11142 7918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 12038 11259 gene locus_tag LOCUS_00680 12038 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 12222 12587 gene locus_tag LOCUS_00690 12222 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 13726 12584 gene locus_tag LOCUS_00700 gene comE 13726 12584 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023231.1 protein_id gnl|my_center|LOCUS_00700 15462 13789 gene locus_tag LOCUS_00710 gene thsB 15462 13789 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 protein_id gnl|my_center|LOCUS_00710 15690 16052 gene locus_tag LOCUS_00720 15690 16052 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879695.1 protein_id gnl|my_center|LOCUS_00720 >Feature sequence005 996 1703 gene locus_tag LOCUS_00730 996 1703 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251230.1 protein_id gnl|my_center|LOCUS_00730 1802 2851 gene locus_tag LOCUS_00740 1802 2851 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_00740 2932 3177 gene locus_tag LOCUS_00750 2932 3177 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066211.1 protein_id gnl|my_center|LOCUS_00750 3208 3567 gene locus_tag LOCUS_00760 3208 3567 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021390.1 protein_id gnl|my_center|LOCUS_00760 3583 4476 gene locus_tag LOCUS_00770 3583 4476 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021391.1 protein_id gnl|my_center|LOCUS_00770 4473 4916 gene locus_tag LOCUS_00780 4473 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 4894 6021 gene locus_tag LOCUS_00790 4894 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 6627 6247 gene locus_tag LOCUS_00800 6627 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 8300 6630 gene locus_tag LOCUS_00810 gene ilvD 8300 6630 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021805.1 protein_id gnl|my_center|LOCUS_00810 9576 8563 gene locus_tag LOCUS_00820 gene fen 9576 8563 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023899.1 protein_id gnl|my_center|LOCUS_00820 9879 9586 gene locus_tag LOCUS_00830 9879 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023897.1 protein_id gnl|my_center|LOCUS_00830 10998 9937 gene locus_tag LOCUS_00840 10998 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 12113 10995 gene locus_tag LOCUS_00850 12113 10995 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496660.1 protein_id gnl|my_center|LOCUS_00850 12543 12127 gene locus_tag LOCUS_00860 12543 12127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 12718 13359 gene locus_tag LOCUS_00870 12718 13359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 <15084 13565 gene locus_tag LOCUS_00880 <15084 13565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065884.1:methionine--tRNA ligase >Feature sequence006 1379 675 gene locus_tag LOCUS_00890 1379 675 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546873.1 protein_id gnl|my_center|LOCUS_00890 2167 1436 gene locus_tag LOCUS_00900 2167 1436 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436912.1 protein_id gnl|my_center|LOCUS_00900 2620 2766 gene locus_tag LOCUS_00910 2620 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 3051 3659 gene locus_tag LOCUS_00920 3051 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 3656 3916 gene locus_tag LOCUS_00930 3656 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 4001 4927 gene locus_tag LOCUS_00940 4001 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 5041 5928 gene locus_tag LOCUS_00950 gene rhuM 5041 5928 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648596.1 protein_id gnl|my_center|LOCUS_00950 6064 7320 gene locus_tag LOCUS_00960 6064 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 7310 7729 gene locus_tag LOCUS_00970 7310 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 7878 8639 gene locus_tag LOCUS_00980 7878 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 8626 9645 gene locus_tag LOCUS_00990 8626 9645 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064796.1 protein_id gnl|my_center|LOCUS_00990 9632 9898 gene locus_tag LOCUS_01000 9632 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 10469 9858 gene locus_tag LOCUS_01010 10469 9858 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064573.1 protein_id gnl|my_center|LOCUS_01010 12216 10474 gene locus_tag LOCUS_01020 gene glyS 12216 10474 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020156.1 protein_id gnl|my_center|LOCUS_01020 13016 12240 gene locus_tag LOCUS_01030 13016 12240 CDS product NrpR regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020866.1 protein_id gnl|my_center|LOCUS_01030 13172 14245 gene locus_tag LOCUS_01040 13172 14245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 >Feature sequence007 1106 1957 gene locus_tag LOCUS_01050 1106 1957 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876243.1 protein_id gnl|my_center|LOCUS_01050 1960 2712 gene locus_tag LOCUS_01060 1960 2712 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_01060 2723 3523 gene locus_tag LOCUS_01070 2723 3523 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_01070 4083 4238 gene locus_tag LOCUS_01080 4083 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 5621 4197 gene locus_tag LOCUS_01090 5621 4197 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088854992.1 protein_id gnl|my_center|LOCUS_01090 5858 6061 gene locus_tag LOCUS_01100 5858 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065699.1 protein_id gnl|my_center|LOCUS_01100 6068 6277 gene locus_tag LOCUS_01110 6068 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 6310 8175 gene locus_tag LOCUS_01120 6310 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 8373 8182 gene locus_tag LOCUS_01130 8373 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 8562 9431 gene locus_tag LOCUS_01140 8562 9431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 9428 9709 gene locus_tag LOCUS_01150 gene gatC 9428 9709 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024398.1 protein_id gnl|my_center|LOCUS_01150 9719 11143 gene locus_tag LOCUS_01160 gene gatA 9719 11143 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066007.1 protein_id gnl|my_center|LOCUS_01160 11144 12598 gene locus_tag LOCUS_01170 gene gatB 11144 12598 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024400.1 protein_id gnl|my_center|LOCUS_01170 12688 12867 gene locus_tag LOCUS_01180 12688 12867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 13245 13042 gene locus_tag LOCUS_01190 13245 13042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 14329 13805 gene locus_tag LOCUS_01200 14329 13805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 >Feature sequence008 2084 261 gene locus_tag LOCUS_01210 gene glmS 2084 261 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022962.1 protein_id gnl|my_center|LOCUS_01210 3313 2105 gene locus_tag LOCUS_01220 3313 2105 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022961.1 protein_id gnl|my_center|LOCUS_01220 3359 3772 gene locus_tag LOCUS_01230 3359 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01230 3797 4816 gene locus_tag LOCUS_01240 3797 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01240 4904 4831 gene locus_tag LOCUS_t00020 4904 4831 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5106 7352 gene locus_tag LOCUS_01250 5106 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 7463 8077 gene locus_tag LOCUS_01260 7463 8077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 8186 9022 gene locus_tag LOCUS_01270 8186 9022 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024124.1 protein_id gnl|my_center|LOCUS_01270 9019 9876 gene locus_tag LOCUS_01280 9019 9876 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024123.1 protein_id gnl|my_center|LOCUS_01280 10834 9968 gene locus_tag LOCUS_01290 10834 9968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 12564 11419 gene locus_tag LOCUS_01300 12564 11419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 13472 12579 gene locus_tag LOCUS_01310 13472 12579 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_01310 <14265 13520 gene locus_tag LOCUS_01320 <14265 13520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840078.1:glycosyltransferase family 4 protein >Feature sequence009 273 187 gene locus_tag LOCUS_t00030 273 187 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1092 289 gene locus_tag LOCUS_01330 1092 289 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879771.1 protein_id gnl|my_center|LOCUS_01330 1482 1093 gene locus_tag LOCUS_01340 1482 1093 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021138.1 protein_id gnl|my_center|LOCUS_01340 2101 1502 gene locus_tag LOCUS_01350 2101 1502 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021137.1 protein_id gnl|my_center|LOCUS_01350 2585 2115 gene locus_tag LOCUS_01360 2585 2115 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066175.1 protein_id gnl|my_center|LOCUS_01360 3106 2861 gene locus_tag LOCUS_01370 3106 2861 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020716.1 protein_id gnl|my_center|LOCUS_01370 3287 4273 gene locus_tag LOCUS_01380 gene thiL 3287 4273 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066048.1 protein_id gnl|my_center|LOCUS_01380 4287 5339 gene locus_tag LOCUS_01390 4287 5339 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024418.1 protein_id gnl|my_center|LOCUS_01390 5484 6146 gene locus_tag LOCUS_01400 5484 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 6493 6278 gene locus_tag LOCUS_01410 6493 6278 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146889.1 protein_id gnl|my_center|LOCUS_01410 7212 6502 gene locus_tag LOCUS_01420 7212 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 8441 7209 gene locus_tag LOCUS_01430 8441 7209 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942363.1 protein_id gnl|my_center|LOCUS_01430 9273 8452 gene locus_tag LOCUS_01440 9273 8452 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722817.1 protein_id gnl|my_center|LOCUS_01440 10096 9293 gene locus_tag LOCUS_01450 10096 9293 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942362.1 protein_id gnl|my_center|LOCUS_01450 10323 10111 gene locus_tag LOCUS_01460 10323 10111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 10617 13118 gene locus_tag LOCUS_01470 gene gyrA 10617 13118 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_01470 >Feature sequence010 151 405 gene locus_tag LOCUS_01480 151 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 353 2305 gene locus_tag LOCUS_01490 353 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 4114 2672 gene locus_tag LOCUS_01500 4114 2672 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990577.1 protein_id gnl|my_center|LOCUS_01500 4552 4346 gene locus_tag LOCUS_01510 4552 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 4772 5137 gene locus_tag LOCUS_01520 4772 5137 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064921.1 protein_id gnl|my_center|LOCUS_01520 5149 5568 gene locus_tag LOCUS_01530 5149 5568 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020645.1 protein_id gnl|my_center|LOCUS_01530 5584 5988 gene locus_tag LOCUS_01540 5584 5988 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020646.1 protein_id gnl|my_center|LOCUS_01540 5999 6187 gene locus_tag LOCUS_01550 5999 6187 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020647.1 protein_id gnl|my_center|LOCUS_01550 6191 6265 gene locus_tag LOCUS_t00040 6191 6265 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6307 6489 gene locus_tag LOCUS_01560 6307 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 6533 7153 gene locus_tag LOCUS_01570 gene rpsB 6533 7153 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020649.1 protein_id gnl|my_center|LOCUS_01570 7181 7978 gene locus_tag LOCUS_01580 7181 7978 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 protein_id gnl|my_center|LOCUS_01580 7991 8887 gene locus_tag LOCUS_01590 7991 8887 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064922.1 protein_id gnl|my_center|LOCUS_01590 8884 9651 gene locus_tag LOCUS_01600 8884 9651 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020652.1 protein_id gnl|my_center|LOCUS_01600 9710 10819 gene locus_tag LOCUS_01610 gene fni 9710 10819 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020653.1 protein_id gnl|my_center|LOCUS_01610 10848 12188 gene locus_tag LOCUS_01620 10848 12188 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020654.1 protein_id gnl|my_center|LOCUS_01620 >Feature sequence011 <1 526 gene locus_tag LOCUS_01630 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_202319494.1:acetate--CoA ligase 1125 838 gene locus_tag LOCUS_01640 1125 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 2428 2661 gene locus_tag LOCUS_01650 2428 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 3681 2944 gene locus_tag LOCUS_01660 3681 2944 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_01660 3941 3678 gene locus_tag LOCUS_01670 3941 3678 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020862.1 protein_id gnl|my_center|LOCUS_01670 4720 4160 gene locus_tag LOCUS_01680 4720 4160 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061000.1 protein_id gnl|my_center|LOCUS_01680 5060 4791 gene locus_tag LOCUS_01690 gene albA 5060 4791 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878567.1 protein_id gnl|my_center|LOCUS_01690 5800 5153 gene locus_tag LOCUS_01700 5800 5153 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249420.1 protein_id gnl|my_center|LOCUS_01700 6345 5797 gene locus_tag LOCUS_01710 6345 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01710 7163 6351 gene locus_tag LOCUS_01720 7163 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01720 8279 7170 gene locus_tag LOCUS_01730 8279 7170 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 protein_id gnl|my_center|LOCUS_01730 8529 9122 gene locus_tag LOCUS_01740 8529 9122 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024506.1 protein_id gnl|my_center|LOCUS_01740 10066 9194 gene locus_tag LOCUS_01750 10066 9194 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024160.1 protein_id gnl|my_center|LOCUS_01750 10999 10205 gene locus_tag LOCUS_01760 10999 10205 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061277.1 protein_id gnl|my_center|LOCUS_01760 12002 11001 gene locus_tag LOCUS_01770 12002 11001 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066146.1 protein_id gnl|my_center|LOCUS_01770 >Feature sequence012 820 1728 gene locus_tag LOCUS_01780 gene cmr4 820 1728 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546538.1 protein_id gnl|my_center|LOCUS_01780 1715 2065 gene locus_tag LOCUS_01790 1715 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546344.1 protein_id gnl|my_center|LOCUS_01790 2076 3011 gene locus_tag LOCUS_01800 2076 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875962.1 protein_id gnl|my_center|LOCUS_01800 3231 4169 gene locus_tag LOCUS_01810 gene cas6 3231 4169 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_01810 4480 4632 gene locus_tag LOCUS_01820 4480 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 4638 5120 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgtaaaagagtagacccgtttataggggattgaaac 6181 8007 gene locus_tag LOCUS_01830 6181 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 8042 9031 gene locus_tag LOCUS_01840 gene cas1 8042 9031 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_01840 9035 9307 gene locus_tag LOCUS_01850 gene cas2 9035 9307 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259224.1 protein_id gnl|my_center|LOCUS_01850 9627 10400 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgtaaaagagtagacccgtttataggggattgaaac 10501 10824 gene locus_tag LOCUS_01860 10501 10824 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667001.1 protein_id gnl|my_center|LOCUS_01860 10808 11155 gene locus_tag LOCUS_01870 10808 11155 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869620.1 protein_id gnl|my_center|LOCUS_01870 11514 12164 gene locus_tag LOCUS_01880 11514 12164 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867364.1 protein_id gnl|my_center|LOCUS_01880 >Feature sequence013 730 1590 gene locus_tag LOCUS_01890 730 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 2686 2099 gene locus_tag LOCUS_01900 2686 2099 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021470.1 protein_id gnl|my_center|LOCUS_01900 3506 2697 gene locus_tag LOCUS_01910 gene proC 3506 2697 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_01910 5395 3512 gene locus_tag LOCUS_01920 gene for 5395 3512 CDS product tungsten-containing formaldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868317.1 protein_id gnl|my_center|LOCUS_01920 5939 5385 gene locus_tag LOCUS_01930 5939 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 7314 6118 gene locus_tag LOCUS_01940 7314 6118 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_01940 7385 8635 gene locus_tag LOCUS_01950 7385 8635 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 protein_id gnl|my_center|LOCUS_01950 9210 8632 gene locus_tag LOCUS_01960 9210 8632 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879461.1 protein_id gnl|my_center|LOCUS_01960 10504 9266 gene locus_tag LOCUS_01970 10504 9266 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289167.1 protein_id gnl|my_center|LOCUS_01970 10724 11491 gene locus_tag LOCUS_01980 10724 11491 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064392.1 protein_id gnl|my_center|LOCUS_01980 >Feature sequence014 60 69 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4134 613 gene locus_tag LOCUS_01990 gene smc 4134 613 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024214.1 protein_id gnl|my_center|LOCUS_01990 4732 4190 gene locus_tag LOCUS_02000 4732 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 6111 4804 gene locus_tag LOCUS_02010 gene aspS 6111 4804 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021688.1 protein_id gnl|my_center|LOCUS_02010 6279 7190 gene locus_tag LOCUS_02020 6279 7190 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_02020 8327 7236 gene locus_tag LOCUS_02030 8327 7236 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_02030 9068 8349 gene locus_tag LOCUS_02040 9068 8349 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_02040 9178 9744 gene locus_tag LOCUS_02050 9178 9744 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903666.1 protein_id gnl|my_center|LOCUS_02050 9780 10598 gene locus_tag LOCUS_02060 9780 10598 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024147.1 protein_id gnl|my_center|LOCUS_02060 >Feature sequence015 118 3618 gene locus_tag LOCUS_02070 118 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 3779 4015 gene locus_tag LOCUS_02080 3779 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 4085 4831 gene locus_tag LOCUS_02090 4085 4831 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_02090 4842 6941 gene locus_tag LOCUS_02100 gene glmA 4842 6941 CDS product exo-beta-D-glucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868123.1 protein_id gnl|my_center|LOCUS_02100 6944 7759 gene locus_tag LOCUS_02110 6944 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 7749 8822 gene locus_tag LOCUS_02120 gene argC 7749 8822 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065747.1 protein_id gnl|my_center|LOCUS_02120 8835 9329 gene locus_tag LOCUS_02130 8835 9329 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065746.1 protein_id gnl|my_center|LOCUS_02130 9330 10499 gene locus_tag LOCUS_02140 gene argJ 9330 10499 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023478.1 protein_id gnl|my_center|LOCUS_02140 >Feature sequence016 244 456 gene locus_tag LOCUS_02150 244 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 523 696 gene locus_tag LOCUS_02160 523 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 1516 2868 gene locus_tag LOCUS_02170 1516 2868 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024504.1 protein_id gnl|my_center|LOCUS_02170 2870 3865 gene locus_tag LOCUS_02180 gene rtcA 2870 3865 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024505.1 protein_id gnl|my_center|LOCUS_02180 4436 3867 gene locus_tag LOCUS_02190 4436 