>Feature sequence001 414 1463 gene locus_tag LOCUS_00010 414 1463 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731544.1 protein_id gnl|my_center|LOCUS_00010 1460 2278 gene locus_tag LOCUS_00020 1460 2278 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974317.1 protein_id gnl|my_center|LOCUS_00020 3265 2267 gene locus_tag LOCUS_00030 3265 2267 CDS product 1,5-anhydro-D-fructose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067379.1 protein_id gnl|my_center|LOCUS_00030 4083 3286 gene locus_tag LOCUS_00040 4083 3286 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726796.1 protein_id gnl|my_center|LOCUS_00040 4881 4096 gene locus_tag LOCUS_00050 gene fabG 4881 4096 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390765.1 protein_id gnl|my_center|LOCUS_00050 5871 4891 gene locus_tag LOCUS_00060 5871 4891 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726798.1 protein_id gnl|my_center|LOCUS_00060 6545 5886 gene locus_tag LOCUS_00070 6545 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891624.1 protein_id gnl|my_center|LOCUS_00070 6823 6542 gene locus_tag LOCUS_00080 6823 6542 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891625.1 protein_id gnl|my_center|LOCUS_00080 7117 6869 gene locus_tag LOCUS_00090 7117 6869 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891626.1 protein_id gnl|my_center|LOCUS_00090 7452 7126 gene locus_tag LOCUS_00100 7452 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 8054 7452 gene locus_tag LOCUS_00110 8054 7452 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726800.1 protein_id gnl|my_center|LOCUS_00110 9562 8057 gene locus_tag LOCUS_00120 9562 8057 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726801.1 protein_id gnl|my_center|LOCUS_00120 10929 9619 gene locus_tag LOCUS_00130 10929 9619 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726802.1 protein_id gnl|my_center|LOCUS_00130 11045 12730 gene locus_tag LOCUS_00140 11045 12730 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726803.1 protein_id gnl|my_center|LOCUS_00140 12797 13816 gene locus_tag LOCUS_00150 12797 13816 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_00150 13813 14244 gene locus_tag LOCUS_00160 13813 14244 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255194.1 protein_id gnl|my_center|LOCUS_00160 14241 16472 gene locus_tag LOCUS_00170 14241 16472 CDS product propanediol/glycerol family dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726995.1 protein_id gnl|my_center|LOCUS_00170 16469 16825 gene locus_tag LOCUS_00180 16469 16825 CDS product diol dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726994.1 protein_id gnl|my_center|LOCUS_00180 16822 18486 gene locus_tag LOCUS_00190 16822 18486 CDS product diol dehydratase reactivase ATPase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731201.1 protein_id gnl|my_center|LOCUS_00190 19377 18532 gene locus_tag LOCUS_00200 19377 18532 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 protein_id gnl|my_center|LOCUS_00200 19844 19374 gene locus_tag LOCUS_00210 19844 19374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21610 19841 gene locus_tag LOCUS_00220 21610 19841 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_00220 21616 21529 gene locus_tag LOCUS_t00010 21616 21529 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 22378 21623 gene locus_tag LOCUS_00230 gene budA 22378 21623 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068896.1 protein_id gnl|my_center|LOCUS_00230 22407 22778 gene locus_tag LOCUS_00240 22407 22778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 24011 22785 gene locus_tag LOCUS_00250 24011 22785 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229291.1 protein_id gnl|my_center|LOCUS_00250 24738 25148 gene locus_tag LOCUS_00260 24738 25148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 25159 25428 gene locus_tag LOCUS_00270 25159 25428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 26900 25524 gene locus_tag LOCUS_00280 26900 25524 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228765.1 protein_id gnl|my_center|LOCUS_00280 27238 27867 gene locus_tag LOCUS_00290 27238 27867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 27905 28684 gene locus_tag LOCUS_00300 27905 28684 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974682.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00300 29881 28685 gene locus_tag LOCUS_00310 gene lhgO 29881 28685 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546485.1 protein_id gnl|my_center|LOCUS_00310 29933 31153 gene locus_tag LOCUS_00320 29933 31153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 31224 32171 gene locus_tag LOCUS_00330 31224 32171 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_00330 >Feature sequence002 1001 24 gene locus_tag LOCUS_00340 1001 24 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_00340 1888 941 gene locus_tag LOCUS_00350 1888 941 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_00350 3160 1943 gene locus_tag LOCUS_00360 3160 1943 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029253.1 protein_id gnl|my_center|LOCUS_00360 3793 3212 gene locus_tag LOCUS_00370 3793 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 4760 3786 gene locus_tag LOCUS_00380 4760 3786 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227736.1 protein_id gnl|my_center|LOCUS_00380 5247 4762 gene locus_tag LOCUS_00390 5247 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 5785 5240 gene locus_tag LOCUS_00400 5785 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 5969 6628 gene locus_tag LOCUS_00410 5969 6628 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973245.1 protein_id gnl|my_center|LOCUS_00410 6625 7968 gene locus_tag LOCUS_00420 6625 7968 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 protein_id gnl|my_center|LOCUS_00420 7965 9164 gene locus_tag LOCUS_00430 gene lhgO 7965 9164 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546485.1 protein_id gnl|my_center|LOCUS_00430 9944 9165 gene locus_tag LOCUS_00440 9944 9165 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974682.1 protein_id gnl|my_center|LOCUS_00440 10611 9982 gene locus_tag LOCUS_00450 10611 9982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 10968 12344 gene locus_tag LOCUS_00460 10968 12344 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228765.1 protein_id gnl|my_center|LOCUS_00460 13632 12469 gene locus_tag LOCUS_00470 13632 12469 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084365.1 protein_id gnl|my_center|LOCUS_00470 14453 13632 gene locus_tag LOCUS_00480 14453 13632 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112952.1 protein_id gnl|my_center|LOCUS_00480 15367 14450 gene locus_tag LOCUS_00490 15367 14450 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529815.1 protein_id gnl|my_center|LOCUS_00490 16434 15364 gene locus_tag LOCUS_00500 16434 15364 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140151.1 protein_id gnl|my_center|LOCUS_00500 16572 17798 gene locus_tag LOCUS_00510 16572 17798 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229291.1 protein_id gnl|my_center|LOCUS_00510 18380 17805 gene locus_tag LOCUS_00520 18380 17805 CDS product nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015392.1 protein_id gnl|my_center|LOCUS_00520 18407 19174 gene locus_tag LOCUS_00530 gene budA 18407 19174 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068896.1 protein_id gnl|my_center|LOCUS_00530 19181 19268 gene locus_tag LOCUS_t00020 19181 19268 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19187 20956 gene locus_tag LOCUS_00540 19187 20956 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_00540 20953 21423 gene locus_tag LOCUS_00550 20953 21423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 21420 22265 gene locus_tag LOCUS_00560 21420 22265 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 protein_id gnl|my_center|LOCUS_00560 23301 22255 gene locus_tag LOCUS_00570 23301 22255 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056643.1 protein_id gnl|my_center|LOCUS_00570 23389 24387 gene locus_tag LOCUS_00580 23389 24387 CDS product 1,5-anhydro-D-fructose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067379.1 protein_id gnl|my_center|LOCUS_00580 24669 24400 gene locus_tag LOCUS_00590 gene relE 24669 24400 CDS product type II toxin-antitoxin system mRNA interferase RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898789.1 protein_id gnl|my_center|LOCUS_00590 24983 24666 gene locus_tag LOCUS_00600 24983 24666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 25811 24993 gene locus_tag LOCUS_00610 25811 24993 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974317.1 protein_id gnl|my_center|LOCUS_00610 26857 25808 gene locus_tag LOCUS_00620 26857 25808 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731544.1 protein_id gnl|my_center|LOCUS_00620 >Feature sequence003 998 1966 gene locus_tag LOCUS_00630 gene aztC 998 1966 CDS product zinc ABC transporter substrate-binding protein AztC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731003.1 protein_id gnl|my_center|LOCUS_00630 1972 2814 gene locus_tag LOCUS_00640 gene aztB 1972 2814 CDS product zinc ABC transporter permease AztB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978391.1 protein_id gnl|my_center|LOCUS_00640 2807 3583 gene locus_tag LOCUS_00650 2807 3583 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777095.1 protein_id gnl|my_center|LOCUS_00650 3666 4118 gene locus_tag LOCUS_00660 3666 4118 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_00660 4818 4258 gene locus_tag LOCUS_00670 4818 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 6411 4846 gene locus_tag LOCUS_00680 6411 4846 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212987816.1 protein_id gnl|my_center|LOCUS_00680 8085 6499 gene locus_tag LOCUS_00690 8085 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 8599 8102 gene locus_tag LOCUS_00700 8599 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 8721 9443 gene locus_tag LOCUS_00710 8721 9443 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775799.1 protein_id gnl|my_center|LOCUS_00710 10288 9482 gene locus_tag LOCUS_00720 10288 9482 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223109.1 protein_id gnl|my_center|LOCUS_00720 11160 10285 gene locus_tag LOCUS_00730 11160 10285 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223108.1 protein_id gnl|my_center|LOCUS_00730 12386 11196 gene locus_tag LOCUS_00740 12386 11196 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223107.1 protein_id gnl|my_center|LOCUS_00740 13475 12447 gene locus_tag LOCUS_00750 13475 12447 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286312.1 protein_id gnl|my_center|LOCUS_00750 13852 13777 gene locus_tag LOCUS_t00030 13852 13777 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14593 13871 gene locus_tag LOCUS_00760 14593 13871 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226459.1 protein_id gnl|my_center|LOCUS_00760 14704 17778 gene locus_tag LOCUS_00770 14704 17778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 18521 17808 gene locus_tag LOCUS_00780 18521 17808 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071061.1 protein_id gnl|my_center|LOCUS_00780 18659 19783 gene locus_tag LOCUS_00790 18659 19783 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742121.1 protein_id gnl|my_center|LOCUS_00790 19783 20592 gene locus_tag LOCUS_00800 19783 20592 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224573.1 protein_id gnl|my_center|LOCUS_00800 20603 20528 gene locus_tag LOCUS_t00040 20603 20528 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence004 1244 2008 gene locus_tag LOCUS_00810 1244 2008 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222589.1 protein_id gnl|my_center|LOCUS_00810 2173 2009 gene locus_tag LOCUS_00820 2173 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 2246 2632 gene locus_tag LOCUS_00830 2246 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 4683 2695 gene locus_tag LOCUS_00840 4683 2695 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_00840 6122 4680 gene locus_tag LOCUS_00850 6122 4680 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226764.1 protein_id gnl|my_center|LOCUS_00850 6178 6372 gene locus_tag LOCUS_00860 6178 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 7433 6462 gene locus_tag LOCUS_00870 7433 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 8985 7657 gene locus_tag LOCUS_00880 8985 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 9985 9074 gene locus_tag LOCUS_00890 9985 9074 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086197.1 protein_id gnl|my_center|LOCUS_00890 11021 10014 gene locus_tag LOCUS_00900 11021 10014 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089142.1 protein_id gnl|my_center|LOCUS_00900 11158 12264 gene locus_tag LOCUS_00910 11158 12264 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086196.1 protein_id gnl|my_center|LOCUS_00910 14883 12436 gene locus_tag LOCUS_00920 14883 12436 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969822.1 protein_id gnl|my_center|LOCUS_00920 15862 14939 gene locus_tag LOCUS_00930 15862 14939 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727101.1 protein_id gnl|my_center|LOCUS_00930 16734 15859 gene locus_tag LOCUS_00940 16734 15859 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727102.1 protein_id gnl|my_center|LOCUS_00940 18043 16757 gene locus_tag LOCUS_00950 18043 16757 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727103.1 protein_id gnl|my_center|LOCUS_00950 >Feature sequence005 88 162 gene locus_tag LOCUS_t00050 88 162 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 359 2851 gene locus_tag LOCUS_00960 359 2851 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095521294.1 protein_id gnl|my_center|LOCUS_00960 2879 3073 gene locus_tag LOCUS_00970 2879 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 3562 3398 gene locus_tag LOCUS_00980 3562 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 3817 3638 gene locus_tag LOCUS_00990 3817 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 3779 4108 gene locus_tag LOCUS_01000 3779 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 4041 4355 gene locus_tag LOCUS_01010 4041 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 5161 4385 gene locus_tag LOCUS_01020 5161 4385 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099690.1 protein_id gnl|my_center|LOCUS_01020 5413 5174 gene locus_tag LOCUS_01030 5413 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 5740 5462 gene locus_tag LOCUS_01040 5740 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 5679 6470 gene locus_tag LOCUS_01050 5679 6470 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908282.1 protein_id gnl|my_center|LOCUS_01050 8320 6467 gene locus_tag LOCUS_01060 gene iolD 8320 6467 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223774.1 protein_id gnl|my_center|LOCUS_01060 9492 8320 gene locus_tag LOCUS_01070 9492 8320 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098253.1 protein_id gnl|my_center|LOCUS_01070 10379 9489 gene locus_tag LOCUS_01080 gene iolB 10379 9489 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223775.1 protein_id gnl|my_center|LOCUS_01080 11275 10376 gene locus_tag LOCUS_01090 11275 10376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223776.1 protein_id gnl|my_center|LOCUS_01090 12228 11272 gene locus_tag LOCUS_01100 gene iolC 12228 11272 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223777.1 protein_id gnl|my_center|LOCUS_01100 >Feature sequence006 <1 1026 gene locus_tag LOCUS_01110 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727162.1:aerobic carbon-monoxide dehydrogenase large subunit 1083 1940 gene locus_tag LOCUS_01120 1083 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 1937 2821 gene locus_tag LOCUS_01130 1937 2821 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898418.1 protein_id gnl|my_center|LOCUS_01130 2814 4052 gene locus_tag LOCUS_01140 2814 4052 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727166.1 protein_id gnl|my_center|LOCUS_01140 4039 5253 gene locus_tag LOCUS_01150 4039 5253 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_01150 5256 5735 gene locus_tag LOCUS_01160 gene moaC 5256 5735 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_01160 5732 6208 gene locus_tag LOCUS_01170 5732 6208 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_01170 6382 7335 gene locus_tag LOCUS_01180 gene pstC 6382 7335 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230714.1 protein_id gnl|my_center|LOCUS_01180 7332 8414 gene locus_tag LOCUS_01190 gene pstA 7332 8414 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_01190 8427 9272 gene locus_tag LOCUS_01200 8427 9272 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229121.1 protein_id gnl|my_center|LOCUS_01200 9402 10457 gene locus_tag LOCUS_01210 gene pstS 9402 10457 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125725.1 protein_id gnl|my_center|LOCUS_01210 10498 11688 gene locus_tag LOCUS_01220 10498 11688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 >Feature sequence007 <1 1026 gene locus_tag LOCUS_01230 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727162.1:aerobic carbon-monoxide dehydrogenase large subunit 1044 1940 gene locus_tag LOCUS_01240 1044 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 1937 2821 gene locus_tag LOCUS_01250 1937 2821 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401863.1 protein_id gnl|my_center|LOCUS_01250 2808 4052 gene locus_tag LOCUS_01260 2808 4052 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727166.1 protein_id gnl|my_center|LOCUS_01260 4039 5253 gene locus_tag LOCUS_01270 4039 5253 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_01270 5256 5735 gene locus_tag LOCUS_01280 gene moaC 5256 5735 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_01280 5732 6217 gene locus_tag LOCUS_01290 5732 6217 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_01290 6366 7319 gene locus_tag LOCUS_01300 gene pstC 6366 7319 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230714.1 protein_id gnl|my_center|LOCUS_01300 7316 8398 gene locus_tag LOCUS_01310 gene pstA 7316 8398 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229120.1 protein_id gnl|my_center|LOCUS_01310 8411 9256 gene locus_tag LOCUS_01320 8411 9256 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229121.1 protein_id gnl|my_center|LOCUS_01320 9386 10441 gene locus_tag LOCUS_01330 gene pstS 9386 10441 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125725.1 protein_id gnl|my_center|LOCUS_01330 10563 11672 gene locus_tag LOCUS_01340 10563 11672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 >Feature sequence008 <1 956 gene locus_tag LOCUS_01350 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114537.1:FAD-dependent oxidoreductase 2402 957 gene locus_tag LOCUS_01360 2402 957 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226084.1 protein_id gnl|my_center|LOCUS_01360 3143 2493 gene locus_tag LOCUS_01370 3143 2493 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972222.1 protein_id gnl|my_center|LOCUS_01370 3263 4447 gene locus_tag LOCUS_01380 3263 4447 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727109.1 protein_id gnl|my_center|LOCUS_01380 4465 6483 gene locus_tag LOCUS_01390 4465 6483 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_01390 6614 7765 gene locus_tag LOCUS_01400 6614 7765 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876827.1 protein_id gnl|my_center|LOCUS_01400 7762 8106 gene locus_tag LOCUS_01410 7762 8106 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530464.1 protein_id gnl|my_center|LOCUS_01410 9757 8171 gene locus_tag LOCUS_01420 9757 8171 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_01420 10958 9759 gene locus_tag LOCUS_01430 10958 9759 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529879.1 protein_id gnl|my_center|LOCUS_01430 11008 11670 gene locus_tag LOCUS_01440 11008 11670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 12584 11679 gene locus_tag LOCUS_01450 12584 11679 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 protein_id gnl|my_center|LOCUS_01450 >Feature sequence009 455 1489 gene locus_tag LOCUS_01460 455 1489 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_01460 3476 1554 gene locus_tag LOCUS_01470 3476 1554 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226492.1 protein_id gnl|my_center|LOCUS_01470 3506 5512 gene locus_tag LOCUS_01480 3506 5512 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803998.1 protein_id gnl|my_center|LOCUS_01480 5513 5914 gene locus_tag LOCUS_01490 5513 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 6269 6009 gene locus_tag LOCUS_01500 6269 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01500 6541 6296 gene locus_tag LOCUS_01510 6541 6296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 9252 6613 gene locus_tag LOCUS_01520 9252 6613 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400547.1 protein_id gnl|my_center|LOCUS_01520 9467 10054 gene locus_tag LOCUS_01530 9467 10054 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975011.1 protein_id gnl|my_center|LOCUS_01530 10097 10471 gene locus_tag LOCUS_01540 10097 10471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 10570 10812 gene locus_tag LOCUS_01550 10570 10812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 11299 10883 gene locus_tag LOCUS_01560 11299 10883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 11698 11342 gene locus_tag LOCUS_01570 11698 11342 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005050947.1 protein_id gnl|my_center|LOCUS_01570 12187 11777 gene locus_tag LOCUS_01580 12187 11777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 >Feature sequence010 <1 526 gene locus_tag LOCUS_01590 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729870.1:glycine--tRNA ligase 937 659 gene locus_tag LOCUS_01600 937 659 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950507.1 protein_id gnl|my_center|LOCUS_01600 2639 1002 gene locus_tag LOCUS_01610 2639 1002 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777012.1 protein_id gnl|my_center|LOCUS_01610 2806 3885 gene locus_tag LOCUS_01620 gene dusB 2806 3885 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010147544.1 protein_id gnl|my_center|LOCUS_01620 3948 4619 gene locus_tag LOCUS_01630 3948 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 5790 4744 gene locus_tag LOCUS_01640 5790 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148043383.1 protein_id gnl|my_center|LOCUS_01640 5957 7186 gene locus_tag LOCUS_01650 5957 7186 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028369.1 protein_id gnl|my_center|LOCUS_01650 7230 7880 gene locus_tag LOCUS_01660 7230 7880 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224125.1 protein_id gnl|my_center|LOCUS_01660 10204 7877 gene locus_tag LOCUS_01670 10204 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 11423 10197 gene locus_tag LOCUS_01680 11423 10197 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421599.1 protein_id gnl|my_center|LOCUS_01680 >Feature sequence011 480 97 gene locus_tag LOCUS_01690 480 97 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974650.1 protein_id gnl|my_center|LOCUS_01690 518 2512 gene locus_tag LOCUS_01700 518 2512 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230251.1 protein_id gnl|my_center|LOCUS_01700 3682 2531 gene locus_tag LOCUS_01710 3682 2531 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227132.1 protein_id gnl|my_center|LOCUS_01710 4326 3682 gene locus_tag LOCUS_01720 4326 3682 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484524.1 protein_id gnl|my_center|LOCUS_01720 4775 4323 gene locus_tag LOCUS_01730 4775 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01730 6169 4772 gene locus_tag LOCUS_01740 6169 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01740 8241 6166 gene locus_tag LOCUS_01750 8241 6166 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110563.1 protein_id gnl|my_center|LOCUS_01750 9866 8247 gene locus_tag LOCUS_01760 9866 8247 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466887.1 protein_id gnl|my_center|LOCUS_01760 11037 9910 gene locus_tag LOCUS_01770 gene menC 11037 9910 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_01770 11837 11034 gene locus_tag LOCUS_01780 11837 11034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225316.1 protein_id gnl|my_center|LOCUS_01780 >Feature sequence012 3747 52 gene locus_tag LOCUS_01790 3747 52 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972444.1 protein_id gnl|my_center|LOCUS_01790 4406 3744 gene locus_tag LOCUS_01800 4406 3744 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929996.1 protein_id gnl|my_center|LOCUS_01800 4484 5842 gene locus_tag LOCUS_01810 4484 5842 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123927512.1 protein_id gnl|my_center|LOCUS_01810 5839 7170 gene locus_tag LOCUS_01820 5839 7170 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014188.1 protein_id gnl|my_center|LOCUS_01820 7320 7490 gene locus_tag LOCUS_01830 7320 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 7490 8947 gene locus_tag LOCUS_01840 7490 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 8944 10986 gene locus_tag LOCUS_01850 8944 10986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 10993 11781 gene locus_tag LOCUS_01860 10993 11781 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894143.1 protein_id gnl|my_center|LOCUS_01860 >Feature sequence013 324 1016 gene locus_tag LOCUS_01870 324 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 3271 944 gene locus_tag LOCUS_01880 3271 944 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226971.1 protein_id gnl|my_center|LOCUS_01880 3454 4203 gene locus_tag LOCUS_01890 3454 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 4206 5801 gene locus_tag LOCUS_01900 4206 5801 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085748.1 protein_id gnl|my_center|LOCUS_01900 5914 5838 gene locus_tag LOCUS_t00060 5914 5838 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6030 6368 gene locus_tag LOCUS_01910 6030 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 6358 7743 gene locus_tag LOCUS_01920 6358 7743 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467865.1 protein_id gnl|my_center|LOCUS_01920 10606 7757 gene locus_tag LOCUS_01930 10606 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 11606 10653 gene locus_tag LOCUS_01940 11606 10653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_01940 >Feature sequence014 196 729 gene locus_tag LOCUS_01950 gene lspA 196 729 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082236.1 protein_id gnl|my_center|LOCUS_01950 726 1691 gene locus_tag LOCUS_01960 726 1691 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224836.1 protein_id gnl|my_center|LOCUS_01960 1713 5246 gene locus_tag LOCUS_01970 gene dnaE 1713 5246 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976751.1 protein_id gnl|my_center|LOCUS_01970 5271 5786 gene locus_tag LOCUS_01980 5271 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 6267 5758 gene locus_tag LOCUS_01990 gene ybaK 6267 5758 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 protein_id gnl|my_center|LOCUS_01990 6961 6290 gene locus_tag LOCUS_02000 6961 6290 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466787.1 protein_id gnl|my_center|LOCUS_02000 7051 8304 gene locus_tag LOCUS_02010 gene hisD 7051 8304 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877610.1 protein_id gnl|my_center|LOCUS_02010 8301 9416 gene locus_tag LOCUS_02020 8301 9416 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929983.1 protein_id gnl|my_center|LOCUS_02020 9413 10015 gene locus_tag LOCUS_02030 gene hisB 9413 10015 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 protein_id gnl|my_center|LOCUS_02030 10025 10660 gene locus_tag LOCUS_02040 gene hisH 10025 10660 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057924.1 protein_id gnl|my_center|LOCUS_02040 >Feature sequence015 <1 1152 gene locus_tag LOCUS_02050 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527968.1:NAD(P)/FAD-dependent oxidoreductase 1200 3368 gene locus_tag LOCUS_02060 1200 3368 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527966.1 protein_id gnl|my_center|LOCUS_02060 3365 4957 gene locus_tag LOCUS_02070 3365 4957 CDS product indolepyruvate oxidoreductase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086194.1 protein_id gnl|my_center|LOCUS_02070 5771 5001 gene locus_tag LOCUS_02080 5771 5001 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227652.1 protein_id gnl|my_center|LOCUS_02080 6903 5797 gene locus_tag LOCUS_02090 6903 5797 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533159.1 protein_id gnl|my_center|LOCUS_02090 7775 6903 gene locus_tag LOCUS_02100 7775 6903 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533158.1 protein_id gnl|my_center|LOCUS_02100 8497 7772 gene locus_tag LOCUS_02110 8497 7772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391472.1 protein_id gnl|my_center|LOCUS_02110 9240 8494 gene locus_tag LOCUS_02120 9240 8494 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533156.1 protein_id gnl|my_center|LOCUS_02120 10632 9355 gene locus_tag LOCUS_02130 10632 9355 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533160.1 protein_id gnl|my_center|LOCUS_02130 >Feature sequence016 825 1511 gene locus_tag LOCUS_02140 825 1511 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222425.1 protein_id gnl|my_center|LOCUS_02140 1508 2716 gene locus_tag LOCUS_02150 1508 2716 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222426.1 protein_id gnl|my_center|LOCUS_02150 2755 2976 gene locus_tag LOCUS_02160 2755 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 3166 4323 gene locus_tag LOCUS_02170 3166 4323 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195843.1 protein_id gnl|my_center|LOCUS_02170 5424 4360 gene locus_tag LOCUS_02180 5424 4360 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974786.1 protein_id gnl|my_center|LOCUS_02180 7475 5448 gene locus_tag LOCUS_02190 7475 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 7600 8466 gene locus_tag LOCUS_02200 7600 8466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 9011 8547 gene locus_tag LOCUS_02210 9011 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 9908 9306 gene locus_tag LOCUS_02220 9908 9306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 10792 10139 gene locus_tag LOCUS_02230 gene trmB 10792 10139 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974862.1 protein_id gnl|my_center|LOCUS_02230 >Feature sequence017 2905 1808 gene locus_tag LOCUS_02240 2905 1808 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091654.1 protein_id gnl|my_center|LOCUS_02240 3633 2935 gene locus_tag LOCUS_02250 3633 2935 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111761.1 protein_id gnl|my_center|LOCUS_02250 3847 4491 gene locus_tag LOCUS_02260 3847 4491 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730262.1 protein_id gnl|my_center|LOCUS_02260 4513 4746 gene locus_tag LOCUS_02270 4513 4746 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015527.1 protein_id gnl|my_center|LOCUS_02270 4737 5609 gene locus_tag LOCUS_02280 4737 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 5790 6866 gene locus_tag LOCUS_02290 5790 6866 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_02290 6919 7860 gene locus_tag LOCUS_02300 6919 7860 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974684.1 protein_id gnl|my_center|LOCUS_02300 8480 7803 gene locus_tag LOCUS_02310 8480 7803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 8676 9821 gene locus_tag LOCUS_02320 8676 9821 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861856.1 protein_id gnl|my_center|LOCUS_02320 9955 9882 gene locus_tag LOCUS_t00070 9955 9882 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10051 10968 gene locus_tag LOCUS_02330 gene folP 10051 10968 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839406.1 protein_id gnl|my_center|LOCUS_02330 >Feature sequence018 1255 3660 gene locus_tag LOCUS_02340 1255 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 3685 3906 gene locus_tag LOCUS_02350 3685 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 6364 4232 gene locus_tag LOCUS_02360 6364 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 7263 7478 gene locus_tag LOCUS_02370 7263 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 7838 8005 gene locus_tag LOCUS_02380 7838 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 9314 8124 gene locus_tag LOCUS_02390 gene moeZ 9314 8124 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_02390 9477 10430 gene locus_tag LOCUS_02400 9477 10430 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228457.1 protein_id gnl|my_center|LOCUS_02400 10633 10469 gene locus_tag LOCUS_02410 10633 10469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 >Feature sequence019 335 1693 gene locus_tag LOCUS_02420 335 1693 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_02420 2069 1710 gene locus_tag LOCUS_02430 2069 1710 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306389.1 protein_id gnl|my_center|LOCUS_02430 3271 2141 gene locus_tag LOCUS_02440 3271 2141 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453275.1 protein_id gnl|my_center|LOCUS_02440 3451 3954 gene locus_tag LOCUS_02450 3451 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 3981 4211 gene locus_tag LOCUS_02460 3981 4211 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690730.1 protein_id gnl|my_center|LOCUS_02460 4216 5733 gene locus_tag LOCUS_02470 gene nrfD 4216 5733 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_02470 5771 8665 gene locus_tag LOCUS_02480 5771 8665 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_02480 8716 9645 gene locus_tag LOCUS_02490 8716 9645 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730500.1 protein_id gnl|my_center|LOCUS_02490 >Feature sequence020 588 1886 gene locus_tag LOCUS_02500 588 1886 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727103.1 protein_id gnl|my_center|LOCUS_02500 1888 2784 gene locus_tag LOCUS_02510 1888 2784 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727102.1 protein_id gnl|my_center|LOCUS_02510 2781 3707 gene locus_tag LOCUS_02520 2781 3707 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727101.1 protein_id gnl|my_center|LOCUS_02520 3739 6189 gene locus_tag LOCUS_02530 3739 6189 