>Feature sequence001 <1 670 gene locus_tag LOCUS_00010 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460674.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPB 785 1093 gene locus_tag LOCUS_00020 785 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1110 1415 gene locus_tag LOCUS_00030 1110 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1766 4237 gene locus_tag LOCUS_00040 1766 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4234 5676 gene locus_tag LOCUS_00050 4234 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6696 5704 gene locus_tag LOCUS_00060 6696 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8513 6894 gene locus_tag LOCUS_00070 8513 6894 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108817.1 protein_id gnl|my_center|LOCUS_00070 10027 8501 gene locus_tag LOCUS_00080 10027 8501 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192488.1 protein_id gnl|my_center|LOCUS_00080 10180 11616 gene locus_tag LOCUS_00090 10180 11616 CDS product DUF4178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672758.1 protein_id gnl|my_center|LOCUS_00090 12585 11713 gene locus_tag LOCUS_00100 12585 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13476 12643 gene locus_tag LOCUS_00110 gene hslO 13476 12643 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881315.1 protein_id gnl|my_center|LOCUS_00110 13713 14819 gene locus_tag LOCUS_00120 13713 14819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16194 14869 gene locus_tag LOCUS_00130 16194 14869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16227 17291 gene locus_tag LOCUS_00140 gene pilM 16227 17291 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_00140 17288 17926 gene locus_tag LOCUS_00150 17288 17926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17926 18582 gene locus_tag LOCUS_00160 17926 18582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18579 19163 gene locus_tag LOCUS_00170 18579 19163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 19336 21591 gene locus_tag LOCUS_00180 19336 21591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21637 22920 gene locus_tag LOCUS_00190 21637 22920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 23031 23969 gene locus_tag LOCUS_00200 23031 23969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23966 24517 gene locus_tag LOCUS_00210 23966 24517 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_00210 24527 26161 gene locus_tag LOCUS_00220 24527 26161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 26236 27345 gene locus_tag LOCUS_00230 26236 27345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27623 29353 gene locus_tag LOCUS_00240 27623 29353 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051300116.1 protein_id gnl|my_center|LOCUS_00240 29396 30253 gene locus_tag LOCUS_00250 29396 30253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 30289 30531 gene locus_tag LOCUS_00260 30289 30531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 30639 31451 gene locus_tag LOCUS_00270 30639 31451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 31448 32743 gene locus_tag LOCUS_00280 gene fabF 31448 32743 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927158.1 protein_id gnl|my_center|LOCUS_00280 32877 35612 gene locus_tag LOCUS_00290 32877 35612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 35952 35764 gene locus_tag LOCUS_00300 35952 35764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 35858 36391 gene locus_tag LOCUS_00310 35858 36391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 37402 36458 gene locus_tag LOCUS_00320 37402 36458 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_00320 39030 37399 gene locus_tag LOCUS_00330 39030 37399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 39581 39057 gene locus_tag LOCUS_00340 39581 39057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 41268 39643 gene locus_tag LOCUS_00350 41268 39643 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_00350 <42272 41330 gene locus_tag LOCUS_00360 <42272 41330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939245.1:bifunctional diguanylate cyclase/phosphodiesterase >Feature sequence002 2226 2528 gene locus_tag LOCUS_00370 2226 2528 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_00370 2542 3750 gene locus_tag LOCUS_00380 2542 3750 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_00380 3747 4754 gene locus_tag LOCUS_00390 3747 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 4751 6274 gene locus_tag LOCUS_00400 4751 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 6271 7101 gene locus_tag LOCUS_00410 6271 7101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 7098 9227 gene locus_tag LOCUS_00420 7098 9227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 10995 9205 gene locus_tag LOCUS_00430 10995 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 11037 11813 gene locus_tag LOCUS_00440 11037 11813 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263846.1 protein_id gnl|my_center|LOCUS_00440 12132 13232 gene locus_tag LOCUS_00450 12132 13232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 13229 14920 gene locus_tag LOCUS_00460 13229 14920 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_00460 15736 14984 gene locus_tag LOCUS_00470 15736 14984 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_00470 16952 15846 gene locus_tag LOCUS_00480 gene ddlA 16952 15846 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053170.1 protein_id gnl|my_center|LOCUS_00480 17491 17114 gene locus_tag LOCUS_00490 17491 17114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 17745 17488 gene locus_tag LOCUS_00500 17745 17488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 18695 18321 gene locus_tag LOCUS_00510 18695 18321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 19389 18757 gene locus_tag LOCUS_00520 19389 18757 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809123.1 protein_id gnl|my_center|LOCUS_00520 20012 19386 gene locus_tag LOCUS_00530 20012 19386 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_00530 20707 20111 gene locus_tag LOCUS_00540 20707 20111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 20706 20954 gene locus_tag LOCUS_00550 20706 20954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 21717 20932 gene locus_tag LOCUS_00560 21717 20932 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814963.1 protein_id gnl|my_center|LOCUS_00560 22337 21726 gene locus_tag LOCUS_00570 22337 21726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00570 23213 22365 gene locus_tag LOCUS_00580 23213 22365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00580 24867 23245 gene locus_tag LOCUS_00590 24867 23245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 25064 26476 gene locus_tag LOCUS_00600 25064 26476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 26555 27121 gene locus_tag LOCUS_00610 26555 27121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 28306 27197 gene locus_tag LOCUS_00620 28306 27197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 28809 28303 gene locus_tag LOCUS_00630 28809 28303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 30110 28809 gene locus_tag LOCUS_00640 30110 28809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00640 31358 30216 gene locus_tag LOCUS_00650 31358 30216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142695.1 protein_id gnl|my_center|LOCUS_00650 32497 31460 gene locus_tag LOCUS_00660 32497 31460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 32605 34437 gene locus_tag LOCUS_00670 32605 34437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 34579 35751 gene locus_tag LOCUS_00680 34579 35751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 35935 36558 gene locus_tag LOCUS_00690 35935 36558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 38152 36575 gene locus_tag LOCUS_00700 38152 36575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 39537 38149 gene locus_tag LOCUS_00710 39537 38149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 >Feature sequence003 1566 226 gene locus_tag LOCUS_00720 1566 226 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_00720 3395 1584 gene locus_tag LOCUS_00730 3395 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 3420 4070 gene locus_tag LOCUS_00740 3420 4070 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258011.1 protein_id gnl|my_center|LOCUS_00740 5467 4082 gene locus_tag LOCUS_00750 5467 4082 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965170.1 protein_id gnl|my_center|LOCUS_00750 5595 6605 gene locus_tag LOCUS_00760 5595 6605 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_00760 7059 6571 gene locus_tag LOCUS_00770 gene coaD 7059 6571 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057007.1 protein_id gnl|my_center|LOCUS_00770 8426 7056 gene locus_tag LOCUS_00780 8426 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 9327 8476 gene locus_tag LOCUS_00790 9327 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 9420 10109 gene locus_tag LOCUS_00800 9420 10109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 10736 10428 gene locus_tag LOCUS_00810 10736 10428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 11053 11865 gene locus_tag LOCUS_00820 11053 11865 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_00820 11879 12805 gene locus_tag LOCUS_00830 11879 12805 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_00830 13203 13709 gene locus_tag LOCUS_00840 13203 13709 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_00840 14095 16377 gene locus_tag LOCUS_00850 14095 16377 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006742214.1 protein_id gnl|my_center|LOCUS_00850 16401 17354 gene locus_tag LOCUS_00860 16401 17354 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_00860 17364 18587 gene locus_tag LOCUS_00870 17364 18587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 20505 18568 gene locus_tag LOCUS_00880 20505 18568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 22106 20532 gene locus_tag LOCUS_00890 22106 20532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 22193 23698 gene locus_tag LOCUS_00900 22193 23698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 24097 23672 gene locus_tag LOCUS_00910 24097 23672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 25870 24164 gene locus_tag LOCUS_00920 25870 24164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 26324 25878 gene locus_tag LOCUS_00930 26324 25878 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143422.1 protein_id gnl|my_center|LOCUS_00930 27208 26327 gene locus_tag LOCUS_00940 27208 26327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 27984 27205 gene locus_tag LOCUS_00950 27984 27205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 29236 28103 gene locus_tag LOCUS_00960 29236 28103 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729107.1 protein_id gnl|my_center|LOCUS_00960 30783 29248 gene locus_tag LOCUS_00970 30783 29248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 31499 30780 gene locus_tag LOCUS_00980 31499 30780 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090304.1 protein_id gnl|my_center|LOCUS_00980 32365 31496 gene locus_tag LOCUS_00990 32365 31496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 32894 32439 gene locus_tag LOCUS_01000 32894 32439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 32973 34028 gene locus_tag LOCUS_01010 32973 34028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 34674 34156 gene locus_tag LOCUS_01020 34674 34156 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_01020 34844 35923 gene locus_tag LOCUS_01030 34844 35923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 >Feature sequence004 393 680 gene locus_tag LOCUS_01040 393 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 2398 647 gene locus_tag LOCUS_01050 2398 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 2310 2618 gene locus_tag LOCUS_01060 2310 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 2737 4185 gene locus_tag LOCUS_01070 gene ssnA 2737 4185 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706028.1 protein_id gnl|my_center|LOCUS_01070 7242 4273 gene locus_tag LOCUS_01080 7242 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 7367 8164 gene locus_tag LOCUS_01090 7367 8164 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480304.1 protein_id gnl|my_center|LOCUS_01090 8672 8265 gene locus_tag LOCUS_01100 8672 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 9216 10826 gene locus_tag LOCUS_01110 9216 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 12338 10878 gene locus_tag LOCUS_01120 12338 10878 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_01120 13715 12402 gene locus_tag LOCUS_01130 13715 12402 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_01130 13906 15444 gene locus_tag LOCUS_01140 13906 15444 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_01140 16293 15529 gene locus_tag LOCUS_01150 16293 15529 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099097343.1 protein_id gnl|my_center|LOCUS_01150 16664 19168 gene locus_tag LOCUS_01160 16664 19168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 19207 20028 gene locus_tag LOCUS_01170 19207 20028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 20156 21712 gene locus_tag LOCUS_01180 20156 21712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 22342 21728 gene locus_tag LOCUS_01190 22342 21728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 22550 24625 gene locus_tag LOCUS_01200 22550 24625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 26821 24641 gene locus_tag LOCUS_01210 26821 24641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 27577 26912 gene locus_tag LOCUS_01220 gene trmB 27577 26912 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057818.1 protein_id gnl|my_center|LOCUS_01220 28030 27584 gene locus_tag LOCUS_01230 28030 27584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 28449 28189 gene locus_tag LOCUS_01240 28449 28189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 28448 29956 gene locus_tag LOCUS_01250 28448 29956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 32230 30137 gene locus_tag LOCUS_01260 32230 30137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 32495 32869 gene locus_tag LOCUS_01270 32495 32869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 33884 32874 gene locus_tag LOCUS_01280 33884 32874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 >Feature sequence005 1783 119 gene locus_tag LOCUS_01290 1783 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 3061 1925 gene