3867 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024463.1 protein_id gnl|my_center|LOCUS_02190 5777 4599 gene locus_tag LOCUS_02200 5777 4599 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024300.1 protein_id gnl|my_center|LOCUS_02200 6755 5802 gene locus_tag LOCUS_02210 6755 5802 CDS product UbiA prenyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065984.1 protein_id gnl|my_center|LOCUS_02210 7339 6767 gene locus_tag LOCUS_02220 7339 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 7467 7697 gene locus_tag LOCUS_02230 7467 7697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022956.1 protein_id gnl|my_center|LOCUS_02230 9014 7842 gene locus_tag LOCUS_02240 gene thiI 9014 7842 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021480.1 protein_id gnl|my_center|LOCUS_02240 10663 9011 gene locus_tag LOCUS_02250 10663 9011 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020198.1 protein_id gnl|my_center|LOCUS_02250 <11524 10660 gene locus_tag LOCUS_02260 <11524 10660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020197.1:protein translocase subunit SecF >Feature sequence017 489 1877 gene locus_tag LOCUS_02270 489 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022672.1 protein_id gnl|my_center|LOCUS_02270 1864 3663 gene locus_tag LOCUS_02280 1864 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 4198 3725 gene locus_tag LOCUS_02290 4198 3725 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786607.1 protein_id gnl|my_center|LOCUS_02290 6693 4354 gene locus_tag LOCUS_02300 gene hdrA2 6693 4354 CDS product CoB-CoM heterodisulfide reductase HdrA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022820.1 protein_id gnl|my_center|LOCUS_02300 6965 11062 gene locus_tag LOCUS_02310 6965 11062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 11031 11046 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence018 1534 494 gene locus_tag LOCUS_02320 1534 494 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021093.1 protein_id gnl|my_center|LOCUS_02320 2712 1531 gene locus_tag LOCUS_02330 gene rfbE 2712 1531 CDS product GDP-perosamine synthase RfbE/PerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875215.1 protein_id gnl|my_center|LOCUS_02330 3398 2712 gene locus_tag LOCUS_02340 3398 2712 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_02340 4612 3434 gene locus_tag LOCUS_02350 4612 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 5185 4628 gene locus_tag LOCUS_02360 5185 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 5647 5189 gene locus_tag LOCUS_02370 5647 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 6341 5658 gene locus_tag LOCUS_02380 6341 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 6490 7920 gene locus_tag LOCUS_02390 6490 7920 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141779.1 protein_id gnl|my_center|LOCUS_02390 8039 8887 gene locus_tag LOCUS_02400 8039 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 9084 8884 gene locus_tag LOCUS_02410 9084 8884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 9869 9081 gene locus_tag LOCUS_02420 gene htpX 9869 9081 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942212.1 protein_id gnl|my_center|LOCUS_02420 >Feature sequence019 322 1437 gene locus_tag LOCUS_02430 322 1437 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021402.1 protein_id gnl|my_center|LOCUS_02430 1442 2251 gene locus_tag LOCUS_02440 1442 2251 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020335.1 protein_id gnl|my_center|LOCUS_02440 3315 2281 gene locus_tag LOCUS_02450 3315 2281 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022056.1 protein_id gnl|my_center|LOCUS_02450 4368 3319 gene locus_tag LOCUS_02460 4368 3319 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023765.1 protein_id gnl|my_center|LOCUS_02460 5208 4765 gene locus_tag LOCUS_02470 5208 4765 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262609.1 protein_id gnl|my_center|LOCUS_02470 5503 7218 gene locus_tag LOCUS_02480 5503 7218 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022420.1 protein_id gnl|my_center|LOCUS_02480 7291 7641 gene locus_tag LOCUS_02490 7291 7641 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020176.1 protein_id gnl|my_center|LOCUS_02490 7702 8469 gene locus_tag LOCUS_02500 7702 8469 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020568.1 protein_id gnl|my_center|LOCUS_02500 8859 8671 gene locus_tag LOCUS_02510 8859 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 9343 8966 gene locus_tag LOCUS_02520 9343 8966 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065599.1 protein_id gnl|my_center|LOCUS_02520 9616 9386 gene locus_tag LOCUS_02530 9616 9386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 9746 10099 gene locus_tag LOCUS_02540 9746 10099 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064993.1 protein_id gnl|my_center|LOCUS_02540 11467 10169 gene locus_tag LOCUS_02550 gene aroA 11467 10169 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024417.1 protein_id gnl|my_center|LOCUS_02550 >Feature sequence020 2 817 gene locus_tag LOCUS_02560 2 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 837 1655 gene locus_tag LOCUS_02570 837 1655 CDS product DUF5803 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990720.1 protein_id gnl|my_center|LOCUS_02570 2388 1648 gene locus_tag LOCUS_02580 2388 1648 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023957.1 protein_id gnl|my_center|LOCUS_02580 2930 2385 gene locus_tag LOCUS_02590 2930 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02590 3661 2927 gene locus_tag LOCUS_02600 3661 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02600 4127 3849 gene locus_tag LOCUS_02610 4127 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 4352 5086 gene locus_tag LOCUS_02620 4352 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 5155 5403 gene locus_tag LOCUS_02630 5155 5403 CDS product Sm protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021429.1 protein_id gnl|my_center|LOCUS_02630 5427 5765 gene locus_tag LOCUS_02640 5427 5765 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589516.1 protein_id gnl|my_center|LOCUS_02640 6340 5834 gene locus_tag LOCUS_02650 6340 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 7756 6368 gene locus_tag LOCUS_02660 7756 6368 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065684.1 protein_id gnl|my_center|LOCUS_02660 8063 7800 gene locus_tag LOCUS_02670 8063 7800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 8116 9054 gene locus_tag LOCUS_02680 8116 9054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 9415 9627 gene locus_tag LOCUS_02690 9415 9627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 9620 9877 gene locus_tag LOCUS_02700 9620 9877 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021287.1 protein_id gnl|my_center|LOCUS_02700 >Feature sequence021 620 1168 gene locus_tag LOCUS_02710 620 1168 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023634.1 protein_id gnl|my_center|LOCUS_02710 1165 1794 gene locus_tag LOCUS_02720 1165 1794 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020322.1 protein_id gnl|my_center|LOCUS_02720 2605 1799 gene locus_tag LOCUS_02730 2605 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 5245 2894 gene locus_tag LOCUS_02740 gene nrdD 5245 2894 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020131.1 protein_id gnl|my_center|LOCUS_02740 5527 5252 gene locus_tag LOCUS_02750 5527 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 7047 5815 gene locus_tag LOCUS_02760 7047 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 7557 9248 gene locus_tag LOCUS_02770 7557 9248 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990592.1 protein_id gnl|my_center|LOCUS_02770 9860 10027 gene locus_tag LOCUS_02780 9860 10027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 <11316 10350 gene locus_tag LOCUS_02790 <11316 10350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023772.1:cell division protein FtsZ >Feature sequence022 547 1614 gene locus_tag LOCUS_02800 547 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 1618 2127 gene locus_tag LOCUS_02810 1618 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02810 2167 2514 gene locus_tag LOCUS_02820 2167 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02820 2516 3232 gene locus_tag LOCUS_02830 2516 3232 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_02830 3387 4544 gene locus_tag LOCUS_02840 3387 4544 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065191.1 protein_id gnl|my_center|LOCUS_02840 4631 5368 gene locus_tag LOCUS_02850 4631 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 5447 5791 gene locus_tag LOCUS_02860 gene eif1A 5447 5791 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064992.1 protein_id gnl|my_center|LOCUS_02860 5798 6613 gene locus_tag LOCUS_02870 5798 6613 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_02870 6649 7185 gene locus_tag LOCUS_02880 6649 7185 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020937.1 protein_id gnl|my_center|LOCUS_02880 8470 7241 gene locus_tag LOCUS_02890 8470 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 9709 8501 gene locus_tag LOCUS_02900 9709 8501 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_02900 <11289 9747 gene locus_tag LOCUS_02910 <11289 9747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021173.1:PAS domain S-box protein >Feature sequence023 120 1127 gene locus_tag LOCUS_02920 120 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 1228 1686 gene locus_tag LOCUS_02930 1228 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 1696 2304 gene locus_tag LOCUS_02940 gene cbiM 1696 2304 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_02940 2311 3096 gene locus_tag LOCUS_02950 gene cbiQ 2311 3096 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545677.1 protein_id gnl|my_center|LOCUS_02950 3234 4028 gene locus_tag LOCUS_02960 3234 4028 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877312.1 protein_id gnl|my_center|LOCUS_02960 5008 4046 gene locus_tag LOCUS_02970 5008 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 5290 5748 gene locus_tag LOCUS_02980 gene ahbB 5290 5748 CDS product siroheme decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064915.1 protein_id gnl|my_center|LOCUS_02980 5745 6407 gene locus_tag LOCUS_02990 5745 6407 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020625.1 protein_id gnl|my_center|LOCUS_02990 6482 8431 gene locus_tag LOCUS_03000 6482 8431 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021871.1 protein_id gnl|my_center|LOCUS_03000 8446 9741 gene locus_tag LOCUS_03010 gene hemA 8446 9741 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020626.1 protein_id gnl|my_center|LOCUS_03010 9760 10740 gene locus_tag LOCUS_03020 gene hemB 9760 10740 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020627.1 protein_id gnl|my_center|LOCUS_03020 >Feature sequence024 849 3452 gene locus_tag LOCUS_03030 gene clpB 849 3452 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_03030 3720 4412 gene locus_tag LOCUS_03040 3720 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 4737 4489 gene locus_tag LOCUS_03050 4737 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 5096 4881 gene locus_tag LOCUS_03060 5096 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 5343 5089 gene locus_tag LOCUS_03070 5343 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 6057 5683 gene locus_tag LOCUS_03080 6057 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 6352 7143 gene locus_tag LOCUS_03090 gene surE 6352 7143 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 protein_id gnl|my_center|LOCUS_03090 7262 8344 gene locus_tag LOCUS_03100 7262 8344 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065833.1 protein_id gnl|my_center|LOCUS_03100 8368 8640 gene locus_tag LOCUS_03110 8368 8640 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023978.1 protein_id gnl|my_center|LOCUS_03110 8651 9838 gene locus_tag LOCUS_03120 8651 9838 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023979.1 protein_id gnl|my_center|LOCUS_03120 10004 9825 gene locus_tag LOCUS_03130 10004 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 <11135 10408 gene locus_tag LOCUS_03140 <11135 10408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence025 120 1400 gene locus_tag LOCUS_03150 120 1400 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860184.1 protein_id gnl|my_center|LOCUS_03150 1659 1486 gene locus_tag LOCUS_03160 1659 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 3044 3472 gene locus_tag LOCUS_03170 3044 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 4908 3730 gene locus_tag LOCUS_03180 4908 3730 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021091.1 protein_id gnl|my_center|LOCUS_03180 5795 5178 gene locus_tag LOCUS_03190 5795 5178 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975594.1 protein_id gnl|my_center|LOCUS_03190 6847 5792 gene locus_tag LOCUS_03200 6847 5792 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963414.1 protein_id gnl|my_center|LOCUS_03200 7464 6835 gene locus_tag LOCUS_03210 7464 6835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 8540 7461 gene locus_tag LOCUS_03220 8540 7461 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024333.1 protein_id gnl|my_center|LOCUS_03220 8977 8540 gene locus_tag LOCUS_03230 8977 8540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 10049 9024 gene locus_tag LOCUS_03240 10049 9024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 10816 10046 gene locus_tag LOCUS_03250 10816 10046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 >Feature sequence026 84 761 gene locus_tag LOCUS_03260 gene fdnI 84 761 CDS product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045648.1 protein_id gnl|my_center|LOCUS_03260 754 999 gene locus_tag LOCUS_03270 754 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 1018 2448 gene locus_tag LOCUS_03280 1018 2448 CDS product methanogenesis multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064939.1 protein_id gnl|my_center|LOCUS_03280 2445 3779 gene locus_tag LOCUS_03290 2445 3779 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860093.1 protein_id gnl|my_center|LOCUS_03290 3776 4636 gene locus_tag LOCUS_03300 3776 4636 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020707.1 protein_id gnl|my_center|LOCUS_03300 4633 5166 gene locus_tag LOCUS_03310 4633 5166 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020708.1 protein_id gnl|my_center|LOCUS_03310 5187 5807 gene locus_tag LOCUS_03320 5187 5807 CDS product RnfABCDGE type electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064940.1 protein_id gnl|my_center|LOCUS_03320 5811 6395 gene locus_tag LOCUS_03330 5811 6395 CDS product electron transport complex protein RnfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064941.1 protein_id gnl|my_center|LOCUS_03330 6392 7213 gene locus_tag LOCUS_03340 6392 7213 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020711.1 protein_id gnl|my_center|LOCUS_03340 7242 7886 gene locus_tag LOCUS_03350 7242 7886 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020502.1 protein_id gnl|my_center|LOCUS_03350 9352 7874 gene locus_tag LOCUS_03360 9352 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 9507 10430 gene locus_tag LOCUS_03370 9507 10430 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904059.1 protein_id gnl|my_center|LOCUS_03370 >Feature sequence027 2206 383 gene locus_tag LOCUS_03380 2206 383 CDS product cytochrome c-type biogenesis CcmF C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938349.1 protein_id gnl|my_center|LOCUS_03380 8733 2260 gene locus_tag LOCUS_03390 8733 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 9740 8730 gene locus_tag LOCUS_03400 9740 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 10300 9737 gene locus_tag LOCUS_03410 10300 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 >Feature sequence028 1342 371 gene locus_tag LOCUS_03420 1342 371 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878013.1 protein_id gnl|my_center|LOCUS_03420 1855 1706 gene locus_tag LOCUS_03430 1855 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 2397 2324 gene locus_tag LOCUS_t00050 2397 2324 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3267 2605 gene locus_tag LOCUS_03440 3267 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 3789 7523 gene locus_tag LOCUS_03450 3789 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 7875 9146 gene locus_tag LOCUS_03460 7875 9146 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147032.1 protein_id gnl|my_center|LOCUS_03460 9514 9143 gene locus_tag LOCUS_03470 9514 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 >Feature sequence029 <1 768 gene locus_tag LOCUS_03480 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065228.1:alanine--glyoxylate aminotransferase family protein 799 1263 gene locus_tag LOCUS_03490 gene ribC 799 1263 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021819.1 protein_id gnl|my_center|LOCUS_03490 1319 1729 gene locus_tag LOCUS_03500 gene ribH 1319 1729 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021820.1 protein_id gnl|my_center|LOCUS_03500 1770 2912 gene locus_tag LOCUS_03510 1770 2912 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021821.1 protein_id gnl|my_center|LOCUS_03510 3043 4107 gene locus_tag LOCUS_03520 3043 4107 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024205.1 protein_id gnl|my_center|LOCUS_03520 4206 4403 gene locus_tag LOCUS_03530 4206 4403 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879289.1 protein_id gnl|my_center|LOCUS_03530 5663 4545 gene locus_tag LOCUS_03540 5663 4545 CDS product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546631.1 protein_id gnl|my_center|LOCUS_03540 6011 5694 gene locus_tag LOCUS_03550 6011 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 6063 6653 gene locus_tag LOCUS_03560 gene pdxT 6063 6653 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021577.1 protein_id gnl|my_center|LOCUS_03560 7450 6800 gene locus_tag LOCUS_03570 7450 6800 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_03570 <10227 7465 gene locus_tag LOCUS_03580 <10227 7465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064990.1:DNA-directed DNA polymerase >Feature sequence030 <1 761 gene locus_tag LOCUS_03590 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065858.1:COG1361 S-layer family protein 788 2002 gene locus_tag LOCUS_03600 788 2002 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020498.1 protein_id gnl|my_center|LOCUS_03600 2087 3241 gene locus_tag LOCUS_03610 2087 3241 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020498.1 protein_id gnl|my_center|LOCUS_03610 3247 4125 gene locus_tag LOCUS_03620 3247 4125 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023395.1 protein_id gnl|my_center|LOCUS_03620 4476 6587 gene locus_tag LOCUS_03630 4476 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 6599 7219 gene locus_tag LOCUS_03640 6599 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 7194 7367 gene locus_tag LOCUS_03650 7194 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence031 418 969 gene locus_tag LOCUS_03660 418 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 1251 1874 gene locus_tag LOCUS_03670 1251 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 3382 1925 gene locus_tag LOCUS_03680 3382 1925 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_03680 4923 3466 gene locus_tag LOCUS_03690 4923 3466 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_03690 6267 4936 gene locus_tag LOCUS_03700 gene trkA 6267 4936 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021494.1 protein_id gnl|my_center|LOCUS_03700 7893 6472 gene locus_tag LOCUS_03710 gene glmM 7893 6472 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065480.1 protein_id gnl|my_center|LOCUS_03710 8707 7877 gene locus_tag LOCUS_03720 8707 7877 CDS product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065273.1 protein_id gnl|my_center|LOCUS_03720 8816 9508 gene locus_tag LOCUS_03730 8816 9508 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064504.1 protein_id