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969822.1 protein_id gnl|my_center|LOCUS_02530 7808 6210 gene locus_tag LOCUS_02540 7808 6210 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_02540 9009 7810 gene locus_tag LOCUS_02550 9009 7810 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529879.1 protein_id gnl|my_center|LOCUS_02550 9086 9718 gene locus_tag LOCUS_02560 9086 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 10628 9723 gene locus_tag LOCUS_02570 10628 9723 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 protein_id gnl|my_center|LOCUS_02570 >Feature sequence021 994 2220 gene locus_tag LOCUS_02580 994 2220 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962593.1 protein_id gnl|my_center|LOCUS_02580 3089 2244 gene locus_tag LOCUS_02590 3089 2244 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292843.1 protein_id gnl|my_center|LOCUS_02590 3116 3808 gene locus_tag LOCUS_02600 3116 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 4014 5234 gene locus_tag LOCUS_02610 4014 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 5213 6502 gene locus_tag LOCUS_02620 5213 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 6595 8112 gene locus_tag LOCUS_02630 6595 8112 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978484.1 protein_id gnl|my_center|LOCUS_02630 8255 10105 gene locus_tag LOCUS_02640 8255 10105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 >Feature sequence022 197 271 gene locus_tag LOCUS_t00080 197 271 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1322 318 gene locus_tag LOCUS_02650 1322 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 1555 2889 gene locus_tag LOCUS_02660 1555 2889 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013893969.1 protein_id gnl|my_center|LOCUS_02660 2893 3639 gene locus_tag LOCUS_02670 2893 3639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533087.1 protein_id gnl|my_center|LOCUS_02670 3636 4400 gene locus_tag LOCUS_02680 3636 4400 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530211.1 protein_id gnl|my_center|LOCUS_02680 4400 5290 gene locus_tag LOCUS_02690 4400 5290 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066620.1 protein_id gnl|my_center|LOCUS_02690 5349 6806 gene locus_tag LOCUS_02700 5349 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 6823 9123 gene locus_tag LOCUS_02710 6823 9123 CDS product large subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727394.1 protein_id gnl|my_center|LOCUS_02710 9134 10249 gene locus_tag LOCUS_02720 9134 10249 CDS product class II histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532992.1 protein_id gnl|my_center|LOCUS_02720 >Feature sequence023 1120 1824 gene locus_tag LOCUS_02730 1120 1824 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729647.1 protein_id gnl|my_center|LOCUS_02730 3071 1821 gene locus_tag LOCUS_02740 3071 1821 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223916.1 protein_id gnl|my_center|LOCUS_02740 3217 3708 gene locus_tag LOCUS_02750 3217 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 3808 5268 gene locus_tag LOCUS_02760 gene hpaE 3808 5268 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528544.1 protein_id gnl|my_center|LOCUS_02760 5259 6179 gene locus_tag LOCUS_02770 5259 6179 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523563.1 protein_id gnl|my_center|LOCUS_02770 6176 7051 gene locus_tag LOCUS_02780 6176 7051 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879714.1 protein_id gnl|my_center|LOCUS_02780 7054 7242 gene locus_tag LOCUS_02790 7054 7242 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898093.1 protein_id gnl|my_center|LOCUS_02790 7259 8434 gene locus_tag LOCUS_02800 7259 8434 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901000.1 protein_id gnl|my_center|LOCUS_02800 8431 9867 gene locus_tag LOCUS_02810 8431 9867 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532193.1 protein_id gnl|my_center|LOCUS_02810 >Feature sequence024 272 1291 gene locus_tag LOCUS_02820 272 1291 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643511.1 protein_id gnl|my_center|LOCUS_02820 1298 2692 gene locus_tag LOCUS_02830 1298 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 4085 2709 gene locus_tag LOCUS_02840 4085 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 4003 4314 gene locus_tag LOCUS_02850 4003 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 4462 4322 gene locus_tag LOCUS_02860 4462 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 4657 4484 gene locus_tag LOCUS_02870 4657 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 4596 4961 gene locus_tag LOCUS_02880 4596 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 4988 5932 gene locus_tag LOCUS_02890 4988 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 6811 5933 gene locus_tag LOCUS_02900 6811 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 7677 6847 gene locus_tag LOCUS_02910 7677 6847 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729048.1 protein_id gnl|my_center|LOCUS_02910 7835 8920 gene locus_tag LOCUS_02920 7835 8920 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_02920 8920 9546 gene locus_tag LOCUS_02930 8920 9546 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978121.1 protein_id gnl|my_center|LOCUS_02930 9650 9841 gene locus_tag LOCUS_02940 9650 9841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 >Feature sequence025 440 4972 gene locus_tag LOCUS_02950 gene gltB 440 4972 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_02950 4965 6419 gene locus_tag LOCUS_02960 4965 6419 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228800.1 protein_id gnl|my_center|LOCUS_02960 6455 7879 gene locus_tag LOCUS_02970 gene pyk 6455 7879 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 protein_id gnl|my_center|LOCUS_02970 7966 8517 gene locus_tag LOCUS_02980 gene pyrR 7966 8517 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_02980 8518 9471 gene locus_tag LOCUS_02990 8518 9471 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_02990 >Feature sequence026 501 1727 gene locus_tag LOCUS_03000 501 1727 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962593.1 protein_id gnl|my_center|LOCUS_03000 2582 1752 gene locus_tag LOCUS_03010 2582 1752 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292843.1 protein_id gnl|my_center|LOCUS_03010 2624 3316 gene locus_tag LOCUS_03020 2624 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 3524 4753 gene locus_tag LOCUS_03030 3524 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 4732 6021 gene locus_tag LOCUS_03040 4732 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 6114 7631 gene locus_tag LOCUS_03050 6114 7631 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978484.1 protein_id gnl|my_center|LOCUS_03050 7672 9609 gene locus_tag LOCUS_03060 7672 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 >Feature sequence027 <1 1287 gene locus_tag LOCUS_03070 <1 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143420.1:sulfatase 3539 1299 gene locus_tag LOCUS_03080 3539 1299 CDS product bifunctional glycosyltransferase/CDP-glycerol:glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028696.1 protein_id gnl|my_center|LOCUS_03080 3606 4496 gene locus_tag LOCUS_03090 3606 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 4543 5646 gene locus_tag LOCUS_03100 4543 5646 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726928.1 protein_id gnl|my_center|LOCUS_03100 5849 5604 gene locus_tag LOCUS_03110 5849 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 5740 6306 gene locus_tag LOCUS_03120 5740 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 7065 6346 gene locus_tag LOCUS_03130 7065 6346 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_03130 7607 7191 gene locus_tag LOCUS_03140 7607 7191 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 protein_id gnl|my_center|LOCUS_03140 7965 7600 gene locus_tag LOCUS_03150 7965 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 8105 8962 gene locus_tag LOCUS_03160 8105 8962 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229360.1 protein_id gnl|my_center|LOCUS_03160 <10130 9432 gene locus_tag LOCUS_03170 <10130 9432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005766899.1:NADP-dependent oxidoreductase >Feature sequence028 <1 1992 gene locus_tag LOCUS_03180 <1 1992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972923.1:aconitate hydratase AcnA 1998 2357 gene locus_tag LOCUS_03190 1998 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 2463 4379 gene locus_tag LOCUS_03200 gene dxs 2463 4379 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031168.1 protein_id gnl|my_center|LOCUS_03200 6508 4394 gene locus_tag LOCUS_03210 6508 4394 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030602.1 protein_id gnl|my_center|LOCUS_03210 7719 6505 gene locus_tag LOCUS_03220 7719 6505 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224501.1 protein_id gnl|my_center|LOCUS_03220 9022 7772 gene locus_tag LOCUS_03230 9022 7772 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_03230 9624 9025 gene locus_tag LOCUS_03240 9624 9025 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030605.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence029 1127 2530 gene locus_tag LOCUS_03250 1127 2530 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229595.1 protein_id gnl|my_center|LOCUS_03250 2895 2518 gene locus_tag LOCUS_03260 gene mscL 2895 2518 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889048.1 protein_id gnl|my_center|LOCUS_03260 3396 2941 gene locus_tag LOCUS_03270 3396 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 3835 3455 gene locus_tag LOCUS_03280 3835 3455 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230041.1 protein_id gnl|my_center|LOCUS_03280 3944 4345 gene locus_tag LOCUS_03290 gene crcB 3944 4345 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227866.1 protein_id gnl|my_center|LOCUS_03290 4342 4713 gene locus_tag LOCUS_03300 gene crcB 4342 4713 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971646.1 protein_id gnl|my_center|LOCUS_03300 4910 6517 gene locus_tag LOCUS_03310 4910 6517 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065280.1 protein_id gnl|my_center|LOCUS_03310 7147 6524 gene locus_tag LOCUS_03320 7147 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 7188 8099 gene locus_tag LOCUS_03330 gene galU 7188 8099 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_03330 8096 8707 gene locus_tag LOCUS_03340 8096 8707 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_03340 8796 9566 gene locus_tag LOCUS_03350 8796 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 >Feature sequence030 1125 1856 gene locus_tag LOCUS_03360 1125 1856 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729647.1 protein_id gnl|my_center|LOCUS_03360 3132 1888 gene locus_tag LOCUS_03370 3132 1888 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730960.1 protein_id gnl|my_center|LOCUS_03370 3279 3770 gene locus_tag LOCUS_03380 3279 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 3882 5342 gene locus_tag LOCUS_03390 gene hpaE 3882 5342 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528544.1 protein_id gnl|my_center|LOCUS_03390 5333 6253 gene locus_tag LOCUS_03400 5333 6253 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523563.1 protein_id gnl|my_center|LOCUS_03400 6250 7125 gene locus_tag LOCUS_03410 6250 7125 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879714.1 protein_id gnl|my_center|LOCUS_03410 7128 7316 gene locus_tag LOCUS_03420 7128 7316 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898093.1 protein_id gnl|my_center|LOCUS_03420 7325 8509 gene locus_tag LOCUS_03430 7325 8509 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901000.1 protein_id gnl|my_center|LOCUS_03430 8506 8667 gene locus_tag LOCUS_03440 8506 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 8934 8707 gene locus_tag LOCUS_03450 8934 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 >Feature sequence031 745 1551 gene locus_tag LOCUS_03460 745 1551 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977273.1 protein_id gnl|my_center|LOCUS_03460 2065 1544 gene locus_tag LOCUS_03470 2065 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 2185 3408 gene locus_tag LOCUS_03480 2185 3408 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223123.1 protein_id gnl|my_center|LOCUS_03480 3703 3401 gene locus_tag LOCUS_03490 3703 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 4834 3746 gene locus_tag LOCUS_03500 4834 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 5632 4838 gene locus_tag LOCUS_03510 5632 4838 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222170.1 protein_id gnl|my_center|LOCUS_03510 5664 6038 gene locus_tag LOCUS_03520 5664 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 6121 7017 gene locus_tag LOCUS_03530 6121 7017 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064726614.1 protein_id gnl|my_center|LOCUS_03530 7014 7424 gene locus_tag LOCUS_03540 7014 7424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 7453 8076 gene locus_tag LOCUS_03550 gene orn 7453 8076 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_03550 8147 8219 gene locus_tag LOCUS_t00090 8147 8219 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 9169 8237 gene locus_tag LOCUS_03560 9169 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 >Feature sequence032 633 1682 gene locus_tag LOCUS_03570 gene iolG 633 1682 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398990.1 protein_id gnl|my_center|LOCUS_03570 1685 2695 gene locus_tag LOCUS_03580 1685 2695 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223782.1 protein_id gnl|my_center|LOCUS_03580 2720 3007 gene locus_tag LOCUS_03590 2720 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 3118 3044 gene locus_tag LOCUS_t00100 3118 3044 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4693 3155 gene locus_tag LOCUS_03600 gene der 4693 3155 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_03600 5325 4693 gene locus_tag LOCUS_03610 5325 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 6023 5325 gene locus_tag LOCUS_03620 gene cmk 6023 5325 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027958.1 protein_id gnl|my_center|LOCUS_03620 7110 6010 gene locus_tag LOCUS_03630 7110 6010 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_03630 7469 7107 gene locus_tag LOCUS_03640 gene aroH 7469 7107 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_03640 8210 7473 gene locus_tag LOCUS_03650 8210 7473 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408439.1 protein_id gnl|my_center|LOCUS_03650 8863 8210 gene locus_tag LOCUS_03660 gene scpB 8863 8210 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_03660 9392 8853 gene locus_tag LOCUS_03670 9392 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 >Feature sequence033 1639 935 gene locus_tag LOCUS_03680 1639 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 2667 1639 gene locus_tag LOCUS_03690 2667 1639 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976492.1 protein_id gnl|my_center|LOCUS_03690 3092 3307 gene locus_tag LOCUS_03700 3092 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 4993 3398 gene locus_tag LOCUS_03710 4993 3398 CDS product TIGR03767 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230137.1 protein_id gnl|my_center|LOCUS_03710 6039 4993 gene locus_tag LOCUS_03720 6039 4993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897935.1 protein_id gnl|my_center|LOCUS_03720 6877 6047 gene locus_tag LOCUS_03730 6877 6047 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897936.1 protein_id gnl|my_center|LOCUS_03730 7731 6874 gene locus_tag LOCUS_03740 7731 6874 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328991.1 protein_id gnl|my_center|LOCUS_03740 9039 7855 gene locus_tag LOCUS_03750 9039 7855 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972095.1 protein_id gnl|my_center|LOCUS_03750 >Feature sequence034 2344 713 gene locus_tag LOCUS_03760 gene metG 2344 713 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975149.1 protein_id gnl|my_center|LOCUS_03760 3268 2354 gene locus_tag LOCUS_03770 gene rsmI 3268 2354 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_03770 3313 4935 gene locus_tag LOCUS_03780 3313 4935 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_03780 5551 4952 gene locus_tag LOCUS_03790 5551 4952 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225371.1 protein_id gnl|my_center|LOCUS_03790 6029 5604 gene locus_tag LOCUS_03800 6029 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 6083 6562 gene locus_tag LOCUS_03810 6083 6562 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028617.1 protein_id gnl|my_center|LOCUS_03810 6815 7192 gene locus_tag LOCUS_03820 6815 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03820 7233 8018 gene locus_tag LOCUS_03830 7233 8018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 8430 8128 gene locus_tag LOCUS_03840 8430 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 8527 8712 gene locus_tag LOCUS_03850 8527 8712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 8847 9065 gene locus_tag LOCUS_03860 8847 9065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 >Feature sequence035 <1 1248 gene locus_tag LOCUS_03870 <1 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742053.1:D-inositol-3-phosphate glycosyltransferase 1235 1789 gene locus_tag LOCUS_03880 1235 1789 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974766.1 protein_id gnl|my_center|LOCUS_03880 1810 2601 gene locus_tag LOCUS_03890 1810 2601 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 protein_id gnl|my_center|LOCUS_03890 2993 2712 gene locus_tag LOCUS_03900 2993 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 3433 4908 gene locus_tag LOCUS_03910 3433 4908 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970931.1 protein_id gnl|my_center|LOCUS_03910 5339 4989 gene locus_tag LOCUS_03920 5339 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 5710 5336 gene locus_tag LOCUS_03930 5710 5336 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029496.1 protein_id gnl|my_center|LOCUS_03930 6743 5781 gene locus_tag LOCUS_03940 6743 5781 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_03940 6782 7249 gene locus_tag LOCUS_03950 gene dtd 6782 7249 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029487.1 protein_id gnl|my_center|LOCUS_03950 9153 7291 gene locus_tag LOCUS_03960 9153 7291 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227016.1 protein_id gnl|my_center|LOCUS_03960 >Feature sequence036 162 1235 gene locus_tag LOCUS_03970 162 1235 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537508.1 protein_id gnl|my_center|LOCUS_03970 1219 2781 gene locus_tag LOCUS_03980 1219 2781 CDS product hydantoinase/oxoprolinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989476.1 protein_id gnl|my_center|LOCUS_03980 2804 4447 gene locus_tag LOCUS_03990 2804 4447 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459110.1 protein_id gnl|my_center|LOCUS_03990 4460 5470 gene locus_tag LOCUS_04000 4460 5470 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370098.1 protein_id gnl|my_center|LOCUS_04000 5602 6393 gene locus_tag LOCUS_04010 5602 6393 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527924.1 protein_id gnl|my_center|LOCUS_04010 6393 7163 gene locus_tag LOCUS_04020 6393 7163 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531724.1 protein_id gnl|my_center|LOCUS_04020 7160 8119 gene locus_tag LOCUS_04030 7160 8119 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390113.1 protein_id gnl|my_center|LOCUS_04030 8203 8433 gene locus_tag LOCUS_04040 8203 8433 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_04040 8436 8816 gene locus_tag LOCUS_04050 8436 8816 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_04050 >Feature sequence037 440 1204 gene locus_tag LOCUS_04060 440 1204 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222589.1 protein_id gnl|my_center|LOCUS_04060 2125 1310 gene locus_tag LOCUS_04070 2125 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 2731 2555 gene locus_tag LOCUS_04080 2731 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 3321 4595 gene locus_tag LOCUS_04090 3321 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 6276 5179 gene locus_tag LOCUS_04100 6276 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 6292 6486 gene locus_tag LOCUS_04110 6292 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 6532 6825 gene locus_tag LOCUS_04120 6532 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 8175 6937 gene locus_tag LOCUS_04130 8175 6937 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728185.1 protein_id gnl|my_center|LOCUS_04130 >Feature sequence038 <1 956 gene locus_tag LOCUS_04140 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114537.1:FAD-dependent oxidoreductase 2419 974 gene locus_tag LOCUS_04150 2419 974 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226084.1 protein_id gnl|my_center|LOCUS_04150 3160 2510 gene locus_tag LOCUS_04160 3160 2510 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972222.1 protein_id gnl|my_center|LOCUS_04160 3279 4463 gene locus_tag LOCUS_04170 3279 4463 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727109.1 protein_id gnl|my_center|LOCUS_04170 4481 6499 gene locus_tag LOCUS_04180 4481 6499 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_04180 6480 7760 gene locus_tag LOCUS_04190 6480 7760 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876827.1 protein_id gnl|my_center|LOCUS_04190 7757 8101 gene locus_tag LOCUS_04200 7757 8101 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530464.1 protein_id gnl|my_center|LOCUS_04200 <8775 8098 gene locus_tag LOCUS_04210 <8775 8098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727105.1:ABC transporter ATP-binding protein >Feature sequence039 1037 348 gene locus_tag LOCUS_04220 1037 348 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 protein_id gnl|my_center|LOCUS_04220 2075 1053 gene locus_tag LOCUS_04230 2075 1053 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975685.1 protein_id gnl|my_center|LOCUS_04230 2205 2276 gene locus_tag LOCUS_t00110 2205 2276 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2479 3936 gene locus_tag LOCUS_04240 2479 3936 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660465.1 protein_id gnl|my_center|LOCUS_04240 4052 5518 gene locus_tag LOCUS_04250 gene glmU 4052 5518 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_04250 5515 6516 gene locus_tag LOCUS_04260 5515 6516 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_04260 6724 7308 gene locus_tag LOCUS_04270 6724 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 7333 7926 gene locus_tag LOCUS_04280 gene pth 7333 7926 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975689.1 protein_id gnl|my_center|LOCUS_04280 7927 8745 gene locus_tag LOCUS_04290 7927 8745 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_04290 >Feature sequence040 <1 1381 gene locus_tag LOCUS_04300 <1 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973484.1:acetolactate synthase large subunit 1381 1905 gene locus_tag LOCUS_04310 gene ilvN 1381 1905 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_04310 1992 3020 gene locus_tag LOCUS_04320 gene ilvC 1992 3020 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775904.1 protein_id gnl|my_center|LOCUS_04320 3054 4637 gene locus_tag LOCUS_04330 gene serA 3054 4637 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_04330 6398 4644 gene locus_tag LOCUS_04340 gene leuA 6398 4644 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_04340 6560 7615 gene locus_tag LOCUS_04350 6560 7615 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893747.1 protein_id gnl|my_center|LOCUS_04350 7633 7794 gene locus_tag LOCUS_04360 7633 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 7778 8257 gene locus_tag LOCUS_04370 7778 8257 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545294.1 protein_id gnl|my_center|LOCUS_04370 >Feature sequence041 288 361 gene locus_tag LOCUS_t00120 288 361 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 394 717 gene locus_tag LOCUS_04380 394 717 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720718.1 protein_id gnl|my_center|LOCUS_04380 727 1386 gene locus_tag LOCUS_04390 727 1386 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070188143.1 protein_id gnl|my_center|LOCUS_04390 1491 2939 gene locus_tag LOCUS_04400 1491 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 4152 3007 gene locus_tag LOCUS_04410 gene tgt 4152 3007 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112950.1 protein_id gnl|my_center|LOCUS_04410 4773 4270 gene locus_tag LOCUS_04420 4773 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 4836 5030 gene locus_tag LOCUS_04430 4836 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 6260 5040 gene locus_tag LOCUS_04440 6260 5040 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223998.1 protein_id gnl|my_center|LOCUS_04440 7252 6290 gene locus_tag LOCUS_04450 7252 6290 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_04450 8076 7327 gene locus_tag LOCUS_04460 8076 7327 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729123.1 protein_id gnl|my_center|LOCUS_04460 >Feature sequence042 1776 844 gene locus_tag LOCUS_04470 gene menB 1776 844 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963873.1 protein_id gnl|my_center|LOCUS_04470 1814 3022 gene locus_tag LOCUS_04480 gene menE 1814 3022 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742122.1 protein_id gnl|my_center|LOCUS_04480 3010 3879 gene locus_tag LOCUS_04490 3010 3879 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466560.1 protein_id gnl|my_center|LOCUS_04490 4152 3826 gene locus_tag LOCUS_04500 4152 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 4276 4578 gene locus_tag LOCUS_04510 4276 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 5544 4594 gene locus_tag LOCUS_04520 gene ccsB 5544 4594 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029680.1 protein_id gnl|my_center|LOCUS_04520 7101 5554 gene locus_tag LOCUS_04530 7101 5554 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029679.1 protein_id gnl|my_center|LOCUS_04530 7839 7102 gene locus_tag LOCUS_04540 7839 7102 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 protein_id gnl|my_center|LOCUS_04540 8426 7836 gene locus_tag LOCUS_04550 8426 7836 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029677.1 protein_id gnl|my_center|LOCUS_04550 >Feature sequence043 1 861 gene locus_tag LOCUS_04560 1 861 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267273.1 protein_id gnl|my_center|LOCUS_04560 1076 1297 gene locus_tag LOCUS_04570 1076 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 2191 1334 gene locus_tag LOCUS_04580 2191 1334 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229360.1 protein_id gnl|my_center|LOCUS_04580 2331 2696 gene locus_tag LOCUS_04590 2331 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 2689 3105 gene locus_tag LOCUS_04600 2689 3105 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 protein_id gnl|my_center|LOCUS_04600 3230 3949 gene locus_tag LOCUS_04610 3230 3949 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_04610 4404 3985 gene locus_tag LOCUS_04620 4404 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 5458 4313 gene locus_tag LOCUS_04630 5458 4313 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726928.1 protein_id gnl|my_center|LOCUS_04630 6395 5505 gene locus_tag LOCUS_04640 6395 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 >Feature sequence044 1407 592 gene locus_tag LOCUS_04650 1407 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 2245 1472 gene locus_tag LOCUS_04660 2245 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 3461 2268 gene locus_tag LOCUS_04670 3461 2268 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_04670 4782 3466 gene locus_tag LOCUS_04680 4782 3466 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 protein_id gnl|my_center|LOCUS_04680 6237 5101 gene locus_tag LOCUS_04690 6237 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 7132 6347 gene locus_tag LOCUS_04700 7132 6347 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230311.1 protein_id gnl|my_center|LOCUS_04700 8423 7302 gene locus_tag LOCUS_04710 8423 7302 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929894.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence045 318 884 gene locus_tag LOCUS_04720 318 884 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_04720 881 1699 gene locus_tag LOCUS_04730 881 1699 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270002.1 protein_id gnl|my_center|LOCUS_04730 1748 2977 gene locus_tag LOCUS_04740 gene mshC 1748 2977 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_04740 4009 2969 gene locus_tag LOCUS_04750 gene gnd 4009 2969 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405880.1 protein_id gnl|my_center|LOCUS_04750 4069 5700 gene locus_tag LOCUS_04760 gene pgi 4069 5700 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888377.1 protein_id gnl|my_center|LOCUS_04760 6597 5746 gene locus_tag LOCUS_04770 gene parJ 6597 5746 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_04770 7475 6594 gene locus_tag LOCUS_04780 7475 6594 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577540.1 protein_id gnl|my_center|LOCUS_04780 >Feature sequence046 1972 272 gene locus_tag LOCUS_04790 1972 272 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893009.1 protein_id gnl|my_center|LOCUS_04790 3558 1996 gene locus_tag LOCUS_04800 3558 1996 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_04800 4678 3569 gene locus_tag LOCUS_04810 4678 3569 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_04810 6182 4686 gene locus_tag LOCUS_04820 gene guaB 6182 4686 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222684.1 protein_id gnl|my_center|LOCUS_04820 7139 6192 gene locus_tag LOCUS_04830 7139 6192 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222679.1 protein_id gnl|my_center|LOCUS_04830 7302 7589 gene locus_tag LOCUS_04840 7302 7589 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974205.1 protein_id gnl|my_center|LOCUS_04840 <8316 7681 gene locus_tag LOCUS_04850 <8316 7681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974210.1:chaperonin GroEL >Feature sequence047 1516 809 gene locus_tag LOCUS_04860 1516 809 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775799.1 protein_id gnl|my_center|LOCUS_04860 1725 3275 gene locus_tag LOCUS_04870 1725 3275 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776491.1 protein_id gnl|my_center|LOCUS_04870 3304 3864 gene locus_tag LOCUS_04880 3304 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 4539 4087 gene locus_tag LOCUS_04890 4539 4087 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_04890 5415 4612 gene locus_tag LOCUS_04900 5415 4612 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_04900 6250 5408 gene locus_tag LOCUS_04910 gene aztB 6250 5408 CDS product zinc ABC transporter permease AztB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978391.1 protein_id gnl|my_center|LOCUS_04910 7200 6256 gene locus_tag LOCUS_04920 gene aztC 7200 6256 CDS product zinc ABC transporter substrate-binding protein AztC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731003.1 protein_id gnl|my_center|LOCUS_04920 7139 7303 gene locus_tag LOCUS_04930 7139 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 >Feature sequence048 <1 509 gene locus_tag LOCUS_04940 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030406.1:ABC transporter ATP-binding protein 506 1432 gene locus_tag LOCUS_04950 506 1432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030405.1 protein_id gnl|my_center|LOCUS_04950 1487 3877 gene locus_tag LOCUS_04960 1487 3877 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528147.1 protein_id gnl|my_center|LOCUS_04960 4695 3874 gene locus_tag LOCUS_04970 4695 3874 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_04970 6609 4699 gene locus_tag LOCUS_04980 6609 4699 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226492.1 protein_id gnl|my_center|LOCUS_04980 7735 6677 gene locus_tag LOCUS_04990 7735 6677 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876827.1 protein_id gnl|my_center|LOCUS_04990 >Feature sequence049 <1 734 gene locus_tag LOCUS_05000 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028182.1:leucyl aminopeptidase 789 2156 gene locus_tag LOCUS_05010 gene lpdA 789 2156 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_05010 2179 3765 gene locus_tag LOCUS_05020 gene sucB 2179 3765 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110455.1 protein_id gnl|my_center|LOCUS_05020 3755 4660 gene locus_tag LOCUS_05030 3755 4660 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_05030 4660 5907 gene locus_tag LOCUS_05040 4660 5907 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026916.1 protein_id gnl|my_center|LOCUS_05040 5904 6563 gene locus_tag LOCUS_05050 gene lipB 5904 6563 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224047.1 protein_id gnl|my_center|LOCUS_05050 6568 7509 gene locus_tag LOCUS_05060 gene lipA 6568 7509 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729704.1 protein_id gnl|my_center|LOCUS_05060 7506 8033 gene locus_tag LOCUS_05070 7506 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 >Feature sequence050 1420 1094 gene locus_tag LOCUS_05080 1420 1094 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015524.1 protein_id gnl|my_center|LOCUS_05080 1547 2956 gene locus_tag LOCUS_05090 gene cysS 1547 2956 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_237701980.1 protein_id gnl|my_center|LOCUS_05090 4794 2986 gene locus_tag LOCUS_05100 4794 2986 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_05100 5252 4872 gene locus_tag LOCUS_05110 5252 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 6115 5249 gene locus_tag LOCUS_05120 gene mshB 6115 5249 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089212260.