locus_tag LOCUS_01300 3061 1925 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258522.1 protein_id gnl|my_center|LOCUS_01300 3243 4568 gene locus_tag LOCUS_01310 3243 4568 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_01310 4640 6922 gene locus_tag LOCUS_01320 4640 6922 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_01320 6940 7410 gene locus_tag LOCUS_01330 6940 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 7407 8231 gene locus_tag LOCUS_01340 7407 8231 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839709.1 protein_id gnl|my_center|LOCUS_01340 9134 8379 gene locus_tag LOCUS_01350 9134 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 9571 10344 gene locus_tag LOCUS_01360 9571 10344 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044922.1 protein_id gnl|my_center|LOCUS_01360 10341 11033 gene locus_tag LOCUS_01370 10341 11033 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944032.1 protein_id gnl|my_center|LOCUS_01370 12330 11008 gene locus_tag LOCUS_01380 12330 11008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 13749 12457 gene locus_tag LOCUS_01390 13749 12457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 13852 13992 gene locus_tag LOCUS_01400 13852 13992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 15005 14232 gene locus_tag LOCUS_01410 15005 14232 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226033.1 protein_id gnl|my_center|LOCUS_01410 15235 16284 gene locus_tag LOCUS_01420 15235 16284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 16281 16958 gene locus_tag LOCUS_01430 gene tsaB 16281 16958 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968552.1 protein_id gnl|my_center|LOCUS_01430 18201 16975 gene locus_tag LOCUS_01440 18201 16975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 18349 19680 gene locus_tag LOCUS_01450 18349 19680 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114272.1 protein_id gnl|my_center|LOCUS_01450 19733 21166 gene locus_tag LOCUS_01460 19733 21166 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222691.1 protein_id gnl|my_center|LOCUS_01460 21193 22809 gene locus_tag LOCUS_01470 21193 22809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 22806 24029 gene locus_tag LOCUS_01480 22806 24029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 24107 24625 gene locus_tag LOCUS_01490 24107 24625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 24622 25107 gene locus_tag LOCUS_01500 24622 25107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 26228 25206 gene locus_tag LOCUS_01510 26228 25206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 27132 26272 gene locus_tag LOCUS_01520 27132 26272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 28229 27219 gene locus_tag LOCUS_01530 28229 27219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 28972 28226 gene locus_tag LOCUS_01540 gene sigR 28972 28226 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_01540 29693 29040 gene locus_tag LOCUS_01550 29693 29040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 29784 30563 gene locus_tag LOCUS_01560 29784 30563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 30629 32701 gene locus_tag LOCUS_01570 30629 32701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 33834 32680 gene locus_tag LOCUS_01580 33834 32680 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257104.1 protein_id gnl|my_center|LOCUS_01580 >Feature sequence006 <1 535 gene locus_tag LOCUS_01590 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888563.1:glycerol kinase GlpK 741 1619 gene locus_tag LOCUS_01600 741 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 3900 1846 gene locus_tag LOCUS_01610 3900 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 4666 3947 gene locus_tag LOCUS_01620 4666 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 5475 4708 gene locus_tag LOCUS_01630 5475 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 5716 7146 gene locus_tag LOCUS_01640 5716 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 7323 8459 gene locus_tag LOCUS_01650 7323 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 8660 9769 gene locus_tag LOCUS_01660 gene apbC 8660 9769 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448044.1 protein_id gnl|my_center|LOCUS_01660 9827 11737 gene locus_tag LOCUS_01670 9827 11737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 11734 12378 gene locus_tag LOCUS_01680 11734 12378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 12387 12581 gene locus_tag LOCUS_01690 12387 12581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 12595 12912 gene locus_tag LOCUS_01700 12595 12912 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937799.1 protein_id gnl|my_center|LOCUS_01700 13225 12905 gene locus_tag LOCUS_01710 13225 12905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 13113 14063 gene locus_tag LOCUS_01720 13113 14063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 14131 14979 gene locus_tag LOCUS_01730 14131 14979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 14976 15665 gene locus_tag LOCUS_01740 14976 15665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 15662 16222 gene locus_tag LOCUS_01750 15662 16222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 16347 17012 gene locus_tag LOCUS_01760 16347 17012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 17151 18026 gene locus_tag LOCUS_01770 17151 18026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 18028 18918 gene locus_tag LOCUS_01780 18028 18918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 18951 19661 gene locus_tag LOCUS_01790 18951 19661 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038010.1 protein_id gnl|my_center|LOCUS_01790 20802 19702 gene locus_tag LOCUS_01800 20802 19702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 20900 22312 gene locus_tag LOCUS_01810 20900 22312 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941686.1 protein_id gnl|my_center|LOCUS_01810 22418 22687 gene locus_tag LOCUS_01820 22418 22687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 23846 22725 gene locus_tag LOCUS_01830 gene bioF 23846 22725 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_01830 24391 23843 gene locus_tag LOCUS_01840 24391 23843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 24530 25099 gene locus_tag LOCUS_01850 24530 25099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 25850 25107 gene locus_tag LOCUS_01860 25850 25107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 26442 25909 gene locus_tag LOCUS_01870 26442 25909 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942669.1 protein_id gnl|my_center|LOCUS_01870 29648 26502 gene locus_tag LOCUS_01880 29648 26502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 31357 29660 gene locus_tag LOCUS_01890 gene ubiB 31357 29660 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 protein_id gnl|my_center|LOCUS_01890 32789 31422 gene locus_tag LOCUS_01900 32789 31422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 33523 32786 gene locus_tag LOCUS_01910 33523 32786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 >Feature sequence007 <1 799 gene locus_tag LOCUS_01920 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940695.1:transcription-repair coupling factor 1893 895 gene locus_tag LOCUS_01930 1893 895 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_01930 2048 2908 gene locus_tag LOCUS_01940 2048 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 3006 3554 gene locus_tag LOCUS_01950 3006 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 3582 4874 gene locus_tag LOCUS_01960 3582 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 4871 5800 gene locus_tag LOCUS_01970 4871 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 6955 5816 gene locus_tag LOCUS_01980 gene nuoD 6955 5816 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_01980 7523 6957 gene locus_tag LOCUS_01990 7523 6957 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932450.1 protein_id gnl|my_center|LOCUS_01990 8201 7623 gene locus_tag LOCUS_02000 8201 7623 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719665.1 protein_id gnl|my_center|LOCUS_02000 8796 8302 gene locus_tag LOCUS_02010 8796 8302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 8938 10410 gene locus_tag LOCUS_02020 8938 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 10594 11484 gene locus_tag LOCUS_02030 10594 11484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 11481 12332 gene locus_tag LOCUS_02040 11481 12332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 13231 12410 gene locus_tag LOCUS_02050 gene thiD 13231 12410 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388857.1 protein_id gnl|my_center|LOCUS_02050 14445 13228 gene locus_tag LOCUS_02060 14445 13228 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 protein_id gnl|my_center|LOCUS_02060 14594 15808 gene locus_tag LOCUS_02070 14594 15808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 15827 17269 gene locus_tag LOCUS_02080 gene glgA 15827 17269 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697284.1 protein_id gnl|my_center|LOCUS_02080 17386 18615 gene locus_tag LOCUS_02090 17386 18615 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_02090 18692 19972 gene locus_tag LOCUS_02100 18692 19972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 19969 21105 gene locus_tag LOCUS_02110 19969 21105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 21140 22375 gene locus_tag LOCUS_02120 21140 22375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_02120 22428 23168 gene locus_tag LOCUS_02130 22428 23168 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_02130 24578 23313 gene locus_tag LOCUS_02140 24578 23313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 25577 24696 gene locus_tag LOCUS_02150 25577 24696 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895122.1 protein_id gnl|my_center|LOCUS_02150 25607 25876 gene locus_tag LOCUS_02160 25607 25876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 26539 25892 gene locus_tag LOCUS_02170 26539 25892 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224350.1 protein_id gnl|my_center|LOCUS_02170 26453 26737 gene locus_tag LOCUS_02180 26453 26737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 27253 26843 gene locus_tag LOCUS_02190 27253 26843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 27325 28950 gene locus_tag LOCUS_02200 27325 28950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02200 <29797 28922 gene locus_tag LOCUS_02210 <29797 28922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922281.1:methionine synthase >Feature sequence008 961 2637 gene locus_tag LOCUS_02220 961 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 2634 3218 gene locus_tag LOCUS_02230 2634 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 3866 3222 gene locus_tag LOCUS_02240 3866 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 4504 3863 gene locus_tag LOCUS_02250 4504 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 6630 4504 gene locus_tag LOCUS_02260 6630 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 6958 6722 gene locus_tag LOCUS_02270 6958 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 7683 7201 gene locus_tag LOCUS_02280 7683 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 7933 8505 gene locus_tag LOCUS_02290 7933 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 9800 8562 gene locus_tag LOCUS_02300 9800 8562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 9921 11090 gene locus_tag LOCUS_02310 9921 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 11178 11543 gene locus_tag LOCUS_02320 11178 11543 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_02320 11540 12094 gene locus_tag LOCUS_02330 11540 12094 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524416.1 protein_id gnl|my_center|LOCUS_02330 12124 12774 gene locus_tag LOCUS_02340 12124 12774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 12776 13990 gene locus_tag LOCUS_02350 12776 13990 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990075.1 protein_id gnl|my_center|LOCUS_02350 14008 15594 gene locus_tag LOCUS_02360 14008 15594 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_02360 15591 17402 gene locus_tag LOCUS_02370 15591 17402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 17512 18135 gene locus_tag LOCUS_02380 17512 18135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 18159 19340 gene locus_tag LOCUS_02390 18159 19340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 20215 19460 gene locus_tag LOCUS_02400 20215 19460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 20820 20212 gene locus_tag LOCUS_02410 20820 20212 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_02410 20970 21416 gene locus_tag LOCUS_02420 20970 21416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 22455 21436 gene locus_tag LOCUS_02430 22455 21436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 23354 22932 gene locus_tag LOCUS_02440 23354 22932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 23253 23900 gene locus_tag LOCUS_02450 23253 23900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 24032 25408 gene locus_tag LOCUS_02460 gene fliD 24032 25408 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943664.1 protein_id gnl|my_center|LOCUS_02460 25459 25878 gene locus_tag LOCUS_02470 25459 25878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 25942 26373 gene locus_tag LOCUS_02480 25942 26373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 27179 26442 gene locus_tag LOCUS_02490 gene flgF 27179 26442 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_02490 27981 27286 gene locus_tag LOCUS_02500 27981 27286 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705288.1 protein_id gnl|my_center|LOCUS_02500 >Feature sequence009 1732 836 gene locus_tag LOCUS_02510 1732 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 1974 1729 gene locus_tag LOCUS_02520 1974 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 2462 1971 gene locus_tag LOCUS_02530 2462 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 3131 2466 gene locus_tag LOCUS_02540 3131 2466 CDS product heme-copper oxidase subunit III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394318.1 protein_id gnl|my_center|LOCUS_02540 3986 3309 gene locus_tag LOCUS_02550 3986 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 5014 4034 gene locus_tag LOCUS_02560 5014 4034 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083991.1 protein_id gnl|my_center|LOCUS_02560 6189 5356 gene locus_tag LOCUS_02570 6189 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 