gnl|my_center|LOCUS_03730 9891 9526 gene locus_tag LOCUS_03740 9891 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 >Feature sequence032 615 2123 gene locus_tag LOCUS_03750 615 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 2101 2508 gene locus_tag LOCUS_03760 2101 2508 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866321.1 protein_id gnl|my_center|LOCUS_03760 2510 3775 gene locus_tag LOCUS_03770 2510 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 4051 4710 gene locus_tag LOCUS_03780 4051 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 5142 4963 gene locus_tag LOCUS_03790 5142 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 6140 5907 gene locus_tag LOCUS_03800 6140 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 6550 6708 gene locus_tag LOCUS_03810 6550 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 6726 6914 gene locus_tag LOCUS_03820 6726 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 7468 7289 gene locus_tag LOCUS_03830 7468 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 7702 7857 gene locus_tag LOCUS_03840 7702 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 7883 9265 gene locus_tag LOCUS_03850 7883 9265 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249095.1 protein_id gnl|my_center|LOCUS_03850 9571 9702 gene locus_tag LOCUS_03860 9571 9702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 >Feature sequence033 58 333 gene locus_tag LOCUS_03870 58 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 296 1426 gene locus_tag LOCUS_03880 296 1426 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942114.1 protein_id gnl|my_center|LOCUS_03880 1423 2256 gene locus_tag LOCUS_03890 1423 2256 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939232.1 protein_id gnl|my_center|LOCUS_03890 2253 2810 gene locus_tag LOCUS_03900 2253 2810 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_03900 3588 2821 gene locus_tag LOCUS_03910 3588 2821 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 protein_id gnl|my_center|LOCUS_03910 4568 3771 gene locus_tag LOCUS_03920 4568 3771 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 protein_id gnl|my_center|LOCUS_03920 4756 4577 gene locus_tag LOCUS_03930 4756 4577 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020692.1 protein_id gnl|my_center|LOCUS_03930 5787 5050 gene locus_tag LOCUS_03940 5787 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064936.1 protein_id gnl|my_center|LOCUS_03940 6845 5784 gene locus_tag LOCUS_03950 gene priS 6845 5784 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020695.1 protein_id gnl|my_center|LOCUS_03950 6979 7260 gene locus_tag LOCUS_03960 6979 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 7223 8698 gene locus_tag LOCUS_03970 7223 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 >Feature sequence034 2357 1488 gene locus_tag LOCUS_03980 2357 1488 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023430.1 protein_id gnl|my_center|LOCUS_03980 2979 2359 gene locus_tag LOCUS_03990 2979 2359 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023431.1 protein_id gnl|my_center|LOCUS_03990 3750 3001 gene locus_tag LOCUS_04000 3750 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04000 4705 3851 gene locus_tag LOCUS_04010 4705 3851 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023435.1 protein_id gnl|my_center|LOCUS_04010 5951 4716 gene locus_tag LOCUS_04020 gene glyA 5951 4716 CDS product bifunctional serine hydroxymethyltransferase/L-allo-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023436.1 protein_id gnl|my_center|LOCUS_04020 6107 6343 gene locus_tag LOCUS_04030 6107 6343 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007190.1 protein_id gnl|my_center|LOCUS_04030 6425 6562 gene locus_tag LOCUS_04040 6425 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 7801 6746 gene locus_tag LOCUS_04050 7801 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 8551 7883 gene locus_tag LOCUS_04060 8551 7883 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024284.1 protein_id gnl|my_center|LOCUS_04060 9143 8574 gene locus_tag LOCUS_04070 9143 8574 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869954.1 protein_id gnl|my_center|LOCUS_04070 >Feature sequence035 962 1573 gene locus_tag LOCUS_04080 gene modA 962 1573 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948645.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04080 1773 2426 gene locus_tag LOCUS_04090 1773 2426 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020734.1 protein_id gnl|my_center|LOCUS_04090 2423 3046 gene locus_tag LOCUS_04100 2423 3046 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020735.1 protein_id gnl|my_center|LOCUS_04100 3151 3411 gene locus_tag LOCUS_04110 3151 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 3404 4960 gene locus_tag LOCUS_04120 3404 4960 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929286.1 protein_id gnl|my_center|LOCUS_04120 <9410 4965 gene locus_tag LOCUS_04130 <9410 4965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162013074.1:PKD domain-containing protein >Feature sequence036 677 2083 gene locus_tag LOCUS_04140 677 2083 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020936.1 protein_id gnl|my_center|LOCUS_04140 2074 2877 gene locus_tag LOCUS_04150 gene mtxX 2074 2877 CDS product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065223.1 protein_id gnl|my_center|LOCUS_04150 2910 3482 gene locus_tag LOCUS_04160 2910 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 3475 4062 gene locus_tag LOCUS_04170 3475 4062 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023613.1 protein_id gnl|my_center|LOCUS_04170 4368 6152 gene locus_tag LOCUS_04180 4368 6152 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 protein_id gnl|my_center|LOCUS_04180 6601 6203 gene locus_tag LOCUS_04190 6601 6203 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256810.1 protein_id gnl|my_center|LOCUS_04190 6761 6913 gene locus_tag LOCUS_04200 6761 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 6910 7824 gene locus_tag LOCUS_04210 6910 7824 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066118.1 protein_id gnl|my_center|LOCUS_04210 7821 8591 gene locus_tag LOCUS_04220 7821 8591 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020633.1 protein_id gnl|my_center|LOCUS_04220 8618 9364 gene locus_tag LOCUS_04230 8618 9364 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020634.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence037 1251 439 gene locus_tag LOCUS_04240 1251 439 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_04240 1609 1292 gene locus_tag LOCUS_04250 1609 1292 CDS product DUF2551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023626.1 protein_id gnl|my_center|LOCUS_04250 2656 1667 gene locus_tag LOCUS_04260 2656 1667 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023617.1 protein_id gnl|my_center|LOCUS_04260 3226 2741 gene locus_tag LOCUS_04270 gene tsaA 3226 2741 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_04270 3391 4962 gene locus_tag LOCUS_04280 gene serA 3391 4962 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_04280 5537 4953 gene locus_tag LOCUS_04290 5537 4953 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021454.1 protein_id gnl|my_center|LOCUS_04290 6292 5534 gene locus_tag LOCUS_04300 gene rsmA 6292 5534 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990848.1 protein_id gnl|my_center|LOCUS_04300 6879 6289 gene locus_tag LOCUS_04310 6879 6289 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065124.1 protein_id gnl|my_center|LOCUS_04310 7435 7085 gene locus_tag LOCUS_04320 7435 7085 CDS product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021458.1 protein_id gnl|my_center|LOCUS_04320 7768 7463 gene locus_tag LOCUS_04330 7768 7463 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021460.1 protein_id gnl|my_center|LOCUS_04330 <9121 7788 gene locus_tag LOCUS_04340 <9121 7788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021461.1:tRNA pseudouridine(54/55) synthase Pus10 >Feature sequence038 2307 64 gene locus_tag LOCUS_04350 2307 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 5747 2313 gene locus_tag LOCUS_04360 5747 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 6888 5785 gene locus_tag LOCUS_04370 6888 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 7297 6893 gene locus_tag LOCUS_04380 7297 6893 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_04380 7430 7311 gene locus_tag LOCUS_04390 7430 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04390 8303 7644 gene locus_tag LOCUS_04400 8303 7644 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941650.1 protein_id gnl|my_center|LOCUS_04400 8602 8300 gene locus_tag LOCUS_04410 8602 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04410 >Feature sequence039 149 847 gene locus_tag LOCUS_04420 149 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 860 2155 gene locus_tag LOCUS_04430 860 2155 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022811.1 protein_id gnl|my_center|LOCUS_04430 3242 2313 gene locus_tag LOCUS_04440 gene arcC 3242 2313 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_04440 4543 3239 gene locus_tag LOCUS_04450 4543 3239 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_04450 4943 5560 gene locus_tag LOCUS_04460 4943 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 5575 6861 gene locus_tag LOCUS_04470 gene hisS 5575 6861 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020981.1 protein_id gnl|my_center|LOCUS_04470 6963 7664 gene locus_tag LOCUS_04480 6963 7664 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024314.1 protein_id gnl|my_center|LOCUS_04480 8951 7665 gene locus_tag LOCUS_04490 8951 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 >Feature sequence040 446 754 gene locus_tag LOCUS_04500 446 754 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065462.1 protein_id gnl|my_center|LOCUS_04500 980 2674 gene locus_tag LOCUS_04510 980 2674 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_04510 2789 3670 gene locus_tag LOCUS_04520 2789 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 3673 4884 gene locus_tag LOCUS_04530 3673 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 4918 6219 gene locus_tag LOCUS_04540 4918 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 6209 7786 gene locus_tag LOCUS_04550 6209 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 8060 8236 gene locus_tag LOCUS_04560 8060 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 >Feature sequence041 140 907 gene locus_tag LOCUS_04570 140 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022686.1 protein_id gnl|my_center|LOCUS_04570 2818 1058 gene locus_tag LOCUS_04580 2818 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 3120 3347 gene locus_tag LOCUS_04590 3120 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 5091 3613 gene locus_tag LOCUS_04600 5091 3613 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023773.1 protein_id gnl|my_center|LOCUS_04600 5388 5098 gene locus_tag LOCUS_04610 5388 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289276.1 protein_id gnl|my_center|LOCUS_04610 5549 6463 gene locus_tag LOCUS_04620 gene guaA 5549 6463 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024387.1 protein_id gnl|my_center|LOCUS_04620 6547 7023 gene locus_tag LOCUS_04630 6547 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 7117 7575 gene locus_tag LOCUS_04640 7117 7575 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020987.1 protein_id gnl|my_center|LOCUS_04640 >Feature sequence042 598 1665 gene locus_tag LOCUS_04650 598 1665 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_04650 1826 2245 gene locus_tag LOCUS_04660 1826 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 2605 2276 gene locus_tag LOCUS_04670 2605 2276 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392925.1 protein_id gnl|my_center|LOCUS_04670 3036 2668 gene locus_tag LOCUS_04680 3036 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 4027 3419 gene locus_tag LOCUS_04690 4027 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023614.1 protein_id gnl|my_center|LOCUS_04690 4192 4863 gene locus_tag LOCUS_04700 4192 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990760.1 protein_id gnl|my_center|LOCUS_04700 5297 4860 gene locus_tag LOCUS_04710 5297 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 5724 5308 gene locus_tag LOCUS_04720 5724 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048170305.1 protein_id gnl|my_center|LOCUS_04720 7767 5830 gene locus_tag LOCUS_04730 7767 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021319.1 protein_id gnl|my_center|LOCUS_04730 8026 7826 gene locus_tag LOCUS_04740 8026 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 >Feature sequence043 327 929 gene locus_tag LOCUS_04750 327 929 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020130.1 protein_id gnl|my_center|LOCUS_04750 962 1507 gene locus_tag LOCUS_04760 962 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04760 1504 1935 gene locus_tag LOCUS_04770 1504 1935 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066042.1 protein_id gnl|my_center|LOCUS_04770 2002 2607 gene locus_tag LOCUS_04780 2002 2607 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023341.1 protein_id gnl|my_center|LOCUS_04780 2627 4024 gene locus_tag LOCUS_04790 2627 4024 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020190.1 protein_id gnl|my_center|LOCUS_04790 4079 4741 gene locus_tag LOCUS_04800 gene phoU 4079 4741 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461595.1 protein_id gnl|my_center|LOCUS_04800 4751 5791 gene locus_tag LOCUS_04810 4751 5791 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022880.1 protein_id gnl|my_center|LOCUS_04810 5791 6480 gene locus_tag LOCUS_04820 5791 6480 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022879.1 protein_id gnl|my_center|LOCUS_04820 6477 7433 gene locus_tag LOCUS_04830 6477 7433 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_04830 <8361 7437 gene locus_tag LOCUS_04840 <8361 7437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023132.1:bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase >Feature sequence044 <1 544 gene locus_tag LOCUS_04850 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870379.1:CoB--CoM heterodisulfide reductase subunit C 591 1673 gene locus_tag LOCUS_04860 591 1673 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392807.1 protein_id gnl|my_center|LOCUS_04860 1674 3185 gene locus_tag LOCUS_04870 1674 3185 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878453.1 protein_id gnl|my_center|LOCUS_04870 3196 3936 gene locus_tag LOCUS_04880 3196 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083223.1 protein_id gnl|my_center|LOCUS_04880 3957 4442 gene locus_tag LOCUS_04890 gene hdrC 3957 4442 CDS product CoB--CoM heterodisulfide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024118.1 protein_id gnl|my_center|LOCUS_04890 4484 5017 gene locus_tag LOCUS_04900 4484 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04900 5032 5379 gene locus_tag LOCUS_04910 5032 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04910 5397 7667 gene locus_tag LOCUS_04920 gene hdrA 5397 7667 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_04920 8021 7677 gene locus_tag LOCUS_04930 8021 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 >Feature sequence045 268 714 gene locus_tag LOCUS_04940 268 714 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021215.1 protein_id gnl|my_center|LOCUS_04940 738 1688 gene locus_tag LOCUS_04950 gene mch 738 1688 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879428.1 protein_id gnl|my_center|LOCUS_04950 1669 2478 gene locus_tag LOCUS_04960 1669 2478 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060998.1 protein_id gnl|my_center|LOCUS_04960 2966 2493 gene locus_tag LOCUS_04970 gene moaC 2966 2493 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066185.1 protein_id gnl|my_center|LOCUS_04970 4447 2963 gene locus_tag LOCUS_04980 4447 2963 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021194.1 protein_id gnl|my_center|LOCUS_04980 4880 4476 gene locus_tag LOCUS_04990 4880 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 6681 4972 gene locus_tag LOCUS_05000 6681 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 7717 6746 gene locus_tag LOCUS_05010 7717 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 >Feature sequence046 1 696 gene locus_tag LOCUS_05020 1 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 1260 718 gene locus_tag LOCUS_05030 1260 718 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496715.1 protein_id gnl|my_center|LOCUS_05030 3031 1250 gene locus_tag LOCUS_05040 gene asnB 3031 1250 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_05040 4116 3133 gene locus_tag LOCUS_05050 4116 3133 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783220.1 protein_id gnl|my_center|LOCUS_05050 5601 4432 gene locus_tag LOCUS_05060 5601 4432 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941287.1 protein_id gnl|my_center|LOCUS_05060 6728 5616 gene locus_tag LOCUS_05070 6728 5616 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969521.1 protein_id gnl|my_center|LOCUS_05070 7890 6964 gene locus_tag LOCUS_05080 7890 6964 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990845.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence047 1074 70 gene locus_tag LOCUS_05090 gene priL 1074 70 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_05090 1818 1081 gene locus_tag LOCUS_05100 1818 1081 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020169.1 protein_id gnl|my_center|LOCUS_05100 4453 2246 gene locus_tag LOCUS_05110 4453 2246 CDS product DUF2298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065896.1 protein_id gnl|my_center|LOCUS_05110 5931 4459 gene locus_tag LOCUS_05120 5931 4459 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065895.1 protein_id gnl|my_center|LOCUS_05120 6512 7189 gene locus_tag LOCUS_05130 6512 7189 CDS product DUF2162 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024305.1 protein_id gnl|my_center|LOCUS_05130 7190 7819 gene locus_tag LOCUS_05140 7190 7819 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013194697.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence048 <1 560 gene locus_tag LOCUS_05150 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021502.1:2-phospho-L-lactate guanylyltransferase 726 577 gene locus_tag LOCUS_05160 726 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 808 1608 gene locus_tag LOCUS_05170 gene larE 808 1608 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020298.1 protein_id gnl|my_center|LOCUS_05170 1750 2883 gene locus_tag LOCUS_05180 1750 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023363.1 protein_id gnl|my_center|LOCUS_05180 3015 3215 gene locus_tag LOCUS_05190 3015 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 3391 3606 gene locus_tag LOCUS_05200 3391 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05200 3612 3845 gene locus_tag LOCUS_05210 3612 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05210 4548 4363 gene locus_tag LOCUS_05220 4548 4363 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878572.1 protein_id gnl|my_center|LOCUS_05220 4596 5840 gene locus_tag LOCUS_05230 4596 5840 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_05230 6188 5835 gene locus_tag LOCUS_05240 6188 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 7054 6191 gene locus_tag LOCUS_05250 7054 6191 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878278.1 protein_id gnl|my_center|LOCUS_05250 >Feature sequence049 <1 1266 gene locus_tag LOCUS_05260 <1 1266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023534.1:Ni-sirohydrochlorin a,c-diamide synthase 1330 1668 gene locus_tag LOCUS_05270 1330 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 1686 2714 gene locus_tag LOCUS_05280 1686 2714 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_05280 2701 3522 gene locus_tag LOCUS_05290 2701 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 3761 4930 gene locus_tag LOCUS_05300 3761 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 5957 5169 gene locus_tag LOCUS_05310 5957 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990719.1 protein_id gnl|my_center|LOCUS_05310 6893 5997 gene locus_tag LOCUS_05320 gene map 6893 5997 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020270.1 protein_id gnl|my_center|LOCUS_05320 <7681 7162 gene locus_tag LOCUS_05330 <7681 7162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020271.1:Xaa-Pro peptidase family protein note possible pseudo, internal stop codon >Feature sequence050 146 1360 gene locus_tag LOCUS_05340 146 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 1448 2620 gene locus_tag LOCUS_05350 1448 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 4334 2709 gene locus_tag LOCUS_05360 4334 2709 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878560.1 protein_id gnl|my_center|LOCUS_05360 4530 4904 gene locus_tag LOCUS_05370 4530 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 5046 6554 gene locus_tag LOCUS_05380 5046 6554 CDS product L-aspartate semialdehyde sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021823.1 protein_id gnl|my_center|LOCUS_05380 6551 6940 gene locus_tag LOCUS_05390 6551 6940 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065229.