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence051 333 2030 gene locus_tag LOCUS_05130 gene ctaD 333 2030 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_05130 2027 2422 gene locus_tag LOCUS_05140 2027 2422 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224074.1 protein_id gnl|my_center|LOCUS_05140 2551 2360 gene locus_tag LOCUS_05150 2551 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 2808 2542 gene locus_tag LOCUS_05160 2808 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 4712 2940 gene locus_tag LOCUS_05170 4712 2940 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_05170 5764 4709 gene locus_tag LOCUS_05180 5764 4709 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_05180 6552 5761 gene locus_tag LOCUS_05190 6552 5761 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805020.1 protein_id gnl|my_center|LOCUS_05190 7177 6572 gene locus_tag LOCUS_05200 7177 6572 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_05200 7336 7776 gene locus_tag LOCUS_05210 7336 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976663.1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence052 36 431 gene locus_tag LOCUS_05220 gene gcvH 36 431 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_05220 465 971 gene locus_tag LOCUS_05230 465 971 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559567.1 protein_id gnl|my_center|LOCUS_05230 968 1672 gene locus_tag LOCUS_05240 968 1672 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467185.1 protein_id gnl|my_center|LOCUS_05240 1689 2207 gene locus_tag LOCUS_05250 1689 2207 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_05250 2365 2940 gene locus_tag LOCUS_05260 2365 2940 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_05260 3247 6177 gene locus_tag LOCUS_05270 gene gcvP 3247 6177 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_05270 6837 6184 gene locus_tag LOCUS_05280 6837 6184 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087078053.1 protein_id gnl|my_center|LOCUS_05280 7531 6851 gene locus_tag LOCUS_05290 7531 6851 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112715.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence053 1023 640 gene locus_tag LOCUS_05300 1023 640 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486044.1 protein_id gnl|my_center|LOCUS_05300 1115 1327 gene locus_tag LOCUS_05310 1115 1327 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325534.1 protein_id gnl|my_center|LOCUS_05310 1327 2025 gene locus_tag LOCUS_05320 1327 2025 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222271.1 protein_id gnl|my_center|LOCUS_05320 2018 2722 gene locus_tag LOCUS_05330 gene fabG 2018 2722 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_05330 2744 3511 gene locus_tag LOCUS_05340 gene fabI 2744 3511 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_05340 3504 4013 gene locus_tag LOCUS_05350 3504 4013 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393763.1 protein_id gnl|my_center|LOCUS_05350 5245 4010 gene locus_tag LOCUS_05360 gene serB 5245 4010 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_05360 5307 6110 gene locus_tag LOCUS_05370 5307 6110 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_05370 6163 6777 gene locus_tag LOCUS_05380 6163 6777 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877775.1 protein_id gnl|my_center|LOCUS_05380 6818 7201 gene locus_tag LOCUS_05390 gene gcvH 6818 7201 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_05390 7235 7741 gene locus_tag LOCUS_05400 7235 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 >Feature sequence054 333 2030 gene locus_tag LOCUS_05410 gene ctaD 333 2030 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_05410 2027 2422 gene locus_tag LOCUS_05420 2027 2422 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_05420 4548 2776 gene locus_tag LOCUS_05430 4548 2776 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_05430 5600 4545 gene locus_tag LOCUS_05440 5600 4545 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_05440 6388 5597 gene locus_tag LOCUS_05450 6388 5597 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805020.1 protein_id gnl|my_center|LOCUS_05450 6970 6425 gene locus_tag LOCUS_05460 6970 6425 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_05460 7189 7644 gene locus_tag LOCUS_05470 7189 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976663.1 protein_id gnl|my_center|LOCUS_05470 >Feature sequence055 1269 565 gene locus_tag LOCUS_05480 1269 565 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_05480 2053 1280 gene locus_tag LOCUS_05490 2053 1280 CDS product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 protein_id gnl|my_center|LOCUS_05490 2073 3440 gene locus_tag LOCUS_05500 2073 3440 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230152.1 protein_id gnl|my_center|LOCUS_05500 3450 4226 gene locus_tag LOCUS_05510 3450 4226 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_05510 4223 4507 gene locus_tag LOCUS_05520 4223 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 5793 4534 gene locus_tag LOCUS_05530 5793 4534 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730701.1 protein_id gnl|my_center|LOCUS_05530 6525 5860 gene locus_tag LOCUS_05540 gene pdxH 6525 5860 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029623.1 protein_id gnl|my_center|LOCUS_05540 >Feature sequence056 1711 575 gene locus_tag LOCUS_05550 1711 575 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776144.1 protein_id gnl|my_center|LOCUS_05550 2720 1788 gene locus_tag LOCUS_05560 gene rihA 2720 1788 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207525.1 protein_id gnl|my_center|LOCUS_05560 4300 2720 gene locus_tag LOCUS_05570 4300 2720 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974103.1 protein_id gnl|my_center|LOCUS_05570 5063 4311 gene locus_tag LOCUS_05580 5063 4311 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_05580 6979 5066 gene locus_tag LOCUS_05590 6979 5066 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_05590 >Feature sequence057 2 964 gene locus_tag LOCUS_05600 gene pdhA 2 964 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112796.1 protein_id gnl|my_center|LOCUS_05600 968 1954 gene locus_tag LOCUS_05610 968 1954 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172527631.1 protein_id gnl|my_center|LOCUS_05610 1956 3194 gene locus_tag LOCUS_05620 1956 3194 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230925.1 protein_id gnl|my_center|LOCUS_05620 4008 3184 gene locus_tag LOCUS_05630 4008 3184 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029242.1 protein_id gnl|my_center|LOCUS_05630 4039 4848 gene locus_tag LOCUS_05640 4039 4848 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_05640 5611 4856 gene locus_tag LOCUS_05650 5611 4856 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027855.1 protein_id gnl|my_center|LOCUS_05650 7645 5621 gene locus_tag LOCUS_05660 7645 5621 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228600.1 protein_id gnl|my_center|LOCUS_05660 >Feature sequence058 2 964 gene locus_tag LOCUS_05670 gene pdhA 2 964 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112796.1 protein_id gnl|my_center|LOCUS_05670 968 1954 gene locus_tag LOCUS_05680 968 1954 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172527631.1 protein_id gnl|my_center|LOCUS_05680 1956 3194 gene locus_tag LOCUS_05690 1956 3194 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230925.1 protein_id gnl|my_center|LOCUS_05690 4008 3184 gene locus_tag LOCUS_05700 4008 3184 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029242.1 protein_id gnl|my_center|LOCUS_05700 4039 4848 gene locus_tag LOCUS_05710 4039 4848 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_05710 5611 4856 gene locus_tag LOCUS_05720 5611 4856 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027855.1 protein_id gnl|my_center|LOCUS_05720 7645 5621 gene locus_tag LOCUS_05730 7645 5621 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878112.1 protein_id gnl|my_center|LOCUS_05730 >Feature sequence059 324 1298 gene locus_tag LOCUS_05740 gene gmd 324 1298 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284917.1 protein_id gnl|my_center|LOCUS_05740 1949 1317 gene locus_tag LOCUS_05750 1949 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 2191 1946 gene locus_tag LOCUS_05760 2191 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 2582 2806 gene locus_tag LOCUS_05770 2582 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 2806 6417 gene locus_tag LOCUS_05780 2806 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 6424 7578 gene locus_tag LOCUS_05790 6424 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 >Feature sequence060 384 1334 gene locus_tag LOCUS_05800 gene rlmB 384 1334 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029524.1 protein_id gnl|my_center|LOCUS_05800 2528 1344 gene locus_tag LOCUS_05810 2528 1344 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975556.1 protein_id gnl|my_center|LOCUS_05810 2588 3286 gene locus_tag LOCUS_05820 2588 3286 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223702.1 protein_id gnl|my_center|LOCUS_05820 3464 3646 gene locus_tag LOCUS_05830 3464 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 3691 3885 gene locus_tag LOCUS_05840 3691 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 4362 4096 gene locus_tag LOCUS_05850 4362 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 5213 4434 gene locus_tag LOCUS_05860 5213 4434 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_05860 6616 5258 gene locus_tag LOCUS_05870 6616 5258 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223703.1 protein_id gnl|my_center|LOCUS_05870 <7634 6659 gene locus_tag LOCUS_05880 <7634 6659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027883.1:gamma-glutamylethanolamide synthetase GlnA4 >Feature sequence061 130 411 gene locus_tag LOCUS_05890 130 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976677.1 protein_id gnl|my_center|LOCUS_05890 451 678 gene locus_tag LOCUS_05900 451 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 828 1901 gene locus_tag LOCUS_05910 828 1901 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028159.1 protein_id gnl|my_center|LOCUS_05910 3725 1929 gene locus_tag LOCUS_05920 3725 1929 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028155.1 protein_id gnl|my_center|LOCUS_05920 3980 3783 gene locus_tag LOCUS_05930 3980 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 3888 4298 gene locus_tag LOCUS_05940 3888 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729677.1 protein_id gnl|my_center|LOCUS_05940 4301 5074 gene locus_tag LOCUS_05950 4301 5074 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028154.1 protein_id gnl|my_center|LOCUS_05950 5169 5624 gene locus_tag LOCUS_05960 5169 5624 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_05960 5593 6762 gene locus_tag LOCUS_05970 5593 6762 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224322.1 protein_id gnl|my_center|LOCUS_05970 6759 7073 gene locus_tag LOCUS_05980 6759 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 >Feature sequence062 828 115 gene locus_tag LOCUS_05990 828 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 1860 895 gene locus_tag LOCUS_06000 1860 895 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_06000 1941 2924 gene locus_tag LOCUS_06010 1941 2924 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 protein_id gnl|my_center|LOCUS_06010 4087 2921 gene locus_tag LOCUS_06020 4087 2921 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 protein_id gnl|my_center|LOCUS_06020 4512 4201 gene locus_tag LOCUS_06030 4512 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 4584 5000 gene locus_tag LOCUS_06040 gene sodN 4584 5000 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_06040 5004 5507 gene locus_tag LOCUS_06050 5004 5507 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229707.1 protein_id gnl|my_center|LOCUS_06050 5497 5907 gene locus_tag LOCUS_06060 5497 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 5917 6717 gene locus_tag LOCUS_06070 5917 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 7151 6738 gene locus_tag LOCUS_06080 7151 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence063 1666 473 gene locus_tag LOCUS_06090 1666 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 2136 1843 gene locus_tag LOCUS_06100 2136 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 2039 4582 gene locus_tag LOCUS_06110 2039 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 4619 5596 gene locus_tag LOCUS_06120 4619 5596 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809529.1 protein_id gnl|my_center|LOCUS_06120 5658 6233 gene locus_tag LOCUS_06130 5658 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06130 6233 6766 gene locus_tag LOCUS_06140 6233 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 7553 6780 gene locus_tag LOCUS_06150 7553 6780 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399793.1 protein_id gnl|my_center|LOCUS_06150 >Feature sequence064 1682 441 gene locus_tag LOCUS_06160 1682 441 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230171.1 protein_id gnl|my_center|LOCUS_06160 1791 2333 gene locus_tag LOCUS_06170 1791 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 2360 2869 gene locus_tag LOCUS_06180 2360 2869 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203764525.1 protein_id gnl|my_center|LOCUS_06180 3728 2859 gene locus_tag LOCUS_06190 3728 2859 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_06190 3793 4008 gene locus_tag LOCUS_06200 3793 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 4030 4707 gene locus_tag LOCUS_06210 4030 4707 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804627.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06210 4814 5170 gene locus_tag LOCUS_06220 4814 5170 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 protein_id gnl|my_center|LOCUS_06220 5167 6699 gene locus_tag LOCUS_06230 5167 6699 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030329.1 protein_id gnl|my_center|LOCUS_06230 >Feature sequence065 582 7 gene locus_tag LOCUS_06240 582 7 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 protein_id gnl|my_center|LOCUS_06240 683 1942 gene locus_tag LOCUS_06250 gene murA 683 1942 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084647.1 protein_id gnl|my_center|LOCUS_06250 2354 1935 gene locus_tag LOCUS_06260 2354 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 2333 4348 gene locus_tag LOCUS_06270 2333 4348 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030947.1 protein_id gnl|my_center|LOCUS_06270 4339 5022 gene locus_tag LOCUS_06280 gene nucS 4339 5022 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014205.1 protein_id gnl|my_center|LOCUS_06280 5043 6842 gene locus_tag LOCUS_06290 5043 6842 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229492.1 protein_id gnl|my_center|LOCUS_06290 >Feature sequence066 1347 325 gene locus_tag LOCUS_06300 gene fbaA 1347 325 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230818.1 protein_id gnl|my_center|LOCUS_06300 2635 1394 gene locus_tag LOCUS_06310 2635 1394 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816310.1 protein_id gnl|my_center|LOCUS_06310 3291 2632 gene locus_tag LOCUS_06320 3291 2632 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892159.1 protein_id gnl|my_center|LOCUS_06320 3286 3939 gene locus_tag LOCUS_06330 3286 3939 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230830.1 protein_id gnl|my_center|LOCUS_06330 4412 3936 gene locus_tag LOCUS_06340 gene pyrE 4412 3936 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230857.1 protein_id gnl|my_center|LOCUS_06340 4525 4974 gene locus_tag LOCUS_06350 4525 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 5750 4971 gene locus_tag LOCUS_06360 5750 4971 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776687.1 protein_id gnl|my_center|LOCUS_06360 5819 7315 gene locus_tag LOCUS_06370 5819 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 >Feature sequence067 2 901 gene locus_tag LOCUS_06380 2 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2655 1441 gene locus_tag LOCUS_06390 gene marP 2655 1441 CDS product acid resistance serine protease MarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083527.1 protein_id gnl|my_center|LOCUS_06390 3323 2652 gene locus_tag LOCUS_06400 3323 2652 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_06400 4015 3320 gene locus_tag LOCUS_06410 gene nth 4015 3320 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419724.1 protein_id gnl|my_center|LOCUS_06410 4152 4826 gene locus_tag LOCUS_06420 4152 4826 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_06420 5668 4823 gene locus_tag LOCUS_06430 5668 4823 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_06430 6321 5665 gene locus_tag LOCUS_06440 6321 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_06440 6798 6325 gene locus_tag LOCUS_06450 6798 6325 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_06450 6972 6817 gene locus_tag LOCUS_06460 6972 6817 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776605.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence068 <1 562 gene locus_tag LOCUS_06470 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929838.1:aminotransferase class V-fold PLP-dependent enzyme 1162 578 gene locus_tag LOCUS_06480 1162 578 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229469.1 protein_id gnl|my_center|LOCUS_06480 1329 1847 gene locus_tag LOCUS_06490 1329 1847 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_06490 3275 1878 gene locus_tag LOCUS_06500 3275 1878 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900487.1 protein_id gnl|my_center|LOCUS_06500 4509 3277 gene locus_tag LOCUS_06510 4509 3277 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_06510 4813 4574 gene locus_tag LOCUS_06520 4813 4574 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559006.1 protein_id gnl|my_center|LOCUS_06520 5879 4875 gene locus_tag LOCUS_06530 5879 4875 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976418.1 protein_id gnl|my_center|LOCUS_06530 7069 5876 gene locus_tag LOCUS_06540 7069 5876 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence069 <1 973 gene locus_tag LOCUS_06550 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224501.1:thiolase family protein 970 3084 gene locus_tag LOCUS_06560 970 3084 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224500.1 protein_id gnl|my_center|LOCUS_06560 5015 3099 gene locus_tag LOCUS_06570 gene dxs 5015 3099 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031168.1 protein_id gnl|my_center|LOCUS_06570 5488 5120 gene locus_tag LOCUS_06580 5488 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 <7361 5485 gene locus_tag LOCUS_06590 <7361 5485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972923.1:aconitate hydratase AcnA >Feature sequence070 1064 990 gene locus_tag LOCUS_t00130 1064 990 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1093 1488 gene locus_tag LOCUS_06600 1093 1488 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978131.1 protein_id gnl|my_center|LOCUS_06600 3555 1531 gene locus_tag LOCUS_06610 3555 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 4822 3560 gene locus_tag LOCUS_06620 4822 3560 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031374.1 protein_id gnl|my_center|LOCUS_06620 6197 4815 gene locus_tag LOCUS_06630 6197 4815 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031373.1 protein_id gnl|my_center|LOCUS_06630 7213 6206 gene locus_tag LOCUS_06640 7213 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence071 <1 664 gene locus_tag LOCUS_06650 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013296133.1:heliorhodopsin HeR 678 1436 gene locus_tag LOCUS_06660 678 1436 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878743.1 protein_id gnl|my_center|LOCUS_06660 1441 2274 gene locus_tag LOCUS_06670 1441 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 3066 2269 gene locus_tag LOCUS_06680 3066 2269 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147982.1 protein_id gnl|my_center|LOCUS_06680 3137 3688 gene locus_tag LOCUS_06690 3137 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 4283 4741 gene locus_tag LOCUS_06700 4283 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 4800 5357 gene locus_tag LOCUS_06710 4800 5357 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068421.1 protein_id gnl|my_center|LOCUS_06710 >Feature sequence072 1145 2530 gene locus_tag LOCUS_06720 1145 2530 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229595.1 protein_id gnl|my_center|LOCUS_06720 2895 2518 gene locus_tag LOCUS_06730 gene mscL 2895 2518 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889048.1 protein_id gnl|my_center|LOCUS_06730 3396 2941 gene locus_tag LOCUS_06740 3396 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 3835 3455 gene locus_tag LOCUS_06750 3835 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 3950 4345 gene locus_tag LOCUS_06760 gene crcB 3950 4345 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927153.1 protein_id gnl|my_center|LOCUS_06760 4342 4713 gene locus_tag LOCUS_06770 4342 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 5462 4722 gene locus_tag LOCUS_06780 5462 4722 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_06780 6193 5570 gene locus_tag LOCUS_06790 6193 5570 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230040.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence073 1617 1306 gene locus_tag LOCUS_06800 1617 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 1960 1610 gene locus_tag LOCUS_06810 1960 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 2137 3438 gene locus_tag LOCUS_06820 2137 3438 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 protein_id gnl|my_center|LOCUS_06820 4658 3435 gene locus_tag LOCUS_06830 4658 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 6595 4619 gene locus_tag LOCUS_06840 6595 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence074 <1 1028 gene locus_tag LOCUS_06850 <1 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003894402.1:replication-associated recombination protein A 1305 3980 gene locus_tag LOCUS_06860 gene alaS 1305 3980 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 protein_id gnl|my_center|LOCUS_06860 3983 4405 gene locus_tag LOCUS_06870 gene ruvX 3983 4405 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_06870 4402 5499 gene locus_tag LOCUS_06880 4402 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 5492 6298 gene locus_tag LOCUS_06890 5492 6298 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_06890 6342 6809 gene locus_tag LOCUS_06900 6342 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 >Feature sequence075 625 1401 gene locus_tag LOCUS_06910 625 1401 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029292.1 protein_id gnl|my_center|LOCUS_06910 1498 2436 gene locus_tag LOCUS_06920 1498 2436 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863476.1 protein_id gnl|my_center|LOCUS_06920 3443 2502 gene locus_tag LOCUS_06930 3443 2502 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_06930 4741 3449 gene locus_tag LOCUS_06940 4741 3449 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_06940 5944 4874 gene locus_tag LOCUS_06950 5944 4874 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898354.1 protein_id gnl|my_center|LOCUS_06950 6264 5944 gene locus_tag LOCUS_06960 gene trxA 6264 5944 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_06960 <7005 6294 gene locus_tag LOCUS_06970 <7005 6294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975041.1:thioredoxin-disulfide reductase >Feature sequence076 <1 604 gene locus_tag LOCUS_06980 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012805053.1:DUF3710 domain-containing protein 653 1018 gene locus_tag LOCUS_06990 653 1018 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327459.1 protein_id gnl|my_center|LOCUS_06990 1015 1698 gene locus_tag LOCUS_07000 1015 1698 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224482.1 protein_id gnl|my_center|LOCUS_07000 2380 1721 gene locus_tag LOCUS_07010 2380 1721 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_07010 3062 2397 gene locus_tag LOCUS_07020 3062 2397 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_07020 3144 5081 gene locus_tag LOCUS_07030 3144 5081 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093687.1 protein_id gnl|my_center|LOCUS_07030 5364 5125 gene locus_tag LOCUS_07040 5364 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 5401 6303 gene locus_tag LOCUS_07050 5401 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence077 1728 511 gene locus_tag LOCUS_07060 1728 511 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224456.1 protein_id gnl|my_center|LOCUS_07060 3050 1740 gene locus_tag LOCUS_07070 3050 1740 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878529.1 protein_id gnl|my_center|LOCUS_07070 3835 3047 gene locus_tag LOCUS_07080 3835 3047 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897420.1 protein_id gnl|my_center|LOCUS_07080 5103 3955 gene locus_tag LOCUS_07090 5103 3955 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897421.1 protein_id gnl|my_center|LOCUS_07090 6342 5179 gene locus_tag LOCUS_07100 gene xylA 6342 5179 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_07100 >Feature sequence078 976 152 gene locus_tag LOCUS_07110 976 152 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977503.1 protein_id gnl|my_center|LOCUS_07110 2022 973 gene locus_tag LOCUS_07120 2022 973 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_07120 2117 3040 gene locus_tag LOCUS_07130 2117 3040 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977155.1 protein_id gnl|my_center|LOCUS_07130 4582 3254 gene locus_tag LOCUS_07140 4582 3254 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_07140 4655 4741 gene locus_tag LOCUS_t00140 4655 4741 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6354 4741 gene locus_tag LOCUS_07150 gene lfrA 6354 4741 CDS product efflux MFS transporter LfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731134.1 protein_id gnl|my_center|LOCUS_07150 6611 6351 gene locus_tag LOCUS_07160 6611 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 >Feature sequence079 1023 640 gene locus_tag LOCUS_07170 1023 640 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486044.1 protein_id gnl|my_center|LOCUS_07170 1115 1327 gene locus_tag LOCUS_07180 1115 1327 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325534.1 protein_id gnl|my_center|LOCUS_07180 1327 2025 gene locus_tag LOCUS_07190 1327 2025 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222271.1 protein_id gnl|my_center|LOCUS_07190 2018 2722 gene locus_tag LOCUS_07200 gene fabG 2018 2722 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_07200 2744 3511 gene locus_tag LOCUS_07210 gene fabI 2744 3511 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_07210 3504 4013 gene locus_tag LOCUS_07220 3504 4013 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393763.1 protein_id gnl|my_center|LOCUS_07220 5245 4010 gene locus_tag LOCUS_07230 gene serB 5245 4010 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_07230 5355 6110 gene locus_tag LOCUS_07240 5355 6110 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_07240 6144 6764 gene locus_tag LOCUS_07250 6144 6764 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877775.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence080 1601 2380 gene locus_tag LOCUS_07260 1601 2380 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_07260 2377 3321 gene locus_tag LOCUS_07270 2377 3321 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056694.1 protein_id gnl|my_center|LOCUS_07270 4325 3354 gene locus_tag LOCUS_07280 4325 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 4514 5749 gene locus_tag LOCUS_07290 4514 5749 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223543.1 protein_id gnl|my_center|LOCUS_07290 5766 6482 gene locus_tag LOCUS_07300 5766 6482 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223530.1 protein_id gnl|my_center|LOCUS_07300 6883 6467 gene locus_tag LOCUS_07310 6883 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence081 <1 1568 gene locus_tag LOCUS_07320 <1 1568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742213.1:glutamate synthase large subunit 1561 3015 gene locus_tag LOCUS_07330 1561 3015 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228800.1 protein_id gnl|my_center|LOCUS_07330 3051 4475 gene locus_tag LOCUS_07340 gene pyk 3051 4475 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 protein_id gnl|my_center|LOCUS_07340 4562 5122 gene locus_tag LOCUS_07350 gene pyrR 4562 5122 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_07350 5123 6076 gene locus_tag LOCUS_07360 5123 6076 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence082 686 381 gene locus_tag LOCUS_07370 686 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 1974 733 gene locus_tag LOCUS_07380 1974 733 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816310.1 protein_id gnl|my_center|LOCUS_07380 2630 1971 gene locus_tag LOCUS_07390 2630 1971 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892159.1 protein_id gnl|my_center|LOCUS_07390 2625 3278 gene locus_tag LOCUS_07400 2625 3278 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230830.1 protein_id gnl|my_center|LOCUS_07400 3751 3275 gene locus_tag LOCUS_07410 gene pyrE 3751 3275 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230857.1 protein_id gnl|my_center|LOCUS_07410 3863 4312 gene locus_tag LOCUS_07420 3863 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 5088 4309 gene locus_tag LOCUS_07430 5088 4309 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085720.1 protein_id gnl|my_center|LOCUS_07430 5155 6654 gene locus_tag LOCUS_07440 5155 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence083 1651 89 gene locus_tag LOCUS_07450 gene purH 1651 89 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 protein_id gnl|my_center|LOCUS_07450 2210 1644 gene locus_tag LOCUS_07460 gene purN 2210 1644 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898661.1 protein_id gnl|my_center|LOCUS_07460 2882 2220 gene locus_tag LOCUS_07470 2882 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 4119 2908 gene locus_tag LOCUS_07480 4119 2908 CDS product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029881.1 protein_id gnl|my_center|LOCUS_07480 4975 4199 gene locus_tag LOCUS_07490 4975 4199 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031344.1 protein_id gnl|my_center|LOCUS_07490 5878 5009 gene locus_tag LOCUS_07500 gene sucD 5878 5009 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804538.1 protein_id gnl|my_center|LOCUS_07500 <6761 5891 gene locus_tag LOCUS_07510 <6761 5891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222715.1:ADP-forming succinate--CoA ligase subunit beta >Feature sequence084 2 541 gene locus_tag LOCUS_07520 2 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 538 2721 gene locus_tag LOCUS_07530 gene glgB 538 2721 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_07530 3713 2748 gene locus_tag LOCUS_07540 3713 2748 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 protein_id gnl|my_center|LOCUS_07540 3758 4231 gene locus_tag LOCUS_07550 3758 4231 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406624.1 protein_id gnl|my_center|LOCUS_07550 5144 4224 gene locus_tag LOCUS_07560 gene meaB 5144 4224 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_07560 6368 5172 gene locus_tag LOCUS_07570 6368 5172 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence085 3394 2501 gene locus_tag LOCUS_07580 3394 2501 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112080.1 protein_id gnl|my_center|LOCUS_07580 4365 3394 gene locus_tag LOCUS_07590 gene tatC 4365 3394 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977194.1 protein_id gnl|my_center|LOCUS_07590 4638 4396 gene locus_tag LOCUS_07600 gene tatA 4638 4396 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895338.1 protein_id gnl|my_center|LOCUS_07600 5615 4641 gene locus_tag LOCUS_07610 5615 4641 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_07610 6598 5612 gene locus_tag LOCUS_07620 6598 5612 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226715.1 protein_id gnl|my_center|LOCUS_07620 >Feature sequence086 885 289 gene locus_tag LOCUS_07630 885 289 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057751.1 protein_id gnl|my_center|LOCUS_07630 1908 895 gene locus_tag LOCUS_07640 gene ribD 1908 895 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803669.1 protein_id gnl|my_center|LOCUS_07640 2573 1905 gene locus_tag LOCUS_07650 gene rpe 2573 1905 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_07650 3962 2613 gene locus_tag LOCUS_07660 3962 2613 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_07660 4888 3959 gene locus_tag LOCUS_07670 gene fmt 4888 3959 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296597.1 protein_id gnl|my_center|LOCUS_07670 5437 4892 gene locus_tag LOCUS_07680 gene def 5437 4892 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_07680 6706 5462 gene locus_tag LOCUS_07690 6706 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence087 1010 1762 gene locus_tag LOCUS_07700 1010 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 1762 2304 gene locus_tag LOCUS_07710 1762 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 2357 3226 gene locus_tag LOCUS_07720 2357 3226 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941296.1 protein_id gnl|my_center|LOCUS_07720 3236 4099 gene locus_tag LOCUS_07730 gene rfbA 3236 4099 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401670.1 protein_id gnl|my_center|LOCUS_07730 5825 4143 gene locus_tag LOCUS_07740 5825 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 <6700 5825 gene locus_tag LOCUS_07750 <6700 5825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157768866.1:glycosyltransferase >Feature sequence088 36 716 gene locus_tag LOCUS_07760 36 716 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386325.1 protein_id gnl|my_center|LOCUS_07760 854 1066 gene locus_tag LOCUS_07770 854 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 1106 2677 gene locus_tag LOCUS_07780 1106 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 4059 2674 gene locus_tag LOCUS_07790 4059 2674 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219112755.1 protein_id gnl|my_center|LOCUS_07790 4994 4086 gene locus_tag LOCUS_07800 4994 4086 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222886.1 protein_id gnl|my_center|LOCUS_07800 5626 5012 gene locus_tag LOCUS_07810 5626 5012 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103336743.1 protein_id gnl|my_center|LOCUS_07810 <6590 5610 gene locus_tag LOCUS_07820 <6590 5610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027921.1:acyl-CoA dehydrogenase >Feature sequence089 2185 1475 gene locus_tag LOCUS_07830 2185 1475 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_07830 2514 2284 gene locus_tag LOCUS_07840 2514 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 4080 2539 gene locus_tag LOCUS_07850 4080 2539 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222411.1 protein_id gnl|my_center|LOCUS_07850 4137 5033 gene locus_tag LOCUS_07860 4137 5033 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666589.1 protein_id gnl|my_center|LOCUS_07860 5956 5045 gene locus_tag LOCUS_07870 5956 5045 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975511.1 protein_id gnl|my_center|LOCUS_07870 <6579 5949 gene locus_tag LOCUS_07880 <6579 5949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975510.