7509 6370 gene locus_tag LOCUS_02580 7509 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 9545 7590 gene locus_tag LOCUS_02590 gene ligA 9545 7590 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679195.1 protein_id gnl|my_center|LOCUS_02590 9742 10209 gene locus_tag LOCUS_02600 9742 10209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 11109 10309 gene locus_tag LOCUS_02610 11109 10309 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142937.1 protein_id gnl|my_center|LOCUS_02610 11311 12906 gene locus_tag LOCUS_02620 11311 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 13424 13693 gene locus_tag LOCUS_02630 13424 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 13810 14436 gene locus_tag LOCUS_02640 13810 14436 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_02640 18803 14448 gene locus_tag LOCUS_02650 18803 14448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 19507 18800 gene locus_tag LOCUS_02660 19507 18800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 20019 21035 gene locus_tag LOCUS_02670 20019 21035 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932879.1 protein_id gnl|my_center|LOCUS_02670 22795 21053 gene locus_tag LOCUS_02680 22795 21053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 22955 23869 gene locus_tag LOCUS_02690 22955 23869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 <25527 23950 gene locus_tag LOCUS_02700 <25527 23950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330711.1:DNA topoisomerase IV subunit B >Feature sequence010 139 468 gene locus_tag LOCUS_02710 139 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 608 535 gene locus_tag LOCUS_t00010 608 535 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 855 1460 gene locus_tag LOCUS_02720 855 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 1633 4221 gene locus_tag LOCUS_02730 1633 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 4398 5630 gene locus_tag LOCUS_02740 4398 5630 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230598.1 protein_id gnl|my_center|LOCUS_02740 6197 5664 gene locus_tag LOCUS_02750 6197 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 6430 7146 gene locus_tag LOCUS_02760 6430 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 7143 7766 gene locus_tag LOCUS_02770 7143 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 7997 7851 gene locus_tag LOCUS_02780 7997 7851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 10044 8080 gene locus_tag LOCUS_02790 10044 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 13852 10208 gene locus_tag LOCUS_02800 13852 10208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 14060 14677 gene locus_tag LOCUS_02810 14060 14677 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930580.1 protein_id gnl|my_center|LOCUS_02810 15883 14780 gene locus_tag LOCUS_02820 15883 14780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 16634 15897 gene locus_tag LOCUS_02830 16634 15897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 17863 16631 gene locus_tag LOCUS_02840 gene glgC 17863 16631 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227648.1 protein_id gnl|my_center|LOCUS_02840 18117 19127 gene locus_tag LOCUS_02850 18117 19127 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095359.1 protein_id gnl|my_center|LOCUS_02850 20035 19283 gene locus_tag LOCUS_02860 20035 19283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 21862 20099 gene locus_tag LOCUS_02870 21862 20099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 22506 21859 gene locus_tag LOCUS_02880 22506 21859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 22563 24845 gene locus_tag LOCUS_02890 22563 24845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 >Feature sequence011 1225 668 gene locus_tag LOCUS_02900 1225 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 4773 1306 gene locus_tag LOCUS_02910 4773 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 4899 5711 gene locus_tag LOCUS_02920 4899 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 5836 6549 gene locus_tag LOCUS_02930 5836 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 6704 8185 gene locus_tag LOCUS_02940 6704 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 8242 12447 gene locus_tag LOCUS_02950 8242 12447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 12525 13241 gene locus_tag LOCUS_02960 12525 13241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 13309 14232 gene locus_tag LOCUS_02970 13309 14232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 14297 14758 gene locus_tag LOCUS_02980 14297 14758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 15855 14839 gene locus_tag LOCUS_02990 15855 14839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 16845 15895 gene locus_tag LOCUS_03000 16845 15895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 16982 18547 gene locus_tag LOCUS_03010 16982 18547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 21174 18544 gene locus_tag LOCUS_03020 gene xdh 21174 18544 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393495.1 protein_id gnl|my_center|LOCUS_03020 21279 23258 gene locus_tag LOCUS_03030 21279 23258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 >Feature sequence012 245 964 gene locus_tag LOCUS_03040 245 964 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063755.1 protein_id gnl|my_center|LOCUS_03040 964 1986 gene locus_tag LOCUS_03050 964 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 2295 2056 gene locus_tag LOCUS_03060 2295 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 2498 4489 gene locus_tag LOCUS_03070 2498 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 4511 6586 gene locus_tag LOCUS_03080 4511 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 6878 7762 gene locus_tag LOCUS_03090 6878 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 8650 8066 gene locus_tag LOCUS_03100 8650 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 10589 8805 gene locus_tag LOCUS_03110 10589 8805 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122985.1 protein_id gnl|my_center|LOCUS_03110 10685 11191 gene locus_tag LOCUS_03120 10685 11191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 11195 12496 gene locus_tag LOCUS_03130 11195 12496 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878430.1 protein_id gnl|my_center|LOCUS_03130 12932 13234 gene locus_tag LOCUS_03140 12932 13234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 14225 13341 gene locus_tag LOCUS_03150 14225 13341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 16999 14324 gene locus_tag LOCUS_03160 gene cphA 16999 14324 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021315.1 protein_id gnl|my_center|LOCUS_03160 17949 16996 gene locus_tag LOCUS_03170 17949 16996 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016692.1 protein_id gnl|my_center|LOCUS_03170 18278 18111 gene locus_tag LOCUS_03180 18278 18111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 18346 19545 gene locus_tag LOCUS_03190 gene rlmI 18346 19545 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097247.1 protein_id gnl|my_center|LOCUS_03190 19567 20295 gene locus_tag LOCUS_03200 19567 20295 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021972.1 protein_id gnl|my_center|LOCUS_03200 20495 20226 gene locus_tag LOCUS_03210 20495 20226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 20395 21186 gene locus_tag LOCUS_03220 20395 21186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 21364 21173 gene locus_tag LOCUS_03230 21364 21173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 21427 22026 gene locus_tag LOCUS_03240 21427 22026 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400645.1 protein_id gnl|my_center|LOCUS_03240 23437 22016 gene locus_tag LOCUS_03250 23437 22016 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015008116.1 protein_id gnl|my_center|LOCUS_03250 >Feature sequence013 2138 1260 gene locus_tag LOCUS_03260 2138 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 2023 2250 gene locus_tag LOCUS_03270 2023 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 2283 2747 gene locus_tag LOCUS_03280 2283 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 2778 3740 gene locus_tag LOCUS_03290 2778 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 3889 4203 gene locus_tag LOCUS_03300 3889 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 4205 4543 gene locus_tag LOCUS_03310 4205 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 5764 4628 gene locus_tag LOCUS_03320 5764 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919038.1 protein_id gnl|my_center|LOCUS_03320 5846 7870 gene locus_tag LOCUS_03330 5846 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 7935 9023 gene locus_tag LOCUS_03340 gene dnaJ 7935 9023 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004170.1 protein_id gnl|my_center|LOCUS_03340 10357 9170 gene locus_tag LOCUS_03350 10357 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 11186 10452 gene locus_tag LOCUS_03360 11186 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 11125 11289 gene locus_tag LOCUS_03370 11125 11289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 13050 11719 gene locus_tag LOCUS_03380 13050 11719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 13584 13117 gene locus_tag LOCUS_03390 13584 13117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 13734 14264 gene locus_tag LOCUS_03400 13734 14264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 14334 14954 gene locus_tag LOCUS_03410 gene ruvA 14334 14954 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_03410 14993 15958 gene locus_tag LOCUS_03420 14993 15958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 15955 16365 gene locus_tag LOCUS_03430 15955 16365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 16367 17185 gene locus_tag LOCUS_03440 16367 17185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 18421 17219 gene locus_tag LOCUS_03450 18421 17219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 19555 18518 gene locus_tag LOCUS_03460 19555 18518 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817862.1 protein_id gnl|my_center|LOCUS_03460 20397 19633 gene locus_tag LOCUS_03470 20397 19633 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_03470 21058 20420 gene locus_tag LOCUS_03480 21058 20420 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880979.1 protein_id gnl|my_center|LOCUS_03480 21097 22836 gene locus_tag LOCUS_03490 21097 22836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 >Feature sequence014 2336 777 gene locus_tag LOCUS_03500 2336 777 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108522916.1 protein_id gnl|my_center|LOCUS_03500 2866 2333 gene locus_tag LOCUS_03510 2866 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 3645 2863 gene locus_tag LOCUS_03520 3645 2863 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775986.1 protein_id gnl|my_center|LOCUS_03520 5899 3830 gene locus_tag LOCUS_03530 5899 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 7633 6119 gene locus_tag LOCUS_03540 7633 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 8088 7636 gene locus_tag LOCUS_03550 8088 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 8853 8173 gene locus_tag LOCUS_03560 gene pgsA 8853 8173 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_03560 10817 9021 gene locus_tag LOCUS_03570 gene ggt 10817 9021 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814321.1 protein_id gnl|my_center|LOCUS_03570 11021 10827 gene locus_tag LOCUS_03580 11021 10827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 11467 11018 gene locus_tag LOCUS_03590 11467 11018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 11609 12568 gene locus_tag LOCUS_03600 gene gshB 11609 12568 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056752.1 protein_id gnl|my_center|LOCUS_03600 12695 12961 gene locus_tag LOCUS_03610 12695 12961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 14044 12965 gene locus_tag LOCUS_03620 14044 12965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 14567 14070 gene locus_tag LOCUS_03630 14567 14070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 16322 14577 gene locus_tag LOCUS_03640 16322 14577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 16603 18264 gene locus_tag LOCUS_03650 16603 18264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 18630 18343 gene locus_tag LOCUS_03660 18630 18343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 18741 20447 gene locus_tag LOCUS_03670 18741 20447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 21129 20533 gene locus_tag LOCUS_03680 21129 20533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 21745 21242 gene locus_tag LOCUS_03690 21745 21242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 <22381 21738 gene locus_tag LOCUS_03700 <22381 21738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942684.1:sigma-54 dependent transcriptional regulator >Feature sequence015 1559 111 gene locus_tag LOCUS_03710 1559 111 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928419.1 protein_id gnl|my_center|LOCUS_03710 1737 2786 gene locus_tag LOCUS_03720 1737 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 3418 2897 gene locus_tag LOCUS_03730 3418 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 4428 3421 gene locus_tag LOCUS_03740 4428 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 4747 6555 gene locus_tag LOCUS_03750 4747 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 7739 6573 gene locus_tag LOCUS_03760 7739 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 8313 7726 gene locus_tag LOCUS_03770 8313 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 10455 8548 gene locus_tag LOCUS_03780 10455 8548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 12072 10729 gene locus_tag LOCUS_03790 12072 10729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 13331 12069 gene locus_tag LOCUS_03800 13331 12069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 15445 13328 gene locus_tag LOCUS_03810 15445 13328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 15629 16879 gene locus_tag LOCUS_03820 15629 16879 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_03820 16954 18621 gene locus_tag LOCUS_03830 16954 18621 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230392.1 protein_id gnl|my_center|LOCUS_03830 18618 19685 gene locus_tag LOCUS_03840 18618 19685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 19821 20804 gene locus_tag LOCUS_03850 19821 20804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 >Feature sequence016 1429 542 gene