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence051 1873 1361 gene locus_tag LOCUS_05400 1873 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 2297 2031 gene locus_tag LOCUS_05410 2297 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 2592 3107 gene locus_tag LOCUS_05420 2592 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 3234 4922 gene locus_tag LOCUS_05430 3234 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 4931 5989 gene locus_tag LOCUS_05440 4931 5989 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064263.1 protein_id gnl|my_center|LOCUS_05440 >Feature sequence052 554 1099 gene locus_tag LOCUS_05450 gene tmk 554 1099 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024311.1 protein_id gnl|my_center|LOCUS_05450 2267 1554 gene locus_tag LOCUS_05460 2267 1554 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902268.1 protein_id gnl|my_center|LOCUS_05460 3098 2295 gene locus_tag LOCUS_05470 3098 2295 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023894.1 protein_id gnl|my_center|LOCUS_05470 4664 3126 gene locus_tag LOCUS_05480 gene gpmI 4664 3126 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065873.1 protein_id gnl|my_center|LOCUS_05480 5242 4667 gene locus_tag LOCUS_05490 5242 4667 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023239.1 protein_id gnl|my_center|LOCUS_05490 5775 5299 gene locus_tag LOCUS_05500 5775 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023265.1 protein_id gnl|my_center|LOCUS_05500 5950 5798 gene locus_tag LOCUS_05510 5950 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 6562 6026 gene locus_tag LOCUS_05520 gene cgi121 6562 6026 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021174.1 protein_id gnl|my_center|LOCUS_05520 >Feature sequence053 614 270 gene locus_tag LOCUS_05530 614 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 979 776 gene locus_tag LOCUS_05540 979 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 1157 963 gene locus_tag LOCUS_05550 1157 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 1683 1489 gene locus_tag LOCUS_05560 1683 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 1983 3218 gene locus_tag LOCUS_05570 1983 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 4113 3889 gene locus_tag LOCUS_05580 4113 3889 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_05580 4327 4127 gene locus_tag LOCUS_05590 4327 4127 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878572.1 protein_id gnl|my_center|LOCUS_05590 5029 5253 gene locus_tag LOCUS_05600 5029 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 5256 5519 gene locus_tag LOCUS_05610 5256 5519 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023420.1 protein_id gnl|my_center|LOCUS_05610 >Feature sequence054 84 686 gene locus_tag LOCUS_05620 84 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 715 861 gene locus_tag LOCUS_05630 715 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 882 1397 gene locus_tag LOCUS_05640 882 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 1375 2007 gene locus_tag LOCUS_05650 1375 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 2011 2412 gene locus_tag LOCUS_05660 2011 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 2393 2875 gene locus_tag LOCUS_05670 2393 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 2872 3477 gene locus_tag LOCUS_05680 2872 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 3807 5537 gene locus_tag LOCUS_05690 gene ade 3807 5537 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392001.1 protein_id gnl|my_center|LOCUS_05690 <7145 5534 gene locus_tag LOCUS_05700 <7145 5534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870139.1:KamA family radical SAM protein >Feature sequence055 <1 640 gene locus_tag LOCUS_05710 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020741.1:dihydromethanopterin reductase (acceptor) 824 2434 gene locus_tag LOCUS_05720 gene pheT 824 2434 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021951.1 protein_id gnl|my_center|LOCUS_05720 2431 3048 gene locus_tag LOCUS_05730 2431 3048 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_05730 4188 3028 gene locus_tag LOCUS_05740 4188 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 4333 6060 gene locus_tag LOCUS_05750 4333 6060 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065860.1 protein_id gnl|my_center|LOCUS_05750 6081 7037 gene locus_tag LOCUS_05760 6081 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence056 600 340 gene locus_tag LOCUS_05770 600 340 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020250.1 protein_id gnl|my_center|LOCUS_05770 990 625 gene locus_tag LOCUS_05780 990 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 2178 994 gene locus_tag LOCUS_05790 2178 994 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060852.1 protein_id gnl|my_center|LOCUS_05790 2878 2168 gene locus_tag LOCUS_05800 2878 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902413.1 protein_id gnl|my_center|LOCUS_05800 4271 2955 gene locus_tag LOCUS_05810 gene truD 4271 2955 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_05810 4417 5397 gene locus_tag LOCUS_05820 4417 5397 CDS product eukaryotic peptide chain release factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021302.1 protein_id gnl|my_center|LOCUS_05820 <7103 5436 gene locus_tag LOCUS_05830 <7103 5436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967805.1:Na(+)/H(+) antiporter subunit D >Feature sequence057 3278 1164 gene locus_tag LOCUS_05840 3278 1164 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020921.1 protein_id gnl|my_center|LOCUS_05840 4035 3307 gene locus_tag LOCUS_05850 4035 3307 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020911.1 protein_id gnl|my_center|LOCUS_05850 4805 4032 gene locus_tag LOCUS_05860 4805 4032 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064988.1 protein_id gnl|my_center|LOCUS_05860 5938 4958 gene locus_tag LOCUS_05870 5938 4958 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870386.1 protein_id gnl|my_center|LOCUS_05870 6017 6250 gene locus_tag LOCUS_05880 6017 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 <7089 6361 gene locus_tag LOCUS_05890 <7089 6361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022504.1:carbonic anhydrase >Feature sequence058 811 470 gene locus_tag LOCUS_05900 811 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 1035 1523 gene locus_tag LOCUS_05910 1035 1523 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_05910 1520 1780 gene locus_tag LOCUS_05920 1520 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 1803 2213 gene locus_tag LOCUS_05930 gene mnhG 1803 2213 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251032.1 protein_id gnl|my_center|LOCUS_05930 2210 2455 gene locus_tag LOCUS_05940 2210 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05940 2452 2727 gene locus_tag LOCUS_05950 2452 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05950 2724 3191 gene locus_tag LOCUS_05960 2724 3191 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328225.1 protein_id gnl|my_center|LOCUS_05960 3188 3628 gene locus_tag LOCUS_05970 3188 3628 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335819.1 protein_id gnl|my_center|LOCUS_05970 3625 5136 gene locus_tag LOCUS_05980 3625 5136 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_05980 5147 6640 gene locus_tag LOCUS_05990 5147 6640 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_05990 >Feature sequence059 966 6278 gene locus_tag LOCUS_06000 966 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 >Feature sequence060 167 856 gene locus_tag LOCUS_06010 167 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 939 1139 gene locus_tag LOCUS_06020 939 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 1167 1367 gene locus_tag LOCUS_06030 1167 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 1295 1921 gene locus_tag LOCUS_06040 1295 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 2199 3035 gene locus_tag LOCUS_06050 2199 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 4682 3117 gene locus_tag LOCUS_06060 4682 3117 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_06060 5670 6149 gene locus_tag LOCUS_06070 5670 6149 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060740.1 protein_id gnl|my_center|LOCUS_06070 >Feature sequence061 1053 478 gene locus_tag LOCUS_06080 1053 478 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021058.1 protein_id gnl|my_center|LOCUS_06080 2876 1053 gene locus_tag LOCUS_06090 gene iorA 2876 1053 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065029.1 protein_id gnl|my_center|LOCUS_06090 4369 2966 gene locus_tag LOCUS_06100 4369 2966 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875835.1 protein_id gnl|my_center|LOCUS_06100 4759 4508 gene locus_tag LOCUS_06110 4759 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 6126 4834 gene locus_tag LOCUS_06120 6126 4834 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021968.1 protein_id gnl|my_center|LOCUS_06120 6323 6141 gene locus_tag LOCUS_06130 6323 6141 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066529.1 protein_id gnl|my_center|LOCUS_06130 >Feature sequence062 <1 1263 gene locus_tag LOCUS_06140 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024460.1:signal recognition particle protein Srp54 1785 2387 gene locus_tag LOCUS_06150 1785 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 2660 4147 gene locus_tag LOCUS_06160 gene argH 2660 4147 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021337.1 protein_id gnl|my_center|LOCUS_06160 4140 5375 gene locus_tag LOCUS_06170 gene gatD 4140 5375 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021336.1 protein_id gnl|my_center|LOCUS_06170 5372 5908 gene locus_tag LOCUS_06180 5372 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 >Feature sequence063 1742 1380 gene locus_tag LOCUS_06190 1742 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 1954 2997 gene locus_tag LOCUS_06200 1954 2997 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023833.1 protein_id gnl|my_center|LOCUS_06200 3077 4240 gene locus_tag LOCUS_06210 3077 4240 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 protein_id gnl|my_center|LOCUS_06210 5031 4348 gene locus_tag LOCUS_06220 5031 4348 CDS product archaetidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020175.1 protein_id gnl|my_center|LOCUS_06220 5683 5033 gene locus_tag LOCUS_06230 5683 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 <6471 5680 gene locus_tag LOCUS_06240 <6471 5680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064816.1:archaeosortase A >Feature sequence064 <1 2582 gene locus_tag LOCUS_06250 <1 2582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942751.1:BREX-1 system adenine-specific DNA-methyltransferase PglX 2579 3445 gene locus_tag LOCUS_06260 2579 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 3448 4002 gene locus_tag LOCUS_06270 3448 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 4004 4450 gene locus_tag LOCUS_06280 4004 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 4717 4935 gene locus_tag LOCUS_06290 4717 4935 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_06290 5221 5349 gene locus_tag LOCUS_06300 5221 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 5346 5687 gene locus_tag LOCUS_06310 5346 5687 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140979.1 protein_id gnl|my_center|LOCUS_06310 5684 6064 gene locus_tag LOCUS_06320 5684 6064 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250023.1 protein_id gnl|my_center|LOCUS_06320 >Feature sequence065 213 905 gene locus_tag LOCUS_06330 213 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 1387 2112 gene locus_tag LOCUS_06340 1387 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 4552 2114 gene locus_tag LOCUS_06350 4552 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 <6384 4787 gene locus_tag LOCUS_06360 <6384 4787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066190.1:PGF-pre-PGF domain-containing protein >Feature sequence066 1785 526 gene locus_tag LOCUS_06370 1785 526 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021506.1 protein_id gnl|my_center|LOCUS_06370 2150 4456 gene locus_tag LOCUS_06380 2150 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 4942 4460 gene locus_tag LOCUS_06390 4942 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 >Feature sequence067 763 632 gene locus_tag LOCUS_06400 763 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 942 760 gene locus_tag LOCUS_06410 942 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 1437 2876 gene locus_tag LOCUS_06420 1437 2876 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868417.1 protein_id gnl|my_center|LOCUS_06420 3169 5217 gene locus_tag LOCUS_06430 3169 5217 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023776.1 protein_id gnl|my_center|LOCUS_06430 <6177 5260 gene locus_tag LOCUS_06440 <6177 5260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020859.1:tyrosine--tRNA ligase >Feature sequence068 1503 589 gene locus_tag LOCUS_06450 1503 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 2704 1514 gene locus_tag LOCUS_06460 gene pseC 2704 1514 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_06460 3402 2818 gene locus_tag LOCUS_06470 3402 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 4130 3423 gene locus_tag LOCUS_06480 4130 3423 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022168.1 protein_id gnl|my_center|LOCUS_06480 5298 4444 gene locus_tag LOCUS_06490 gene rfbD 5298 4444 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023678.1 protein_id gnl|my_center|LOCUS_06490 <6097 5271 gene locus_tag LOCUS_06500 <6097 5271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023679.1:dTDP-glucose 4,6-dehydratase >Feature sequence069 380 640 gene locus_tag LOCUS_06510 gene porD 380 640 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020092.1 protein_id gnl|my_center|LOCUS_06510 642 1847 gene locus_tag LOCUS_06520 gene porA 642 1847 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_06520 1844 2716 gene locus_tag LOCUS_06530 gene porB 1844 2716 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 protein_id gnl|my_center|LOCUS_06530 3052 2978 gene locus_tag LOCUS_t00060 3052 2978 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3534 3145 gene locus_tag LOCUS_06540 3534 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 4301 3549 gene locus_tag LOCUS_06550 4301 3549 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066594.1 protein_id gnl|my_center|LOCUS_06550 5643 4360 gene locus_tag LOCUS_06560 5643 4360 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024335.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence070 1526 912 gene locus_tag LOCUS_06570 1526 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 1922 1536 gene locus_tag LOCUS_06580 1922 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 2839 3291 gene locus_tag LOCUS_06590 2839 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3636 3394 gene locus_tag LOCUS_06600 3636 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06600 3789 3667 gene locus_tag LOCUS_06610 3789 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 4093 3776 gene locus_tag LOCUS_06620 4093 3776 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_06620 4297 4224 gene locus_tag LOCUS_t00070 4297 4224 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 <6019 4344 gene locus_tag LOCUS_06630 <6019 4344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066079.1:ATP-dependent DNA helicase 5763 5783 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence071 284 2629 gene locus_tag LOCUS_06640 284 2629 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209617549.1 protein_id gnl|my_center|LOCUS_06640 2626 3735 gene locus_tag LOCUS_06650 2626 3735 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020343.1 protein_id gnl|my_center|LOCUS_06650 3759 4841 gene locus_tag LOCUS_06660 3759 4841 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064850.1 protein_id gnl|my_center|LOCUS_06660 >Feature sequence072 2167 353 gene locus_tag LOCUS_06670 2167 353 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066253.1 protein_id gnl|my_center|LOCUS_06670 3091 5235 gene locus_tag LOCUS_06680 gene purL 3091 5235 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023948.1 protein_id gnl|my_center|LOCUS_06680 <5899 5215 gene locus_tag LOCUS_06690 <5899 5215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167441479.1:amidohydrolase family protein >Feature sequence073 753 343 gene locus_tag LOCUS_06700 753 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 1700 849 gene locus_tag LOCUS_06710 1700 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 2833 1697 gene locus_tag LOCUS_06720 2833 1697 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966615.1 protein_id gnl|my_center|LOCUS_06720 4295 3225 gene locus_tag LOCUS_06730 4295 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 >Feature sequence074 1480 494 gene locus_tag LOCUS_06740 1480 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 1736 2401 gene locus_tag LOCUS_06750 gene minD 1736 2401 CDS product cell division ATPase MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249304.1 protein_id gnl|my_center|LOCUS_06750 2450 2662 gene locus_tag LOCUS_06760 2450 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 3360 4157 gene locus_tag LOCUS_06770 3360 4157 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024464.1 protein_id gnl|my_center|LOCUS_06770 4154 5299 gene locus_tag LOCUS_06780 4154 5299 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024465.