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence090 130 411 gene locus_tag LOCUS_07890 130 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976677.1 protein_id gnl|my_center|LOCUS_07890 451 678 gene locus_tag LOCUS_07900 451 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 877 1929 gene locus_tag LOCUS_07910 877 1929 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028159.1 protein_id gnl|my_center|LOCUS_07910 3753 1957 gene locus_tag LOCUS_07920 3753 1957 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028155.1 protein_id gnl|my_center|LOCUS_07920 3914 4324 gene locus_tag LOCUS_07930 3914 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729677.1 protein_id gnl|my_center|LOCUS_07930 4333 5100 gene locus_tag LOCUS_07940 4333 5100 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028154.1 protein_id gnl|my_center|LOCUS_07940 5195 5650 gene locus_tag LOCUS_07950 5195 5650 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence091 2075 1029 gene locus_tag LOCUS_07960 2075 1029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528943.1 protein_id gnl|my_center|LOCUS_07960 2842 2072 gene locus_tag LOCUS_07970 2842 2072 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528944.1 protein_id gnl|my_center|LOCUS_07970 3728 2835 gene locus_tag LOCUS_07980 3728 2835 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528945.1 protein_id gnl|my_center|LOCUS_07980 4829 3741 gene locus_tag LOCUS_07990 4829 3741 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528946.1 protein_id gnl|my_center|LOCUS_07990 5036 5662 gene locus_tag LOCUS_08000 5036 5662 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730474.1 protein_id gnl|my_center|LOCUS_08000 >Feature sequence092 1666 473 gene locus_tag LOCUS_08010 1666 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 2122 1772 gene locus_tag LOCUS_08020 2122 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 2127 4655 gene locus_tag LOCUS_08030 2127 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 4692 5669 gene locus_tag LOCUS_08040 4692 5669 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809529.1 protein_id gnl|my_center|LOCUS_08040 6446 5673 gene locus_tag LOCUS_08050 6446 5673 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399793.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence093 451 1236 gene locus_tag LOCUS_08060 451 1236 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223166.1 protein_id gnl|my_center|LOCUS_08060 1244 2161 gene locus_tag LOCUS_08070 gene hutG 1244 2161 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399848.1 protein_id gnl|my_center|LOCUS_08070 2175 2384 gene locus_tag LOCUS_08080 2175 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 3126 2377 gene locus_tag LOCUS_08090 3126 2377 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031666.1 protein_id gnl|my_center|LOCUS_08090 3179 5389 gene locus_tag LOCUS_08100 3179 5389 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence094 451 1236 gene locus_tag LOCUS_08110 451 1236 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223166.1 protein_id gnl|my_center|LOCUS_08110 1244 2161 gene locus_tag LOCUS_08120 gene hutG 1244 2161 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243908.1 protein_id gnl|my_center|LOCUS_08120 2175 2384 gene locus_tag LOCUS_08130 2175 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 3126 2371 gene locus_tag LOCUS_08140 3126 2371 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031666.1 protein_id gnl|my_center|LOCUS_08140 3182 5389 gene locus_tag LOCUS_08150 3182 5389 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence095 822 79 gene locus_tag LOCUS_08160 822 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 864 1619 gene locus_tag LOCUS_08170 864 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1624 2016 gene locus_tag LOCUS_08180 1624 2016 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728346.1 protein_id gnl|my_center|LOCUS_08180 2059 2634 gene locus_tag LOCUS_08190 gene dcd 2059 2634 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_08190 5402 3195 gene locus_tag LOCUS_08200 5402 3195 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226200.1 protein_id gnl|my_center|LOCUS_08200 <6430 5458 gene locus_tag LOCUS_08210 <6430 5458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726709.1:formate dehydrogenase subunit alpha >Feature sequence096 <1 1549 gene locus_tag LOCUS_08220 <1 1549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027283.1:glycerol-3-phosphate dehydrogenase/oxidase 1533 2216 gene locus_tag LOCUS_08230 1533 2216 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804665.1 protein_id gnl|my_center|LOCUS_08230 2213 2524 gene locus_tag LOCUS_08240 2213 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 2521 3021 gene locus_tag LOCUS_08250 2521 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 3780 3028 gene locus_tag LOCUS_08260 gene dapB 3780 3028 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014794.1 protein_id gnl|my_center|LOCUS_08260 5091 3790 gene locus_tag LOCUS_08270 5091 3790 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_08270 <6410 5081 gene locus_tag LOCUS_08280 <6410 5081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973290.1:polyribonucleotide nucleotidyltransferase >Feature sequence097 <1 1549 gene locus_tag LOCUS_08290 <1 1549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027283.1:glycerol-3-phosphate dehydrogenase/oxidase 1533 2216 gene locus_tag LOCUS_08300 1533 2216 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804665.1 protein_id gnl|my_center|LOCUS_08300 2213 2524 gene locus_tag LOCUS_08310 2213 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 2521 3021 gene locus_tag LOCUS_08320 2521 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 3780 3028 gene locus_tag LOCUS_08330 gene dapB 3780 3028 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014794.1 protein_id gnl|my_center|LOCUS_08330 5091 3790 gene locus_tag LOCUS_08340 5091 3790 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_08340 <6410 5081 gene locus_tag LOCUS_08350 <6410 5081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973290.1:polyribonucleotide nucleotidyltransferase >Feature sequence098 212 901 gene locus_tag LOCUS_08360 212 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 2102 879 gene locus_tag LOCUS_08370 2102 879 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776070.1 protein_id gnl|my_center|LOCUS_08370 2689 2099 gene locus_tag LOCUS_08380 2689 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 2854 3123 gene locus_tag LOCUS_08390 2854 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 3625 3059 gene locus_tag LOCUS_08400 3625 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 3959 4462 gene locus_tag LOCUS_08410 3959 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 <6390 4483 gene locus_tag LOCUS_08420 <6390 4483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975807.1:preprotein translocase subunit SecA >Feature sequence099 <1 2089 gene locus_tag LOCUS_08430 <1 2089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226749.1:methionine synthase 2079 2768 gene locus_tag LOCUS_08440 2079 2768 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 protein_id gnl|my_center|LOCUS_08440 3588 2770 gene locus_tag LOCUS_08450 3588 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 3721 4629 gene locus_tag LOCUS_08460 3721 4629 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_08460 4733 6385 gene locus_tag LOCUS_08470 gene arc 4733 6385 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence100 1197 4 gene locus_tag LOCUS_08480 1197 4 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230507.1 protein_id gnl|my_center|LOCUS_08480 1820 1194 gene locus_tag LOCUS_08490 1820 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 4552 1823 gene locus_tag LOCUS_08500 gene topA 4552 1823 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029075.1 protein_id gnl|my_center|LOCUS_08500 <6368 4734 gene locus_tag LOCUS_08510 <6368 4734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029076.1:sodium-translocating pyrophosphatase >Feature sequence101 939 316 gene locus_tag LOCUS_08520 939 316 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 protein_id gnl|my_center|LOCUS_08520 1761 970 gene locus_tag LOCUS_08530 1761 970 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_08530 4088 1746 gene locus_tag LOCUS_08540 4088 1746 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029584.1 protein_id gnl|my_center|LOCUS_08540 5014 4085 gene locus_tag LOCUS_08550 5014 4085 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_08550 5101 5868 gene locus_tag LOCUS_08560 5101 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence102 574 1941 gene locus_tag LOCUS_08570 574 1941 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230152.1 protein_id gnl|my_center|LOCUS_08570 1951 2727 gene locus_tag LOCUS_08580 1951 2727 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_08580 2724 3008 gene locus_tag LOCUS_08590 2724 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 4292 3033 gene locus_tag LOCUS_08600 4292 3033 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730701.1 protein_id gnl|my_center|LOCUS_08600 5025 4336 gene locus_tag LOCUS_08610 gene pdxH 5025 4336 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230168.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence103 1636 77 gene locus_tag LOCUS_08620 gene purF 1636 77 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_08620 2048 1683 gene locus_tag LOCUS_08630 2048 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 4305 2053 gene locus_tag LOCUS_08640 gene purL 4305 2053 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_08640 4979 4302 gene locus_tag LOCUS_08650 gene purQ 4979 4302 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974894.1 protein_id gnl|my_center|LOCUS_08650 5230 4976 gene locus_tag LOCUS_08660 gene purS 5230 4976 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974895.1 protein_id gnl|my_center|LOCUS_08660 5717 5307 gene locus_tag LOCUS_08670 gene vapC26 5717 5307 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_08670 5929 5714 gene locus_tag LOCUS_08680 5929 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence104 1484 1191 gene locus_tag LOCUS_08690 1484 1191 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226308.1 protein_id gnl|my_center|LOCUS_08690 1935 1564 gene locus_tag LOCUS_08700 1935 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 2324 1929 gene locus_tag LOCUS_08710 2324 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 2530 2348 gene locus_tag LOCUS_08720 2530 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 3400 2684 gene locus_tag LOCUS_08730 3400 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 4095 3397 gene locus_tag LOCUS_08740 4095 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 5252 4092 gene locus_tag LOCUS_08750 5252 4092 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_08750 <6221 5249 gene locus_tag LOCUS_08760 <6221 5249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029084.1:septum formation initiator >Feature sequence105 361 570 gene locus_tag LOCUS_08770 361 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 2067 544 gene locus_tag LOCUS_08780 2067 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 2984 2064 gene locus_tag LOCUS_08790 gene yedA 2984 2064 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268946.1 protein_id gnl|my_center|LOCUS_08790 3048 4652 gene locus_tag LOCUS_08800 3048 4652 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 protein_id gnl|my_center|LOCUS_08800 5356 4649 gene locus_tag LOCUS_08810 5356 4649 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_08810 5802 5332 gene locus_tag LOCUS_08820 5802 5332 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227655.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence106 594 1604 gene locus_tag LOCUS_08830 gene corA 594 1604 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027906.1 protein_id gnl|my_center|LOCUS_08830 2436 1612 gene locus_tag LOCUS_08840 2436 1612 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971321.1 protein_id gnl|my_center|LOCUS_08840 3482 2433 gene locus_tag LOCUS_08850 3482 2433 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_08850 3517 4500 gene locus_tag LOCUS_08860 3517 4500 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977155.1 protein_id gnl|my_center|LOCUS_08860 6042 4714 gene locus_tag LOCUS_08870 6042 4714 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence107 2039 597 gene locus_tag LOCUS_08880 gene murD 2039 597 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_08880 3100 2036 gene locus_tag LOCUS_08890 gene mraY 3100 2036 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 protein_id gnl|my_center|LOCUS_08890 4473 3097 gene locus_tag LOCUS_08900 4473 3097 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_08900 5927 4470 gene locus_tag LOCUS_08910 5927 4470 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence108 1531 281 gene locus_tag LOCUS_08920 1531 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1674 2948 gene locus_tag LOCUS_08930 1674 2948 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_08930 3011 3811 gene locus_tag LOCUS_08940 3011 3811 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905199.1 protein_id gnl|my_center|LOCUS_08940 3808 5049 gene locus_tag LOCUS_08950 3808 5049 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence109 384 1442 gene locus_tag LOCUS_08960 384 1442 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876827.1 protein_id gnl|my_center|LOCUS_08960 1494 3407 gene locus_tag LOCUS_08970 1494 3407 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226492.1 protein_id gnl|my_center|LOCUS_08970 3411 4232 gene locus_tag LOCUS_08980 3411 4232 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_08980 <6071 4229 gene locus_tag LOCUS_08990 <6071 4229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528147.1:FAD-dependent oxidoreductase >Feature sequence110 111 39 gene locus_tag LOCUS_t00150 111 39 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 805 182 gene locus_tag LOCUS_09000 gene orn 805 182 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_09000 1473 1099 gene locus_tag LOCUS_09010 1473 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1505 2317 gene locus_tag LOCUS_09020 1505 2317 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222170.1 protein_id gnl|my_center|LOCUS_09020 2321 3409 gene locus_tag LOCUS_09030 2321 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 3452 3754 gene locus_tag LOCUS_09040 3452 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 3888 4451 gene locus_tag LOCUS_09050 3888 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 5250 4444 gene locus_tag LOCUS_09060 5250 4444 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930212.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence111 <1 530 gene locus_tag LOCUS_09070 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528942.1:glycosyltransferase 545 1633 gene locus_tag LOCUS_09080 545 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1630 2583 gene locus_tag LOCUS_09090 1630 2583 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896728.1 protein_id gnl|my_center|LOCUS_09090 3385 2570 gene locus_tag LOCUS_09100 3385 2570 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456342.1 protein_id gnl|my_center|LOCUS_09100 3662 3393 gene locus_tag LOCUS_09110 3662 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 4407 3667 gene locus_tag LOCUS_09120 4407 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 4757 4575 gene locus_tag LOCUS_09130 4757 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 4936 5385 gene locus_tag LOCUS_09140 4936 5385 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071603.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence112 224 21 gene locus_tag LOCUS_09150 224 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 115 435 gene locus_tag LOCUS_09160 115 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1598 516 gene locus_tag LOCUS_09170 1598 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 2211 1783 gene locus_tag LOCUS_09180 2211 1783 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_09180 2487 2239 gene locus_tag LOCUS_09190 2487 2239 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403834.1 protein_id gnl|my_center|LOCUS_09190 2641 2922 gene locus_tag LOCUS_09200 2641 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 2929 3366 gene locus_tag LOCUS_09210 2929 3366 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092502.1 protein_id gnl|my_center|LOCUS_09210 4098 3307 gene locus_tag LOCUS_09220 4098 3307 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222392.1 protein_id gnl|my_center|LOCUS_09220 4670 4119 gene locus_tag LOCUS_09230 4670 4119 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974766.1 protein_id gnl|my_center|LOCUS_09230 <5904 4657 gene locus_tag LOCUS_09240 <5904 4657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742053.1:D-inositol-3-phosphate glycosyltransferase >Feature sequence113 491 1450 gene locus_tag LOCUS_09250 491 1450 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228081.1 protein_id gnl|my_center|LOCUS_09250 1460 2638 gene locus_tag LOCUS_09260 1460 2638 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918994.1 protein_id gnl|my_center|LOCUS_09260 4114 2672 gene locus_tag LOCUS_09270 4114 2672 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195505.1 protein_id gnl|my_center|LOCUS_09270 5483 4116 gene locus_tag LOCUS_09280 5483 4116 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972090.1 protein_id gnl|my_center|LOCUS_09280 5899 5483 gene locus_tag LOCUS_09290 5899 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence114 1143 376 gene locus_tag LOCUS_09300 1143 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_09300 1230 2159 gene locus_tag LOCUS_09310 1230 2159 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_09310 2156 4474 gene locus_tag LOCUS_09320 2156 4474 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029584.1 protein_id gnl|my_center|LOCUS_09320 4471 5250 gene locus_tag LOCUS_09330 4471 5250 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence115 2 901 gene locus_tag LOCUS_09340 2 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1024 851 gene locus_tag LOCUS_09350 1024 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1001 3409 gene locus_tag LOCUS_09360 1001 3409 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533043.1 protein_id gnl|my_center|LOCUS_09360 3533 3724 gene locus_tag LOCUS_09370 3533 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 5031 3817 gene locus_tag LOCUS_09380 gene marP 5031 3817 CDS product acid resistance serine protease MarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083527.1 protein_id gnl|my_center|LOCUS_09380 5699 5028 gene locus_tag LOCUS_09390 5699 5028 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence116 517 930 gene locus_tag LOCUS_09400 517 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1041 1976 gene locus_tag LOCUS_09410 1041 1976 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057202.1 protein_id gnl|my_center|LOCUS_09410 3497 1983 gene locus_tag LOCUS_09420 3497 1983 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_09420 3595 4617 gene locus_tag LOCUS_09430 3595 4617 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775776.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence117 50 952 gene locus_tag LOCUS_09440 gene yedA 50 952 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212226.1 protein_id gnl|my_center|LOCUS_09440 1448 960 gene locus_tag LOCUS_09450 1448 960 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092530.1 protein_id gnl|my_center|LOCUS_09450 1654 2433 gene locus_tag LOCUS_09460 1654 2433 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_09460 2458 3411 gene locus_tag LOCUS_09470 2458 3411 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_09470 3446 4642 gene locus_tag LOCUS_09480 3446 4642 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030274.1 protein_id gnl|my_center|LOCUS_09480 4677 5744 gene locus_tag LOCUS_09490 gene mnmA 4677 5744 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence118 3 743 gene locus_tag LOCUS_09500 3 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 755 2224 gene locus_tag LOCUS_09510 755 2224 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222793.1 protein_id gnl|my_center|LOCUS_09510 2221 3084 gene locus_tag LOCUS_09520 2221 3084 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222792.1 protein_id gnl|my_center|LOCUS_09520 3364 3104 gene locus_tag LOCUS_09530 3364 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 4502 3351 gene locus_tag LOCUS_09540 4502 3351 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_09540 4587 5429 gene locus_tag LOCUS_09550 4587 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence119 1814 21 gene locus_tag LOCUS_09560 1814 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09560 3565 1811 gene locus_tag LOCUS_09570 3565 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09570 4666 3587 gene locus_tag LOCUS_09580 gene cydB 4666 3587 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227295.1 protein_id gnl|my_center|LOCUS_09580 <5850 4682 gene locus_tag LOCUS_09590 <5850 4682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227294.1:cytochrome ubiquinol oxidase subunit I >Feature sequence120 789 277 gene locus_tag LOCUS_09600 789 277 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_09600 1507 998 gene locus_tag LOCUS_09610 1507 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 2020 1535 gene locus_tag LOCUS_09620 gene coaD 2020 1535 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_09620 2621 2037 gene locus_tag LOCUS_09630 gene rsmD 2621 2037 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_09630 4804 2618 gene locus_tag LOCUS_09640 gene recG 4804 2618 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223647.1 protein_id gnl|my_center|LOCUS_09640 <5847 4801 gene locus_tag LOCUS_09650 <5847 4801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030309.1:DAK2 domain-containing protein >Feature sequence121 1820 1188 gene locus_tag LOCUS_09660 1820 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 2518 1820 gene locus_tag LOCUS_09670 gene cmk 2518 1820 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027958.1 protein_id gnl|my_center|LOCUS_09670 3605 2505 gene locus_tag LOCUS_09680 3605 2505 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_09680 3964 3602 gene locus_tag LOCUS_09690 gene aroH 3964 3602 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_09690 4705 3968 gene locus_tag LOCUS_09700 4705 3968 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408439.1 protein_id gnl|my_center|LOCUS_09700 5313 4705 gene locus_tag LOCUS_09710 gene scpB 5313 4705 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_09710 5842 5303 gene locus_tag LOCUS_09720 5842 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 >Feature sequence122 1626 355 gene locus_tag LOCUS_09730 gene lysA 1626 355 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_09730 3383 1728 gene locus_tag LOCUS_09740 gene argS 3383 1728 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730214.1 protein_id gnl|my_center|LOCUS_09740 3602 3805 gene locus_tag LOCUS_09750 3602 3805 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_09750 4860 4012 gene locus_tag LOCUS_09760 4860 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 >Feature sequence123 1691 756 gene locus_tag LOCUS_09770 gene nudC 1691 756 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_09770 1756 3060 gene locus_tag LOCUS_09780 1756 3060 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729107.1 protein_id gnl|my_center|LOCUS_09780 <5833 3062 gene locus_tag LOCUS_09790 <5833 3062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728029.1:ATP-dependent DNA helicase AdnB >Feature sequence124 <1 973 gene locus_tag LOCUS_09800 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029084.1:septum formation initiator 970 2130 gene locus_tag LOCUS_09810 970 2130 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_09810 2127 2825 gene locus_tag LOCUS_09820 2127 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 2822 3538 gene locus_tag LOCUS_09830 2822 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3692 3874 gene locus_tag LOCUS_09840 3692 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 3874 4293 gene locus_tag LOCUS_09850 3874 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4287 4658 gene locus_tag LOCUS_09860 4287 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 4677 5030 gene locus_tag LOCUS_09870 4677 5030 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226308.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence125 3 743 gene locus_tag LOCUS_09880 3 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 755 2224 gene locus_tag LOCUS_09890 755 2224 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222793.1 protein_id gnl|my_center|LOCUS_09890 2221 3084 gene locus_tag LOCUS_09900 2221 3084 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222792.1 protein_id gnl|my_center|LOCUS_09900 3310 3053 gene locus_tag LOCUS_09910 3310 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 4448 3297 gene locus_tag LOCUS_09920 4448 3297 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_09920 4486 5373 gene locus_tag LOCUS_09930 4486 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence126 50 952 gene locus_tag LOCUS_09940 gene yedA 50 952 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212226.1 protein_id gnl|my_center|LOCUS_09940 1442 960 gene locus_tag LOCUS_09950 1442 960 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092530.1 protein_id gnl|my_center|LOCUS_09950 1654 2433 gene locus_tag LOCUS_09960 1654 2433 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_09960 2458 3411 gene locus_tag LOCUS_09970 2458 3411 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_09970 3446 4642 gene locus_tag LOCUS_09980 3446 4642 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030274.1 protein_id gnl|my_center|LOCUS_09980 4677 5744 gene locus_tag LOCUS_09990 gene mnmA 4677 5744 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence127 848 261 gene locus_tag LOCUS_10000 848 261 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_10000 977 1498 gene locus_tag LOCUS_10010 977 1498 CDS product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731617.1 protein_id gnl|my_center|LOCUS_10010 1654 1439 gene locus_tag LOCUS_10020 1654 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 1641 3728 gene locus_tag LOCUS_10030 1641 3728 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777144.1 protein_id gnl|my_center|LOCUS_10030 3725 5116 gene locus_tag LOCUS_10040 3725 5116 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_10040 <5767 5121 gene locus_tag LOCUS_10050 <5767 5121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975028.1:alanine racemase >Feature sequence128 25 2847 gene locus_tag LOCUS_10060 25 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 4246 2861 gene locus_tag LOCUS_10070 4246 2861 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467865.1 protein_id gnl|my_center|LOCUS_10070 4574 4236 gene locus_tag LOCUS_10080 4574 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 4689 4765 gene locus_tag LOCUS_t00160 4689 4765 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <5765 4802 gene locus_tag LOCUS_10090 <5765 4802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973724.1:Na+/H+ antiporter >Feature sequence129 233 511 gene locus_tag LOCUS_10100 233 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 508 918 gene locus_tag LOCUS_10110 gene vapC26 508 918 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_10110 995 1249 gene locus_tag LOCUS_10120 gene purS 995 1249 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974895.1 protein_id gnl|my_center|LOCUS_10120 1246 1923 gene locus_tag LOCUS_10130 gene purQ 1246 1923 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974894.1 protein_id gnl|my_center|LOCUS_10130 1920 4172 gene locus_tag LOCUS_10140 gene purL 1920 4172 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_10140 4177 4542 gene locus_tag LOCUS_10150 4177 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence130 848 261 gene locus_tag LOCUS_10160 848 261 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_10160 928 1449 gene locus_tag LOCUS_10170 928 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1628 3691 gene locus_tag LOCUS_10180 1628 3691 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777144.1 protein_id gnl|my_center|LOCUS_10180 3688 5079 gene locus_tag LOCUS_10190 3688 5079 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_10190 <5730 5084 gene locus_tag LOCUS_10200 <5730 5084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975028.1:alanine racemase >Feature sequence131 1196 330 gene locus_tag LOCUS_10210 1196 330 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_10210 2083 1193 gene locus_tag LOCUS_10220 2083 1193 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_10220 3059 2073 gene locus_tag LOCUS_10230 3059 2073 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_10230 4370 3063 gene locus_tag LOCUS_10240 4370 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 4854 4417 gene locus_tag LOCUS_10250 4854 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence132 <1 841 gene locus_tag LOCUS_10260 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003901535.1:sulfatase-like hydrolase/transferase 943 1374 gene locus_tag LOCUS_10270 943 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1539 3794 gene locus_tag LOCUS_10280 1539 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 5356 3791 gene locus_tag LOCUS_10290 5356 3791 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731065.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence133 337 1545 gene locus_tag LOCUS_10300 337 1545 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_10300 1542 2546 gene locus_tag LOCUS_10310 1542 2546 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976418.1 protein_id gnl|my_center|LOCUS_10310 2618 2854 gene locus_tag LOCUS_10320 2618 2854 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559006.1 protein_id gnl|my_center|LOCUS_10320 2961 4193 gene locus_tag LOCUS_10330 2961 4193 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_10330 4195 5592 gene locus_tag LOCUS_10340 4195 5592 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900487.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence134 <1 862 gene locus_tag LOCUS_10350 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976275.1:2-isopropylmalate synthase 2452 869 gene locus_tag LOCUS_10360 gene serA 2452 869 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_10360 3514 2486 gene locus_tag LOCUS_10370 gene ilvC 3514 2486 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775904.1 protein_id gnl|my_center|LOCUS_10370 4124 3600 gene locus_tag LOCUS_10380 gene ilvN 4124 3600 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_10380 <5689 4124 gene locus_tag LOCUS_10390 <5689 4124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973484.1:acetolactate synthase large subunit >Feature sequence135 1067 372 gene locus_tag LOCUS_10400 1067 372 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224482.1 protein_id gnl|my_center|LOCUS_10400 1429 1064 gene locus_tag LOCUS_10410 1429 1064 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327459.1 protein_id gnl|my_center|LOCUS_10410 2092 1478 gene locus_tag LOCUS_10420 2092 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 2553 2089 gene locus_tag LOCUS_10430 gene dut 2553 2089 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973153.1 protein_id gnl|my_center|LOCUS_10430 3143 2550 gene locus_tag LOCUS_10440 3143 2550 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030506.1 protein_id gnl|my_center|LOCUS_10440 3179 3634 gene locus_tag LOCUS_10450 3179 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 3670 3951 gene locus_tag LOCUS_10460 3670 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 4244 3948 gene locus_tag LOCUS_10470 4244 3948 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 protein_id gnl|my_center|LOCUS_10470 4406 4924 gene locus_tag LOCUS_10480 4406 4924 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975835.1 protein_id gnl|my_center|LOCUS_10480 <5688 4927 gene locus_tag LOCUS_10490 <5688 4927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_153505920.1:inositol monophosphatase family protein >Feature sequence136 <1 1644 gene locus_tag LOCUS_10500 <1 1644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030402.1:translation initiation factor IF-2 1669 2109 gene locus_tag LOCUS_10510 gene rbfA 1669 2109 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804655.1 protein_id gnl|my_center|LOCUS_10510 2106 2996 gene locus_tag LOCUS_10520 gene truB 2106 2996 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030403.1 protein_id gnl|my_center|LOCUS_10520 3014 3940 gene locus_tag LOCUS_10530 3014 3940 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_10530 4087 4422 gene locus_tag LOCUS_10540 gene rpsO 4087 4422 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence137 256 594 gene locus_tag LOCUS_10550 gene glnB 256 594 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414756.1 protein_id gnl|my_center|LOCUS_10550 624 2951 gene locus_tag LOCUS_10560 624 2951 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487177.1 protein_id gnl|my_center|LOCUS_10560 2989 4524 gene locus_tag LOCUS_10570 gene ffh 2989 4524 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327355.1 protein_id gnl|my_center|LOCUS_10570 4529 5140 gene locus_tag LOCUS_10580 4529 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence138 <1 710 gene locus_tag LOCUS_10590 <1 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973637.1:peptide chain release factor 1 707 1705 gene locus_tag LOCUS_10600 gene prmC 707 1705 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_10600 1705 2409 gene locus_tag LOCUS_10610 1705 2409 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973635.1 protein_id gnl|my_center|LOCUS_10610 2458 3720 gene locus_tag LOCUS_10620 2458 3720 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_10620 3751 4872 gene locus_tag LOCUS_10630 3751 4872 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775946.1 protein_id gnl|my_center|LOCUS_10630 4979 5467 gene locus_tag LOCUS_10640 4979 5467 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908156.