locus_tag LOCUS_03860 1429 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 3054 1651 gene locus_tag LOCUS_03870 3054 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 4460 3051 gene locus_tag LOCUS_03880 4460 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 5437 4457 gene locus_tag LOCUS_03890 5437 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 5988 5434 gene locus_tag LOCUS_03900 5988 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 7265 5985 gene locus_tag LOCUS_03910 7265 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 9193 7265 gene locus_tag LOCUS_03920 9193 7265 CDS product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114027.1 protein_id gnl|my_center|LOCUS_03920 9444 9190 gene locus_tag LOCUS_03930 9444 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 9723 9547 gene locus_tag LOCUS_03940 9723 9547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 10127 9909 gene locus_tag LOCUS_03950 10127 9909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 10015 11412 gene locus_tag LOCUS_03960 10015 11412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 11799 11431 gene locus_tag LOCUS_03970 11799 11431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 12488 11796 gene locus_tag LOCUS_03980 12488 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 13229 12543 gene locus_tag LOCUS_03990 13229 12543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 15388 13304 gene locus_tag LOCUS_04000 15388 13304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 15457 16350 gene locus_tag LOCUS_04010 15457 16350 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_04010 16462 16989 gene locus_tag LOCUS_04020 16462 16989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 17111 17986 gene locus_tag LOCUS_04030 17111 17986 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324308.1 protein_id gnl|my_center|LOCUS_04030 18247 18005 gene locus_tag LOCUS_04040 18247 18005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 18966 18265 gene locus_tag LOCUS_04050 18966 18265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 18980 19150 gene locus_tag LOCUS_04060 18980 19150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 <21260 19131 gene locus_tag LOCUS_04070 <21260 19131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:CRTAC1 family protein >Feature sequence017 4882 2057 gene locus_tag LOCUS_04080 4882 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 6450 4891 gene locus_tag LOCUS_04090 6450 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 6850 6668 gene locus_tag LOCUS_04100 6850 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 7024 8355 gene locus_tag LOCUS_04110 7024 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 8442 8786 gene locus_tag LOCUS_04120 8442 8786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04120 8832 9410 gene locus_tag LOCUS_04130 8832 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04130 9441 11123 gene locus_tag LOCUS_04140 9441 11123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 11083 11919 gene locus_tag LOCUS_04150 gene rsmA 11083 11919 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942509.1 protein_id gnl|my_center|LOCUS_04150 13095 11935 gene locus_tag LOCUS_04160 13095 11935 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147298.1 protein_id gnl|my_center|LOCUS_04160 13079 13327 gene locus_tag LOCUS_04170 13079 13327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 13500 16061 gene locus_tag LOCUS_04180 13500 16061 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941349.1 protein_id gnl|my_center|LOCUS_04180 17209 16043 gene locus_tag LOCUS_04190 17209 16043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 19063 17240 gene locus_tag LOCUS_04200 19063 17240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 19325 19684 gene locus_tag LOCUS_04210 19325 19684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 19719 20195 gene locus_tag LOCUS_04220 19719 20195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 >Feature sequence018 1927 1097 gene locus_tag LOCUS_04230 1927 1097 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_04230 2368 1979 gene locus_tag LOCUS_04240 2368 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 2523 3560 gene locus_tag LOCUS_04250 2523 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3663 5024 gene locus_tag LOCUS_04260 3663 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 5803 5153 gene locus_tag LOCUS_04270 5803 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 6151 8979 gene locus_tag LOCUS_04280 6151 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 9081 10106 gene locus_tag LOCUS_04290 9081 10106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 10236 10141 gene locus_tag LOCUS_t00020 10236 10141 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 10296 12185 gene locus_tag LOCUS_04300 gene selB 10296 12185 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_04300 12234 13583 gene locus_tag LOCUS_04310 12234 13583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 14331 13669 gene locus_tag LOCUS_04320 14331 13669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 14529 15065 gene locus_tag LOCUS_04330 14529 15065 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 protein_id gnl|my_center|LOCUS_04330 15163 17091 gene locus_tag LOCUS_04340 15163 17091 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156206934.1 protein_id gnl|my_center|LOCUS_04340 20048 17112 gene locus_tag LOCUS_04350 20048 17112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 >Feature sequence019 681 448 gene locus_tag LOCUS_04360 681 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 896 1711 gene locus_tag LOCUS_04370 896 1711 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 protein_id gnl|my_center|LOCUS_04370 1927 4119 gene locus_tag LOCUS_04380 1927 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 4658 4308 gene locus_tag LOCUS_04390 4658 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 5574 4786 gene locus_tag LOCUS_04400 5574 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 6150 5725 gene locus_tag LOCUS_04410 6150 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 6583 6137 gene locus_tag LOCUS_04420 6583 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 7320 6655 gene locus_tag LOCUS_04430 7320 6655 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_04430 8075 7317 gene locus_tag LOCUS_04440 gene rph 8075 7317 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811149.1 protein_id gnl|my_center|LOCUS_04440 9160 8117 gene locus_tag LOCUS_04450 gene bcd 9160 8117 CDS product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 protein_id gnl|my_center|LOCUS_04450 10197 9244 gene locus_tag LOCUS_04460 10197 9244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 11457 10321 gene locus_tag LOCUS_04470 gene rseP 11457 10321 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810655.1 protein_id gnl|my_center|LOCUS_04470 12218 11580 gene locus_tag LOCUS_04480 12218 11580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 12359 13423 gene locus_tag LOCUS_04490 12359 13423 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118564.1 protein_id gnl|my_center|LOCUS_04490 14455 13457 gene locus_tag LOCUS_04500 14455 13457 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549977.1 protein_id gnl|my_center|LOCUS_04500 14627 16453 gene locus_tag LOCUS_04510 14627 16453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 16507 18432 gene locus_tag LOCUS_04520 16507 18432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 18440 19618 gene locus_tag LOCUS_04530 18440 19618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 >Feature sequence020 140 661 gene locus_tag LOCUS_04540 140 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 791 2269 gene locus_tag LOCUS_04550 791 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 2488 3069 gene locus_tag LOCUS_04560 2488 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 3170 4516 gene locus_tag LOCUS_04570 3170 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 4528 5154 gene locus_tag LOCUS_04580 4528 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 6337 5216 gene locus_tag LOCUS_04590 6337 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 6324 6950 gene locus_tag LOCUS_04600 6324 6950 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 protein_id gnl|my_center|LOCUS_04600 8526 7183 gene locus_tag LOCUS_04610 8526 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 9598 8585 gene locus_tag LOCUS_04620 9598 8585 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235433858.1 protein_id gnl|my_center|LOCUS_04620 9780 11003 gene locus_tag LOCUS_04630 9780 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 11760 11041 gene locus_tag LOCUS_04640 11760 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 12058 11977 gene locus_tag LOCUS_t00030 12058 11977 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13282 12095 gene locus_tag LOCUS_04650 13282 12095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 15121 13406 gene locus_tag LOCUS_04660 15121 13406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 15744 15136 gene locus_tag LOCUS_04670 15744 15136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 18538 15881 gene locus_tag LOCUS_04680 18538 15881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 18428 18685 gene locus_tag LOCUS_04690 18428 18685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 <19724 18731 gene locus_tag LOCUS_04700 <19724 18731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390371.1:S49 family peptidase >Feature sequence021 886 380 gene locus_tag LOCUS_04710 gene purE 886 380 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941273.1 protein_id gnl|my_center|LOCUS_04710 2313 898 gene locus_tag LOCUS_04720 gene purD 2313 898 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035746.1 protein_id gnl|my_center|LOCUS_04720 3870 2458 gene locus_tag LOCUS_04730 3870 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 4583 3912 gene locus_tag LOCUS_04740 4583 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 4486 5370 gene locus_tag LOCUS_04750 4486 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 5364 6332 gene locus_tag LOCUS_04760 5364 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 7206 6763 gene locus_tag LOCUS_04770 7206 6763 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988493.1 protein_id gnl|my_center|LOCUS_04770 9307 7331 gene locus_tag LOCUS_04780 9307 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 15167 9822 gene locus_tag LOCUS_04790 15167 9822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 15310 16128 gene locus_tag LOCUS_04800 15310 16128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 19053 16321 gene locus_tag LOCUS_04810 19053 16321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 >Feature sequence022 1684 536 gene locus_tag LOCUS_04820 1684 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 2044 1763 gene locus_tag LOCUS_04830 2044 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 3085 2120 gene locus_tag LOCUS_04840 3085 2120 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_04840 3897 3151 gene locus_tag LOCUS_04850 3897 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 4973 3924 gene locus_tag LOCUS_04860 4973 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 6403 4982 gene locus_tag LOCUS_04870 6403 4982 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_04870 6658 7314 gene locus_tag LOCUS_04880 6658 7314 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_04880 7398 8666 gene locus_tag LOCUS_04890 7398 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 8813 9403 gene locus_tag LOCUS_04900 8813 9403 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417984.1 protein_id gnl|my_center|LOCUS_04900 9461 10132 gene locus_tag LOCUS_04910 9461 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 11335 10193 gene locus_tag LOCUS_04920 gene pgsW 11335 10193 CDS product poly-gamma-glutamate system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118209.1 protein_id gnl|my_center|LOCUS_04920 11772 11332 gene locus_tag LOCUS_04930 gene pgsC 11772 11332 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016687.1 protein_id gnl|my_center|LOCUS_04930 12969 11776 gene locus_tag LOCUS_04940 gene pgsB 12969 11776 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118210.1 protein_id gnl|my_center|LOCUS_04940 13282 13055 gene locus_tag LOCUS_04950 13282 13055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 13748 14017 gene locus_tag LOCUS_04960 13748 14017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 14291 15331 gene locus_tag LOCUS_04970 14291 15331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 15952 15377 gene locus_tag LOCUS_04980 15952 15377 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_04980 17083 16124 gene locus_tag LOCUS_04990 17083 16124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 <19234 17293 gene locus_tag LOCUS_05000 <19234 17293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941209.1:DNA polymerase I >Feature sequence023 740 2131 gene locus_tag LOCUS_05010 gene lat 740 2131 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893146.1 protein_id gnl|my_center|LOCUS_05010 2131 3093 gene locus_tag LOCUS_05020 2131 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3207 4637 gene locus_tag LOCUS_05030 gene lat 3207 4637 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893146.1 protein_id gnl|my_center|LOCUS_05030 4643 5566 gene locus_tag LOCUS_05040 4643 5566 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_05040 6066 5563 gene locus_tag LOCUS_05050 6066 5563 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980181.1 protein_id gnl|my_center|LOCUS_05050 7517 6132 gene locus_tag LOCUS_05060 7517 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 8299 7529 gene locus_tag LOCUS_05070 8299 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 9494 8319 gene locus_tag LOCUS_05080 9494 8319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 10687 9491 gene locus_tag LOCUS_05090 10687 9491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 11063 11317 gene locus_tag LOCUS_05100 11063 11317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 12023 11406 gene locus_tag LOCUS_05110 12023 11406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 12088 12693 gene locus_tag LOCUS_05120 12088 12693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 12715 13005 gene locus_tag LOCUS_05130 12715 13005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 13185 17885 gene locus_tag LOCUS_05140 13185 