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence075 <1 1116 gene locus_tag LOCUS_06790 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065247.1:Fic family protein 1236 2006 gene locus_tag LOCUS_06800 gene dph5 1236 2006 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021388.1 protein_id gnl|my_center|LOCUS_06800 4114 2015 gene locus_tag LOCUS_06810 4114 2015 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020139.1 protein_id gnl|my_center|LOCUS_06810 5050 4490 gene locus_tag LOCUS_06820 5050 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066058.1 protein_id gnl|my_center|LOCUS_06820 5563 5417 gene locus_tag LOCUS_06830 5563 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence076 755 183 gene locus_tag LOCUS_06840 755 183 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_06840 1405 752 gene locus_tag LOCUS_06850 1405 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 2206 1472 gene locus_tag LOCUS_06860 2206 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 4489 2402 gene locus_tag LOCUS_06870 gene pcrA 4489 2402 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542538.1 protein_id gnl|my_center|LOCUS_06870 <5818 4784 gene locus_tag LOCUS_06880 <5818 4784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022836.1:NosD domain-containing protein >Feature sequence077 2 1174 gene locus_tag LOCUS_06890 2 1174 CDS product IS4-like element ISH8C family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890462.1 protein_id gnl|my_center|LOCUS_06890 1519 1665 gene locus_tag LOCUS_06900 1519 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 1730 1936 gene locus_tag LOCUS_06910 1730 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065476.1 protein_id gnl|my_center|LOCUS_06910 1933 2196 gene locus_tag LOCUS_06920 1933 2196 CDS product YafQ family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870686.1 protein_id gnl|my_center|LOCUS_06920 2236 2916 gene locus_tag LOCUS_06930 2236 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 2929 3087 gene locus_tag LOCUS_06940 2929 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 3838 4632 gene locus_tag LOCUS_06950 3838 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 5781 4609 gene locus_tag LOCUS_06960 5781 4609 CDS product IS4-like element ISH8C family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890462.1 protein_id gnl|my_center|LOCUS_06960 >Feature sequence078 424 732 gene locus_tag LOCUS_06970 424 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 902 2044 gene locus_tag LOCUS_06980 902 2044 CDS product TIGR04083 family peptide-modifying radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023249.1 protein_id gnl|my_center|LOCUS_06980 2114 3556 gene locus_tag LOCUS_06990 2114 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 3592 4704 gene locus_tag LOCUS_07000 gene ftsZ 3592 4704 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024152.1 protein_id gnl|my_center|LOCUS_07000 4768 4998 gene locus_tag LOCUS_07010 4768 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 4995 5519 gene locus_tag LOCUS_07020 4995 5519 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065945.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence079 3381 1528 gene locus_tag LOCUS_07030 3381 1528 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023084.1 protein_id gnl|my_center|LOCUS_07030 4244 3387 gene locus_tag LOCUS_07040 4244 3387 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023085.1 protein_id gnl|my_center|LOCUS_07040 5221 4328 gene locus_tag LOCUS_07050 5221 4328 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023086.1 protein_id gnl|my_center|LOCUS_07050 >Feature sequence080 1553 1206 gene locus_tag LOCUS_07060 1553 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 1629 1937 gene locus_tag LOCUS_07070 gene yciH 1629 1937 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023951.1 protein_id gnl|my_center|LOCUS_07070 2024 3178 gene locus_tag LOCUS_07080 gene nifS 2024 3178 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_07080 3208 3603 gene locus_tag LOCUS_07090 gene nifU 3208 3603 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_07090 5756 3861 gene locus_tag LOCUS_07100 5756 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 >Feature sequence081 1962 457 gene locus_tag LOCUS_07110 1962 457 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022533.1 protein_id gnl|my_center|LOCUS_07110 2281 1949 gene locus_tag LOCUS_07120 2281 1949 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788017.1 protein_id gnl|my_center|LOCUS_07120 3531 2278 gene locus_tag LOCUS_07130 3531 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 4423 3623 gene locus_tag LOCUS_07140 4423 3623 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867167.1 protein_id gnl|my_center|LOCUS_07140 5221 5370 gene locus_tag LOCUS_07150 5221 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 >Feature sequence082 <1 902 gene locus_tag LOCUS_07160 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020587.1:DUF3656 domain-containing protein 931 1827 gene locus_tag LOCUS_07170 931 1827 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020723.1 protein_id gnl|my_center|LOCUS_07170 1871 2821 gene locus_tag LOCUS_07180 gene mptA 1871 2821 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066005.1 protein_id gnl|my_center|LOCUS_07180 2923 3099 gene locus_tag LOCUS_07190 gene rpl18a 2923 3099 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879556.1 protein_id gnl|my_center|LOCUS_07190 3106 3585 gene locus_tag LOCUS_07200 gene pfdA 3106 3585 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024001.1 protein_id gnl|my_center|LOCUS_07200 3586 3936 gene locus_tag LOCUS_07210 3586 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07210 4013 4654 gene locus_tag LOCUS_07220 4013 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07220 5318 4677 gene locus_tag LOCUS_07230 5318 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 >Feature sequence083 2471 2986 gene locus_tag LOCUS_07240 2471 2986 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020400.1 protein_id gnl|my_center|LOCUS_07240 3106 3690 gene locus_tag LOCUS_07250 3106 3690 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020574.1 protein_id gnl|my_center|LOCUS_07250 3745 3818 gene locus_tag LOCUS_t00080 3745 3818 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4246 5070 gene locus_tag LOCUS_07260 4246 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence084 618 878 gene locus_tag LOCUS_07270 618 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 928 2418 gene locus_tag LOCUS_07280 928 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 3164 3015 gene locus_tag LOCUS_07290 3164 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 3228 4610 gene locus_tag LOCUS_07300 3228 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 4703 4966 gene locus_tag LOCUS_07310 4703 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 5155 5230 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence085 2670 1768 gene locus_tag LOCUS_07320 2670 1768 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021969.1 protein_id gnl|my_center|LOCUS_07320 2728 3639 gene locus_tag LOCUS_07330 2728 3639 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022486.1 protein_id gnl|my_center|LOCUS_07330 3742 3669 gene locus_tag LOCUS_t00090 3742 3669 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4381 3803 gene locus_tag LOCUS_07340 4381 3803 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024150.1 protein_id gnl|my_center|LOCUS_07340 4659 4381 gene locus_tag LOCUS_07350 4659 4381 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020766.1 protein_id gnl|my_center|LOCUS_07350 5304 4672 gene locus_tag LOCUS_07360 5304 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence086 198 659 gene locus_tag LOCUS_07370 198 659 CDS product DUF2240 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064346.1 protein_id gnl|my_center|LOCUS_07370 2221 776 gene locus_tag LOCUS_07380 2221 776 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250266.1 protein_id gnl|my_center|LOCUS_07380 2447 2752 gene locus_tag LOCUS_07390 2447 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 2749 3279 gene locus_tag LOCUS_07400 2749 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 3523 3927 gene locus_tag LOCUS_07410 3523 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048124573.1 protein_id gnl|my_center|LOCUS_07410 4155 4661 gene locus_tag LOCUS_07420 4155 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 4983 4738 gene locus_tag LOCUS_07430 4983 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence087 1157 609 gene locus_tag LOCUS_07440 1157 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 1373 1522 gene locus_tag LOCUS_07450 1373 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 1619 2542 gene locus_tag LOCUS_07460 gene mdh 1619 2542 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020863.1 protein_id gnl|my_center|LOCUS_07460 2539 3378 gene locus_tag LOCUS_07470 2539 3378 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065423.1 protein_id gnl|my_center|LOCUS_07470 3371 3949 gene locus_tag LOCUS_07480 3371 3949 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022469.1 protein_id gnl|my_center|LOCUS_07480 3975 4661 gene locus_tag LOCUS_07490 3975 4661 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169713.1 protein_id gnl|my_center|LOCUS_07490 4702 5418 gene locus_tag LOCUS_07500 gene ribB 4702 5418 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879598.1 protein_id gnl|my_center|LOCUS_07500 5632 5429 gene locus_tag LOCUS_07510 5632 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence088 <1 676 gene locus_tag LOCUS_07520 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020431.1:ABC transporter permease 981 718 gene locus_tag LOCUS_07530 981 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 729 738 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2106 994 gene locus_tag LOCUS_07540 2106 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020430.1 protein_id gnl|my_center|LOCUS_07540 2513 2719 gene locus_tag LOCUS_07550 2513 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 2683 2880 gene locus_tag LOCUS_07560 2683 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 3021 3200 gene locus_tag LOCUS_07570 3021 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 4886 3273 gene locus_tag LOCUS_07580 gene sepS 4886 3273 CDS product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020149.1 protein_id gnl|my_center|LOCUS_07580 >Feature sequence089 1563 2909 gene locus_tag LOCUS_07590 1563 2909 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023091.1 protein_id gnl|my_center|LOCUS_07590 4167 2911 gene locus_tag LOCUS_07600 gene larA 4167 2911 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_07600 <5495 4178 gene locus_tag LOCUS_07610 <5495 4178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065661.1:TldD/PmbA family protein >Feature sequence090 <1 1138 gene locus_tag LOCUS_07620 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020441.1:cobaltochelatase subunit CobN >Feature sequence091 385 792 gene locus_tag LOCUS_07630 385 792 CDS product DUF2111 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589540.1 protein_id gnl|my_center|LOCUS_07630 1293 802 gene locus_tag LOCUS_07640 1293 802 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024074.1 protein_id gnl|my_center|LOCUS_07640 1607 1290 gene locus_tag LOCUS_07650 1607 1290 CDS product DUF5611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065922.1 protein_id gnl|my_center|LOCUS_07650 1776 2498 gene locus_tag LOCUS_07660 1776 2498 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403082.1 protein_id gnl|my_center|LOCUS_07660 3060 3926 gene locus_tag LOCUS_07670 3060 3926 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048168954.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07670 3952 4845 gene locus_tag LOCUS_07680 3952 4845 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024518.1 protein_id gnl|my_center|LOCUS_07680 >Feature sequence092 739 566 gene locus_tag LOCUS_07690 739 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2013 736 gene locus_tag LOCUS_07700 gene hisD 2013 736 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023136.1 protein_id gnl|my_center|LOCUS_07700 2168 2034 gene locus_tag LOCUS_07710 2168 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 2181 2723 gene locus_tag LOCUS_07720 2181 2723 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_07720 3369 2704 gene locus_tag LOCUS_07730 3369 2704 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083183.1 protein_id gnl|my_center|LOCUS_07730 3674 5011 gene locus_tag LOCUS_07740 3674 5011 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064814.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence093 2 1222 gene locus_tag LOCUS_07750 gene larC 2 1222 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020481.1 protein_id gnl|my_center|LOCUS_07750 1257 2390 gene locus_tag LOCUS_07760 gene mfnA 1257 2390 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020065.1 protein_id gnl|my_center|LOCUS_07760 2830 2519 gene locus_tag LOCUS_07770 2830 2519 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878730.1 protein_id gnl|my_center|LOCUS_07770 3790 2978 gene locus_tag LOCUS_07780 gene hisF 3790 2978 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061292.1 protein_id gnl|my_center|LOCUS_07780 4275 3856 gene locus_tag LOCUS_07790 gene gcvH 4275 3856 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222781.1 protein_id gnl|my_center|LOCUS_07790 <5370 4381 gene locus_tag LOCUS_07800 <5370 4381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810321.1:carbamoyl-phosphate synthase large subunit >Feature sequence094 79 912 gene locus_tag LOCUS_07810 gene pheA 79 912 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066451.1 protein_id gnl|my_center|LOCUS_07810 933 2729 gene locus_tag LOCUS_07820 gene uvrC 933 2729 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_07820 2772 3293 gene locus_tag LOCUS_07830 2772 3293 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020241.1 protein_id gnl|my_center|LOCUS_07830 3325 3936 gene locus_tag LOCUS_07840 3325 3936 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_07840 >Feature sequence095 1339 509 gene locus_tag LOCUS_07850 1339 509 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868388.1 protein_id gnl|my_center|LOCUS_07850 2644 1631 gene locus_tag LOCUS_07860 2644 1631 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249816.1 protein_id gnl|my_center|LOCUS_07860 3245 4657 gene locus_tag LOCUS_07870 3245 4657 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_07870 4919 4671 gene locus_tag LOCUS_07880 4919 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence096 2703 832 gene locus_tag LOCUS_07890 2703 832 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_07890 2976 2746 gene locus_tag LOCUS_07900 2976 2746 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021598.1 protein_id gnl|my_center|LOCUS_07900 3910 3053 gene locus_tag LOCUS_07910 3910 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 4370 3948 gene locus_tag LOCUS_07920 4370 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence097 740 279 gene locus_tag LOCUS_07930 740 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020180.1 protein_id gnl|my_center|LOCUS_07930 1801 791 gene locus_tag LOCUS_07940 1801 791 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022537.1 protein_id gnl|my_center|LOCUS_07940 2316 1810 gene locus_tag LOCUS_07950 2316 1810 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065441.1 protein_id gnl|my_center|LOCUS_07950 2454 2633 gene locus_tag LOCUS_07960 2454 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 2630 3625 gene locus_tag LOCUS_07970 2630 3625 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879606.1 protein_id gnl|my_center|LOCUS_07970 <5145 3755 gene locus_tag LOCUS_07980 <5145 3755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065200.1:DUF3344 domain-containing protein >Feature sequence098 1145 873 gene locus_tag LOCUS_07990 gene trxA 1145 873 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065637.1 protein_id gnl|my_center|LOCUS_07990 4700 1257 gene locus_tag LOCUS_08000 4700 1257 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024425.1 protein_id gnl|my_center|LOCUS_08000 >Feature sequence099 1618 3498 gene locus_tag LOCUS_08010 1618 3498 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878496.1 protein_id gnl|my_center|LOCUS_08010 3488 4414 gene locus_tag LOCUS_08020 3488 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08020 >Feature sequence100 1051 917 gene locus_tag LOCUS_08030 1051 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 1201 1563 gene locus_tag LOCUS_08040 1201 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 1790 4612 gene locus_tag LOCUS_08050 1790 4612 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence101 <1 850 gene locus_tag LOCUS_08060 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020719.1:sodium-extruding oxaloacetate decarboxylase subunit alpha 862 2331 gene locus_tag LOCUS_08070 862 2331 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020720.1 protein_id gnl|my_center|LOCUS_08070 2437 3402 gene locus_tag LOCUS_08080 2437 3402 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020721.1 protein_id gnl|my_center|LOCUS_08080 3493 4653 gene locus_tag LOCUS_08090 3493 4653 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870036.1 protein_id gnl|my_center|LOCUS_08090 >Feature sequence102 1883 951 gene locus_tag LOCUS_08100 1883 951 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence103 <1 4168 gene locus_tag LOCUS_08110 <1 4168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024242.1:NosD domain-containing protein >Feature sequence104 422 1597 gene locus_tag LOCUS_08120 422 1597 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023489.1 protein_id gnl|my_center|LOCUS_08120 2385 1594 gene locus_tag LOCUS_08130 gene dapB 2385 1594 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024350.1 protein_id gnl|my_center|LOCUS_08130 3257 2382 gene locus_tag LOCUS_08140 gene dapA 3257 2382 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024349.1 protein_id gnl|my_center|LOCUS_08140 3546 3349 gene locus_tag LOCUS_08150 3546 3349 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878411.1 protein_id gnl|my_center|LOCUS_08150 3857 3606 gene locus_tag LOCUS_08160 3857 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 3963 4937 gene locus_tag LOCUS_08170 gene xseA 3963 4937 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_08170 >Feature sequence105 1369 761 gene locus_tag LOCUS_08180 1369 761 CDS product methanogenesis marker 17 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023888.1 protein_id gnl|my_center|LOCUS_08180 2648 1407 gene locus_tag LOCUS_08190 2648 1407 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023889.1 protein_id gnl|my_center|LOCUS_08190 3129 2650 gene locus_tag LOCUS_08200 3129 2650 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066559.1 protein_id gnl|my_center|LOCUS_08200 3580 3140 gene locus_tag LOCUS_08210 3580 3140 CDS product methanogenesis marker 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065869.1 protein_id gnl|my_center|LOCUS_08210 <4950 3581 gene locus_tag LOCUS_08220 <4950 3581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023892.1:methanogenesis marker 3 protein >Feature sequence106 <1 565 gene locus_tag LOCUS_08230 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393716.1:group II intron reverse transcriptase/maturase 2652 1000 gene locus_tag LOCUS_08240 2652 1000 CDS product IS1634-like element ISMac10 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021311.1 protein_id gnl|my_center|LOCUS_08240 3097 2879 gene locus_tag LOCUS_08250 3097 2879 CDS product DUF2180 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060737.1 protein_id gnl|my_center|LOCUS_08250 3323 3111 gene locus_tag LOCUS_08260 3323 3111 CDS product DUF2180 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023639.1 protein_id gnl|my_center|LOCUS_08260 3497 3342 gene locus_tag LOCUS_08270 3497 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 3884 3609 gene locus_tag LOCUS_08280 3884 3609 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022822.1 protein_id gnl|my_center|LOCUS_08280 <4925 4003 gene locus_tag LOCUS_08290 <4925 4003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065790.1:FprA family A-type flavoprotein >Feature sequence107 <1 1453 gene locus_tag LOCUS_08300 <1 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020980.1:threonine-phosphate decarboxylase CobD 1450 2385 gene locus_tag LOCUS_08310 1450 2385 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020979.1 protein_id gnl|my_center|LOCUS_08310 2395 3201 gene locus_tag LOCUS_08320 gene cobS 2395 3201 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020977.1 protein_id gnl|my_center|LOCUS_08320 3201 3809 gene locus_tag LOCUS_08330 3201 3809 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020976.