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence139 770 1882 gene locus_tag LOCUS_10650 770 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10650 1882 2127 gene locus_tag LOCUS_10660 1882 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10660 2786 2124 gene locus_tag LOCUS_10670 gene aat 2786 2124 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097324.1 protein_id gnl|my_center|LOCUS_10670 3791 2805 gene locus_tag LOCUS_10680 3791 2805 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_10680 4566 4195 gene locus_tag LOCUS_10690 4566 4195 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence140 <1 530 gene locus_tag LOCUS_10700 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528942.1:glycosyltransferase 527 1633 gene locus_tag LOCUS_10710 527 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1630 2583 gene locus_tag LOCUS_10720 1630 2583 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896728.1 protein_id gnl|my_center|LOCUS_10720 3385 2570 gene locus_tag LOCUS_10730 3385 2570 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456342.1 protein_id gnl|my_center|LOCUS_10730 3662 3393 gene locus_tag LOCUS_10740 3662 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 4452 3667 gene locus_tag LOCUS_10750 4452 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 4935 5384 gene locus_tag LOCUS_10760 4935 5384 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071603.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence141 <1 1423 gene locus_tag LOCUS_10770 <1 1423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230209.1:NCS2 family permease 1529 2398 gene locus_tag LOCUS_10780 1529 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 2968 2399 gene locus_tag LOCUS_10790 2968 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 4297 3116 gene locus_tag LOCUS_10800 4297 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 5415 4294 gene locus_tag LOCUS_10810 gene serC 5415 4294 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230187.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence142 2119 944 gene locus_tag LOCUS_10820 gene dnaN 2119 944 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_10820 4092 2644 gene locus_tag LOCUS_10830 4092 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 4508 4861 gene locus_tag LOCUS_10840 gene rnpA 4508 4861 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296830.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence143 2412 520 gene locus_tag LOCUS_10850 2412 520 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_10850 2402 2746 gene locus_tag LOCUS_10860 2402 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 2789 3457 gene locus_tag LOCUS_10870 2789 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 4610 3486 gene locus_tag LOCUS_10880 4610 3486 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529819.1 protein_id gnl|my_center|LOCUS_10880 5336 4674 gene locus_tag LOCUS_10890 5336 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence144 3228 1942 gene locus_tag LOCUS_10900 gene tyrS 3228 1942 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_10900 3310 3906 gene locus_tag LOCUS_10910 3310 3906 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256153.1 protein_id gnl|my_center|LOCUS_10910 5320 3911 gene locus_tag LOCUS_10920 gene argH 5320 3911 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227831.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence145 1142 378 gene locus_tag LOCUS_10930 1142 378 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_10930 1192 1914 gene locus_tag LOCUS_10940 1192 1914 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_10940 3413 1911 gene locus_tag LOCUS_10950 gene glpK 3413 1911 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_10950 3508 4533 gene locus_tag LOCUS_10960 3508 4533 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_10960 >Feature sequence146 1142 378 gene locus_tag LOCUS_10970 1142 378 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_10970 1191 1913 gene locus_tag LOCUS_10980 1191 1913 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_10980 3412 1910 gene locus_tag LOCUS_10990 gene glpK 3412 1910 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_10990 3369 3734 gene locus_tag LOCUS_11000 3369 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11000 3785 4531 gene locus_tag LOCUS_11010 3785 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11010 >Feature sequence147 995 453 gene locus_tag LOCUS_11020 995 453 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_11020 1099 1686 gene locus_tag LOCUS_11030 1099 1686 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088046.1 protein_id gnl|my_center|LOCUS_11030 1683 1910 gene locus_tag LOCUS_11040 1683 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1910 2371 gene locus_tag LOCUS_11050 1910 2371 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222966.1 protein_id gnl|my_center|LOCUS_11050 2451 2618 gene locus_tag LOCUS_11060 2451 2618 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222969.1 protein_id gnl|my_center|LOCUS_11060 3429 2686 gene locus_tag LOCUS_11070 3429 2686 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222974.1 protein_id gnl|my_center|LOCUS_11070 3435 4616 gene locus_tag LOCUS_11080 3435 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 4634 4969 gene locus_tag LOCUS_11090 4634 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence148 451 1062 gene locus_tag LOCUS_11100 gene folE 451 1062 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_11100 1069 1938 gene locus_tag LOCUS_11110 gene folP 1069 1938 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_11110 1938 2294 gene locus_tag LOCUS_11120 gene folB 1938 2294 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028954.1 protein_id gnl|my_center|LOCUS_11120 2291 2803 gene locus_tag LOCUS_11130 gene folK 2291 2803 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 protein_id gnl|my_center|LOCUS_11130 2814 3281 gene locus_tag LOCUS_11140 2814 3281 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419535.1 protein_id gnl|my_center|LOCUS_11140 3292 3576 gene locus_tag LOCUS_11150 3292 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 4719 3607 gene locus_tag LOCUS_11160 4719 3607 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_11160 5349 4732 gene locus_tag LOCUS_11170 5349 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 >Feature sequence149 130 756 gene locus_tag LOCUS_11180 130 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 820 1944 gene locus_tag LOCUS_11190 820 1944 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529819.1 protein_id gnl|my_center|LOCUS_11190 3020 1962 gene locus_tag LOCUS_11200 3020 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 3019 4827 gene locus_tag LOCUS_11210 3019 4827 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence150 398 589 gene locus_tag LOCUS_11220 398 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 595 1047 gene locus_tag LOCUS_11230 595 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1954 1184 gene locus_tag LOCUS_11240 1954 1184 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970992.1 protein_id gnl|my_center|LOCUS_11240 3807 2119 gene locus_tag LOCUS_11250 3807 2119 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705581.1 protein_id gnl|my_center|LOCUS_11250 4117 3818 gene locus_tag LOCUS_11260 4117 3818 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064709.1 protein_id gnl|my_center|LOCUS_11260 5151 4186 gene locus_tag LOCUS_11270 5151 4186 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530364.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence151 1020 310 gene locus_tag LOCUS_11280 1020 310 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 protein_id gnl|my_center|LOCUS_11280 1019 1294 gene locus_tag LOCUS_11290 1019 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 2649 1291 gene locus_tag LOCUS_11300 2649 1291 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054423.1 protein_id gnl|my_center|LOCUS_11300 2907 2677 gene locus_tag LOCUS_11310 2907 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 3096 3470 gene locus_tag LOCUS_11320 3096 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 3517 4521 gene locus_tag LOCUS_11330 gene argF 3517 4521 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030578.1 protein_id gnl|my_center|LOCUS_11330 <5333 4514 gene locus_tag LOCUS_11340 <5333 4514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973998.1:phosphoenolpyruvate carboxykinase (GTP) >Feature sequence152 <1 2758 gene locus_tag LOCUS_11350 <1 2758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030315.1:chromosome segregation protein SMC 2810 3934 gene locus_tag LOCUS_11360 gene ftsY 2810 3934 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence153 2 541 gene locus_tag LOCUS_11370 2 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 538 2721 gene locus_tag LOCUS_11380 gene glgB 538 2721 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_11380 3764 2748 gene locus_tag LOCUS_11390 3764 2748 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 protein_id gnl|my_center|LOCUS_11390 3759 4232 gene locus_tag LOCUS_11400 3759 4232 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406624.1 protein_id gnl|my_center|LOCUS_11400 4848 4225 gene locus_tag LOCUS_11410 4848 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence154 384 1334 gene locus_tag LOCUS_11420 gene rlmB 384 1334 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029524.1 protein_id gnl|my_center|LOCUS_11420 2528 1344 gene locus_tag LOCUS_11430 2528 1344 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975556.1 protein_id gnl|my_center|LOCUS_11430 2588 3286 gene locus_tag LOCUS_11440 2588 3286 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223702.1 protein_id gnl|my_center|LOCUS_11440 4137 3358 gene locus_tag LOCUS_11450 4137 3358 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_11450 <5189 4182 gene locus_tag LOCUS_11460 <5189 4182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223703.1:aldehyde dehydrogenase family protein >Feature sequence155 1258 887 gene locus_tag LOCUS_11470 1258 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 2412 1276 gene locus_tag LOCUS_11480 gene proB 2412 1276 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_11480 3782 2409 gene locus_tag LOCUS_11490 gene obgE 3782 2409 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_11490 4161 3907 gene locus_tag LOCUS_11500 gene rpmA 4161 3907 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_11500 4480 4166 gene locus_tag LOCUS_11510 gene rplU 4480 4166 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976204.1 protein_id gnl|my_center|LOCUS_11510 <5132 4583 gene locus_tag LOCUS_11520 <5132 4583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005110173.1:Rne/Rng family ribonuclease >Feature sequence156 1266 535 gene locus_tag LOCUS_11530 1266 535 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_11530 2012 1263 gene locus_tag LOCUS_11540 gene pgeF 2012 1263 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028130.1 protein_id gnl|my_center|LOCUS_11540 3152 2022 gene locus_tag LOCUS_11550 gene ftsZ 3152 2022 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_11550 4071 3364 gene locus_tag LOCUS_11560 4071 3364 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228035.1 protein_id gnl|my_center|LOCUS_11560 <5127 4068 gene locus_tag LOCUS_11570 <5127 4068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228036.1:UDP-N-acetylmuramate--L-alanine ligase >Feature sequence157 1629 2459 gene locus_tag LOCUS_11580 1629 2459 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312277.1 protein_id gnl|my_center|LOCUS_11580 2471 3445 gene locus_tag LOCUS_11590 gene cobS 2471 3445 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175820.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence158 2099 2752 gene locus_tag LOCUS_11600 2099 2752 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_11600 3898 2960 gene locus_tag LOCUS_11610 3898 2960 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227898.1 protein_id gnl|my_center|LOCUS_11610 <5094 3898 gene locus_tag LOCUS_11620 <5094 3898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003911575.1:excinuclease ABC subunit UvrB >Feature sequence159 412 576 gene locus_tag LOCUS_11630 412 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11630 1385 612 gene locus_tag LOCUS_11640 1385 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1867 1349 gene locus_tag LOCUS_11650 1867 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 3215 1842 gene locus_tag LOCUS_11660 3215 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence160 929 744 gene locus_tag LOCUS_11670 929 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 2356 926 gene locus_tag LOCUS_11680 2356 926 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_11680 2797 2462 gene locus_tag LOCUS_11690 2797 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 4451 2964 gene locus_tag LOCUS_11700 4451 2964 CDS product DUF5719 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028724.1 protein_id gnl|my_center|LOCUS_11700 <5072 4448 gene locus_tag LOCUS_11710 <5072 4448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028725.1:glycosyltransferase >Feature sequence161 655 1596 gene locus_tag LOCUS_11720 655 1596 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528030.1 protein_id gnl|my_center|LOCUS_11720 1756 3456 gene locus_tag LOCUS_11730 1756 3456 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230797.1 protein_id gnl|my_center|LOCUS_11730 3890 3507 gene locus_tag LOCUS_11740 3890 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 4806 3895 gene locus_tag LOCUS_11750 4806 3895 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence162 324 1673 gene locus_tag LOCUS_11760 gene glmM 324 1673 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_11760 2586 1624 gene locus_tag LOCUS_11770 2586 1624 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466857.1 protein_id gnl|my_center|LOCUS_11770 2616 4454 gene locus_tag LOCUS_11780 gene glmS 2616 4454 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence163 146 231 gene locus_tag LOCUS_t00170 146 231 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 317 406 gene locus_tag LOCUS_t00180 317 406 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2402 441 gene locus_tag LOCUS_11790 2402 441 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901535.1 protein_id gnl|my_center|LOCUS_11790 3447 2407 gene locus_tag LOCUS_11800 3447 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 4182 3523 gene locus_tag LOCUS_11810 4182 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 4658 4182 gene locus_tag LOCUS_11820 gene tadA 4658 4182 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_11820 5041 4658 gene locus_tag LOCUS_11830 5041 4658 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199198884.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence164 2380 926 gene locus_tag LOCUS_11840 2380 926 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_11840 2797 2462 gene locus_tag LOCUS_11850 2797 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 4451 2964 gene locus_tag LOCUS_11860 4451 2964 CDS product DUF5719 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028724.1 protein_id gnl|my_center|LOCUS_11860 <5042 4448 gene locus_tag LOCUS_11870 <5042 4448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028725.1:glycosyltransferase >Feature sequence165 1211 1801 gene locus_tag LOCUS_11880 1211 1801 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229706.1 protein_id gnl|my_center|LOCUS_11880 1847 2038 gene locus_tag LOCUS_11890 1847 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 2044 2496 gene locus_tag LOCUS_11900 2044 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 3277 2507 gene locus_tag LOCUS_11910 gene fabG 3277 2507 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_11910 3800 3501 gene locus_tag LOCUS_11920 3800 3501 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064709.1 protein_id gnl|my_center|LOCUS_11920 4834 3869 gene locus_tag LOCUS_11930 4834 3869 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530364.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence166 <1 1971 gene locus_tag LOCUS_11940 <1 1971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226749.1:methionine synthase 1961 2650 gene locus_tag LOCUS_11950 1961 2650 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 protein_id gnl|my_center|LOCUS_11950 3389 2652 gene locus_tag LOCUS_11960 3389 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 3603 4511 gene locus_tag LOCUS_11970 3603 4511 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence167 2066 1029 gene locus_tag LOCUS_11980 gene mgrA 2066 1029 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_11980 2599 2069 gene locus_tag LOCUS_11990 2599 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 3429 2749 gene locus_tag LOCUS_12000 3429 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 4172 3792 gene locus_tag LOCUS_12010 4172 3792 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169809.1 protein_id gnl|my_center|LOCUS_12010 <4983 4246 gene locus_tag LOCUS_12020 <4983 4246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030467.1:vitamin B12-dependent ribonucleotide reductase >Feature sequence168 614 1831 gene locus_tag LOCUS_12030 614 1831 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224029.1 protein_id gnl|my_center|LOCUS_12030 3049 1820 gene locus_tag LOCUS_12040 3049 1820 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028369.1 protein_id gnl|my_center|LOCUS_12040 3800 3129 gene locus_tag LOCUS_12050 3800 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 4942 3863 gene locus_tag LOCUS_12060 gene dusB 4942 3863 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010147544.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence169 2 3364 gene locus_tag LOCUS_12070 gene dnaE 2 3364 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027948.1 protein_id gnl|my_center|LOCUS_12070 3352 4617 gene locus_tag LOCUS_12080 gene dinB 3352 4617 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence170 2 325 gene locus_tag LOCUS_12090 2 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 322 1944 gene locus_tag LOCUS_12100 322 1944 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028281.1 protein_id gnl|my_center|LOCUS_12100 1944 2747 gene locus_tag LOCUS_12110 1944 2747 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028282.1 protein_id gnl|my_center|LOCUS_12110 2879 4150 gene locus_tag LOCUS_12120 2879 4150 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869456.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence171 324 1016 gene locus_tag LOCUS_12130 324 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 3271 944 gene locus_tag LOCUS_12140 3271 944 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226971.1 protein_id gnl|my_center|LOCUS_12140 3454 4203 gene locus_tag LOCUS_12150 3454 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence172 2 589 gene locus_tag LOCUS_12160 2 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1958 600 gene locus_tag LOCUS_12170 1958 600 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205737.1 protein_id gnl|my_center|LOCUS_12170 3507 1966 gene locus_tag LOCUS_12180 3507 1966 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029543.1 protein_id gnl|my_center|LOCUS_12180 4096 3518 gene locus_tag LOCUS_12190 4096 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521816.1 protein_id gnl|my_center|LOCUS_12190 4920 4156 gene locus_tag LOCUS_12200 4920 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence173 <1 814 gene locus_tag LOCUS_12210 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972090.1:glutamine synthetase family protein 815 1534 gene locus_tag LOCUS_12220 815 1534 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729647.1 protein_id gnl|my_center|LOCUS_12220 2660 2022 gene locus_tag LOCUS_12230 2660 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2872 2660 gene locus_tag LOCUS_12240 2872 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2972 3694 gene locus_tag LOCUS_12250 2972 3694 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976364.1 protein_id gnl|my_center|LOCUS_12250 3691 4434 gene locus_tag LOCUS_12260 3691 4434 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254611.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence174 857 468 gene locus_tag LOCUS_12270 857 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1032 2576 gene locus_tag LOCUS_12280 1032 2576 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974722.1 protein_id gnl|my_center|LOCUS_12280 2614 3060 gene locus_tag LOCUS_12290 2614 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 3077 3460 gene locus_tag LOCUS_12300 3077 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226671.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence175 <1 1457 gene locus_tag LOCUS_12310 <1 1457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727477.1:urocanate hydratase 1463 2641 gene locus_tag LOCUS_12320 gene hutI 1463 2641 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028748.1 protein_id gnl|my_center|LOCUS_12320 2638 4149 gene locus_tag LOCUS_12330 gene hutH 2638 4149 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777032.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence176 >Feature sequence177 772 1572 gene locus_tag LOCUS_12340 772 1572 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084957.1 protein_id gnl|my_center|LOCUS_12340 1596 1880 gene locus_tag LOCUS_12350 1596 1880 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_12350 3025 1877 gene locus_tag LOCUS_12360 3025 1877 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226428.1 protein_id gnl|my_center|LOCUS_12360 3128 3670 gene locus_tag LOCUS_12370 3128 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 <4844 3671 gene locus_tag LOCUS_12380 <4844 3671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029870.1:DNA helicase PcrA >Feature sequence178 2916 436 gene locus_tag LOCUS_12390 gene pheT 2916 436 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 protein_id gnl|my_center|LOCUS_12390 4025 2916 gene locus_tag LOCUS_12400 gene pheS 4025 2916 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 protein_id gnl|my_center|LOCUS_12400 <4796 4041 gene locus_tag LOCUS_12410 <4796 4041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994000.1:sulfate adenylyltransferase subunit CysN >Feature sequence179 52 279 gene locus_tag LOCUS_12420 52 279 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907944.1 protein_id gnl|my_center|LOCUS_12420 992 300 gene locus_tag LOCUS_12430 992 300 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 protein_id gnl|my_center|LOCUS_12430 1037 2479 gene locus_tag LOCUS_12440 1037 2479 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223014.1 protein_id gnl|my_center|LOCUS_12440 2503 2880 gene locus_tag LOCUS_12450 2503 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3305 2904 gene locus_tag LOCUS_12460 3305 2904 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223006.1 protein_id gnl|my_center|LOCUS_12460 4504 3302 gene locus_tag LOCUS_12470 4504 3302 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence180 408 740 gene locus_tag LOCUS_12480 408 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 740 1651 gene locus_tag LOCUS_12490 gene era 740 1651 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_12490 1703 2464 gene locus_tag LOCUS_12500 gene recO 1703 2464 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_12500 2563 3270 gene locus_tag LOCUS_12510 2563 3270 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976293.1 protein_id gnl|my_center|LOCUS_12510 3267 4262 gene locus_tag LOCUS_12520 3267 4262 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225345.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence181 867 58 gene locus_tag LOCUS_12530 gene trpC 867 58 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_12530 1382 903 gene locus_tag LOCUS_12540 1382 903 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028111.1 protein_id gnl|my_center|LOCUS_12540 2769 1387 gene locus_tag LOCUS_12550 2769 1387 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228142.1 protein_id gnl|my_center|LOCUS_12550 3458 2766 gene locus_tag LOCUS_12560 3458 2766 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228141.1 protein_id gnl|my_center|LOCUS_12560 3772 3542 gene locus_tag LOCUS_12570 3772 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 4389 3811 gene locus_tag LOCUS_12580 4389 3811 CDS product TIGR02234 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028113.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence182 <1 1423 gene locus_tag LOCUS_12590 <1 1423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230209.1:NCS2 family permease 1529 2371 gene locus_tag LOCUS_12600 1529 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 3542 2346 gene locus_tag LOCUS_12610 3542 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 4660 3539 gene locus_tag LOCUS_12620 gene serC 4660 3539 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230187.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence183 1693 554 gene locus_tag LOCUS_12630 1693 554 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898087.1 protein_id gnl|my_center|LOCUS_12630 2868 1693 gene locus_tag LOCUS_12640 2868 1693 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728358.1 protein_id gnl|my_center|LOCUS_12640 4342 2948 gene locus_tag LOCUS_12650 4342 2948 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence184 3052 2645 gene locus_tag LOCUS_12660 3052 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 3933 3169 gene locus_tag LOCUS_12670 3933 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 4548 4039 gene locus_tag LOCUS_12680 4548 4039 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226958.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence185 169 330 gene locus_tag LOCUS_12690 169 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1721 801 gene locus_tag LOCUS_12700 gene thrB 1721 801 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_12700 2782 1721 gene locus_tag LOCUS_12710 gene thrC 2782 1721 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_12710 4077 2785 gene locus_tag LOCUS_12720 4077 2785 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence186 580 2769 gene locus_tag LOCUS_12730 580 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2829 4049 gene locus_tag LOCUS_12740 2829 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 >Feature sequence187 2079 1348 gene locus_tag LOCUS_12750 2079 1348 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172591967.1 protein_id gnl|my_center|LOCUS_12750 2786 2139 gene locus_tag LOCUS_12760 2786 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3529 2786 gene locus_tag LOCUS_12770 3529 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4143 3610 gene locus_tag LOCUS_12780 4143 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 4170 4697 gene locus_tag LOCUS_12790 4170 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence188 807 4439 gene locus_tag LOCUS_12800 807 4439 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_12800 4451 4648 gene locus_tag LOCUS_12810 4451 4648 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence189 <1 1437 gene locus_tag LOCUS_12820 <1 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973866.1:translational GTPase TypA 1569 2558 gene locus_tag LOCUS_12830 1569 2558 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_12830 2673 4421 gene locus_tag LOCUS_12840 2673 4421 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994617.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence190 <1 1378 gene locus_tag LOCUS_12850 <1 1378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225004.1:phosphotransferase family protein 1422 2282 gene locus_tag LOCUS_12860 gene tesB 1422 2282 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413466.1 protein_id gnl|my_center|LOCUS_12860 2911 2276 gene locus_tag LOCUS_12870 2911 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 3488 2967 gene locus_tag LOCUS_12880 3488 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 3628 3909 gene locus_tag LOCUS_12890 3628 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 3906 4061 gene locus_tag LOCUS_12900 3906 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence191 2241 730 gene locus_tag LOCUS_12910 gene hutH 2241 730 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777032.1 protein_id gnl|my_center|LOCUS_12910 3416 2238 gene locus_tag LOCUS_12920 gene hutI 3416 2238 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028748.1 protein_id gnl|my_center|LOCUS_12920 <4689 3422 gene locus_tag LOCUS_12930 <4689 3422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727477.1:urocanate hydratase >Feature sequence192 340 879 gene locus_tag LOCUS_12940 340 879 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870383.1 protein_id gnl|my_center|LOCUS_12940 1022 876 gene locus_tag LOCUS_12950 1022 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1268 1101 gene locus_tag LOCUS_12960 1268 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1393 2337 gene locus_tag LOCUS_12970 1393 2337 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110688.1 protein_id gnl|my_center|LOCUS_12970 2401 3228 gene locus_tag LOCUS_12980 2401 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 4030 3236 gene locus_tag LOCUS_12990 4030 3236 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948031.1 protein_id gnl|my_center|LOCUS_12990 4216 4374 gene locus_tag LOCUS_13000 4216 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence193 1307 219 gene locus_tag LOCUS_13010 1307 219 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029424.1 protein_id gnl|my_center|LOCUS_13010 1454 1663 gene locus_tag LOCUS_13020 gene bldC 1454 1663 CDS product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_13020 2426 1641 gene locus_tag LOCUS_13030 2426 1641 CDS product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779966.1 protein_id gnl|my_center|LOCUS_13030 3153 2419 gene locus_tag LOCUS_13040 gene narI 3153 2419 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730339.1 protein_id gnl|my_center|LOCUS_13040 3791 3150 gene locus_tag LOCUS_13050 gene narJ 3791 3150 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406093.1 protein_id gnl|my_center|LOCUS_13050 <4661 3784 gene locus_tag LOCUS_13060 <4661 3784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730341.1:nitrate reductase subunit beta >Feature sequence194 <1 921 gene locus_tag LOCUS_13070 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029104448.1:bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD 931 1527 gene locus_tag LOCUS_13080 931 1527 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_13080 1524 2855 gene locus_tag LOCUS_13090 1524 2855 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057753.1 protein_id gnl|my_center|LOCUS_13090 2852 3328 gene locus_tag LOCUS_13100 gene ribH 2852 3328 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803672.1 protein_id gnl|my_center|LOCUS_13100 3347 3610 gene locus_tag LOCUS_13110 3347 3610 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403497.1 protein_id gnl|my_center|LOCUS_13110 3610 4461 gene locus_tag LOCUS_13120 gene hisG 3610 4461 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence195 <1 1371 gene locus_tag LOCUS_13130 <1 1371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976122.1:energy-dependent translational throttle protein EttA 1374 1781 gene locus_tag LOCUS_13140 1374 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1785 2453 gene locus_tag LOCUS_13150 1785 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 2851 2450 gene locus_tag LOCUS_13160 2851 2450 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060114.1 protein_id gnl|my_center|LOCUS_13160 4365 2848 gene locus_tag LOCUS_13170 4365 2848 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027383.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence196 3500 1437 gene locus_tag LOCUS_13180 3500 1437 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064868.1 protein_id gnl|my_center|LOCUS_13180 3895 3497 gene locus_tag LOCUS_13190 3895 3497 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973036.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence197 86 898 gene locus_tag LOCUS_13200 86 898 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257991.1 protein_id gnl|my_center|LOCUS_13200 921 2234 gene locus_tag LOCUS_13210 921 2234 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942610.1 protein_id gnl|my_center|LOCUS_13210 2234 3115 gene locus_tag LOCUS_13220 2234 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 3115 4035 gene locus_tag LOCUS_13230 3115 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence198 539 1363 gene locus_tag LOCUS_13240 539 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1356 1967 gene locus_tag LOCUS_13250 gene wrbA 1356 1967 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228078.1 protein_id gnl|my_center|LOCUS_13250 3352 2021 gene locus_tag LOCUS_13260 gene chrA 3352 2021 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379044.