17885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence024 1839 691 gene locus_tag LOCUS_05150 1839 691 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973070.1 protein_id gnl|my_center|LOCUS_05150 1968 3590 gene locus_tag LOCUS_05160 1968 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 3731 4576 gene locus_tag LOCUS_05170 3731 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 5815 4628 gene locus_tag LOCUS_05180 5815 4628 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812582.1 protein_id gnl|my_center|LOCUS_05180 6873 5836 gene locus_tag LOCUS_05190 6873 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 7645 6956 gene locus_tag LOCUS_05200 gene aat 7645 6956 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_05200 8068 7820 gene locus_tag LOCUS_05210 8068 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 7968 8168 gene locus_tag LOCUS_05220 7968 8168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 8184 8600 gene locus_tag LOCUS_05230 8184 8600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05230 11124 8578 gene locus_tag LOCUS_05240 11124 8578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 12688 11144 gene locus_tag LOCUS_05250 12688 11144 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566963.1 protein_id gnl|my_center|LOCUS_05250 13984 12845 gene locus_tag LOCUS_05260 13984 12845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 14981 14079 gene locus_tag LOCUS_05270 14981 14079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 15192 15671 gene locus_tag LOCUS_05280 15192 15671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 16358 16432 gene locus_tag LOCUS_t00040 16358 16432 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16728 16474 gene locus_tag LOCUS_05290 16728 16474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 16894 17673 gene locus_tag LOCUS_05300 16894 17673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 18024 17815 gene locus_tag LOCUS_05310 18024 17815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 17983 18438 gene locus_tag LOCUS_05320 gene tadA 17983 18438 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence025 760 92 gene locus_tag LOCUS_05330 760 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 940 1839 gene locus_tag LOCUS_05340 940 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 2554 1901 gene locus_tag LOCUS_05350 2554 1901 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776270.1 protein_id gnl|my_center|LOCUS_05350 2764 3924 gene locus_tag LOCUS_05360 2764 3924 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_05360 4010 4582 gene locus_tag LOCUS_05370 4010 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 4587 6809 gene locus_tag LOCUS_05380 4587 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 6888 7820 gene locus_tag LOCUS_05390 6888 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 7817 8497 gene locus_tag LOCUS_05400 7817 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 8553 9410 gene locus_tag LOCUS_05410 8553 9410 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255957.1 protein_id gnl|my_center|LOCUS_05410 9506 9811 gene locus_tag LOCUS_05420 9506 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 9808 11616 gene locus_tag LOCUS_05430 9808 11616 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051300116.1 protein_id gnl|my_center|LOCUS_05430 15504 11653 gene locus_tag LOCUS_05440 15504 11653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 15586 17127 gene locus_tag LOCUS_05450 15586 17127 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_05450 17286 17645 gene locus_tag LOCUS_05460 17286 17645 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_05460 17687 18094 gene locus_tag LOCUS_05470 17687 18094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 >Feature sequence026 725 988 gene locus_tag LOCUS_05480 725 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 1667 978 gene locus_tag LOCUS_05490 gene yihA 1667 978 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565283.1 protein_id gnl|my_center|LOCUS_05490 2068 1667 gene locus_tag LOCUS_05500 2068 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 2608 2093 gene locus_tag LOCUS_05510 2608 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 6376 2711 gene locus_tag LOCUS_05520 6376 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 7041 6454 gene locus_tag LOCUS_05530 7041 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 8366 7146 gene locus_tag LOCUS_05540 8366 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 9132 8449 gene locus_tag LOCUS_05550 9132 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 9724 9137 gene locus_tag LOCUS_05560 9724 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 9660 9944 gene locus_tag LOCUS_05570 9660 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 9975 11054 gene locus_tag LOCUS_05580 9975 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 11348 13183 gene locus_tag LOCUS_05590 11348 13183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 15774 13294 gene locus_tag LOCUS_05600 15774 13294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 15805 16767 gene locus_tag LOCUS_05610 15805 16767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 17016 16777 gene locus_tag LOCUS_05620 gene purS 17016 16777 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088473.1 protein_id gnl|my_center|LOCUS_05620 17992 17027 gene locus_tag LOCUS_05630 17992 17027 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681898.1 protein_id gnl|my_center|LOCUS_05630 >Feature sequence027 1292 156 gene locus_tag LOCUS_05640 1292 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 1365 1691 gene locus_tag LOCUS_05650 1365 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 1909 5043 gene locus_tag LOCUS_05660 1909 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 5047 5778 gene locus_tag LOCUS_05670 5047 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 5775 6311 gene locus_tag LOCUS_05680 5775 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 6480 6668 gene locus_tag LOCUS_05690 6480 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 8947 6683 gene locus_tag LOCUS_05700 8947 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 12629 9057 gene locus_tag LOCUS_05710 12629 9057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 13703 12708 gene locus_tag LOCUS_05720 13703 12708 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_05720 13802 14227 gene locus_tag LOCUS_05730 13802 14227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 15766 14330 gene locus_tag LOCUS_05740 15766 14330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 15765 15977 gene locus_tag LOCUS_05750 15765 15977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 16140 17633 gene locus_tag LOCUS_05760 16140 17633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence028 <1 812 gene locus_tag LOCUS_05770 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039172.1:threo-3-hydroxy-L-aspartate ammonia-lyase 1108 2346 gene locus_tag LOCUS_05780 1108 2346 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792562.1 protein_id gnl|my_center|LOCUS_05780 2407 3138 gene locus_tag LOCUS_05790 2407 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05790 3704 4294 gene locus_tag LOCUS_05800 3704 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 4299 4871 gene locus_tag LOCUS_05810 4299 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 5781 4906 gene locus_tag LOCUS_05820 5781 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 6039 6767 gene locus_tag LOCUS_05830 6039 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 6886 8811 gene locus_tag LOCUS_05840 6886 8811 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587238.1 protein_id gnl|my_center|LOCUS_05840 9032 9199 gene locus_tag LOCUS_05850 9032 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 9196 10518 gene locus_tag LOCUS_05860 9196 10518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 10641 11891 gene locus_tag LOCUS_05870 10641 11891 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_05870 11888 15100 gene locus_tag LOCUS_05880 11888 15100 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389025.1 protein_id gnl|my_center|LOCUS_05880 15852 15130 gene locus_tag LOCUS_05890 15852 15130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 16130 16819 gene locus_tag LOCUS_05900 16130 16819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 17005 17898 gene locus_tag LOCUS_05910 17005 17898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence029 1 444 gene locus_tag LOCUS_05920 1 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 499 1662 gene locus_tag LOCUS_05930 499 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 1659 4037 gene locus_tag LOCUS_05940 1659 4037 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942341.1 protein_id gnl|my_center|LOCUS_05940 4117 4824 gene locus_tag LOCUS_05950 4117 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 5190 4969 gene locus_tag LOCUS_05960 5190 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 5406 5993 gene locus_tag LOCUS_05970 5406 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 6157 8373 gene locus_tag LOCUS_05980 6157 8373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 8581 9762 gene locus_tag LOCUS_05990 8581 9762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 9774 10415 gene locus_tag LOCUS_06000 9774 10415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 11749 10418 gene locus_tag LOCUS_06010 11749 10418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 11943 13448 gene locus_tag LOCUS_06020 11943 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 13631 16114 gene locus_tag LOCUS_06030 13631 16114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 16111 16467 gene locus_tag LOCUS_06040 16111 16467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 16539 17597 gene locus_tag LOCUS_06050 16539 17597 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence030 802 1215 gene locus_tag LOCUS_06060 802 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 2521 1412 gene locus_tag LOCUS_06070 2521 1412 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813839.1 protein_id gnl|my_center|LOCUS_06070 2633 4075 gene locus_tag LOCUS_06080 gene glgA 2633 4075 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_06080 4413 7058 gene locus_tag LOCUS_06090 4413 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 7124 8806 gene locus_tag LOCUS_06100 7124 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 9080 9430 gene locus_tag LOCUS_06110 9080 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 9435 9707 gene locus_tag LOCUS_06120 9435 9707 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460446.1 protein_id gnl|my_center|LOCUS_06120 9760 10278 gene locus_tag LOCUS_06130 gene rimM 9760 10278 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223850.1 protein_id gnl|my_center|LOCUS_06130 10296 11012 gene locus_tag LOCUS_06140 gene trmD 10296 11012 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140891.1 protein_id gnl|my_center|LOCUS_06140 12268 11132 gene locus_tag LOCUS_06150 12268 11132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 12343 13437 gene locus_tag LOCUS_06160 gene queG 12343 13437 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141464.1 protein_id gnl|my_center|LOCUS_06160 13524 13760 gene locus_tag LOCUS_06170 gene rpmB 13524 13760 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771445.1 protein_id gnl|my_center|LOCUS_06170 14927 13893 gene locus_tag LOCUS_06180 14927 13893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 15630 14929 gene locus_tag LOCUS_06190 15630 14929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 16706 15753 gene locus_tag LOCUS_06200 16706 15753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 17581 16703 gene locus_tag LOCUS_06210 17581 16703 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626403.1 protein_id gnl|my_center|LOCUS_06210 >Feature sequence031 2443 518 gene locus_tag LOCUS_06220 gene recD 2443 518 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932748.1 protein_id gnl|my_center|LOCUS_06220 5033 2436 gene locus_tag LOCUS_06230 5033 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06230 6503 5076 gene locus_tag LOCUS_06240 6503 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06240 9804 6508 gene locus_tag LOCUS_06250 gene recC 9804 6508 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942180.1 protein_id gnl|my_center|LOCUS_06250 9947 10360 gene locus_tag LOCUS_06260 9947 10360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 11381 10440 gene locus_tag LOCUS_06270 11381 10440 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115465.1 protein_id gnl|my_center|LOCUS_06270 11687 12061 gene locus_tag LOCUS_06280 11687 12061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 12140 13354 gene locus_tag LOCUS_06290 12140 13354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 13514 15448 gene locus_tag LOCUS_06300 13514 15448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 15536 15754 gene locus_tag LOCUS_06310 15536 15754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 15884 16891 gene locus_tag LOCUS_06320 15884 16891 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_06320 17723 16920 gene locus_tag LOCUS_06330 17723 16920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence032 1625 750 gene locus_tag LOCUS_06340 1625 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 1753 4284 gene locus_tag LOCUS_06350 1753 4284 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161963454.1 protein_id gnl|my_center|LOCUS_06350 4398 6473 gene locus_tag LOCUS_06360 4398 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 6473 8473 gene locus_tag LOCUS_06370 6473 8473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 8509 9447 gene locus_tag LOCUS_06380 8509 9447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 10114 9536 gene locus_tag LOCUS_06390 10114 9536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 10131 12680 gene locus_tag LOCUS_06400 10131 12680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 12825 12580 gene locus_tag LOCUS_06410 12825 12580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 12885 13967 gene locus_tag LOCUS_06420 12885 13967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 14006 15949 gene locus_tag LOCUS_06430 14006 15949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 15963 17852 gene locus_tag LOCUS_06440 15963 17852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 >Feature sequence033 195 971 gene locus_tag LOCUS_06450 195 