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence108 818 438 gene locus_tag LOCUS_08340 818 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 2375 1077 gene locus_tag LOCUS_08350 2375 1077 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980656.1 protein_id gnl|my_center|LOCUS_08350 3255 3533 gene locus_tag LOCUS_08360 3255 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 <4810 3793 gene locus_tag LOCUS_08370 <4810 3793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_088854992.1:ATP-binding protein >Feature sequence109 544 197 gene locus_tag LOCUS_08380 gene pth2 544 197 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023203.1 protein_id gnl|my_center|LOCUS_08380 920 537 gene locus_tag LOCUS_08390 920 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 2114 930 gene locus_tag LOCUS_08400 2114 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 2561 2824 gene locus_tag LOCUS_08410 2561 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 3629 3003 gene locus_tag LOCUS_08420 3629 3003 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024310.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence110 442 254 gene locus_tag LOCUS_08430 442 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1242 823 gene locus_tag LOCUS_08440 1242 823 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867143.1 protein_id gnl|my_center|LOCUS_08440 1678 1250 gene locus_tag LOCUS_08450 1678 1250 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867144.1 protein_id gnl|my_center|LOCUS_08450 1959 2240 gene locus_tag LOCUS_08460 1959 2240 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683272.1 protein_id gnl|my_center|LOCUS_08460 2357 3910 gene locus_tag LOCUS_08470 2357 3910 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868291.1 protein_id gnl|my_center|LOCUS_08470 4641 3916 gene locus_tag LOCUS_08480 4641 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence111 <1 832 gene locus_tag LOCUS_08490 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_105217984.1:glycosyltransferase 3789 979 gene locus_tag LOCUS_08500 3789 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 >Feature sequence112 272 1192 gene locus_tag LOCUS_08510 272 1192 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021489.1 protein_id gnl|my_center|LOCUS_08510 1736 1167 gene locus_tag LOCUS_08520 1736 1167 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948128.1 protein_id gnl|my_center|LOCUS_08520 2094 1762 gene locus_tag LOCUS_08530 2094 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 2302 4212 gene locus_tag LOCUS_08540 2302 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 4175 4684 gene locus_tag LOCUS_08550 4175 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 >Feature sequence113 190 597 gene locus_tag LOCUS_08560 190 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 567 1046 gene locus_tag LOCUS_08570 567 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 1171 1566 gene locus_tag LOCUS_08580 1171 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 3050 4600 gene locus_tag LOCUS_08590 gene ltrA 3050 4600 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048122254.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence114 252 608 gene locus_tag LOCUS_08600 252 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1745 624 gene locus_tag LOCUS_08610 gene cofH 1745 624 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021504.1 protein_id gnl|my_center|LOCUS_08610 2756 2361 gene locus_tag LOCUS_08620 2756 2361 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254762.1 protein_id gnl|my_center|LOCUS_08620 2907 3584 gene locus_tag LOCUS_08630 2907 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 3565 3801 gene locus_tag LOCUS_08640 3565 3801 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence115 <1 1067 gene locus_tag LOCUS_08650 <1 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990811.1:DUF3344 domain-containing protein 1237 2886 gene locus_tag LOCUS_08660 gene thsB 1237 2886 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878948.1 protein_id gnl|my_center|LOCUS_08660 2849 3535 gene locus_tag LOCUS_08670 2849 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence116 621 1321 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgtaaaagagtagacccgtttataggggattgaaac 2265 3488 gene locus_tag LOCUS_08680 2265 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence117 299 1153 gene locus_tag LOCUS_08690 299 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 1465 1154 gene locus_tag LOCUS_08700 gene rpsJ 1465 1154 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021276.1 protein_id gnl|my_center|LOCUS_08700 1862 1509 gene locus_tag LOCUS_08710 1862 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08710 2777 1914 gene locus_tag LOCUS_08720 2777 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08720 <4607 2858 gene locus_tag LOCUS_08730 <4607 2858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021278.1:elongation factor EF-2 >Feature sequence118 446 27 gene locus_tag LOCUS_08740 446 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 531 1421 gene locus_tag LOCUS_08750 531 1421 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021976.1 protein_id gnl|my_center|LOCUS_08750 1642 1436 gene locus_tag LOCUS_08760 1642 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 >Feature sequence119 1501 377 gene locus_tag LOCUS_08770 1501 377 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024513.1 protein_id gnl|my_center|LOCUS_08770 1680 2378 gene locus_tag LOCUS_08780 1680 2378 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022767.1 protein_id gnl|my_center|LOCUS_08780 2466 2552 gene locus_tag LOCUS_t00100 2466 2552 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3701 2559 gene locus_tag LOCUS_08790 3701 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 3838 3752 gene locus_tag LOCUS_t00110 3838 3752 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4301 4543 gene locus_tag LOCUS_08800 4301 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence120 1481 639 gene locus_tag LOCUS_08810 1481 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 2034 3311 gene locus_tag LOCUS_08820 2034 3311 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940104.1 protein_id gnl|my_center|LOCUS_08820 3301 3813 gene locus_tag LOCUS_08830 3301 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 4350 3958 gene locus_tag LOCUS_08840 4350 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence121 <1 961 gene locus_tag LOCUS_08850 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066527.1:translation initiation factor IF-2 subunit gamma 925 1353 gene locus_tag LOCUS_08860 925 1353 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023598.1 protein_id gnl|my_center|LOCUS_08860 1376 1954 gene locus_tag LOCUS_08870 1376 1954 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023599.1 protein_id gnl|my_center|LOCUS_08870 1958 2143 gene locus_tag LOCUS_08880 1958 2143 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875904.1 protein_id gnl|my_center|LOCUS_08880 2151 2696 gene locus_tag LOCUS_08890 2151 2696 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869894.1 protein_id gnl|my_center|LOCUS_08890 2796 3218 gene locus_tag LOCUS_08900 2796 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 <4553 3430 gene locus_tag LOCUS_08910 <4553 3430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020144.1:ORC1-type DNA replication protein >Feature sequence122 <1 974 gene locus_tag LOCUS_08920 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902193.1:SPFH domain-containing protein 987 1418 gene locus_tag LOCUS_08930 987 1418 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020297.1 protein_id gnl|my_center|LOCUS_08930 1423 1956 gene locus_tag LOCUS_08940 1423 1956 CDS product DUF531 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020296.1 protein_id gnl|my_center|LOCUS_08940 2928 2017 gene locus_tag LOCUS_08950 2928 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021970.1 protein_id gnl|my_center|LOCUS_08950 4014 3049 gene locus_tag LOCUS_08960 4014 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence123 684 355 gene locus_tag LOCUS_08970 684 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 848 1270 gene locus_tag LOCUS_08980 848 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1267 1731 gene locus_tag LOCUS_08990 gene pyrI 1267 1731 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024377.1 protein_id gnl|my_center|LOCUS_08990 1970 2731 gene locus_tag LOCUS_09000 1970 2731 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021408.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09000 2895 3077 gene locus_tag LOCUS_09010 2895 3077 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023214.1 protein_id gnl|my_center|LOCUS_09010 3098 3733 gene locus_tag LOCUS_09020 3098 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 4406 3648 gene locus_tag LOCUS_09030 4406 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09030 >Feature sequence124 <1 1224 gene locus_tag LOCUS_09040 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016159.1:ATP-binding protein 2592 1210 gene locus_tag LOCUS_09050 gene cca 2592 1210 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023473.1 protein_id gnl|my_center|LOCUS_09050 3220 2675 gene locus_tag LOCUS_09060 gene thpR 3220 2675 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066123.1 protein_id gnl|my_center|LOCUS_09060 4027 3263 gene locus_tag LOCUS_09070 gene trpA 4027 3263 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_09070 4434 4024 gene locus_tag LOCUS_09080 4434 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence125 <1 3534 gene locus_tag LOCUS_09090 <1 3534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024190.1:PKD domain-containing protein >Feature sequence126 1418 1137 gene locus_tag LOCUS_09100 1418 1137 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065686.1 protein_id gnl|my_center|LOCUS_09100 1625 2443 gene locus_tag LOCUS_09110 gene nadC 1625 2443 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020993.1 protein_id gnl|my_center|LOCUS_09110 2650 3819 gene locus_tag LOCUS_09120 2650 3819 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860339.1 protein_id gnl|my_center|LOCUS_09120 <4413 3820 gene locus_tag LOCUS_09130 <4413 3820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210196.1:glycoside hydrolase family 130 protein >Feature sequence127 2221 1496 gene locus_tag LOCUS_09140 2221 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 4077 2227 gene locus_tag LOCUS_09150 gene nuoF 4077 2227 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence128 3547 2459 gene locus_tag LOCUS_09160 3547 2459 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065824.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence129 126 857 gene locus_tag LOCUS_09170 126 857 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990915.1 protein_id gnl|my_center|LOCUS_09170 859 1278 gene locus_tag LOCUS_09180 gene phnG 859 1278 CDS product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892105.1 protein_id gnl|my_center|LOCUS_09180 1385 1579 gene locus_tag LOCUS_09190 1385 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1586 1759 gene locus_tag LOCUS_09200 1586 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 2545 1793 gene locus_tag LOCUS_09210 2545 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 3623 2508 gene locus_tag LOCUS_09220 3623 2508 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010680900.1 protein_id gnl|my_center|LOCUS_09220 4175 4047 gene locus_tag LOCUS_09230 4175 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence130 <1 732 gene locus_tag LOCUS_09240 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024331.1:glycosyltransferase family 2 protein 1745 2281 gene locus_tag LOCUS_09250 1745 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 2330 3493 gene locus_tag LOCUS_09260 2330 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence131 1239 655 gene locus_tag LOCUS_09270 1239 655 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020205.1 protein_id gnl|my_center|LOCUS_09270 1813 1376 gene locus_tag LOCUS_09280 1813 1376 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358219.1 protein_id gnl|my_center|LOCUS_09280 2308 2177 gene locus_tag LOCUS_09290 2308 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence132 1193 120 gene locus_tag LOCUS_09300 1193 120 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021442.1 protein_id gnl|my_center|LOCUS_09300 2247 1258 gene locus_tag LOCUS_09310 2247 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09310 2541 2278 gene locus_tag LOCUS_09320 2541 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09320 3206 2580 gene locus_tag LOCUS_09330 3206 2580 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990793.1 protein_id gnl|my_center|LOCUS_09330 <4314 3231 gene locus_tag LOCUS_09340 <4314 3231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023790.1:geranylgeranyl reductase family protein >Feature sequence133 253 552 gene locus_tag LOCUS_09350 253 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1973 666 gene locus_tag LOCUS_09360 1973 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09360 3384 1960 gene locus_tag LOCUS_09370 3384 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09370 <4307 3523 gene locus_tag LOCUS_09380 <4307 3523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209226.1:cation-transporting P-type ATPase >Feature sequence134 <1 531 gene locus_tag LOCUS_09390 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393367.1:pyruvate kinase 2256 532 gene locus_tag LOCUS_09400 2256 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 2401 3396 gene locus_tag LOCUS_09410 2401 3396 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence135 142 312 gene locus_tag LOCUS_09420 142 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 1560 1390 gene locus_tag LOCUS_09430 1560 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 1772 1608 gene locus_tag LOCUS_09440 1772 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 2619 1969 gene locus_tag LOCUS_09450 2619 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 3323 3066 gene locus_tag LOCUS_09460 3323 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 >Feature sequence136 <1 1281 gene locus_tag LOCUS_09470 <1 1281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011285756.1:imidazolonepropionase 1301 2767 gene locus_tag LOCUS_09480 1301 2767 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406951.1 protein_id gnl|my_center|LOCUS_09480 2770 3885 gene locus_tag LOCUS_09490 2770 3885 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878013.1 protein_id gnl|my_center|LOCUS_09490 3961 4176 gene locus_tag LOCUS_09500 3961 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence137 1 1134 gene locus_tag LOCUS_09510 1 1134 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948785.1 protein_id gnl|my_center|LOCUS_09510 1428 2249 gene locus_tag LOCUS_09520 1428 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence138 <1 568 gene locus_tag LOCUS_09530 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020804.1:PAS domain S-box protein 534 2510 gene locus_tag LOCUS_09540 534 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 2776 3426 gene locus_tag LOCUS_09550 2776 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 <4135 3491 gene locus_tag LOCUS_09560 <4135 3491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024468.1:prephenate dehydrogenase >Feature sequence139 <1 524 gene locus_tag LOCUS_09570 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020758.1:HD domain-containing protein 596 2341 gene locus_tag LOCUS_09580 gene argS 596 2341 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_09580 2431 2682 gene locus_tag LOCUS_09590 gene purS 2431 2682 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066286.1 protein_id gnl|my_center|LOCUS_09590 2679 3380 gene locus_tag LOCUS_09600 gene purQ 2679 3380 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021958.1 protein_id gnl|my_center|LOCUS_09600 3399 3845 gene locus_tag LOCUS_09610 3399 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 >Feature sequence140 1939 980 gene locus_tag LOCUS_09620 1939 980 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975753.1 protein_id gnl|my_center|LOCUS_09620 2745 1942 gene locus_tag LOCUS_09630 2745 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 3157 2738 gene locus_tag LOCUS_09640 3157 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence141 295 3111 gene locus_tag LOCUS_09650 295 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 3849 3253 gene locus_tag LOCUS_09660 3849 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence142 67 342 gene locus_tag LOCUS_09670 67 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1761 370 gene locus_tag LOCUS_09680 1761 370 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088854992.1 protein_id gnl|my_center|LOCUS_09680 2245 2814 gene locus_tag LOCUS_09690 2245 2814 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990722.1 protein_id gnl|my_center|LOCUS_09690 2836 3861 gene locus_tag LOCUS_09700 2836 3861 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020363.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence143 1226 774 gene locus_tag LOCUS_09710 1226 774 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023392.1 protein_id gnl|my_center|LOCUS_09710 2973 1231 gene locus_tag LOCUS_09720 2973 1231 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869281.1 protein_id gnl|my_center|LOCUS_09720 3212 2973 gene locus_tag LOCUS_09730 3212 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 <4006 3360 gene locus_tag LOCUS_09740 <4006 3360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583336.1:MFS transporter >Feature sequence144 >Feature sequence145 <1 533 gene locus_tag LOCUS_09750 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024009.1:adenylosuccinate synthase 563 2854 gene locus_tag LOCUS_09760 563 2854 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021816.1 protein_id gnl|my_center|LOCUS_09760 2861 3871 gene locus_tag LOCUS_09770 gene amrS 2861 3871 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023404.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence146 2870 3436 gene locus_tag LOCUS_09780 2870 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 3436 3852 gene locus_tag LOCUS_09790 3436 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 >Feature sequence147 873 481 gene locus_tag LOCUS_09800 873 481 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065550.1 protein_id gnl|my_center|LOCUS_09800 2123 873 gene locus_tag LOCUS_09810 2123 873 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065549.1 protein_id gnl|my_center|LOCUS_09810 2602 2141 gene locus_tag LOCUS_09820 2602 2141 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022827.1 protein_id gnl|my_center|LOCUS_09820 2929 2702 gene locus_tag LOCUS_09830 2929 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 <3911 2943 gene locus_tag LOCUS_09840 <3911 2943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024427.1:L-threonylcarbamoyladenylate synthase >Feature sequence148 <1 880 gene locus_tag LOCUS_09850 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836710.1:DUF3267 domain-containing protein 1275 2480 gene locus_tag LOCUS_09860 1275 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 2662 3096 gene locus_tag LOCUS_09870 2662 3096 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023470.1 protein_id gnl|my_center|LOCUS_09870 <3906 3153 gene locus_tag LOCUS_09880 <3906 3153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003414705.1:formate dehydrogenase accessory sulfurtransferase FdhD >Feature sequence149 1822 341 gene locus_tag LOCUS_09890 gene fpoN 1822 341 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_09890 3285 1819 gene locus_tag LOCUS_09900 gene fpoM 3285 1819 CDS product F(420)H(2) dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021519.1 protein_id gnl|my_center|LOCUS_09900 <3891 3286 gene locus_tag LOCUS_09910 <3891 3286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021518.1:F420H2 dehydrogenase subunit FpoL >Feature sequence150 <1 1003 gene locus_tag LOCUS_09920 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021937.1:ATP-binding protein 2057 1152 gene locus_tag LOCUS_09930 2057 1152 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020718.1 protein_id gnl|my_center|LOCUS_09930 2752 2069 gene locus_tag LOCUS_09940 2752 2069 CDS product DUF2150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023591.1 protein_id gnl|my_center|LOCUS_09940 3610 2816 gene locus_tag LOCUS_09950 3610 2816 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148183444.