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence199 985 8 gene locus_tag LOCUS_13270 985 8 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228081.1 protein_id gnl|my_center|LOCUS_13270 1737 982 gene locus_tag LOCUS_13280 1737 982 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775698.1 protein_id gnl|my_center|LOCUS_13280 1821 1913 gene locus_tag LOCUS_t00190 1821 1913 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence200 273 1292 gene locus_tag LOCUS_13290 gene yxeI 273 1292 CDS product penicillin V amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243495.1 protein_id gnl|my_center|LOCUS_13290 1299 2693 gene locus_tag LOCUS_13300 1299 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 4231 2711 gene locus_tag LOCUS_13310 4231 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 4252 4464 gene locus_tag LOCUS_13320 4252 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence201 398 1849 gene locus_tag LOCUS_13330 398 1849 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893539.1 protein_id gnl|my_center|LOCUS_13330 1905 3251 gene locus_tag LOCUS_13340 1905 3251 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976662.1 protein_id gnl|my_center|LOCUS_13340 3272 4447 gene locus_tag LOCUS_13350 3272 4447 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776705.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence202 372 1838 gene locus_tag LOCUS_13360 372 1838 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893539.1 protein_id gnl|my_center|LOCUS_13360 1855 3240 gene locus_tag LOCUS_13370 1855 3240 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976662.1 protein_id gnl|my_center|LOCUS_13370 3261 4436 gene locus_tag LOCUS_13380 3261 4436 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776705.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence203 296 72 gene locus_tag LOCUS_13390 296 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 744 289 gene locus_tag LOCUS_13400 744 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1625 795 gene locus_tag LOCUS_13410 1625 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2095 1622 gene locus_tag LOCUS_13420 2095 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 2504 2145 gene locus_tag LOCUS_13430 2504 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 2649 3575 gene locus_tag LOCUS_13440 2649 3575 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903522.1 protein_id gnl|my_center|LOCUS_13440 4194 3538 gene locus_tag LOCUS_13450 4194 3538 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977032.1 protein_id gnl|my_center|LOCUS_13450 4244 4549 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgcggccgatcagaacgcggc >Feature sequence204 480 97 gene locus_tag LOCUS_13460 480 97 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974650.1 protein_id gnl|my_center|LOCUS_13460 518 2512 gene locus_tag LOCUS_13470 518 2512 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230251.1 protein_id gnl|my_center|LOCUS_13470 3623 2505 gene locus_tag LOCUS_13480 gene menC 3623 2505 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_13480 4423 3620 gene locus_tag LOCUS_13490 4423 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225316.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence205 217 1740 gene locus_tag LOCUS_13500 gene glmU 217 1740 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_13500 1737 2738 gene locus_tag LOCUS_13510 1737 2738 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_13510 2898 3482 gene locus_tag LOCUS_13520 2898 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 3507 4100 gene locus_tag LOCUS_13530 gene pth 3507 4100 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975689.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence206 240 1646 gene locus_tag LOCUS_13540 240 1646 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537927.1 protein_id gnl|my_center|LOCUS_13540 1675 2124 gene locus_tag LOCUS_13550 gene rpiB 1675 2124 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932728.1 protein_id gnl|my_center|LOCUS_13550 2906 2133 gene locus_tag LOCUS_13560 2906 2133 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727758.1 protein_id gnl|my_center|LOCUS_13560 2965 3426 gene locus_tag LOCUS_13570 2965 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 3444 3938 gene locus_tag LOCUS_13580 3444 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence207 123 974 gene locus_tag LOCUS_13590 123 974 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941296.1 protein_id gnl|my_center|LOCUS_13590 984 1847 gene locus_tag LOCUS_13600 gene rfbA 984 1847 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401670.1 protein_id gnl|my_center|LOCUS_13600 3536 1854 gene locus_tag LOCUS_13610 3536 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 <4505 3536 gene locus_tag LOCUS_13620 <4505 3536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157768866.1:glycosyltransferase >Feature sequence208 2254 572 gene locus_tag LOCUS_13630 2254 572 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_13630 3251 2238 gene locus_tag LOCUS_13640 gene glpX 3251 2238 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_13640 3357 3863 gene locus_tag LOCUS_13650 3357 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 4072 3860 gene locus_tag LOCUS_13660 4072 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence209 1302 985 gene locus_tag LOCUS_13670 gene yajC 1302 985 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626242.1 protein_id gnl|my_center|LOCUS_13670 2436 1408 gene locus_tag LOCUS_13680 gene ruvB 2436 1408 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_13680 3038 2433 gene locus_tag LOCUS_13690 gene ruvA 3038 2433 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_13690 3550 3035 gene locus_tag LOCUS_13700 gene ruvC 3550 3035 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 protein_id gnl|my_center|LOCUS_13700 <4492 3621 gene locus_tag LOCUS_13710 <4492 3621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729414.1:wax ester/triacylglycerol synthase family O-acyltransferase >Feature sequence210 <1 1683 gene locus_tag LOCUS_13720 <1 1683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392105.1:leucine--tRNA ligase 1707 2555 gene locus_tag LOCUS_13730 1707 2555 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_13730 2552 3133 gene locus_tag LOCUS_13740 gene plsY 2552 3133 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_13740 3231 3989 gene locus_tag LOCUS_13750 3231 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence211 <1 862 gene locus_tag LOCUS_13760 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977296.1:threonine--tRNA ligase 865 1377 gene locus_tag LOCUS_13770 865 1377 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027833.1 protein_id gnl|my_center|LOCUS_13770 3522 1387 gene locus_tag LOCUS_13780 3522 1387 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400860.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence212 828 85 gene locus_tag LOCUS_13790 828 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 855 1610 gene locus_tag LOCUS_13800 855 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1615 2007 gene locus_tag LOCUS_13810 1615 2007 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728346.1 protein_id gnl|my_center|LOCUS_13810 2050 2625 gene locus_tag LOCUS_13820 gene dcd 2050 2625 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_13820 3121 3441 gene locus_tag LOCUS_13830 3121 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 4430 3447 gene locus_tag LOCUS_13840 4430 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence213 204 1613 gene locus_tag LOCUS_13850 gene cysS 204 1613 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_237701980.1 protein_id gnl|my_center|LOCUS_13850 3451 1643 gene locus_tag LOCUS_13860 3451 1643 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_13860 3909 3529 gene locus_tag LOCUS_13870 3909 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 <4417 3906 gene locus_tag LOCUS_13880 <4417 3906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_089212260.1:N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase >Feature sequence214 <1 619 gene locus_tag LOCUS_13890 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005063739.1:DUF2786 domain-containing protein 616 1833 gene locus_tag LOCUS_13900 gene ilvA 616 1833 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229835.1 protein_id gnl|my_center|LOCUS_13900 1844 2836 gene locus_tag LOCUS_13910 1844 2836 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_13910 2833 3696 gene locus_tag LOCUS_13920 2833 3696 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_13920 4229 3744 gene locus_tag LOCUS_13930 gene greA 4229 3744 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974011.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence215 738 208 gene locus_tag LOCUS_13940 738 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1568 888 gene locus_tag LOCUS_13950 1568 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 2311 1931 gene locus_tag LOCUS_13960 2311 1931 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897694.1 protein_id gnl|my_center|LOCUS_13960 2978 2385 gene locus_tag LOCUS_13970 2978 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13970 <4358 3147 gene locus_tag LOCUS_13980 <4358 3147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224267.1:vitamin B12-dependent ribonucleotide reductase note possible pseudo, internal stop codon >Feature sequence216 560 1414 gene locus_tag LOCUS_13990 gene purU 560 1414 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814312.1 protein_id gnl|my_center|LOCUS_13990 2346 1411 gene locus_tag LOCUS_14000 2346 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 3095 2352 gene locus_tag LOCUS_14010 3095 2352 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978705.1 protein_id gnl|my_center|LOCUS_14010 3267 3965 gene locus_tag LOCUS_14020 3267 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence217 117 1055 gene locus_tag LOCUS_14030 117 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1066 2100 gene locus_tag LOCUS_14040 1066 2100 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222386.1 protein_id gnl|my_center|LOCUS_14040 3320 2106 gene locus_tag LOCUS_14050 3320 2106 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_14050 3444 3517 gene locus_tag LOCUS_t00200 3444 3517 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3628 3876 gene locus_tag LOCUS_14060 3628 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence218 2430 1873 gene locus_tag LOCUS_14070 2430 1873 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383583.1 protein_id gnl|my_center|LOCUS_14070 3535 2441 gene locus_tag LOCUS_14080 gene secF 3535 2441 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_14080 <4356 3532 gene locus_tag LOCUS_14090 <4356 3532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027823.1:protein translocase subunit SecD >Feature sequence219 1432 3513 gene locus_tag LOCUS_14100 1432 3513 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence220 1921 374 gene locus_tag LOCUS_14110 1921 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 3560 1935 gene locus_tag LOCUS_14120 3560 1935 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866976.1 protein_id gnl|my_center|LOCUS_14120 <4330 3535 gene locus_tag LOCUS_14130 <4330 3535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027782.1:acyl-CoA dehydrogenase >Feature sequence221 150 839 gene locus_tag LOCUS_14140 gene ftsE 150 839 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_14140 878 1786 gene locus_tag LOCUS_14150 gene ftsX 878 1786 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_14150 1846 3153 gene locus_tag LOCUS_14160 1846 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 3204 3680 gene locus_tag LOCUS_14170 gene smpB 3204 3680 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence222 121 444 gene locus_tag LOCUS_14180 121 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1260 391 gene locus_tag LOCUS_14190 1260 391 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466560.1 protein_id gnl|my_center|LOCUS_14190 2408 1248 gene locus_tag LOCUS_14200 gene menE 2408 1248 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742122.1 protein_id gnl|my_center|LOCUS_14200 2494 3426 gene locus_tag LOCUS_14210 gene menB 2494 3426 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963873.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence223 479 1627 gene locus_tag LOCUS_14220 479 1627 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223977.1 protein_id gnl|my_center|LOCUS_14220 1630 1941 gene locus_tag LOCUS_14230 1630 1941 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_14230 1938 3311 gene locus_tag LOCUS_14240 1938 3311 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_14240 3999 3361 gene locus_tag LOCUS_14250 gene upp 3999 3361 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence224 <1 1735 gene locus_tag LOCUS_14260 <1 1735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030487.1:DNA topoisomerase IV subunit A 1813 2706 gene locus_tag LOCUS_14270 1813 2706 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 protein_id gnl|my_center|LOCUS_14270 4075 2711 gene locus_tag LOCUS_14280 4075 2711 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence225 <1 718 gene locus_tag LOCUS_14290 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030040.1:MFS transporter 721 1329 gene locus_tag LOCUS_14300 721 1329 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400977.1 protein_id gnl|my_center|LOCUS_14300 3013 1280 gene locus_tag LOCUS_14310 3013 1280 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208946.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence226 2398 1028 gene locus_tag LOCUS_14320 2398 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 3285 2407 gene locus_tag LOCUS_14330 3285 2407 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223281.1 protein_id gnl|my_center|LOCUS_14330 4001 3297 gene locus_tag LOCUS_14340 4001 3297 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223280.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence227 2395 1025 gene locus_tag LOCUS_14350 2395 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3282 2404 gene locus_tag LOCUS_14360 3282 2404 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223281.1 protein_id gnl|my_center|LOCUS_14360 3998 3294 gene locus_tag LOCUS_14370 3998 3294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223280.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence228 <1 1329 gene locus_tag LOCUS_14380 <1 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975268.1:molecular chaperone DnaK 1326 1901 gene locus_tag LOCUS_14390 1326 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 1904 3076 gene locus_tag LOCUS_14400 gene dnaJ 1904 3076 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 protein_id gnl|my_center|LOCUS_14400 3073 3423 gene locus_tag LOCUS_14410 3073 3423 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975271.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence229 1344 3374 gene locus_tag LOCUS_14420 1344 3374 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803998.1 protein_id gnl|my_center|LOCUS_14420 3375 3776 gene locus_tag LOCUS_14430 3375 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence230 2178 802 gene locus_tag LOCUS_14440 2178 802 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_14440 3647 2178 gene locus_tag LOCUS_14450 3647 2178 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258343.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence231 3 1091 gene locus_tag LOCUS_14460 3 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 2397 1093 gene locus_tag LOCUS_14470 2397 1093 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729107.1 protein_id gnl|my_center|LOCUS_14470 2462 3397 gene locus_tag LOCUS_14480 gene nudC 2462 3397 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence232 <1 781 gene locus_tag LOCUS_14490 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030493.1:alkaline phosphatase family protein 833 1498 gene locus_tag LOCUS_14500 833 1498 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 protein_id gnl|my_center|LOCUS_14500 2008 1844 gene locus_tag LOCUS_14510 2008 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 2934 2188 gene locus_tag LOCUS_14520 gene sepH 2934 2188 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973165.1 protein_id gnl|my_center|LOCUS_14520 <4150 3014 gene locus_tag LOCUS_14530 <4150 3014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973162.1:MFS transporter >Feature sequence233 1592 675 gene locus_tag LOCUS_14540 1592 675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030405.1 protein_id gnl|my_center|LOCUS_14540 2566 1589 gene locus_tag LOCUS_14550 2566 1589 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030406.1 protein_id gnl|my_center|LOCUS_14550 3438 2563 gene locus_tag LOCUS_14560 3438 2563 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973312.1 protein_id gnl|my_center|LOCUS_14560 <4149 3435 gene locus_tag LOCUS_14570 <4149 3435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226493.1:ABC transporter permease >Feature sequence234 820 479 gene locus_tag LOCUS_14580 820 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 865 1509 gene locus_tag LOCUS_14590 865 1509 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_14590 2281 1517 gene locus_tag LOCUS_14600 gene hisF 2281 1517 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466799.1 protein_id gnl|my_center|LOCUS_14600 3075 2284 gene locus_tag LOCUS_14610 gene priA 3075 2284 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 protein_id gnl|my_center|LOCUS_14610 3736 3101 gene locus_tag LOCUS_14620 gene hisH 3736 3101 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057924.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence235 983 90 gene locus_tag LOCUS_14630 983 90 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112080.1 protein_id gnl|my_center|LOCUS_14630 1864 983 gene locus_tag LOCUS_14640 gene tatC 1864 983 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977194.1 protein_id gnl|my_center|LOCUS_14640 2137 1895 gene locus_tag LOCUS_14650 gene tatA 2137 1895 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895338.1 protein_id gnl|my_center|LOCUS_14650 3114 2140 gene locus_tag LOCUS_14660 3114 2140 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_14660 4097 3111 gene locus_tag LOCUS_14670 4097 3111 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226715.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence236 <1 1114 gene locus_tag LOCUS_14680 <1 1114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088825.1:acyl-CoA dehydrogenase family protein 1224 2765 gene locus_tag LOCUS_14690 1224 2765 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528554.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence237 <1 1114 gene locus_tag LOCUS_14700 <1 1114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088825.1:acyl-CoA dehydrogenase family protein 1227 2768 gene locus_tag LOCUS_14710 1227 2768 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528554.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence238 1445 459 gene locus_tag LOCUS_14720 1445 459 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_14720 2756 1449 gene locus_tag LOCUS_14730 2756 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 3240 2803 gene locus_tag LOCUS_14740 3240 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence239 695 1792 gene locus_tag LOCUS_14750 695 1792 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028729.1 protein_id gnl|my_center|LOCUS_14750 3153 1789 gene locus_tag LOCUS_14760 3153 1789 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028727.1 protein_id gnl|my_center|LOCUS_14760 <4088 3155 gene locus_tag LOCUS_14770 <4088 3155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222933.1:2-phospho-L-lactate transferase >Feature sequence240 1006 839 gene locus_tag LOCUS_14780 1006 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 3844 1118 gene locus_tag LOCUS_14790 3844 1118 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088902.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence241 164 1912 gene locus_tag LOCUS_14800 164 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14800 1909 3042 gene locus_tag LOCUS_14810 1909 3042 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015009.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence242 1415 468 gene locus_tag LOCUS_14820 1415 468 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229459.1 protein_id gnl|my_center|LOCUS_14820 1753 1433 gene locus_tag LOCUS_14830 1753 1433 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059911.1 protein_id gnl|my_center|LOCUS_14830 2258 1830 gene locus_tag LOCUS_14840 2258 1830 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229460.1 protein_id gnl|my_center|LOCUS_14840 2409 3236 gene locus_tag LOCUS_14850 2409 3236 CDS product bacteriorhodopsin-like inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_14850 3849 3298 gene locus_tag LOCUS_14860 3849 3298 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857980.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence243 2473 239 gene locus_tag LOCUS_14870 2473 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 3081 2629 gene locus_tag LOCUS_14880 3081 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence244 1143 388 gene locus_tag LOCUS_14890 1143 388 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724134.1 protein_id gnl|my_center|LOCUS_14890 2018 1140 gene locus_tag LOCUS_14900 2018 1140 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970316.1 protein_id gnl|my_center|LOCUS_14900 2783 2025 gene locus_tag LOCUS_14910 2783 2025 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525194.1 protein_id gnl|my_center|LOCUS_14910 2740 2979 gene locus_tag LOCUS_14920 2740 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence245 1143 388 gene locus_tag LOCUS_14930 1143 388 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724134.1 protein_id gnl|my_center|LOCUS_14930 2018 1140 gene locus_tag LOCUS_14940 2018 1140 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970316.1 protein_id gnl|my_center|LOCUS_14940 2753 2025 gene locus_tag LOCUS_14950 2753 2025 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525194.1 protein_id gnl|my_center|LOCUS_14950 2785 2979 gene locus_tag LOCUS_14960 2785 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 >Feature sequence246 959 696 gene locus_tag LOCUS_14970 959 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1184 1017 gene locus_tag LOCUS_14980 1184 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1475 1275 gene locus_tag LOCUS_14990 1475 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 3311 1572 gene locus_tag LOCUS_15000 3311 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 3886 3308 gene locus_tag LOCUS_15010 3886 3308 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226663.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence247 435 1271 gene locus_tag LOCUS_15020 435 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 2445 1291 gene locus_tag LOCUS_15030 2445 1291 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975683.1 protein_id gnl|my_center|LOCUS_15030 3157 2438 gene locus_tag LOCUS_15040 3157 2438 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729647.1 protein_id gnl|my_center|LOCUS_15040 <3971 3158 gene locus_tag LOCUS_15050 <3971 3158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066639.1:glutamine synthetase family protein >Feature sequence248 1365 2327 gene locus_tag LOCUS_15060 1365 2327 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466857.1 protein_id gnl|my_center|LOCUS_15060 3642 2278 gene locus_tag LOCUS_15070 gene glmM 3642 2278 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence249 444 2579 gene locus_tag LOCUS_15080 444 2579 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400860.1 protein_id gnl|my_center|LOCUS_15080 3104 2589 gene locus_tag LOCUS_15090 3104 2589 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027833.1 protein_id gnl|my_center|LOCUS_15090 <3965 3104 gene locus_tag LOCUS_15100 <3965 3104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977296.1:threonine--tRNA ligase >Feature sequence250 <1 502 gene locus_tag LOCUS_15110 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223946.1:DEAD/DEAH box helicase 1487 495 gene locus_tag LOCUS_15120 1487 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 2424 1639 gene locus_tag LOCUS_15130 2424 1639 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692076.1 protein_id gnl|my_center|LOCUS_15130 2415 2903 gene locus_tag LOCUS_15140 2415 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 2963 3679 gene locus_tag LOCUS_15150 2963 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence251 391 1728 gene locus_tag LOCUS_15160 gene ccrA 391 1728 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283587.1 protein_id gnl|my_center|LOCUS_15160 1806 3629 gene locus_tag LOCUS_15170 gene oatA 1806 3629 CDS product peptidoglycan O-acetyltransferase OatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932001.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence252 1046 2221 gene locus_tag LOCUS_15180 gene glgA 1046 2221 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226306.1 protein_id gnl|my_center|LOCUS_15180 2218 3177 gene locus_tag LOCUS_15190 2218 3177 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228081.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence253 38 1945 gene locus_tag LOCUS_15200 gene uvrC 38 1945 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082304.1 protein_id gnl|my_center|LOCUS_15200 1932 2807 gene locus_tag LOCUS_15210 gene rapZ 1932 2807 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_15210 2804 3778 gene locus_tag LOCUS_15220 gene yvcK 2804 3778 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence254 <1 706 gene locus_tag LOCUS_15230 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975011.1:low molecular weight protein-tyrosine-phosphatase 749 1123 gene locus_tag LOCUS_15240 749 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1222 1464 gene locus_tag LOCUS_15250 1222 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1951 1535 gene locus_tag LOCUS_15260 1951 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 2362 1994 gene locus_tag LOCUS_15270 2362 1994 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098871.1 protein_id gnl|my_center|LOCUS_15270 2851 2441 gene locus_tag LOCUS_15280 2851 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 3335 2889 gene locus_tag LOCUS_15290 gene rplI 3335 2889 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_15290 3619 3347 gene locus_tag LOCUS_15300 gene rpsR 3619 3347 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777137.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence255 1754 363 gene locus_tag LOCUS_15310 1754 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 <3938 1751 gene locus_tag LOCUS_15320 <3938 1751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005092974.1:bifunctional FO biosynthesis protein CofGH >Feature sequence256 <1 1307 gene locus_tag LOCUS_15330 <1 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226360.1:FAD-binding oxidoreductase 1304 2536 gene locus_tag LOCUS_15340 1304 2536 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226359.1 protein_id gnl|my_center|LOCUS_15340 3025 2600 gene locus_tag LOCUS_15350 3025 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence257 2491 653 gene locus_tag LOCUS_15360 2491 653 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_15360 3405 2521 gene locus_tag LOCUS_15370 3405 2521 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924398.1 protein_id gnl|my_center|LOCUS_15370 3905 3399 gene locus_tag LOCUS_15380 3905 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence258 <1 781 gene locus_tag LOCUS_15390 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003894937.1:alkaline phosphatase family protein 847 1512 gene locus_tag LOCUS_15400 847 1512 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 protein_id gnl|my_center|LOCUS_15400 2082 1855 gene locus_tag LOCUS_15410 2082 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 2948 2202 gene locus_tag LOCUS_15420 gene sepH 2948 2202 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230196.1 protein_id gnl|my_center|LOCUS_15420 <3903 3028 gene locus_tag LOCUS_15430 <3903 3028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973162.1:MFS transporter >Feature sequence259 375 1007 gene locus_tag LOCUS_15440 375 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1065 1934 gene locus_tag LOCUS_15450 1065 1934 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892164.1 protein_id gnl|my_center|LOCUS_15450 1936 2415 gene locus_tag LOCUS_15460 1936 2415 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892165.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence260 358 990 gene locus_tag LOCUS_15470 358 990 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141279381.1 protein_id gnl|my_center|LOCUS_15470 1050 1919 gene locus_tag LOCUS_15480 1050 1919 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892164.1 protein_id gnl|my_center|LOCUS_15480 1921 2400 gene locus_tag LOCUS_15490 1921 2400 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892165.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence261 481 1002 gene locus_tag LOCUS_15500 481 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1679 1768 gene locus_tag LOCUS_t00210 1679 1768 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2282 1803 gene locus_tag LOCUS_15510 2282 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 3017 2358 gene locus_tag LOCUS_15520 3017 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 3493 3017 gene locus_tag LOCUS_15530 gene tadA 3493 3017 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_15530 3876 3493 gene locus_tag LOCUS_15540 3876 3493 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199198884.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence262 465 2954 gene locus_tag LOCUS_15550 465 2954 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484949.1 protein_id gnl|my_center|LOCUS_15550 2951 3829 gene locus_tag LOCUS_15560 2951 3829 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028540.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence263 1304 75 gene locus_tag LOCUS_15570 gene dxr 1304 75 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284246.1 protein_id gnl|my_center|LOCUS_15570 1737 1306 gene locus_tag LOCUS_15580 1737 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 2039 1740 gene locus_tag LOCUS_15590 2039 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 3421 2066 gene locus_tag LOCUS_15600 3421 2066 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030384.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence264 926 720 gene locus_tag LOCUS_15610 926 720 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004984898.1 protein_id gnl|my_center|LOCUS_15610 2292 1087 gene locus_tag LOCUS_15620 2292 1087 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 protein_id gnl|my_center|LOCUS_15620 3053 2289 gene locus_tag LOCUS_15630 gene proC 3053 2289 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 protein_id gnl|my_center|LOCUS_15630 <3873 3112 gene locus_tag LOCUS_15640 <3873 3112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224531.1:proline dehydrogenase family protein >Feature sequence265 2232 856 gene locus_tag LOCUS_15650 2232 856 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_15650 3686 2229 gene locus_tag LOCUS_15660 3686 2229 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729660.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence266 <1 652 gene locus_tag LOCUS_15670 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976890.1:ABC transporter permease 726 1745 gene locus_tag LOCUS_15680 726 1745 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_15680 2531 1674 gene locus_tag LOCUS_15690 2531 1674 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805128.1 protein_id gnl|my_center|LOCUS_15690 >Feature sequence267 <1 652 gene locus_tag LOCUS_15700 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976890.1:ABC transporter permease 678 1661 gene locus_tag LOCUS_15710 678 1661 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929933.1 protein_id gnl|my_center|LOCUS_15710 2621 1674 gene locus_tag LOCUS_15720 2621 1674 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805128.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence268 454 1809 gene locus_tag LOCUS_15730 454 1809 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030384.1 protein_id gnl|my_center|LOCUS_15730 1836 2135 gene locus_tag LOCUS_15740 1836 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 2138 2407 gene locus_tag LOCUS_15750 2138 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2409 3638 gene locus_tag LOCUS_15760 gene dxr 2409 3638 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284246.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence269 <1 612 gene locus_tag LOCUS_15770 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223283.1:ABC transporter substrate-binding protein 625 2343 gene locus_tag LOCUS_15780 625 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 2420 2833 gene locus_tag LOCUS_15790 2420 2833 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775840.1 protein_id gnl|my_center|LOCUS_15790 2830 3609 gene locus_tag LOCUS_15800 gene modA 2830 3609 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728090.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence270 <1 918 gene locus_tag LOCUS_15810 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223493.1:class I mannose-6-phosphate isomerase 908 1948 gene locus_tag LOCUS_15820 908 1948 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230475.1 protein_id gnl|my_center|LOCUS_15820 1948 2946 gene locus_tag LOCUS_15830 gene tilS 1948 2946 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230474.1 protein_id gnl|my_center|LOCUS_15830 2959 3513 gene locus_tag LOCUS_15840 gene hpt 2959 3513 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence271 985 1134 gene locus_tag LOCUS_15850 985 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 2071 1118 gene locus_tag LOCUS_15860 2071 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2105 3163 gene locus_tag LOCUS_15870 2105 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence272 1484 1008 gene locus_tag LOCUS_15880 1484 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 3247 1544 gene locus_tag LOCUS_15890 3247 1544 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904576.1 protein_id gnl|my_center|LOCUS_15890 3482 3309 gene locus_tag LOCUS_15900 3482 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence273 <1 848 gene locus_tag LOCUS_15910 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030453.