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 968 2746 gene locus_tag LOCUS_06460 968 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 2930 7699 gene locus_tag LOCUS_06470 2930 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 8480 7800 gene locus_tag LOCUS_06480 8480 7800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 10989 8566 gene locus_tag LOCUS_06490 10989 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 11291 10989 gene locus_tag LOCUS_06500 11291 10989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 11178 12038 gene locus_tag LOCUS_06510 11178 12038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 12211 13458 gene locus_tag LOCUS_06520 12211 13458 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 protein_id gnl|my_center|LOCUS_06520 14463 13498 gene locus_tag LOCUS_06530 14463 13498 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_06530 16058 14523 gene locus_tag LOCUS_06540 16058 14523 CDS product CUAEP/CCAEP-tail radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257877.1 protein_id gnl|my_center|LOCUS_06540 16459 16055 gene locus_tag LOCUS_06550 16459 16055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 16594 17127 gene locus_tag LOCUS_06560 16594 17127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence034 156 1268 gene locus_tag LOCUS_06570 156 1268 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731604.1 protein_id gnl|my_center|LOCUS_06570 2129 1329 gene locus_tag LOCUS_06580 2129 1329 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928819.1 protein_id gnl|my_center|LOCUS_06580 2192 2890 gene locus_tag LOCUS_06590 2192 2890 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878130.1 protein_id gnl|my_center|LOCUS_06590 2981 3652 gene locus_tag LOCUS_06600 2981 3652 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 protein_id gnl|my_center|LOCUS_06600 3699 4388 gene locus_tag LOCUS_06610 3699 4388 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873009.1 protein_id gnl|my_center|LOCUS_06610 4562 6055 gene locus_tag LOCUS_06620 4562 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 7428 6100 gene locus_tag LOCUS_06630 7428 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 9109 7451 gene locus_tag LOCUS_06640 9109 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 9141 10313 gene locus_tag LOCUS_06650 9141 10313 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_06650 10373 10810 gene locus_tag LOCUS_06660 10373 10810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 11443 10832 gene locus_tag LOCUS_06670 11443 10832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 11553 12296 gene locus_tag LOCUS_06680 11553 12296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 12265 13011 gene locus_tag LOCUS_06690 12265 13011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 13973 13065 gene locus_tag LOCUS_06700 gene rimK 13973 13065 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459235.1 protein_id gnl|my_center|LOCUS_06700 14138 15307 gene locus_tag LOCUS_06710 gene atuD 14138 15307 CDS product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 protein_id gnl|my_center|LOCUS_06710 16031 15330 gene locus_tag LOCUS_06720 16031 15330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 17314 16136 gene locus_tag LOCUS_06730 17314 16136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 >Feature sequence035 229 1161 gene locus_tag LOCUS_06740 229 1161 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 protein_id gnl|my_center|LOCUS_06740 1984 1217 gene locus_tag LOCUS_06750 1984 1217 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_06750 2681 1992 gene locus_tag LOCUS_06760 2681 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 2930 3001 gene locus_tag LOCUS_t00050 2930 3001 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3041 3115 gene locus_tag LOCUS_t00060 3041 3115 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3266 3568 gene locus_tag LOCUS_06770 3266 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 3983 5143 gene locus_tag LOCUS_06780 3983 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 5702 5133 gene locus_tag LOCUS_06790 5702 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 5604 6194 gene locus_tag LOCUS_06800 5604 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 6191 7249 gene locus_tag LOCUS_06810 gene mcrC 6191 7249 CDS product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437621.1 protein_id gnl|my_center|LOCUS_06810 7763 7461 gene locus_tag LOCUS_06820 7763 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 7993 7823 gene locus_tag LOCUS_06830 7993 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 8148 9449 gene locus_tag LOCUS_06840 8148 9449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 9451 9930 gene locus_tag LOCUS_06850 9451 9930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 10638 9949 gene locus_tag LOCUS_06860 10638 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 11531 10635 gene locus_tag LOCUS_06870 11531 10635 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919059.1 protein_id gnl|my_center|LOCUS_06870 12591 11566 gene locus_tag LOCUS_06880 12591 11566 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_06880 11674 11577 gene locus_tag LOCUS_t00070 11674 11577 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 13962 12703 gene locus_tag LOCUS_06890 gene hisD 13962 12703 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404855.1 protein_id gnl|my_center|LOCUS_06890 15296 13959 gene locus_tag LOCUS_06900 15296 13959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 16181 15423 gene locus_tag LOCUS_06910 gene hisF 16181 15423 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404312.1 protein_id gnl|my_center|LOCUS_06910 16798 16175 gene locus_tag LOCUS_06920 gene hisH 16798 16175 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_06920 17400 16795 gene locus_tag LOCUS_06930 gene hisB 17400 16795 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404306.1 protein_id gnl|my_center|LOCUS_06930 >Feature sequence036 <1 547 gene locus_tag LOCUS_06940 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583513.1:BMP family ABC transporter substrate-binding protein 1619 633 gene locus_tag LOCUS_06950 1619 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 2957 1626 gene locus_tag LOCUS_06960 2957 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 3870 2950 gene locus_tag LOCUS_06970 gene folP 3870 2950 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_06970 4238 5944 gene locus_tag LOCUS_06980 4238 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 5946 7664 gene locus_tag LOCUS_06990 5946 7664 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_06990 7726 8577 gene locus_tag LOCUS_07000 7726 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 8646 9233 gene locus_tag LOCUS_07010 8646 9233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 9445 11574 gene locus_tag LOCUS_07020 9445 11574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388856.1 protein_id gnl|my_center|LOCUS_07020 11942 11610 gene locus_tag LOCUS_07030 11942 11610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 13009 11972 gene locus_tag LOCUS_07040 13009 11972 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897322.1 protein_id gnl|my_center|LOCUS_07040 14459 13233 gene locus_tag LOCUS_07050 14459 13233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 17169 14461 gene locus_tag LOCUS_07060 17169 14461 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790264.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence037 1387 1106 gene locus_tag LOCUS_07070 gene acpP 1387 1106 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813816.1 protein_id gnl|my_center|LOCUS_07070 2221 1469 gene locus_tag LOCUS_07080 gene fabG 2221 1469 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_07080 3269 2328 gene locus_tag LOCUS_07090 gene fabD 3269 2328 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_07090 3426 4442 gene locus_tag LOCUS_07100 3426 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 5261 4446 gene locus_tag LOCUS_07110 5261 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 5418 6011 gene locus_tag LOCUS_07120 5418 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 6327 11402 gene locus_tag LOCUS_07130 6327 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 11856 11596 gene locus_tag LOCUS_07140 11856 11596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 12232 12411 gene locus_tag LOCUS_07150 12232 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 12459 13568 gene locus_tag LOCUS_07160 12459 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 14875 13628 gene locus_tag LOCUS_07170 14875 13628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 15142 15711 gene locus_tag LOCUS_07180 15142 15711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 15713 16387 gene locus_tag LOCUS_07190 gene gmk 15713 16387 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938199.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence038 1062 12416 gene locus_tag LOCUS_07200 1062 12416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 12416 13291 gene locus_tag LOCUS_07210 gene ilvE 12416 13291 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_07210 13640 13302 gene locus_tag LOCUS_07220 13640 13302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 15037 13829 gene locus_tag LOCUS_07230 15037 13829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07230 15081 15440 gene locus_tag LOCUS_07240 15081 15440 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_07240 15444 16073 gene locus_tag LOCUS_07250 gene recR 15444 16073 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_07250 16165 16548 gene locus_tag LOCUS_07260 16165 16548 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence039 2 925 gene locus_tag LOCUS_07270 2 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 1042 1785 gene locus_tag LOCUS_07280 1042 1785 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931959.1 protein_id gnl|my_center|LOCUS_07280 1800 2621 gene locus_tag LOCUS_07290 1800 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 2650 3966 gene locus_tag LOCUS_07300 gene gdhA 2650 3966 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 protein_id gnl|my_center|LOCUS_07300 4990 4040 gene locus_tag LOCUS_07310 4990 4040 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_07310 5582 5058 gene locus_tag LOCUS_07320 5582 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 6907 5696 gene locus_tag LOCUS_07330 6907 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 6994 8469 gene locus_tag LOCUS_07340 6994 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 8563 9861 gene locus_tag LOCUS_07350 8563 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 9987 11498 gene locus_tag LOCUS_07360 9987 11498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 11582 12430 gene locus_tag LOCUS_07370 11582 12430 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140077.1 protein_id gnl|my_center|LOCUS_07370 12902 12468 gene locus_tag LOCUS_07380 12902 12468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 13258 12950 gene locus_tag LOCUS_07390 gene nuoK 13258 12950 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932455.1 protein_id gnl|my_center|LOCUS_07390 13776 13261 gene locus_tag LOCUS_07400 13776 13261 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_07400 14254 14580 gene locus_tag LOCUS_07410 14254 14580 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008139488.1 protein_id gnl|my_center|LOCUS_07410 14858 15268 gene locus_tag LOCUS_07420 14858 15268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 15368 16267 gene locus_tag LOCUS_07430 15368 16267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 <16829 16295 gene locus_tag LOCUS_07440 <16829 16295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230479.1:serine hydroxymethyltransferase >Feature sequence040 2949 358 gene locus_tag LOCUS_07450 2949 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 4100 3192 gene locus_tag LOCUS_07460 4100 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 4316 5368 gene locus_tag LOCUS_07470 4316 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 6526 5498 gene locus_tag LOCUS_07480 6526 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 8474 6663 gene locus_tag LOCUS_07490 8474 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403737.1 protein_id gnl|my_center|LOCUS_07490 10052 8673 gene locus_tag LOCUS_07500 10052 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 10112 10804 gene locus_tag LOCUS_07510 10112 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 10978 13323 gene locus_tag LOCUS_07520 10978 13323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 13341 14615 gene locus_tag LOCUS_07530 13341 14615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 14612 16102 gene locus_tag LOCUS_07540 gene malQ 14612 16102 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_07540 <16678 16179 gene locus_tag LOCUS_07550 <16678 16179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104130.1:ATP-binding protein >Feature sequence041 2478 2068 gene locus_tag LOCUS_07560 2478 2068 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720191.1 protein_id gnl|my_center|LOCUS_07560 3619 2570 gene locus_tag LOCUS_07570 3619 2570 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870053.1 protein_id gnl|my_center|LOCUS_07570 5073 3616 gene locus_tag LOCUS_07580 5073 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 5771 5073 gene locus_tag LOCUS_07590 5771 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07590 5766 5993 gene locus_tag LOCUS_07600 5766 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 8569 6161 gene locus_tag LOCUS_07610 8569 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 8584 8808 gene locus_tag LOCUS_07620 8584 8808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 8968 10620 gene locus_tag LOCUS_07630 8968 10620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 11476 10736 gene locus_tag LOCUS_07640 11476 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 11788 13188 gene locus_tag LOCUS_07650 11788 13188 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 protein_id gnl|my_center|LOCUS_07650 13375 14700 gene locus_tag LOCUS_07660 13375 14700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 15700 14717 gene locus_tag LOCUS_07670 15700 14717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence042 2139 241 gene locus_tag LOCUS_07680 2139 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 3811 2273 gene locus_tag LOCUS_07690 3811 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 