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence151 1037 792 gene locus_tag LOCUS_09960 1037 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 1274 1065 gene locus_tag LOCUS_09970 1274 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1781 1365 gene locus_tag LOCUS_09980 gene nifU 1781 1365 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_09980 2970 1810 gene locus_tag LOCUS_09990 2970 1810 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064599.1 protein_id gnl|my_center|LOCUS_09990 3353 2988 gene locus_tag LOCUS_10000 3353 2988 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318897.1 protein_id gnl|my_center|LOCUS_10000 3625 3371 gene locus_tag LOCUS_10010 3625 3371 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979944.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence152 169 1215 gene locus_tag LOCUS_10020 169 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence153 524 706 gene locus_tag LOCUS_10030 524 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 725 1732 gene locus_tag LOCUS_10040 725 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1814 2317 gene locus_tag LOCUS_10050 1814 2317 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021413.1 protein_id gnl|my_center|LOCUS_10050 3437 3513 gene locus_tag LOCUS_t00120 3437 3513 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence154 <1 1468 gene locus_tag LOCUS_10060 <1 1468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480160.1:biosynthetic arginine decarboxylase 1500 1661 gene locus_tag LOCUS_10070 1500 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1729 2619 gene locus_tag LOCUS_10080 gene moaA 1729 2619 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020164.1 protein_id gnl|my_center|LOCUS_10080 3209 2616 gene locus_tag LOCUS_10090 3209 2616 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066526.1 protein_id gnl|my_center|LOCUS_10090 3700 3206 gene locus_tag LOCUS_10100 3700 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10100 >Feature sequence155 772 506 gene locus_tag LOCUS_10110 772 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 876 1292 gene locus_tag LOCUS_10120 876 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 2663 1584 gene locus_tag LOCUS_10130 gene aroC 2663 1584 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_10130 3423 2665 gene locus_tag LOCUS_10140 gene moeB 3423 2665 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460729.1 protein_id gnl|my_center|LOCUS_10140 3740 3459 gene locus_tag LOCUS_10150 3740 3459 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066210.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence156 183 107 gene locus_tag LOCUS_t00130 183 107 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1347 241 gene locus_tag LOCUS_10160 1347 241 CDS product DUF2117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990783.1 protein_id gnl|my_center|LOCUS_10160 1709 1371 gene locus_tag LOCUS_10170 1709 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 <3704 1806 gene locus_tag LOCUS_10180 <3704 1806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020657.1:pyruvate, phosphate dikinase >Feature sequence157 3454 731 gene locus_tag LOCUS_10190 3454 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence158 <1 899 gene locus_tag LOCUS_10200 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022964.1:sugar phosphate nucleotidyltransferase 787 2289 gene locus_tag LOCUS_10210 787 2289 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875981.1 protein_id gnl|my_center|LOCUS_10210 793 828 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3450 2323 gene locus_tag LOCUS_10220 3450 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence159 1491 406 gene locus_tag LOCUS_10230 1491 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1619 1491 gene locus_tag LOCUS_10240 1619 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1895 2659 gene locus_tag LOCUS_10250 gene cofE 1895 2659 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023428.1 protein_id gnl|my_center|LOCUS_10250 3665 2667 gene locus_tag LOCUS_10260 gene purM 3665 2667 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066059.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence160 27 539 gene locus_tag LOCUS_10270 27 539 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065101.1 protein_id gnl|my_center|LOCUS_10270 613 1545 gene locus_tag LOCUS_10280 613 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1548 2114 gene locus_tag LOCUS_10290 1548 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 2102 2506 gene locus_tag LOCUS_10300 2102 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 2528 2974 gene locus_tag LOCUS_10310 2528 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence161 <1 1061 gene locus_tag LOCUS_10320 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024301.1:radical SAM protein 1108 2133 gene locus_tag LOCUS_10330 1108 2133 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589523.1 protein_id gnl|my_center|LOCUS_10330 2227 2141 gene locus_tag LOCUS_t00140 2227 2141 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2401 3204 gene locus_tag LOCUS_10340 gene rnc 2401 3204 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_10340 3568 3230 gene locus_tag LOCUS_10350 3568 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence162 350 1534 gene locus_tag LOCUS_10360 350 1534 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022500.1 protein_id gnl|my_center|LOCUS_10360 1594 2559 gene locus_tag LOCUS_10370 1594 2559 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391615.1 protein_id gnl|my_center|LOCUS_10370 2863 3063 gene locus_tag LOCUS_10380 2863 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10380 >Feature sequence163 3 2162 gene locus_tag LOCUS_10390 3 2162 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022991.1 protein_id gnl|my_center|LOCUS_10390 2348 2473 gene locus_tag LOCUS_10400 2348 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 <3624 2781 gene locus_tag LOCUS_10410 <3624 2781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020482.1:aspartate-semialdehyde dehydrogenase >Feature sequence164 1954 614 gene locus_tag LOCUS_10420 1954 614 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875980.1 protein_id gnl|my_center|LOCUS_10420 3116 1929 gene locus_tag LOCUS_10430 3116 1929 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868366.1 protein_id gnl|my_center|LOCUS_10430 <3619 3113 gene locus_tag LOCUS_10440 <3619 3113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941811.1:hopanoid biosynthesis associated radical SAM protein HpnJ >Feature sequence165 1368 121 gene locus_tag LOCUS_10450 1368 121 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065539.1 protein_id gnl|my_center|LOCUS_10450 1492 2316 gene locus_tag LOCUS_10460 1492 2316 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023089.1 protein_id gnl|my_center|LOCUS_10460 2525 2818 gene locus_tag LOCUS_10470 2525 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence166 886 140 gene locus_tag LOCUS_10480 gene cbiG 886 140 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903134.1 protein_id gnl|my_center|LOCUS_10480 1737 1012 gene locus_tag LOCUS_10490 1737 1012 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024142.1 protein_id gnl|my_center|LOCUS_10490 2347 1730 gene locus_tag LOCUS_10500 2347 1730 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024143.1 protein_id gnl|my_center|LOCUS_10500 2888 2349 gene locus_tag LOCUS_10510 gene cbiT 2888 2349 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024144.1 protein_id gnl|my_center|LOCUS_10510 2992 3183 gene locus_tag LOCUS_10520 2992 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence167 1391 672 gene locus_tag LOCUS_10530 gene alaXM 1391 672 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022008.1 protein_id gnl|my_center|LOCUS_10530 1885 1373 gene locus_tag LOCUS_10540 1885 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 2651 2040 gene locus_tag LOCUS_10550 2651 2040 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021972.1 protein_id gnl|my_center|LOCUS_10550 3412 2630 gene locus_tag LOCUS_10560 3412 2630 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024199.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence168 896 336 gene locus_tag LOCUS_10570 896 336 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021817.1 protein_id gnl|my_center|LOCUS_10570 2046 877 gene locus_tag LOCUS_10580 2046 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 <3513 2107 gene locus_tag LOCUS_10590 <3513 2107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020145.1:thermosome subunit beta >Feature sequence169 >Feature sequence170 48 476 gene locus_tag LOCUS_10600 48 476 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431730.1 protein_id gnl|my_center|LOCUS_10600 642 1262 gene locus_tag LOCUS_10610 gene engB 642 1262 CDS product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022535.1 protein_id gnl|my_center|LOCUS_10610 <3499 1287 gene locus_tag LOCUS_10620 <3499 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878955.1:DEAD/DEAH box helicase >Feature sequence171 950 45 gene locus_tag LOCUS_10630 950 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1790 972 gene locus_tag LOCUS_10640 1790 972 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021191.1 protein_id gnl|my_center|LOCUS_10640 2319 1870 gene locus_tag LOCUS_10650 gene rimI 2319 1870 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978207.1 protein_id gnl|my_center|LOCUS_10650 3483 2338 gene locus_tag LOCUS_10660 3483 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064972.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence172 <1 997 gene locus_tag LOCUS_10670 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390101.1:glycosyltransferase 2231 1002 gene locus_tag LOCUS_10680 2231 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 2747 2238 gene locus_tag LOCUS_10690 2747 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 <3490 2805 gene locus_tag LOCUS_10700 <3490 2805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228324.1:mannosyl-3-phosphoglycerate phosphatase >Feature sequence173 10 660 gene locus_tag LOCUS_10710 10 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 657 1067 gene locus_tag LOCUS_10720 657 1067 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397752.1 protein_id gnl|my_center|LOCUS_10720 1811 1077 gene locus_tag LOCUS_10730 1811 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 2637 1885 gene locus_tag LOCUS_10740 2637 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence174 1 1365 gene locus_tag LOCUS_10750 1 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1649 1422 gene locus_tag LOCUS_10760 1649 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 2000 2569 gene locus_tag LOCUS_10770 2000 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3435 2851 gene locus_tag LOCUS_10780 3435 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence175 <1 1043 gene locus_tag LOCUS_10790 <1 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020340.1:ATP-binding cassette domain-containing protein 1119 1730 gene locus_tag LOCUS_10800 1119 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 2129 1698 gene locus_tag LOCUS_10810 2129 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020121.1 protein_id gnl|my_center|LOCUS_10810 2199 2834 gene locus_tag LOCUS_10820 2199 2834 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066013.1 protein_id gnl|my_center|LOCUS_10820 2883 3173 gene locus_tag LOCUS_10830 2883 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence176 101 406 gene locus_tag LOCUS_10840 101 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 749 465 gene locus_tag LOCUS_10850 749 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 869 750 gene locus_tag LOCUS_10860 869 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 2132 975 gene locus_tag LOCUS_10870 2132 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 2512 2255 gene locus_tag LOCUS_10880 2512 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence177 1058 21 gene locus_tag LOCUS_10890 1058 21 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020704.1 protein_id gnl|my_center|LOCUS_10890 1209 2162 gene locus_tag LOCUS_10900 1209 2162 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_10900 2682 2149 gene locus_tag LOCUS_10910 2682 2149 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065830.1 protein_id gnl|my_center|LOCUS_10910 <3337 2754 gene locus_tag LOCUS_10920 <3337 2754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021656.1:class I SAM-dependent methyltransferase family protein >Feature sequence178 1692 574 gene locus_tag LOCUS_10930 1692 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 2557 1715 gene locus_tag LOCUS_10940 2557 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 >Feature sequence179 1314 79 gene locus_tag LOCUS_10950 gene hmgA 1314 79 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065600.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence180 <1 993 gene locus_tag LOCUS_10960 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023987.1:amidohydrolase family protein 990 1454 gene locus_tag LOCUS_10970 990 1454 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023986.1 protein_id gnl|my_center|LOCUS_10970 1468 2322 gene locus_tag LOCUS_10980 1468 2322 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023985.1 protein_id gnl|my_center|LOCUS_10980 2414 2587 gene locus_tag LOCUS_10990 2414 2587 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064803.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence181 1270 446 gene locus_tag LOCUS_11000 1270 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1734 1240 gene locus_tag LOCUS_11010 1734 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 2107 1988 gene locus_tag LOCUS_11020 2107 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 2843 2349 gene locus_tag LOCUS_11030 2843 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 3033 3152 gene locus_tag LOCUS_11040 3033 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence182 <1 1558 gene locus_tag LOCUS_11050 <1 1558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941642.1:phage tail sheath family protein 1624 2052 gene locus_tag LOCUS_11060 1624 2052 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_11060 2070 2435 gene locus_tag LOCUS_11070 2070 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 protein_id gnl|my_center|LOCUS_11070 2627 3061 gene locus_tag LOCUS_11080 2627 3061 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence183 <1 692 gene locus_tag LOCUS_11090 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082348.1:type I-B CRISPR-associated protein Cas7/Csh2 701 1423 gene locus_tag LOCUS_11100 701 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence184 <1 1348 gene locus_tag LOCUS_11110 <1 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016159.1:ATP-binding protein 3057 1651 gene locus_tag LOCUS_11120 3057 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence185 >Feature sequence186 1848 1516 gene locus_tag LOCUS_11130 1848 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence187 <1 579 gene locus_tag LOCUS_11140 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877280.1:ABC transporter ATP-binding protein 576 1274 gene locus_tag LOCUS_11150 576 1274 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402640.1 protein_id gnl|my_center|LOCUS_11150 1274 1930 gene locus_tag LOCUS_11160 1274 1930 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877278.1 protein_id gnl|my_center|LOCUS_11160 <3180 1955 gene locus_tag LOCUS_11170 <3180 1955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064974.1:DHH family phosphoesterase >Feature sequence188 81 1352 gene locus_tag LOCUS_11180 81 1352 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 protein_id gnl|my_center|LOCUS_11180 1345 1512 gene locus_tag LOCUS_11190 1345 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1691 2056 gene locus_tag LOCUS_11200 1691 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 2677 2102 gene locus_tag LOCUS_11210 2677 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 3175 2792 gene locus_tag LOCUS_11220 3175 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence189 1279 29 gene locus_tag LOCUS_11230 1279 29 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_11230 1407 2429 gene locus_tag LOCUS_11240 1407 2429 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020570.1 protein_id gnl|my_center|LOCUS_11240 2426 3019 gene locus_tag LOCUS_11250 2426 3019 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020569.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence190 98 1075 gene locus_tag LOCUS_11260 98 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1673 1281 gene locus_tag LOCUS_11270 1673 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1880 1707 gene locus_tag LOCUS_11280 1880 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2130 2002 gene locus_tag LOCUS_11290 2130 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 2896 2234 gene locus_tag LOCUS_11300 2896 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence191 828 1547 gene locus_tag LOCUS_11310 828 1547 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103921.1 protein_id gnl|my_center|LOCUS_11310 2246 1836 gene locus_tag LOCUS_11320 2246 1836 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876396.1 protein_id gnl|my_center|LOCUS_11320 2902 2576 gene locus_tag LOCUS_11330 2902 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence192 1420 506 gene locus_tag LOCUS_11340 1420 506 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_11340 2117 1551 gene locus_tag LOCUS_11350 2117 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 2572 2447 gene locus_tag LOCUS_11360 2572 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence193 834 595 gene locus_tag LOCUS_11370 834 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1495 758 gene locus_tag LOCUS_11380 1495 758 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021826.1 protein_id gnl|my_center|LOCUS_11380 1657 2040 gene locus_tag LOCUS_11390 1657 2040 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020729.1 protein_id gnl|my_center|LOCUS_11390 2166 2741 gene locus_tag LOCUS_11400 2166 2741 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392800.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence194 >Feature sequence195 <1 774 gene locus_tag LOCUS_11410 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065199.1:energy-coupling factor transporter transmembrane protein EcfT 791 2515 gene locus_tag LOCUS_11420 791 2515 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021751.