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB 862 1764 gene locus_tag LOCUS_15920 gene miaA 862 1764 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_15920 2507 1701 gene locus_tag LOCUS_15930 2507 1701 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467152.1 protein_id gnl|my_center|LOCUS_15930 2538 3671 gene locus_tag LOCUS_15940 2538 3671 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence274 3 1187 gene locus_tag LOCUS_15950 3 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1336 1938 gene locus_tag LOCUS_15960 1336 1938 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence275 350 2134 gene locus_tag LOCUS_15970 gene pknB 350 2134 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222003.1 protein_id gnl|my_center|LOCUS_15970 2806 2150 gene locus_tag LOCUS_15980 2806 2150 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030445363.1 protein_id gnl|my_center|LOCUS_15980 2841 3128 gene locus_tag LOCUS_15990 gene crgA 2841 3128 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975080.1 protein_id gnl|my_center|LOCUS_15990 3314 3514 gene locus_tag LOCUS_16000 3314 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence276 <1 763 gene locus_tag LOCUS_16010 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013221960.1:DNA topoisomerase (ATP-hydrolyzing) subunit B 803 3331 gene locus_tag LOCUS_16020 gene gyrA 803 3331 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_16020 3328 3717 gene locus_tag LOCUS_16030 3328 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence277 15 2621 gene locus_tag LOCUS_16040 15 2621 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229784.1 protein_id gnl|my_center|LOCUS_16040 2650 3486 gene locus_tag LOCUS_16050 2650 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence278 1 726 gene locus_tag LOCUS_16060 1 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 729 1151 gene locus_tag LOCUS_16070 gene ruvX 729 1151 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_16070 1148 2245 gene locus_tag LOCUS_16080 1148 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 2238 3044 gene locus_tag LOCUS_16090 2238 3044 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_16090 3087 3554 gene locus_tag LOCUS_16100 3087 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence279 2284 2060 gene locus_tag LOCUS_16110 2284 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 3454 2480 gene locus_tag LOCUS_16120 gene gmd 3454 2480 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284917.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence280 2026 278 gene locus_tag LOCUS_16130 2026 278 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803733.1 protein_id gnl|my_center|LOCUS_16130 3124 2141 gene locus_tag LOCUS_16140 3124 2141 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence281 1157 3535 gene locus_tag LOCUS_16150 1157 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence282 700 1944 gene locus_tag LOCUS_16160 700 1944 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058221.1 protein_id gnl|my_center|LOCUS_16160 2114 3184 gene locus_tag LOCUS_16170 2114 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence283 1564 1740 gene locus_tag LOCUS_16180 1564 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1785 1967 gene locus_tag LOCUS_16190 1785 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence284 1116 1505 gene locus_tag LOCUS_16200 1116 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1502 3415 gene locus_tag LOCUS_16210 1502 3415 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence285 989 2029 gene locus_tag LOCUS_16220 gene gnd 989 2029 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405880.1 protein_id gnl|my_center|LOCUS_16220 3250 2021 gene locus_tag LOCUS_16230 gene mshC 3250 2021 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence286 1832 1035 gene locus_tag LOCUS_16240 gene argB 1832 1035 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_16240 2980 1829 gene locus_tag LOCUS_16250 gene argJ 2980 1829 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_16250 <3759 2991 gene locus_tag LOCUS_16260 <3759 2991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977244.1:N-acetyl-gamma-glutamyl-phosphate reductase >Feature sequence287 1019 444 gene locus_tag LOCUS_16270 1019 444 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_16270 1141 2049 gene locus_tag LOCUS_16280 1141 2049 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976848.1 protein_id gnl|my_center|LOCUS_16280 2046 2948 gene locus_tag LOCUS_16290 2046 2948 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466843.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence288 >Feature sequence289 338 1246 gene locus_tag LOCUS_16300 gene ftsX 338 1246 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_16300 1306 2583 gene locus_tag LOCUS_16310 1306 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2634 3110 gene locus_tag LOCUS_16320 gene smpB 2634 3110 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence290 1158 919 gene locus_tag LOCUS_16330 1158 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 <3723 1299 gene locus_tag LOCUS_16340 <3723 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014877465.1:DNA translocase FtsK >Feature sequence291 1928 486 gene locus_tag LOCUS_16350 1928 486 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195505.1 protein_id gnl|my_center|LOCUS_16350 3297 1930 gene locus_tag LOCUS_16360 3297 1930 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972090.1 protein_id gnl|my_center|LOCUS_16360 3713 3297 gene locus_tag LOCUS_16370 3713 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence292 1919 81 gene locus_tag LOCUS_16380 1919 81 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_16380 3676 1916 gene locus_tag LOCUS_16390 3676 1916 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564050.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence293 3 416 gene locus_tag LOCUS_16400 3 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1187 516 gene locus_tag LOCUS_16410 gene uvrY 1187 516 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705978.1 protein_id gnl|my_center|LOCUS_16410 3456 1174 gene locus_tag LOCUS_16420 3456 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence294 1137 2234 gene locus_tag LOCUS_16430 1137 2234 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_16430 2818 2231 gene locus_tag LOCUS_16440 2818 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence295 1137 2234 gene locus_tag LOCUS_16450 1137 2234 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_16450 2806 2231 gene locus_tag LOCUS_16460 2806 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 >Feature sequence296 <1 516 gene locus_tag LOCUS_16470 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066567685.1:glutamate racemase 539 1264 gene locus_tag LOCUS_16480 gene rph 539 1264 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_16480 1279 1875 gene locus_tag LOCUS_16490 gene rdgB 1279 1875 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_16490 1872 2177 gene locus_tag LOCUS_16500 1872 2177 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084050946.1 protein_id gnl|my_center|LOCUS_16500 2264 2181 gene locus_tag LOCUS_t00220 2264 2181 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2419 3153 gene locus_tag LOCUS_16510 2419 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16510 3155 3496 gene locus_tag LOCUS_16520 3155 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16520 >Feature sequence297 182 760 gene locus_tag LOCUS_16530 182 760 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893431.1 protein_id gnl|my_center|LOCUS_16530 757 1461 gene locus_tag LOCUS_16540 757 1461 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_16540 1461 2798 gene locus_tag LOCUS_16550 1461 2798 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_16550 2829 3485 gene locus_tag LOCUS_16560 gene nuoE 2829 3485 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974380.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence298 <1 650 gene locus_tag LOCUS_16570 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230874.1:molecular chaperone DnaK 647 1222 gene locus_tag LOCUS_16580 647 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1225 2397 gene locus_tag LOCUS_16590 gene dnaJ 1225 2397 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 protein_id gnl|my_center|LOCUS_16590 2394 2744 gene locus_tag LOCUS_16600 2394 2744 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975271.1 protein_id gnl|my_center|LOCUS_16600 >Feature sequence299 <1 714 gene locus_tag LOCUS_16610 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965824.1:oxygenase MpaB family protein 1114 2793 gene locus_tag LOCUS_16620 1114 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 3659 2790 gene locus_tag LOCUS_16630 3659 2790 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804230.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence300 3210 2953 gene locus_tag LOCUS_16640 3210 2953 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975777.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence301 <1 1378 gene locus_tag LOCUS_16650 <1 1378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225004.1:phosphotransferase family protein 1422 2282 gene locus_tag LOCUS_16660 gene tesB 1422 2282 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413466.1 protein_id gnl|my_center|LOCUS_16660 2911 2276 gene locus_tag LOCUS_16670 2911 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence302 116 958 gene locus_tag LOCUS_16680 116 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1702 980 gene locus_tag LOCUS_16690 1702 980 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419147.1 protein_id gnl|my_center|LOCUS_16690 2733 1699 gene locus_tag LOCUS_16700 2733 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 3547 2720 gene locus_tag LOCUS_16710 3547 2720 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015754.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence303 125 1006 gene locus_tag LOCUS_16720 125 1006 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114440.1 protein_id gnl|my_center|LOCUS_16720 1019 1870 gene locus_tag LOCUS_16730 1019 1870 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417751.1 protein_id gnl|my_center|LOCUS_16730 1867 2187 gene locus_tag LOCUS_16740 1867 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 2316 3272 gene locus_tag LOCUS_16750 gene mdh 2316 3272 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942112.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence304 2 532 gene locus_tag LOCUS_16760 2 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 588 2246 gene locus_tag LOCUS_16770 588 2246 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027968.1 protein_id gnl|my_center|LOCUS_16770 2243 2920 gene locus_tag LOCUS_16780 2243 2920 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895191.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence305 2 274 gene locus_tag LOCUS_16790 2 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 875 357 gene locus_tag LOCUS_16800 875 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16800 1582 833 gene locus_tag LOCUS_16810 1582 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16810 1632 2480 gene locus_tag LOCUS_16820 1632 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 3356 2505 gene locus_tag LOCUS_16830 3356 2505 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533422.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence306 94 567 gene locus_tag LOCUS_16840 gene fhaB 94 567 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_16840 574 1947 gene locus_tag LOCUS_16850 574 1947 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029266.1 protein_id gnl|my_center|LOCUS_16850 1944 3344 gene locus_tag LOCUS_16860 1944 3344 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776671.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence307 391 1728 gene locus_tag LOCUS_16870 gene ccrA 391 1728 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283587.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence308 399 1052 gene locus_tag LOCUS_16880 gene trmB 399 1052 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974862.1 protein_id gnl|my_center|LOCUS_16880 1577 1356 gene locus_tag LOCUS_16890 1577 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 >Feature sequence309 <1 574 gene locus_tag LOCUS_16900 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030368.1:gamma-aminobutyraldehyde dehydrogenase 1612 581 gene locus_tag LOCUS_16910 1612 581 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729474.1 protein_id gnl|my_center|LOCUS_16910 3115 1628 gene locus_tag LOCUS_16920 gene mmsA 3115 1628 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence310 1755 997 gene locus_tag LOCUS_16930 1755 997 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031344.1 protein_id gnl|my_center|LOCUS_16930 2676 1807 gene locus_tag LOCUS_16940 gene sucD 2676 1807 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804538.1 protein_id gnl|my_center|LOCUS_16940 <3559 2689 gene locus_tag LOCUS_16950 <3559 2689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730595.1:ADP-forming succinate--CoA ligase subunit beta >Feature sequence311 <1 1846 gene locus_tag LOCUS_16960 <1 1846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230093.1:bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase 2180 1848 gene locus_tag LOCUS_16970 2180 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 3039 2242 gene locus_tag LOCUS_16980 gene menB 3039 2242 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459123.1 protein_id gnl|my_center|LOCUS_16980 <3551 3039 gene locus_tag LOCUS_16990 <3551 3039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388027.1:acetyl-CoA C-acetyltransferase >Feature sequence312 4 1008 gene locus_tag LOCUS_17000 4 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1050 1122 gene locus_tag LOCUS_t00230 1050 1122 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1204 1279 gene locus_tag LOCUS_t00240 1204 1279 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1338 2747 gene locus_tag LOCUS_17010 gene leuC 1338 2747 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223619.1 protein_id gnl|my_center|LOCUS_17010 2775 3362 gene locus_tag LOCUS_17020 gene leuD 2775 3362 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence313 <1 1575 gene locus_tag LOCUS_17030 <1 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003895262.1:excinuclease ABC subunit UvrB 1575 2513 gene locus_tag LOCUS_17040 1575 2513 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227898.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence314 747 58 gene locus_tag LOCUS_17050 gene prcA 747 58 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_17050 1592 744 gene locus_tag LOCUS_17060 gene prcB 1592 744 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_17060 1792 1589 gene locus_tag LOCUS_17070 1792 1589 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_17070 3341 1830 gene locus_tag LOCUS_17080 gene dop 3341 1830 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence315 1093 2115 gene locus_tag LOCUS_17090 1093 2115 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775776.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence316 477 1625 gene locus_tag LOCUS_17100 477 1625 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457344.1 protein_id gnl|my_center|LOCUS_17100 1933 1622 gene locus_tag LOCUS_17110 1933 1622 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_17110 2730 1930 gene locus_tag LOCUS_17120 2730 1930 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084957.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence317 7 822 gene locus_tag LOCUS_17130 7 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 2927 834 gene locus_tag LOCUS_17140 2927 834 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_17140 2957 3184 gene locus_tag LOCUS_17150 2957 3184 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_17150 3499 3197 gene locus_tag LOCUS_17160 3499 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence318 683 381 gene locus_tag LOCUS_17170 gene gatC 683 381 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_17170 2884 683 gene locus_tag LOCUS_17180 gene ligA 2884 683 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728295.1 protein_id gnl|my_center|LOCUS_17180 <3490 2874 gene locus_tag LOCUS_17190 <3490 2874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030277.1:methionine synthase >Feature sequence319 7 822 gene locus_tag LOCUS_17200 7 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2927 834 gene locus_tag LOCUS_17210 2927 834 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_17210 2930 3184 gene locus_tag LOCUS_17220 2930 3184 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_17220 3487 3185 gene locus_tag LOCUS_17230 3487 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence320 136 1056 gene locus_tag LOCUS_17240 136 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1049 2200 gene locus_tag LOCUS_17250 1049 2200 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390245.1 protein_id gnl|my_center|LOCUS_17250 2876 2184 gene locus_tag LOCUS_17260 2876 2184 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876008.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence321 602 297 gene locus_tag LOCUS_17270 gene rpsF 602 297 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072064.1 protein_id gnl|my_center|LOCUS_17270 854 1639 gene locus_tag LOCUS_17280 854 1639 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030841.1 protein_id gnl|my_center|LOCUS_17280 1641 2795 gene locus_tag LOCUS_17290 gene femX 1641 2795 CDS product peptidoglycan bridge formation glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029302.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence322 561 1058 gene locus_tag LOCUS_17300 561 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1061 2038 gene locus_tag LOCUS_17310 gene rfbB 1061 2038 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_17310 2044 2907 gene locus_tag LOCUS_17320 gene rfbD 2044 2907 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417101.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence323 2085 406 gene locus_tag LOCUS_17330 2085 406 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_17330 2993 2082 gene locus_tag LOCUS_17340 gene dapA 2993 2082 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence324 415 1989 gene locus_tag LOCUS_17350 415 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1986 2999 gene locus_tag LOCUS_17360 1986 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence325 2067 544 gene locus_tag LOCUS_17370 2067 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 2984 2064 gene locus_tag LOCUS_17380 gene yedA 2984 2064 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268946.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence326 1121 117 gene locus_tag LOCUS_17390 gene prfB 1121 117 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975840.1 protein_id gnl|my_center|LOCUS_17390 1622 1167 gene locus_tag LOCUS_17400 1622 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 2074 1619 gene locus_tag LOCUS_17410 2074 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 2484 2071 gene locus_tag LOCUS_17420 2484 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 2689 2495 gene locus_tag LOCUS_17430 2689 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 <3444 2740 gene locus_tag LOCUS_17440 <3444 2740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776056.1:type II secretion system F family protein >Feature sequence327 <1 617 gene locus_tag LOCUS_17450 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030277.1:methionine synthase 607 1686 gene locus_tag LOCUS_17460 607 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17460 1702 2808 gene locus_tag LOCUS_17470 1702 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17470 2808 3110 gene locus_tag LOCUS_17480 gene gatC 2808 3110 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence328 1837 1199 gene locus_tag LOCUS_17490 1837 1199 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804879.1 protein_id gnl|my_center|LOCUS_17490 2374 1940 gene locus_tag LOCUS_17500 2374 1940 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570773.1 protein_id gnl|my_center|LOCUS_17500 2520 3371 gene locus_tag LOCUS_17510 2520 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17510 >Feature sequence329 866 1603 gene locus_tag LOCUS_17520 866 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2477 1605 gene locus_tag LOCUS_17530 2477 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 <3428 2477 gene locus_tag LOCUS_17540 <3428 2477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929836.1:glycosyltransferase >Feature sequence330 806 171 gene locus_tag LOCUS_17550 806 171 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_17550 911 1819 gene locus_tag LOCUS_17560 911 1819 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030094.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence331 88 1407 gene locus_tag LOCUS_17570 gene tig 88 1407 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228513.1 protein_id gnl|my_center|LOCUS_17570 1552 2214 gene locus_tag LOCUS_17580 1552 2214 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412275.1 protein_id gnl|my_center|LOCUS_17580 2211 2825 gene locus_tag LOCUS_17590 2211 2825 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668811.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence332 1323 478 gene locus_tag LOCUS_17600 1323 478 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_17600 1976 1320 gene locus_tag LOCUS_17610 1976 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_17610 2453 1980 gene locus_tag LOCUS_17620 2453 1980 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_17620 2627 2472 gene locus_tag LOCUS_17630 2627 2472 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776605.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence333 1822 377 gene locus_tag LOCUS_17640 1822 377 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_17640 3088 1853 gene locus_tag LOCUS_17650 3088 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 3410 3093 gene locus_tag LOCUS_17660 3410 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence334 561 1058 gene locus_tag LOCUS_17670 561 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1061 2038 gene locus_tag LOCUS_17680 gene rfbB 1061 2038 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_17680 2044 2907 gene locus_tag LOCUS_17690 gene rfbD 2044 2907 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417101.1 protein_id gnl|my_center|LOCUS_17690 3271 2894 gene locus_tag LOCUS_17700 3271 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence335 2130 325 gene locus_tag LOCUS_17710 2130 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 2840 2193 gene locus_tag LOCUS_17720 2840 2193 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975875.1 protein_id gnl|my_center|LOCUS_17720 >Feature sequence336 1830 169 gene locus_tag LOCUS_17730 1830 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 2019 3392 gene locus_tag LOCUS_17740 2019 3392 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486660.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17740 >Feature sequence337 1548 580 gene locus_tag LOCUS_17750 1548 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 1582 2736 gene locus_tag LOCUS_17760 1582 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence338 284 1489 gene locus_tag LOCUS_17770 284 1489 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_17770 1486 1887 gene locus_tag LOCUS_17780 1486 1887 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223006.1 protein_id gnl|my_center|LOCUS_17780 2288 1911 gene locus_tag LOCUS_17790 2288 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 <3381 2312 gene locus_tag LOCUS_17800 <3381 2312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030093.1:DEAD/DEAH box helicase >Feature sequence339 561 2108 gene locus_tag LOCUS_17810 561 2108 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094785.1 protein_id gnl|my_center|LOCUS_17810 2122 2574 gene locus_tag LOCUS_17820 2122 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence340 60 1058 gene locus_tag LOCUS_17830 gene plsX 60 1058 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056688.1 protein_id gnl|my_center|LOCUS_17830 1055 1321 gene locus_tag LOCUS_17840 1055 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 1318 2049 gene locus_tag LOCUS_17850 gene rnc 1318 2049 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_17850 2050 2925 gene locus_tag LOCUS_17860 gene mutM 2050 2925 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence341 <1 2181 gene locus_tag LOCUS_17870 <1 2181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_113701643.1:DNA translocase FtsK >Feature sequence342 1904 39 gene locus_tag LOCUS_17880 1904 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2373 1924 gene locus_tag LOCUS_17890 2373 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 2621 3292 gene locus_tag LOCUS_17900 2621 3292 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049832585.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence343 1089 769 gene locus_tag LOCUS_17910 1089 769 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059911.1 protein_id gnl|my_center|LOCUS_17910 1594 1166 gene locus_tag LOCUS_17920 1594 1166 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229460.1 protein_id gnl|my_center|LOCUS_17920 1746 2573 gene locus_tag LOCUS_17930 1746 2573 CDS product bacteriorhodopsin-like inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_17930 3186 2635 gene locus_tag LOCUS_17940 3186 2635 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857980.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence344 35 901 gene locus_tag LOCUS_17950 35 901 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_17950 2476 965 gene locus_tag LOCUS_17960 2476 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 2825 2898 gene locus_tag LOCUS_t00250 2825 2898 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence345 2208 1486 gene locus_tag LOCUS_17970 gene ureA 2208 1486 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030293.1 protein_id gnl|my_center|LOCUS_17970 <3358 2222 gene locus_tag LOCUS_17980 <3358 2222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726949.1:amidohydrolase >Feature sequence346 1189 1431 gene locus_tag LOCUS_17990 1189 1431 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141679.1 protein_id gnl|my_center|LOCUS_17990 1428 1832 gene locus_tag LOCUS_18000 1428 1832 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141678.1 protein_id gnl|my_center|LOCUS_18000 3279 1846 gene locus_tag LOCUS_18010 3279 1846 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence347 1189 1431 gene locus_tag LOCUS_18020 1189 1431 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141679.1 protein_id gnl|my_center|LOCUS_18020 1428 1832 gene locus_tag LOCUS_18030 1428 1832 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141678.1 protein_id gnl|my_center|LOCUS_18030 3271 1838 gene locus_tag LOCUS_18040 3271 1838 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence348 193 582 gene locus_tag LOCUS_18050 193 582 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085450.1 protein_id gnl|my_center|LOCUS_18050 1306 569 gene locus_tag LOCUS_18060 1306 569 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 protein_id gnl|my_center|LOCUS_18060 2170 1334 gene locus_tag LOCUS_18070 2170 1334 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083532.1 protein_id gnl|my_center|LOCUS_18070 2943 2236 gene locus_tag LOCUS_18080 2943 2236 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229800.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence349 193 567 gene locus_tag LOCUS_18090 193 567 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085450.1 protein_id gnl|my_center|LOCUS_18090 1306 569 gene locus_tag LOCUS_18100 1306 569 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 protein_id gnl|my_center|LOCUS_18100 2170 1334 gene locus_tag LOCUS_18110 2170 1334 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083532.1 protein_id gnl|my_center|LOCUS_18110 2943 2236 gene locus_tag LOCUS_18120 2943 2236 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229800.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence350 720 1694 gene locus_tag LOCUS_18130 720 1694 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_18130 1691 2920 gene locus_tag LOCUS_18140 1691 2920 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878473.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence351 <1 520 gene locus_tag LOCUS_18150 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223946.1:DEAD/DEAH box helicase 1592 513 gene locus_tag LOCUS_18160 1592 513 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929894.1 protein_id gnl|my_center|LOCUS_18160 2442 1657 gene locus_tag LOCUS_18170 2442 1657 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692076.1 protein_id gnl|my_center|LOCUS_18170 2433 2921 gene locus_tag LOCUS_18180 2433 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence352 <1 1036 gene locus_tag LOCUS_18190 <1 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193485775.1:bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC 1139 2389 gene locus_tag LOCUS_18200 gene metK 1139 2389 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence353 227 301 gene locus_tag LOCUS_t00260 227 301 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 625 338 gene locus_tag LOCUS_18210 625 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1660 650 gene locus_tag LOCUS_18220 1660 650 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223782.1 protein_id gnl|my_center|LOCUS_18220 2682 1663 gene locus_tag LOCUS_18230 gene iolG 2682 1663 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence354 783 1532 gene locus_tag LOCUS_18240 783 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 2406 1534 gene locus_tag LOCUS_18250 2406 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 3311 2406 gene locus_tag LOCUS_18260 3311 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence355 1400 492 gene locus_tag LOCUS_18270 1400 492 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029901.1 protein_id gnl|my_center|LOCUS_18270 1929 1381 gene locus_tag LOCUS_18280 1929 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence356 2426 861 gene locus_tag LOCUS_18290 gene crtI 2426 861 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728283.1 protein_id gnl|my_center|LOCUS_18290 <3310 2453 gene locus_tag LOCUS_18300 <3310 2453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224198.1:polyprenyl synthetase family protein >Feature sequence357 <1 709 gene locus_tag LOCUS_18310 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_107906544.1:rod shape-determining protein 754 1779 gene locus_tag LOCUS_18320 gene mreC 754 1779 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 protein_id gnl|my_center|LOCUS_18320 1782 2291 gene locus_tag LOCUS_18330 1782 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence358 274 1308 gene locus_tag LOCUS_18340 274 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1305 2027 gene locus_tag LOCUS_18350 1305 2027 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419147.1 protein_id gnl|my_center|LOCUS_18350 2891 2049 gene locus_tag LOCUS_18360 2891 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence359 908 126 gene locus_tag LOCUS_18370 gene pgl 908 126 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_18370 1807 896 gene locus_tag LOCUS_18380 gene opcA 1807 896 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976880.1 protein_id gnl|my_center|LOCUS_18380 <3287 1804 gene locus_tag LOCUS_18390 <3287 1804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031084.1:glucose-6-phosphate dehydrogenase >Feature sequence360 1227 91 gene locus_tag LOCUS_18400 1227 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2363 1443 gene locus_tag LOCUS_18410 gene thrB 2363 1443 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_18410 <3271 2363 gene locus_tag LOCUS_18420 <3271 2363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973642.1:threonine synthase >Feature sequence361 1917 529 gene locus_tag LOCUS_18430 1917 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2329 1922 gene locus_tag LOCUS_18440 gene ndk 2329 1922 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228487.1 protein_id gnl|my_center|LOCUS_18440 2731 2381 gene locus_tag LOCUS_18450 2731 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 3258 2752 gene locus_tag LOCUS_18460 3258 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence362 1917 532 gene locus_tag LOCUS_18470 1917 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2329 1922 gene locus_tag LOCUS_18480 gene ndk 2329 1922 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228487.1 protein_id gnl|my_center|LOCUS_18480 2731 2381 gene locus_tag LOCUS_18490 2731 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 3258 2728 gene locus_tag LOCUS_18500 3258 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 >Feature sequence363 2726 969 gene locus_tag LOCUS_18510 2726 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143322.1 protein_id gnl|my_center|LOCUS_18510 <3259 2723 gene locus_tag LOCUS_18520 <3259 2723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919030.1:SDR family oxidoreductase >Feature sequence364 <1 1198 gene locus_tag LOCUS_18530 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730431.1:cystathionine beta-synthase 2092 1469 gene locus_tag LOCUS_18540 gene msrA 2092 1469 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015498.