4706 4062 gene locus_tag LOCUS_07700 4706 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 5209 4703 gene locus_tag LOCUS_07710 5209 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 6122 5454 gene locus_tag LOCUS_07720 6122 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 6547 7206 gene locus_tag LOCUS_07730 6547 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 7343 7894 gene locus_tag LOCUS_07740 7343 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 7926 8519 gene locus_tag LOCUS_07750 7926 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 8648 9733 gene locus_tag LOCUS_07760 8648 9733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 10840 9809 gene locus_tag LOCUS_07770 10840 9809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 12034 11027 gene locus_tag LOCUS_07780 12034 11027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 14158 12047 gene locus_tag LOCUS_07790 14158 12047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 <16299 14271 gene locus_tag LOCUS_07800 <16299 14271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940682.1:DNA gyrase subunit A >Feature sequence043 1274 174 gene locus_tag LOCUS_07810 1274 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 3380 1362 gene locus_tag LOCUS_07820 3380 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 4650 3463 gene locus_tag LOCUS_07830 4650 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 4970 4647 gene locus_tag LOCUS_07840 4970 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 5731 5114 gene locus_tag LOCUS_07850 gene lexA 5731 5114 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940718.1 protein_id gnl|my_center|LOCUS_07850 6477 6046 gene locus_tag LOCUS_07860 6477 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 6563 6862 gene locus_tag LOCUS_07870 6563 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 7329 6859 gene locus_tag LOCUS_07880 7329 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 8327 7440 gene locus_tag LOCUS_07890 8327 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 8870 8352 gene locus_tag LOCUS_07900 8870 8352 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919048.1 protein_id gnl|my_center|LOCUS_07900 9669 8872 gene locus_tag LOCUS_07910 9669 8872 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177702.1 protein_id gnl|my_center|LOCUS_07910 11141 9990 gene locus_tag LOCUS_07920 gene truD 11141 9990 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479835.1 protein_id gnl|my_center|LOCUS_07920 11169 12032 gene locus_tag LOCUS_07930 11169 12032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 12541 12122 gene locus_tag LOCUS_07940 12541 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 14014 12542 gene locus_tag LOCUS_07950 14014 12542 CDS product HAD-IG family 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405487.1 protein_id gnl|my_center|LOCUS_07950 14139 15503 gene locus_tag LOCUS_07960 14139 15503 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921243.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence044 1542 1934 gene locus_tag LOCUS_07970 1542 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 3459 2437 gene locus_tag LOCUS_07980 gene plsX 3459 2437 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774380.1 protein_id gnl|my_center|LOCUS_07980 3569 4519 gene locus_tag LOCUS_07990 3569 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 6022 4583 gene locus_tag LOCUS_08000 6022 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 6113 7147 gene locus_tag LOCUS_08010 6113 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 7524 7255 gene locus_tag LOCUS_08020 7524 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 10849 7577 gene locus_tag LOCUS_08030 10849 7577 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_08030 12270 10846 gene locus_tag LOCUS_08040 12270 10846 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015670.1 protein_id gnl|my_center|LOCUS_08040 13778 12267 gene locus_tag LOCUS_08050 13778 12267 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927123.1 protein_id gnl|my_center|LOCUS_08050 14075 15325 gene locus_tag LOCUS_08060 14075 15325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence045 1 1503 gene locus_tag LOCUS_08070 1 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2163 1519 gene locus_tag LOCUS_08080 2163 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 3641 2235 gene locus_tag LOCUS_08090 3641 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 4396 3680 gene locus_tag LOCUS_08100 4396 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 4543 5190 gene locus_tag LOCUS_08110 4543 5190 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706539.1 protein_id gnl|my_center|LOCUS_08110 5372 5241 gene locus_tag LOCUS_08120 5372 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 5625 5386 gene locus_tag LOCUS_08130 5625 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 5605 5787 gene locus_tag LOCUS_08140 5605 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 7067 5817 gene locus_tag LOCUS_08150 7067 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 8841 7267 gene locus_tag LOCUS_08160 8841 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 10236 8872 gene locus_tag LOCUS_08170 10236 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 10892 10284 gene locus_tag LOCUS_08180 10892 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 11112 11438 gene locus_tag LOCUS_08190 gene trxA 11112 11438 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852918.1 protein_id gnl|my_center|LOCUS_08190 13654 11405 gene locus_tag LOCUS_08200 13654 11405 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_08200 14113 13874 gene locus_tag LOCUS_08210 14113 13874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 14578 15192 gene locus_tag LOCUS_08220 14578 15192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 <15817 15255 gene locus_tag LOCUS_08230 <15817 15255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185910.1:Crp/Fnr family transcriptional regulator >Feature sequence046 769 1026 gene locus_tag LOCUS_08240 769 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 3874 932 gene locus_tag LOCUS_08250 3874 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 3992 4996 gene locus_tag LOCUS_08260 3992 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 5218 5949 gene locus_tag LOCUS_08270 5218 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 5957 6286 gene locus_tag LOCUS_08280 5957 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 6292 7281 gene locus_tag LOCUS_08290 6292 7281 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188783.1 protein_id gnl|my_center|LOCUS_08290 8623 7376 gene locus_tag LOCUS_08300 8623 7376 CDS product 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791484.1 protein_id gnl|my_center|LOCUS_08300 9807 8686 gene locus_tag LOCUS_08310 9807 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 9847 10665 gene locus_tag LOCUS_08320 9847 10665 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038369.1 protein_id gnl|my_center|LOCUS_08320 11725 10859 gene locus_tag LOCUS_08330 11725 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 12298 11738 gene locus_tag LOCUS_08340 12298 11738 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390014.1 protein_id gnl|my_center|LOCUS_08340 13263 12400 gene locus_tag LOCUS_08350 13263 12400 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496957.1 protein_id gnl|my_center|LOCUS_08350 13461 13910 gene locus_tag LOCUS_08360 13461 13910 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920646.1 protein_id gnl|my_center|LOCUS_08360 14354 14554 gene locus_tag LOCUS_08370 14354 14554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 >Feature sequence047 <1 686 gene locus_tag LOCUS_08380 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895552.1:RimK family alpha-L-glutamate ligase 683 1999 gene locus_tag LOCUS_08390 683 1999 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444859.1 protein_id gnl|my_center|LOCUS_08390 2157 2606 gene locus_tag LOCUS_08400 2157 2606 CDS product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596824.1 protein_id gnl|my_center|LOCUS_08400 2727 3176 gene locus_tag LOCUS_08410 2727 3176 CDS product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946477.1 protein_id gnl|my_center|LOCUS_08410 3496 3173 gene locus_tag LOCUS_08420 3496 3173 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819377.1 protein_id gnl|my_center|LOCUS_08420 5094 3493 gene locus_tag LOCUS_08430 5094 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 5409 6467 gene locus_tag LOCUS_08440 5409 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 6464 7450 gene locus_tag LOCUS_08450 6464 7450 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402923.1 protein_id gnl|my_center|LOCUS_08450 7554 12344 gene locus_tag LOCUS_08460 7554 12344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 12341 13339 gene locus_tag LOCUS_08470 12341 13339 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_08470 13514 14461 gene locus_tag LOCUS_08480 13514 14461 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_08480 14458 15423 gene locus_tag LOCUS_08490 14458 15423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence048 1990 662 gene locus_tag LOCUS_08500 1990 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 2141 2779 gene locus_tag LOCUS_08510 2141 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 2855 3190 gene locus_tag LOCUS_08520 2855 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 3343 3269 gene locus_tag LOCUS_t00080 3343 3269 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3534 4271 gene locus_tag LOCUS_08530 3534 4271 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_08530 4448 6766 gene locus_tag LOCUS_08540 4448 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 6840 7097 gene locus_tag LOCUS_08550 6840 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 7189 8064 gene locus_tag LOCUS_08560 7189 8064 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202330.1 protein_id gnl|my_center|LOCUS_08560 8716 8138 gene locus_tag LOCUS_08570 8716 8138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 8937 8686 gene locus_tag LOCUS_08580 8937 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 9095 9023 gene locus_tag LOCUS_t00090 9095 9023 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 9253 9795 gene locus_tag LOCUS_08590 9253 9795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 11602 9848 gene locus_tag LOCUS_08600 11602 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 14007 11728 gene locus_tag LOCUS_08610 14007 11728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 >Feature sequence049 <1 1479 gene locus_tag LOCUS_08620 <1 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943823.1:30S ribosomal protein S12 methylthiotransferase RimO 1631 2020 gene locus_tag LOCUS_08630 1631 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 2193 3674 gene locus_tag LOCUS_08640 2193 3674 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_08640 3770 4354 gene locus_tag LOCUS_08650 3770 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 4700 5302 gene locus_tag LOCUS_08660 4700 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 5361 5903 gene locus_tag LOCUS_08670 5361 5903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 6106 6702 gene locus_tag LOCUS_08680 6106 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 6823 7326 gene locus_tag LOCUS_08690 6823 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 7323 8264 gene locus_tag LOCUS_08700 7323 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 10475 8325 gene locus_tag LOCUS_08710 10475 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 13289 10665 gene locus_tag LOCUS_08720 13289 10665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 14485 13286 gene locus_tag LOCUS_08730 14485 13286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 14575 14877 gene locus_tag LOCUS_08740 gene gatC 14575 14877 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881409.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence050 <1 1938 gene locus_tag LOCUS_08750 <1 1938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_075123474.1:DEAD/DEAH box helicase 3025 2018 gene locus_tag LOCUS_08760 3025 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 3168 4202 gene locus_tag LOCUS_08770 3168 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 4268 4906 gene locus_tag LOCUS_08780 4268 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 5590 4925 gene locus_tag LOCUS_08790 gene thiE 5590 4925 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_08790 5769 7121 gene locus_tag LOCUS_08800 5769 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 7985 7203 gene locus_tag LOCUS_08810 7985 7203 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088784.1 protein_id gnl|my_center|LOCUS_08810 8890 7991 gene locus_tag LOCUS_08820 8890 7991 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524880.1 protein_id gnl|my_center|LOCUS_08820 9372 8881 gene locus_tag LOCUS_08830 9372 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 10620 9439 gene locus_tag LOCUS_08840 10620 9439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 12202 10625 gene locus_tag LOCUS_08850 12202 10625 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 protein_id gnl|my_center|LOCUS_08850 13393 12287 gene locus_tag LOCUS_08860 13393 12287 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 protein_id gnl|my_center|LOCUS_08860 14518 13475 gene locus_tag LOCUS_08870 gene obgE 14518 13475 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943831.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence051 3117 5588 gene locus_tag LOCUS_08880 3117 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 5585 7729 gene locus_tag LOCUS_08890 5585 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 7853 8989 gene locus_tag LOCUS_08900 7853 8989 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533145.1 protein_id gnl|my_center|LOCUS_08900 9493 9068 gene locus_tag LOCUS_08910 9493 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 9648 10280 gene locus_tag LOCUS_08920 9648 10280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124702.1 protein_id gnl|my_center|LOCUS_08920 10529 11665 gene locus_tag LOCUS_08930 10529 11665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 11713 12810 gene locus_tag LOCUS_08940 11713 12810 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056551.1 protein_id gnl|my_center|LOCUS_08940 15004 12899 gene locus_tag LOCUS_08950 15004 12899 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839249.