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence196 <1 1068 gene locus_tag LOCUS_11430 <1 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065667.1:phosphoribosylamine--glycine ligase 1074 1994 gene locus_tag LOCUS_11440 gene argF 1074 1994 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878750.1 protein_id gnl|my_center|LOCUS_11440 2072 2158 gene locus_tag LOCUS_t00150 2072 2158 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <3097 2108 gene locus_tag LOCUS_11450 <3097 2108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020662.1:class I SAM-dependent methyltransferase family protein >Feature sequence197 71 1402 gene locus_tag LOCUS_11460 gene acsC 71 1402 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021046.1 protein_id gnl|my_center|LOCUS_11460 1612 1406 gene locus_tag LOCUS_11470 1612 1406 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870227.1 protein_id gnl|my_center|LOCUS_11470 2028 1609 gene locus_tag LOCUS_11480 2028 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 2217 2870 gene locus_tag LOCUS_11490 2217 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence198 <1 771 gene locus_tag LOCUS_11500 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784336.1:glycosyltransferase 2090 777 gene locus_tag LOCUS_11510 2090 777 CDS product TIGR04295 family B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533194.1 protein_id gnl|my_center|LOCUS_11510 2332 2691 gene locus_tag LOCUS_11520 2332 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 2648 3052 gene locus_tag LOCUS_11530 2648 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence199 1353 661 gene locus_tag LOCUS_11540 1353 661 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023274.1 protein_id gnl|my_center|LOCUS_11540 1791 1480 gene locus_tag LOCUS_11550 1791 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 2332 2258 gene locus_tag LOCUS_t00160 2332 2258 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2952 2617 gene locus_tag LOCUS_11560 2952 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 >Feature sequence200 233 114 gene locus_tag LOCUS_11570 233 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1357 377 gene locus_tag LOCUS_11580 1357 377 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066092.1 protein_id gnl|my_center|LOCUS_11580 1778 1389 gene locus_tag LOCUS_11590 1778 1389 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023936.1 protein_id gnl|my_center|LOCUS_11590 2956 1784 gene locus_tag LOCUS_11600 2956 1784 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence201 <1 501 gene locus_tag LOCUS_11610 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065213.1:exosome complex exonuclease Rrp41 494 1306 gene locus_tag LOCUS_11620 gene rrp42 494 1306 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021779.1 protein_id gnl|my_center|LOCUS_11620 1198 1250 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1310 1831 gene locus_tag LOCUS_11630 1310 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1840 1977 gene locus_tag LOCUS_11640 1840 1977 CDS product DNA-directed RNA polymerase subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021777.1 protein_id gnl|my_center|LOCUS_11640 2390 2752 gene locus_tag LOCUS_11650 2390 2752 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878647.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence202 626 243 gene locus_tag LOCUS_11660 626 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11660 956 657 gene locus_tag LOCUS_11670 956 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11670 <2978 1489 gene locus_tag LOCUS_11680 <2978 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249788.1:heavy metal translocating P-type ATPase >Feature sequence203 2072 1533 gene locus_tag LOCUS_11690 2072 1533 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880243.1 protein_id gnl|my_center|LOCUS_11690 2293 2111 gene locus_tag LOCUS_11700 2293 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence204 <1 1189 gene locus_tag LOCUS_11710 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990912.1:PQQ-binding-like beta-propeller repeat protein 1174 2703 gene locus_tag LOCUS_11720 1174 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence205 154 369 gene locus_tag LOCUS_11730 154 369 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_11730 1562 1134 gene locus_tag LOCUS_11740 1562 1134 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023482.1 protein_id gnl|my_center|LOCUS_11740 1818 1603 gene locus_tag LOCUS_11750 1818 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 2049 1834 gene locus_tag LOCUS_11760 2049 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 2638 2321 gene locus_tag LOCUS_11770 2638 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 2754 2635 gene locus_tag LOCUS_11780 2754 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence206 1480 722 gene locus_tag LOCUS_11790 gene mtrD 1480 722 CDS product tetrahydromethanopterin S-methyltransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020333.1 protein_id gnl|my_center|LOCUS_11790 2385 1477 gene locus_tag LOCUS_11800 gene mtrE 2385 1477 CDS product tetrahydromethanopterin S-methyltransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020334.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence207 430 439 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 455 682 gene locus_tag LOCUS_11810 455 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1238 1561 gene locus_tag LOCUS_11820 1238 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1622 2059 gene locus_tag LOCUS_11830 1622 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 2063 2902 gene locus_tag LOCUS_11840 2063 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence208 <1 522 gene locus_tag LOCUS_11850 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164993978.1:IS66 family transposase 827 1420 gene locus_tag LOCUS_11860 827 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1605 1892 gene locus_tag LOCUS_11870 1605 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence209 810 139 gene locus_tag LOCUS_11880 810 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11880 1953 823 gene locus_tag LOCUS_11890 gene fpoD 1953 823 CDS product F420H2 dehydrogenase subunit FpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021512.1 protein_id gnl|my_center|LOCUS_11890 2422 1964 gene locus_tag LOCUS_11900 gene fpoC 2422 1964 CDS product F420H2 dehydrogenase subunit FpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021511.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence210 <1 603 gene locus_tag LOCUS_11910 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024213.1:ScpA family protein 551 1681 gene locus_tag LOCUS_11920 gene scpB 551 1681 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065962.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence211 1745 435 gene locus_tag LOCUS_11930 gene ablA 1745 435 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023873.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence212 2 922 gene locus_tag LOCUS_11940 2 922 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066036.1 protein_id gnl|my_center|LOCUS_11940 1125 931 gene locus_tag LOCUS_11950 1125 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 2549 1260 gene locus_tag LOCUS_11960 2549 1260 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence213 <1 1060 gene locus_tag LOCUS_11970 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022224.1:tetratricopeptide repeat protein 2152 1049 gene locus_tag LOCUS_11980 2152 1049 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence214 112 681 gene locus_tag LOCUS_11990 112 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 935 648 gene locus_tag LOCUS_12000 935 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1499 948 gene locus_tag LOCUS_12010 1499 948 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024211.1 protein_id gnl|my_center|LOCUS_12010 2211 1648 gene locus_tag LOCUS_12020 2211 1648 CDS product DUF2115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870151.1 protein_id gnl|my_center|LOCUS_12020 <2826 2211 gene locus_tag LOCUS_12030 <2826 2211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021687.1:ribose 5-phosphate isomerase A >Feature sequence215 1671 460 gene locus_tag LOCUS_12040 1671 460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065859.1 protein_id gnl|my_center|LOCUS_12040 2579 1668 gene locus_tag LOCUS_12050 2579 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence216 430 1662 gene locus_tag LOCUS_12060 430 1662 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065858.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence217 41 1459 gene locus_tag LOCUS_12070 41 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1494 2501 gene locus_tag LOCUS_12080 gene cofG 1494 2501 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755891.1 protein_id gnl|my_center|LOCUS_12080 2728 2573 gene locus_tag LOCUS_12090 2728 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence218 33 257 gene locus_tag LOCUS_12100 33 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 551 2383 gene locus_tag LOCUS_12110 551 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence219 495 686 gene locus_tag LOCUS_12120 495 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 804 977 gene locus_tag LOCUS_12130 804 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1035 1475 gene locus_tag LOCUS_12140 1035 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1556 2305 gene locus_tag LOCUS_12150 1556 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence220 900 616 gene locus_tag LOCUS_12160 900 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1367 879 gene locus_tag LOCUS_12170 1367 879 CDS product DUF1890 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020187.1 protein_id gnl|my_center|LOCUS_12170 <2733 1379 gene locus_tag LOCUS_12180 <2733 1379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024395.1:methanogenesis marker 14 protein >Feature sequence221 <1 711 gene locus_tag LOCUS_12190 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023607.1:PKD domain-containing protein 713 1831 gene locus_tag LOCUS_12200 713 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence222 >Feature sequence223 2158 593 gene locus_tag LOCUS_12210 2158 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 2659 2177 gene locus_tag LOCUS_12220 2659 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence224 246 1100 gene locus_tag LOCUS_12230 246 1100 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869583.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence225 509 1057 gene locus_tag LOCUS_12240 509 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1177 1347 gene locus_tag LOCUS_12250 1177 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 >Feature sequence226 <1 1511 gene locus_tag LOCUS_12260 <1 1511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020916.1:cobaltochelatase subunit CobN 1753 1565 gene locus_tag LOCUS_12270 1753 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 <2607 1806 gene locus_tag LOCUS_12280 <2607 1806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876079.1:methanogen output domain 1-containing protein >Feature sequence227 1012 2070 gene locus_tag LOCUS_12290 1012 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence228 79 1890 gene locus_tag LOCUS_12300 79 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 2552 2082 gene locus_tag LOCUS_12310 2552 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence229 <1 1807 gene locus_tag LOCUS_12320 <1 1807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021291.1:PAS domain S-box protein 1794 2189 gene locus_tag LOCUS_12330 1794 2189 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060853.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence230 573 722 gene locus_tag LOCUS_12340 573 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12340 706 715 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 835 1056 gene locus_tag LOCUS_12350 835 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12350 2278 1070 gene locus_tag LOCUS_12360 gene ahbC 2278 1070 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022974.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence231 382 32 gene locus_tag LOCUS_12370 382 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12370 779 399 gene locus_tag LOCUS_12380 779 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12380 1571 780 gene locus_tag LOCUS_12390 1571 780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020123.1 protein_id gnl|my_center|LOCUS_12390 <2509 1580 gene locus_tag LOCUS_12400 <2509 1580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020124.1:ABC transporter substrate-binding protein >Feature sequence232 511 308 gene locus_tag LOCUS_12410 511 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 694 975 gene locus_tag LOCUS_12420 694 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1396 875 gene locus_tag LOCUS_12430 1396 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1840 1544 gene locus_tag LOCUS_12440 1840 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 <2507 1837 gene locus_tag LOCUS_12450 <2507 1837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022843.1:phosphoadenosine phosphosulfate reductase family protein >Feature sequence233 <2504 720 gene locus_tag LOCUS_12460 <2504 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941655.1:phage tail protein >Feature sequence234 1231 890 gene locus_tag LOCUS_12470 1231 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 2253 1321 gene locus_tag LOCUS_12480 2253 1321 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024078.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence235 >Feature sequence236 43 843 gene locus_tag LOCUS_12490 43 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 987 1223 gene locus_tag LOCUS_12500 987 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1753 1322 gene locus_tag LOCUS_12510 1753 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12510 <2419 1845 gene locus_tag LOCUS_12520 <2419 1845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065935.1:IS1182-like element ISMac1 family transposase note possible pseudo, frameshifted >Feature sequence237 795 82 gene locus_tag LOCUS_12530 795 82 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021104.1 protein_id gnl|my_center|LOCUS_12530 1061 810 gene locus_tag LOCUS_12540 1061 810 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867462.1 protein_id gnl|my_center|LOCUS_12540 1819 1061 gene locus_tag LOCUS_12550 gene rpl4p 1819 1061 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021102.1 protein_id gnl|my_center|LOCUS_12550 2247 1825 gene locus_tag LOCUS_12560 2247 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence238 441 37 gene locus_tag LOCUS_12570 441 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1464 454 gene locus_tag LOCUS_12580 1464 454 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932409.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence239 >Feature sequence240 <1 810 gene locus_tag LOCUS_12590 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022929.1:anthranilate phosphoribosyltransferase 819 1505 gene locus_tag LOCUS_12600 819 1505 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065580.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence241 >Feature sequence242 499 95 gene locus_tag LOCUS_12610 499 95 CDS product WxcM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202464.1 protein_id gnl|my_center|LOCUS_12610 1470 496 gene locus_tag LOCUS_12620 gene pseB 1470 496 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence243 302 604 gene locus_tag LOCUS_12630 302 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence244 <1 1037 gene locus_tag LOCUS_12640 <1 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083755994.1:ISH3 family transposase 1798 1043 gene locus_tag LOCUS_12650 1798 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 2088 1870 gene locus_tag LOCUS_12660 2088 1870 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence245 <1 2029 gene locus_tag LOCUS_12670 <1 2029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020572.1:DNA mismatch repair protein MutS >Feature sequence246 341 583 gene locus_tag LOCUS_12680 341 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 580 744 gene locus_tag LOCUS_12690 580 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 752 1660 gene locus_tag LOCUS_12700 752 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903431.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence247 1932 1705 gene locus_tag LOCUS_12710 1932 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence248 981 43 gene locus_tag LOCUS_12720 981 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875877.1 protein_id gnl|my_center|LOCUS_12720 <2256 1009 gene locus_tag LOCUS_12730 <2256 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978991.1:ATP-binding protein 1756 1765 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence249 1 414 gene locus_tag LOCUS_12740 1 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 2134 728 gene locus_tag LOCUS_12750 gene purF 2134 728 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065634.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence250 486 1448 gene locus_tag LOCUS_12760 486 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1462 2226 gene locus_tag LOCUS_12770 1462 2226 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence251 <1 628 gene locus_tag LOCUS_12780 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000198563.1:IS91 family transposase 896 1639 gene locus_tag LOCUS_12790 896 1639 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065997.1 protein_id gnl|my_center|LOCUS_12790 1895 1665 gene locus_tag LOCUS_12800 1895 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence252 114 500 gene locus_tag LOCUS_12810 114 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1468 587 gene locus_tag LOCUS_12820 1468 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875877.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence253 188 904 gene locus_tag LOCUS_12830 188 904 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879451.1 protein_id gnl|my_center|LOCUS_12830 1248 901 gene locus_tag LOCUS_12840 1248 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065924.1 protein_id gnl|my_center|LOCUS_12840 1684 1286 gene locus_tag LOCUS_12850 1684 1286 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024076.1 protein_id gnl|my_center|LOCUS_12850 2125 1760 gene locus_tag LOCUS_12860 2125 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence254 <1 670 gene locus_tag LOCUS_12870 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867813.1:4-phosphopantoate--beta-alanine ligase 2016 748 gene locus_tag LOCUS_12880 2016 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence255 <1 1624 gene locus_tag LOCUS_12890 <1 1624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015646.1:leucine--tRNA ligase 1671 2138 gene locus_tag LOCUS_12900 1671 2138 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024219.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence256 1512 355 gene locus_tag LOCUS_12910 1512 355 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 protein_id gnl|my_center|LOCUS_12910 <2205 1533 gene locus_tag LOCUS_12920 <2205 1533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052279215.1:NADPH-dependent F420 reductase >Feature sequence257 <2203 1154 gene locus_tag LOCUS_12930 <2203 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124879.1:glycosyl transferase >Feature sequence258 <1 540 gene locus_tag LOCUS_12940 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870578.1:N-acetylneuraminate synthase family protein 547 1575 gene locus_tag LOCUS_12950 547 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence259 <1 761 gene locus_tag LOCUS_12960 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546047.1:glycosyltransferase family 2 protein >Feature sequence260 773 270 gene locus_tag LOCUS_12970 773 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12970 992 855 gene locus_tag LOCUS_12980 992 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12980 <2160 1029 gene locus_tag LOCUS_12990 <2160 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022339.1:BREX-1 system phosphatase PglZ type A >Feature sequence261 713 1060 gene locus_tag LOCUS_13000 713 1060 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065843.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence262 >Feature sequence263 647 1366 gene locus_tag LOCUS_13010 647 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence264 407 1366 gene locus_tag LOCUS_13020 407 1366 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319540.1 protein_id gnl|my_center|LOCUS_13020 <2036 1350 gene locus_tag LOCUS_13030 <2036 1350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879565.1:formylmethanofuran--tetrahydromethanopterin N-formyltransferase >Feature sequence265 1 1029 gene locus_tag LOCUS_13040 1 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1020 1637 gene locus_tag LOCUS_13050 1020 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence266 115 1560 gene locus_tag LOCUS_13060 gene wzx 115 1560 CDS product O83 family O-antigen flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102965.1 protein_id gnl|my_center|LOCUS_13060 1562 1684 gene locus_tag LOCUS_13070 1562 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070