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence365 1789 389 gene locus_tag LOCUS_18550 1789 389 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973370.1 protein_id gnl|my_center|LOCUS_18550 2265 1786 gene locus_tag LOCUS_18560 2265 1786 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973369.1 protein_id gnl|my_center|LOCUS_18560 >Feature sequence366 1131 832 gene locus_tag LOCUS_18570 gene nuoK 1131 832 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061219.1 protein_id gnl|my_center|LOCUS_18570 1898 1128 gene locus_tag LOCUS_18580 1898 1128 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893423.1 protein_id gnl|my_center|LOCUS_18580 2455 1895 gene locus_tag LOCUS_18590 gene nuoI 2455 1895 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086544.1 protein_id gnl|my_center|LOCUS_18590 <3248 2448 gene locus_tag LOCUS_18600 <3248 2448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029736.1:NADH-quinone oxidoreductase subunit NuoH >Feature sequence367 1739 822 gene locus_tag LOCUS_18610 1739 822 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_18610 2338 1736 gene locus_tag LOCUS_18620 2338 1736 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence368 799 2070 gene locus_tag LOCUS_18630 gene glnA 799 2070 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259233.1 protein_id gnl|my_center|LOCUS_18630 2331 3092 gene locus_tag LOCUS_18640 2331 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence369 94 1233 gene locus_tag LOCUS_18650 gene hemW 94 1233 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_18650 1768 1247 gene locus_tag LOCUS_18660 1768 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 1992 3011 gene locus_tag LOCUS_18670 gene hrcA 1992 3011 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence370 1491 262 gene locus_tag LOCUS_18680 1491 262 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466839.1 protein_id gnl|my_center|LOCUS_18680 2462 1488 gene locus_tag LOCUS_18690 2462 1488 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_18690 >Feature sequence371 3118 746 gene locus_tag LOCUS_18700 3118 746 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence372 1761 1009 gene locus_tag LOCUS_18710 1761 1009 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_18710 2366 1758 gene locus_tag LOCUS_18720 gene pdxT 2366 1758 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_18720 <3187 2363 gene locus_tag LOCUS_18730 <3187 2363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_070939476.1:pyridoxal 5'-phosphate synthase lyase subunit PdxS >Feature sequence373 77 907 gene locus_tag LOCUS_18740 77 907 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227822.1 protein_id gnl|my_center|LOCUS_18740 904 1830 gene locus_tag LOCUS_18750 904 1830 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence374 1742 318 gene locus_tag LOCUS_18760 1742 318 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727104.1 protein_id gnl|my_center|LOCUS_18760 1852 2307 gene locus_tag LOCUS_18770 1852 2307 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927167.1 protein_id gnl|my_center|LOCUS_18770 2304 2903 gene locus_tag LOCUS_18780 2304 2903 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729062.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence375 1736 312 gene locus_tag LOCUS_18790 1736 312 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727104.1 protein_id gnl|my_center|LOCUS_18790 1844 2299 gene locus_tag LOCUS_18800 1844 2299 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927167.1 protein_id gnl|my_center|LOCUS_18800 2296 2895 gene locus_tag LOCUS_18810 2296 2895 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079489.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence376 88 399 gene locus_tag LOCUS_18820 88 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1657 416 gene locus_tag LOCUS_18830 1657 416 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230171.1 protein_id gnl|my_center|LOCUS_18830 1754 2296 gene locus_tag LOCUS_18840 1754 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2323 2832 gene locus_tag LOCUS_18850 2323 2832 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203764525.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence377 <1 516 gene locus_tag LOCUS_18860 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224217.1:recombinase RecA 526 1014 gene locus_tag LOCUS_18870 gene recX 526 1014 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894108.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence378 210 395 gene locus_tag LOCUS_18880 210 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 1528 422 gene locus_tag LOCUS_18890 1528 422 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_18890 1587 2009 gene locus_tag LOCUS_18900 1587 2009 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730722.1 protein_id gnl|my_center|LOCUS_18900 1991 3007 gene locus_tag LOCUS_18910 gene moaA 1991 3007 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence379 <1 1289 gene locus_tag LOCUS_18920 <1 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775775.1:alpha/beta fold hydrolase 1289 2257 gene locus_tag LOCUS_18930 1289 2257 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775774.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence380 <1 581 gene locus_tag LOCUS_18940 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193486968.1:glycogen debranching protein GlgX <3117 578 gene locus_tag LOCUS_18950 <3117 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193486976.1:glycosyltransferase family 1 protein >Feature sequence381 1487 708 gene locus_tag LOCUS_18960 1487 708 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943910.1 protein_id gnl|my_center|LOCUS_18960 1707 1465 gene locus_tag LOCUS_18970 1707 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 2474 1707 gene locus_tag LOCUS_18980 gene mca 2474 1707 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_18980 2599 3075 gene locus_tag LOCUS_18990 2599 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence382 1487 708 gene locus_tag LOCUS_19000 1487 708 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929892.1 protein_id gnl|my_center|LOCUS_19000 1707 1465 gene locus_tag LOCUS_19010 1707 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 2474 1707 gene locus_tag LOCUS_19020 gene mca 2474 1707 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_19020 2590 3075 gene locus_tag LOCUS_19030 2590 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence383 302 781 gene locus_tag LOCUS_19040 302 781 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726707.1 protein_id gnl|my_center|LOCUS_19040 778 2310 gene locus_tag LOCUS_19050 778 2310 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726708.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence384 984 109 gene locus_tag LOCUS_19060 984 109 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869424.1 protein_id gnl|my_center|LOCUS_19060 1964 981 gene locus_tag LOCUS_19070 1964 981 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence385 <1 1735 gene locus_tag LOCUS_19080 <1 1735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030487.1:DNA topoisomerase IV subunit A 1732 2706 gene locus_tag LOCUS_19090 1732 2706 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence386 571 2817 gene locus_tag LOCUS_19100 571 2817 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225368.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence387 32 1630 gene locus_tag LOCUS_19110 32 1630 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_19110 1653 2441 gene locus_tag LOCUS_19120 1653 2441 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence388 1841 1083 gene locus_tag LOCUS_19130 1841 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2520 1939 gene locus_tag LOCUS_19140 gene plsY 2520 1939 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_19140 <3083 2517 gene locus_tag LOCUS_19150 <3083 2517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976234.1:DegV family protein >Feature sequence389 139 825 gene locus_tag LOCUS_19160 139 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19160 2338 827 gene locus_tag LOCUS_19170 gene cobT 2338 827 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566423.1 protein_id gnl|my_center|LOCUS_19170 3078 2557 gene locus_tag LOCUS_19180 3078 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence390 2360 336 gene locus_tag LOCUS_19190 2360 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 <3078 2365 gene locus_tag LOCUS_19200 <3078 2365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031374.1:FAD-dependent oxidoreductase >Feature sequence391 1078 197 gene locus_tag LOCUS_19210 1078 197 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_19210 1880 1083 gene locus_tag LOCUS_19220 1880 1083 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270333.1 protein_id gnl|my_center|LOCUS_19220 2677 1877 gene locus_tag LOCUS_19230 2677 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence392 <1 1014 gene locus_tag LOCUS_19240 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976218.1:glutamate-5-semialdehyde dehydrogenase 1223 1825 gene locus_tag LOCUS_19250 gene nadD 1223 1825 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_19250 1856 2299 gene locus_tag LOCUS_19260 gene rsfS 1856 2299 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_19260 2437 2958 gene locus_tag LOCUS_19270 2437 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence393 288 1364 gene locus_tag LOCUS_19280 288 1364 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327056.1 protein_id gnl|my_center|LOCUS_19280 1361 1837 gene locus_tag LOCUS_19290 gene tsaE 1361 1837 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 protein_id gnl|my_center|LOCUS_19290 1834 2502 gene locus_tag LOCUS_19300 gene tsaB 1834 2502 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_19300 2499 2975 gene locus_tag LOCUS_19310 gene rimI 2499 2975 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence394 <1 948 gene locus_tag LOCUS_19320 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390775.1:sulfotransferase domain-containing protein <3071 966 gene locus_tag LOCUS_19330 <3071 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_086860976.1:TOMM precursor leader peptide-binding protein >Feature sequence395 <1 908 gene locus_tag LOCUS_19340 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742232.1:NAD(P)/FAD-dependent oxidoreductase 905 1564 gene locus_tag LOCUS_19350 gene lipB 905 1564 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224047.1 protein_id gnl|my_center|LOCUS_19350 1569 2510 gene locus_tag LOCUS_19360 gene lipA 1569 2510 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729704.1 protein_id gnl|my_center|LOCUS_19360 2507 3034 gene locus_tag LOCUS_19370 2507 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence396 340 879 gene locus_tag LOCUS_19380 340 879 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870383.1 protein_id gnl|my_center|LOCUS_19380 1268 876 gene locus_tag LOCUS_19390 1268 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 1393 2337 gene locus_tag LOCUS_19400 1393 2337 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110688.1 protein_id gnl|my_center|LOCUS_19400 2584 2766 gene locus_tag LOCUS_19410 2584 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 >Feature sequence397 <1 1349 gene locus_tag LOCUS_19420 <1 1349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016327174.1:fumarate hydratase 1898 1350 gene locus_tag LOCUS_19430 1898 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 <3058 2153 gene locus_tag LOCUS_19440 <3058 2153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229808.1:PhoH family protein >Feature sequence398 433 1557 gene locus_tag LOCUS_19450 433 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 1554 2828 gene locus_tag LOCUS_19460 1554 2828 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728183.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence399 1336 2055 gene locus_tag LOCUS_19470 1336 2055 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_19470 2444 2097 gene locus_tag LOCUS_19480 2444 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327076.1 protein_id gnl|my_center|LOCUS_19480 <3038 2450 gene locus_tag LOCUS_19490 <3038 2450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222695.1:glutamine-hydrolyzing GMP synthase >Feature sequence400 714 1193 gene locus_tag LOCUS_19500 714 1193 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223567.1 protein_id gnl|my_center|LOCUS_19500 1600 1205 gene locus_tag LOCUS_19510 1600 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 1833 1618 gene locus_tag LOCUS_19520 1833 1618 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877243.1 protein_id gnl|my_center|LOCUS_19520 2154 1888 gene locus_tag LOCUS_19530 2154 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2828 2151 gene locus_tag LOCUS_19540 2828 2151 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_19540 3036 2860 gene locus_tag LOCUS_19550 3036 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence401 562 14 gene locus_tag LOCUS_19560 562 14 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_19560 1795 575 gene locus_tag LOCUS_19570 1795 575 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226315.1 protein_id gnl|my_center|LOCUS_19570 2621 1821 gene locus_tag LOCUS_19580 2621 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence402 1458 424 gene locus_tag LOCUS_19590 1458 424 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223493.1 protein_id gnl|my_center|LOCUS_19590 2738 1455 gene locus_tag LOCUS_19600 gene dacB 2738 1455 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485148.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence403 163 1005 gene locus_tag LOCUS_19610 gene ppiB 163 1005 CDS product peptidylprolyl isomerase PpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950744.1 protein_id gnl|my_center|LOCUS_19610 1057 2376 gene locus_tag LOCUS_19620 1057 2376 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_19620 <3020 2402 gene locus_tag LOCUS_19630 <3020 2402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977314.1:GTP pyrophosphokinase >Feature sequence404 413 1213 gene locus_tag LOCUS_19640 413 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 1239 2459 gene locus_tag LOCUS_19650 1239 2459 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226315.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence405 358 1089 gene locus_tag LOCUS_19660 358 1089 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941604.1 protein_id gnl|my_center|LOCUS_19660 >Feature sequence406 <1 1137 gene locus_tag LOCUS_19670 <1 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029150.1:pyridoxal phosphate-dependent aminotransferase 1292 1134 gene locus_tag LOCUS_19680 1292 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 <2994 1330 gene locus_tag LOCUS_19690 <2994 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975278.1:ATP-dependent chaperone ClpB >Feature sequence407 475 1623 gene locus_tag LOCUS_19700 475 1623 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404932.1 protein_id gnl|my_center|LOCUS_19700 1626 1937 gene locus_tag LOCUS_19710 1626 1937 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223978.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence408 <1 1198 gene locus_tag LOCUS_19720 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730431.1:cystathionine beta-synthase 1826 1203 gene locus_tag LOCUS_19730 gene msrA 1826 1203 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918878.1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence409 2 766 gene locus_tag LOCUS_19740 2 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 827 1405 gene locus_tag LOCUS_19750 827 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521816.1 protein_id gnl|my_center|LOCUS_19750 1408 2766 gene locus_tag LOCUS_19760 1408 2766 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205737.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence410 >Feature sequence411 1234 89 gene locus_tag LOCUS_19770 1234 89 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420258.1 protein_id gnl|my_center|LOCUS_19770 1317 1745 gene locus_tag LOCUS_19780 1317 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2593 1742 gene locus_tag LOCUS_19790 gene hisG 2593 1742 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_19790 2856 2593 gene locus_tag LOCUS_19800 2856 2593 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403497.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence412 2600 1746 gene locus_tag LOCUS_19810 2600 1746 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence413 <1 2250 gene locus_tag LOCUS_19820 <1 2250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016326690.1:DNA gyrase subunit A 2247 2636 gene locus_tag LOCUS_19830 2247 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2716 2791 gene locus_tag LOCUS_t00270 2716 2791 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence414 1077 430 gene locus_tag LOCUS_19840 1077 430 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893820.1 protein_id gnl|my_center|LOCUS_19840 2213 1074 gene locus_tag LOCUS_19850 2213 1074 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898087.1 protein_id gnl|my_center|LOCUS_19850 2887 2213 gene locus_tag LOCUS_19860 2887 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 >Feature sequence415 1155 361 gene locus_tag LOCUS_19870 1155 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 <2891 1184 gene locus_tag LOCUS_19880 <2891 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087310.1:SagB family peptide dehydrogenase >Feature sequence416 1155 361 gene locus_tag LOCUS_19890 1155 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 <2891 1184 gene locus_tag LOCUS_19900 <2891 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005092398.1:SagB family peptide dehydrogenase >Feature sequence417 958 1749 gene locus_tag LOCUS_19910 958 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419692.1 protein_id gnl|my_center|LOCUS_19910 2572 1790 gene locus_tag LOCUS_19920 2572 1790 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence418 1362 349 gene locus_tag LOCUS_19930 1362 349 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878082.1 protein_id gnl|my_center|LOCUS_19930 2819 1359 gene locus_tag LOCUS_19940 2819 1359 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296672.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence419 1608 763 gene locus_tag LOCUS_19950 gene dapF 1608 763 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030458.1 protein_id gnl|my_center|LOCUS_19950 <2877 1618 gene locus_tag LOCUS_19960 <2877 1618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250274.1:glycosyltransferase family 4 protein >Feature sequence420 1754 1098 gene locus_tag LOCUS_19970 gene nuoE 1754 1098 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974380.1 protein_id gnl|my_center|LOCUS_19970 <2877 1785 gene locus_tag LOCUS_19980 <2877 1785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003416430.1:NADH dehydrogenase (quinone) subunit D >Feature sequence421 1042 767 gene locus_tag LOCUS_19990 1042 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 1532 2209 gene locus_tag LOCUS_20000 gene lexA 1532 2209 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894124.1 protein_id gnl|my_center|LOCUS_20000 <2874 2238 gene locus_tag LOCUS_20010 <2874 2238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005089963.1:ATP-dependent DNA helicase >Feature sequence422 1324 488 gene locus_tag LOCUS_20020 1324 488 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_20020 2141 1377 gene locus_tag LOCUS_20030 2141 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 <2855 2138 gene locus_tag LOCUS_20040 <2855 2138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034286377.1:site-specific tyrosine recombinase XerD >Feature sequence423 1196 234 gene locus_tag LOCUS_20050 1196 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2172 1189 gene locus_tag LOCUS_20060 2172 1189 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_20060 2847 2182 gene locus_tag LOCUS_20070 2847 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 >Feature sequence424 1207 767 gene locus_tag LOCUS_20080 1207 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 1504 2181 gene locus_tag LOCUS_20090 gene lexA 1504 2181 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_20090 <2846 2210 gene locus_tag LOCUS_20100 <2846 2210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005089963.1:ATP-dependent DNA helicase >Feature sequence425 1888 920 gene locus_tag LOCUS_20110 1888 920 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 protein_id gnl|my_center|LOCUS_20110 2686 1898 gene locus_tag LOCUS_20120 2686 1898 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974967.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence426 1243 50 gene locus_tag LOCUS_20130 1243 50 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230507.1 protein_id gnl|my_center|LOCUS_20130 1866 1240 gene locus_tag LOCUS_20140 1866 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 <2834 1869 gene locus_tag LOCUS_20150 <2834 1869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029075.1:type I DNA topoisomerase >Feature sequence427 362 1513 gene locus_tag LOCUS_20160 362 1513 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390245.1 protein_id gnl|my_center|LOCUS_20160 2189 1497 gene locus_tag LOCUS_20170 2189 1497 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876008.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence428 <1 622 gene locus_tag LOCUS_20180 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905199.1:ABC transporter permease 619 1860 gene locus_tag LOCUS_20190 619 1860 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_20190 >Feature sequence429 2752 719 gene locus_tag LOCUS_20200 2752 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence430 256 594 gene locus_tag LOCUS_20210 gene glnB 256 594 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414756.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence431 528 19 gene locus_tag LOCUS_20220 528 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 798 1529 gene locus_tag LOCUS_20230 798 1529 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415922.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence432 <1 1086 gene locus_tag LOCUS_20240 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976739.1:isoleucine--tRNA ligase note possible pseudo, internal stop codon >Feature sequence433 814 95 gene locus_tag LOCUS_20250 814 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 2595 814 gene locus_tag LOCUS_20260 gene aspS 2595 814 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224570.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence434 2099 2752 gene locus_tag LOCUS_20270 2099 2752 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence435 901 2346 gene locus_tag LOCUS_20280 901 2346 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence436 359 30 gene locus_tag LOCUS_20290 359 30 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 protein_id gnl|my_center|LOCUS_20290 630 382 gene locus_tag LOCUS_20300 gene secG 630 382 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224669.1 protein_id gnl|my_center|LOCUS_20300 1481 696 gene locus_tag LOCUS_20310 gene tpiA 1481 696 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_20310 2692 1484 gene locus_tag LOCUS_20320 2692 1484 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224667.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence437 <1 567 gene locus_tag LOCUS_20330 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043688023.1:EamA family transporter 911 747 gene locus_tag LOCUS_20340 911 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 1118 1045 gene locus_tag LOCUS_t00280 1118 1045 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1724 1203 gene locus_tag LOCUS_20350 1724 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2305 1862 gene locus_tag LOCUS_20360 gene rsfS 2305 1862 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence438 955 446 gene locus_tag LOCUS_20370 955 446 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_20370 1692 952 gene locus_tag LOCUS_20380 1692 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 2180 1689 gene locus_tag LOCUS_20390 2180 1689 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975457.1 protein_id gnl|my_center|LOCUS_20390 <2744 2190 gene locus_tag LOCUS_20400 <2744 2190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230454.1:lysine--tRNA ligase >Feature sequence439 1208 393 gene locus_tag LOCUS_20410 1208 393 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776134.1 protein_id gnl|my_center|LOCUS_20410 2630 1236 gene locus_tag LOCUS_20420 2630 1236 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence440 1208 393 gene locus_tag LOCUS_20430 1208 393 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776134.1 protein_id gnl|my_center|LOCUS_20430 2630 1236 gene locus_tag LOCUS_20440 2630 1236 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence441 <1 882 gene locus_tag LOCUS_20450 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027320.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme 975 1574 gene locus_tag LOCUS_20460 975 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 >Feature sequence442 192 1253 gene locus_tag LOCUS_20470 192 1253 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031139.1 protein_id gnl|my_center|LOCUS_20470 1796 1239 gene locus_tag LOCUS_20480 1796 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence443 <1 2219 gene locus_tag LOCUS_20490 <1 2219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027893.1:DEAD/DEAH box helicase <2712 2205 gene locus_tag LOCUS_20500 <2712 2205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027889.1:5'-3' exonuclease >Feature sequence444 1513 431 gene locus_tag LOCUS_20510 1513 431 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230995.1 protein_id gnl|my_center|LOCUS_20510 1929 2102 gene locus_tag LOCUS_20520 1929 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence445 1226 1642 gene locus_tag LOCUS_20530 1226 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 1890 1720 gene locus_tag LOCUS_20540 1890 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 2104 1934 gene locus_tag LOCUS_20550 2104 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence446 <1 1367 gene locus_tag LOCUS_20560 <1 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258472.1:cytochrome P450 1772 1476 gene locus_tag LOCUS_20570 1772 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 >Feature sequence447 >Feature sequence448 <1 1394 gene locus_tag LOCUS_20580 <1 1394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_136208946.1:NAD+ synthase 1893 1336 gene locus_tag LOCUS_20590 1893 1336 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400977.1 protein_id gnl|my_center|LOCUS_20590 <2667 1947 gene locus_tag LOCUS_20600 <2667 1947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030040.1:MFS transporter >Feature sequence449 1416 898 gene locus_tag LOCUS_20610 1416 898 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469672.1 protein_id gnl|my_center|LOCUS_20610 <2666 1409 gene locus_tag LOCUS_20620 <2666 1409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030088.1:CBS domain-containing protein >Feature sequence450 1416 898 gene locus_tag LOCUS_20630 1416 898 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469672.1 protein_id gnl|my_center|LOCUS_20630 <2666 1409 gene locus_tag LOCUS_20640 <2666 1409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030088.1:CBS domain-containing protein >Feature sequence451 577 404 gene locus_tag LOCUS_20650 577 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 795 622 gene locus_tag LOCUS_20660 795 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 <2652 1474 gene locus_tag LOCUS_20670 <2652 1474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037393367.1:GMC family oxidoreductase >Feature sequence452 1933 431 gene locus_tag LOCUS_20680 1933 431 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_20680 <2642 1930 gene locus_tag LOCUS_20690 <2642 1930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729267.1:long-chain fatty acid--CoA ligase >Feature sequence453 1447 263 gene locus_tag LOCUS_20700 1447 263 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_20700 <2639 1422 gene locus_tag LOCUS_20710 <2639 1422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_060384516.1:aldehyde dehydrogenase family protein >Feature sequence454 417 1769 gene locus_tag LOCUS_20720 417 1769 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727632.1 protein_id gnl|my_center|LOCUS_20720 1782 2309 gene locus_tag LOCUS_20730 1782 2309 CDS product TIGR04338 family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726754.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence455 <1 779 gene locus_tag LOCUS_20740 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027320.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme 797 1471 gene locus_tag LOCUS_20750 797 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence456 3 374 gene locus_tag LOCUS_20760 3 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 377 1141 gene locus_tag LOCUS_20770 gene hisF 377 1141 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466799.1 protein_id gnl|my_center|LOCUS_20770 1793 1149 gene locus_tag LOCUS_20780 1793 1149 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_20780 1838 2179 gene locus_tag LOCUS_20790 1838 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence457 <1 1101 gene locus_tag LOCUS_20800 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027810.1:glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit >Feature sequence458 999 826 gene locus_tag LOCUS_20810 999 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20810 1620 1051 gene locus_tag LOCUS_20820 1620 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 2581 1745 gene locus_tag LOCUS_20830 2581 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence459 <1 1231 gene locus_tag LOCUS_20840 <1 1231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027968.1:CTP synthase 1228 1905 gene locus_tag LOCUS_20850 1228 1905 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895191.1 protein_id gnl|my_center|LOCUS_20850 >Feature sequence460 <1 573 gene locus_tag LOCUS_20860 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029177.1:ABC transporter permease 570 1631 gene locus_tag LOCUS_20870 570 1631 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_20870 1638 2318 gene locus_tag LOCUS_20880 1638 2318 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223644.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence461 1998 1399 gene locus_tag LOCUS_20890 1998 1399 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_20890 2060 2134 gene locus_tag LOCUS_t00290 2060 2134 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence462 1249 452 gene locus_tag LOCUS_20900 gene trpA 1249 452 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075867.1 protein_id gnl|my_center|LOCUS_20900 2535 1246 gene locus_tag LOCUS_20910 gene trpB 2535 1246 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284348.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence463 1249 452 gene locus_tag LOCUS_20920 gene trpA 1249 452 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075867.1 protein_id gnl|my_center|LOCUS_20920 2535 1246 gene locus_tag LOCUS_20930 gene trpB 2535 1246 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284348.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence464 1986 1387 gene locus_tag LOCUS_20940 1986 1387 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 protein_id gnl|my_center|LOCUS_20940 2048 2122 gene locus_tag LOCUS_t00300 2048 2122 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence465 1309 458 gene locus_tag LOCUS_20950 1309 458 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312277.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence466 1129 275 gene locus_tag LOCUS_20960 gene panC 1129 275 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092170.1 protein_id gnl|my_center|LOCUS_20960 2067 1126 gene locus_tag LOCUS_20970 2067 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence467 1430 567 gene locus_tag LOCUS_20980 gene kynA 1430 567 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661957.1 protein_id gnl|my_center|LOCUS_20980 1550 2029 gene locus_tag LOCUS_20990 1550 2029 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222590.1 protein_id gnl|my_center|LOCUS_20990 <2540 2022 gene locus_tag LOCUS_21000 <2540 2022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975294.1:alpha/beta hydrolase >Feature sequence468 1871 1071 gene locus_tag LOCUS_21010 1871 1071 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225926.1 protein_id gnl|my_center|LOCUS_21010 2387 1890 gene locus_tag LOCUS_21020 2387 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence469 1876 332 gene locus_tag LOCUS_21030 1876 332 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527970.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence470 >Feature sequence471 373 537 gene locus_tag LOCUS_21040 373 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 1015 524 gene locus_tag LOCUS_21050 1015 524 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727465.1 protein_id gnl|my_center|LOCUS_21050 1151 1236 gene locus_tag LOCUS_t00310 1151 1236 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 <2517 1438 gene locus_tag LOCUS_21060 <2517 1438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899798.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence472 1089 475 gene locus_tag LOCUS_21070 1089 475 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975710.1 protein_id gnl|my_center|LOCUS_21070 <2517 1125 gene locus_tag LOCUS_21080 <2517 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_068204100.1:transcription-repair coupling factor >Feature sequence473 1089 475 gene locus_tag LOCUS_21090 1089 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 <2517 1125 gene locus_tag LOCUS_21100 <2517 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_068204100.1:transcription-repair coupling factor >Feature sequence474 >Feature sequence475 1046 291 gene locus_tag LOCUS_21110 gene atpB 1046 291 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908157.1 protein_id gnl|my_center|LOCUS_21110 1540 1052 gene locus_tag LOCUS_21120 1540 1052 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908156.1 protein_id gnl|my_center|LOCUS_21120 <2510 1647 gene locus_tag LOCUS_21130 <2510 1647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775946.1:MraY family glycosyltransferase >Feature sequence476 <1 1318 gene locus_tag LOCUS_21140 <1 1318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838678.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme 1793 1305 gene locus_tag LOCUS_21150 1793 1305 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058688.1 protein_id gnl|my_center|LOCUS_21150 <2507 1815 gene locus_tag LOCUS_21160 <2507 1815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976701.1:3-deoxy-7-phosphoheptulonate synthase class II