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence052 98 1084 gene locus_tag LOCUS_08960 98 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 1081 2385 gene locus_tag LOCUS_08970 1081 2385 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839880.1 protein_id gnl|my_center|LOCUS_08970 2382 3488 gene locus_tag LOCUS_08980 2382 3488 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_08980 3478 4677 gene locus_tag LOCUS_08990 3478 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 4674 6665 gene locus_tag LOCUS_09000 4674 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 6749 7531 gene locus_tag LOCUS_09010 6749 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 7625 8173 gene locus_tag LOCUS_09020 7625 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 9370 8207 gene locus_tag LOCUS_09030 9370 8207 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_09030 9889 9452 gene locus_tag LOCUS_09040 9889 9452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221985.1 protein_id gnl|my_center|LOCUS_09040 10362 9901 gene locus_tag LOCUS_09050 10362 9901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 10416 11348 gene locus_tag LOCUS_09060 10416 11348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 11373 12263 gene locus_tag LOCUS_09070 11373 12263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 12303 13019 gene locus_tag LOCUS_09080 12303 13019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 13266 14414 gene locus_tag LOCUS_09090 13266 14414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 14425 15336 gene locus_tag LOCUS_09100 14425 15336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence053 1101 343 gene locus_tag LOCUS_09110 1101 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 1907 1272 gene locus_tag LOCUS_09120 1907 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 2080 3000 gene locus_tag LOCUS_09130 2080 3000 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902464.1 protein_id gnl|my_center|LOCUS_09130 3000 5600 gene locus_tag LOCUS_09140 3000 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 5597 6622 gene locus_tag LOCUS_09150 5597 6622 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_09150 8878 6671 gene locus_tag LOCUS_09160 8878 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 10170 8962 gene locus_tag LOCUS_09170 10170 8962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 10297 11433 gene locus_tag LOCUS_09180 10297 11433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 12334 11492 gene locus_tag LOCUS_09190 12334 11492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 14226 12400 gene locus_tag LOCUS_09200 gene argS 14226 12400 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229544.1 protein_id gnl|my_center|LOCUS_09200 >Feature sequence054 658 1617 gene locus_tag LOCUS_09210 658 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 3075 1678 gene locus_tag LOCUS_09220 3075 1678 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878135.1 protein_id gnl|my_center|LOCUS_09220 3883 3218 gene locus_tag LOCUS_09230 gene rpiA 3883 3218 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140034.1 protein_id gnl|my_center|LOCUS_09230 4885 3965 gene locus_tag LOCUS_09240 4885 3965 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_09240 5826 4915 gene locus_tag LOCUS_09250 5826 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 5806 8625 gene locus_tag LOCUS_09260 gene glnE 5806 8625 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038683.1 protein_id gnl|my_center|LOCUS_09260 8874 9413 gene locus_tag LOCUS_09270 8874 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 9893 9480 gene locus_tag LOCUS_09280 9893 9480 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814993.1 protein_id gnl|my_center|LOCUS_09280 10489 9887 gene locus_tag LOCUS_09290 10489 9887 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_09290 11810 10491 gene locus_tag LOCUS_09300 11810 10491 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190664.1 protein_id gnl|my_center|LOCUS_09300 12391 11972 gene locus_tag LOCUS_09310 12391 11972 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_09310 12997 12578 gene locus_tag LOCUS_09320 12997 12578 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973766.1 protein_id gnl|my_center|LOCUS_09320 >Feature sequence055 1281 1138 gene locus_tag LOCUS_09330 1281 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1714 1346 gene locus_tag LOCUS_09340 1714 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 2460 1753 gene locus_tag LOCUS_09350 2460 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 3905 2547 gene locus_tag LOCUS_09360 3905 2547 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941480.1 protein_id gnl|my_center|LOCUS_09360 4827 3970 gene locus_tag LOCUS_09370 4827 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 4989 5399 gene locus_tag LOCUS_09380 4989 5399 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938085.1 protein_id gnl|my_center|LOCUS_09380 5396 6178 gene locus_tag LOCUS_09390 5396 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 6224 6982 gene locus_tag LOCUS_09400 6224 6982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 8533 7040 gene locus_tag LOCUS_09410 8533 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 8857 10464 gene locus_tag LOCUS_09420 8857 10464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 10738 12120 gene locus_tag LOCUS_09430 10738 12120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 12200 12748 gene locus_tag LOCUS_09440 12200 12748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 13009 12812 gene locus_tag LOCUS_09450 13009 12812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 13530 13006 gene locus_tag LOCUS_09460 13530 13006 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421522.1 protein_id gnl|my_center|LOCUS_09460 <14868 13634 gene locus_tag LOCUS_09470 <14868 13634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010927876.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB >Feature sequence056 1667 915 gene locus_tag LOCUS_09480 gene ribA 1667 915 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256265.1 protein_id gnl|my_center|LOCUS_09480 1877 2737 gene locus_tag LOCUS_09490 1877 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 3655 2834 gene locus_tag LOCUS_09500 3655 2834 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_09500 5024 4017 gene locus_tag LOCUS_09510 5024 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 7377 5083 gene locus_tag LOCUS_09520 7377 5083 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537861.1 protein_id gnl|my_center|LOCUS_09520 8030 7374 gene locus_tag LOCUS_09530 8030 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 8698 8141 gene locus_tag LOCUS_09540 8698 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 9096 9545 gene locus_tag LOCUS_09550 9096 9545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 9542 9796 gene locus_tag LOCUS_09560 9542 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 9801 10646 gene locus_tag LOCUS_09570 9801 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 10701 11294 gene locus_tag LOCUS_09580 10701 11294 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142741.1 protein_id gnl|my_center|LOCUS_09580 12537 11386 gene locus_tag LOCUS_09590 12537 11386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 13737 12610 gene locus_tag LOCUS_09600 13737 12610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 13993 14682 gene locus_tag LOCUS_09610 13993 14682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 >Feature sequence057 186 1118 gene locus_tag LOCUS_09620 186 1118 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095575.1 protein_id gnl|my_center|LOCUS_09620 2915 1167 gene locus_tag LOCUS_09630 2915 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 3088 4167 gene locus_tag LOCUS_09640 3088 4167 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919898.1 protein_id gnl|my_center|LOCUS_09640 5517 4216 gene locus_tag LOCUS_09650 5517 4216 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946829.1 protein_id gnl|my_center|LOCUS_09650 6866 5514 gene locus_tag LOCUS_09660 6866 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 8153 6981 gene locus_tag LOCUS_09670 8153 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 8188 8388 gene locus_tag LOCUS_09680 8188 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 8930 8490 gene locus_tag LOCUS_09690 8930 8490 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085816.1 protein_id gnl|my_center|LOCUS_09690 8948 11893 gene locus_tag LOCUS_09700 8948 11893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 12522 12094 gene locus_tag LOCUS_09710 12522 12094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 12711 13556 gene locus_tag LOCUS_09720 12711 13556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 <14569 13583 gene locus_tag LOCUS_09730 <14569 13583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090834.1:MFS transporter >Feature sequence058 505 672 gene locus_tag LOCUS_09740 505 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 822 1760 gene locus_tag LOCUS_09750 822 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 2181 1903 gene locus_tag LOCUS_09760 2181 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 3092 2241 gene locus_tag LOCUS_09770 3092 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 4687 3089 gene locus_tag LOCUS_09780 4687 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 6113 4908 gene locus_tag LOCUS_09790 6113 4908 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403007.1 protein_id gnl|my_center|LOCUS_09790 6749 6186 gene locus_tag LOCUS_09800 6749 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 7118 6876 gene locus_tag LOCUS_09810 7118 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 7054 7743 gene locus_tag LOCUS_09820 7054 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 7795 10467 gene locus_tag LOCUS_09830 7795 10467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 10490 13816 gene locus_tag LOCUS_09840 10490 13816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence059 2719 461 gene locus_tag LOCUS_09850 2719 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 3054 3920 gene locus_tag LOCUS_09860 3054 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 3979 4911 gene locus_tag LOCUS_09870 3979 4911 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118888.1 protein_id gnl|my_center|LOCUS_09870 4961 5689 gene locus_tag LOCUS_09880 4961 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 5686 6315 gene locus_tag LOCUS_09890 5686 6315 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975840.1 protein_id gnl|my_center|LOCUS_09890 6315 7307 gene locus_tag LOCUS_09900 6315 7307 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392272.1 protein_id gnl|my_center|LOCUS_09900 8314 7379 gene locus_tag LOCUS_09910 8314 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 8603 9178 gene locus_tag LOCUS_09920 8603 9178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 9334 10053 gene locus_tag LOCUS_09930 9334 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 11188 10187 gene locus_tag LOCUS_09940 11188 10187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 12626 11178 gene locus_tag LOCUS_09950 12626 11178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 12726 13703 gene locus_tag LOCUS_09960 12726 13703 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259483.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence060 <1 828 gene locus_tag LOCUS_09970 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169351683.1:sigma 54-interacting transcriptional regulator 837 1460 gene locus_tag LOCUS_09980 gene plsY 837 1460 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_09980 1637 3064 gene locus_tag LOCUS_09990 1637 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 3157 6582 gene locus_tag LOCUS_10000 3157 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 6684 11024 gene locus_tag LOCUS_10010 6684 11024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 12017 11055 gene locus_tag LOCUS_10020 12017 11055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 12264 12797 gene locus_tag LOCUS_10030 12264 12797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 13764 13138 gene locus_tag LOCUS_10040 13764 13138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 <14416 13757 gene locus_tag LOCUS_10050 <14416 13757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230333.1:benzoyl-CoA 2,3-epoxidase subunit BoxB >Feature sequence061 1666 152 gene locus_tag LOCUS_10060 1666 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 2750 1887 gene locus_tag LOCUS_10070 2750 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 2838 2922 gene locus_tag LOCUS_t00100 2838 2922 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3102 5180 gene locus_tag LOCUS_10080 3102 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 6176 5172 gene locus_tag LOCUS_10090 gene trpS 6176 5172 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404409.1 protein_id gnl|my_center|LOCUS_10090 8584 6236 gene locus_tag LOCUS_10100 8584 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 9783 8740 gene locus_tag LOCUS_10110 9783 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 9822 10739 gene locus_tag LOCUS_10120 9822 10739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 10754 11728 gene locus_tag LOCUS_10130 10754 11728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 11750 13210 gene locus_tag LOCUS_10140 11750 13210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence062 1074 328 gene locus_tag LOCUS_10150 1074 328 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940256.1 protein_id gnl|my_center|LOCUS_10150 1261 3711 gene locus_tag LOCUS_10160 gene pheT 1261 3711 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_10160 4089 3775 gene locus_tag LOCUS_10170 4089 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 4163 5629 gene locus_tag LOCUS_10180 4163 5629 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_10180 5638 6126 gene locus_tag LOCUS_10190 gene ruvC 5638 6126 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121356.1 protein_id gnl|my_center|LOCUS_10190 8084 6144 gene locus_tag LOCUS_10200 8084 6144 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272796.1 protein_id gnl|my_center|LOCUS_10200 8504 8097 gene locus_tag LOCUS_10210 8504 8097 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_10210 8821 9270 gene locus_tag LOCUS_10220 gene mraZ 8821 9270 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221402.1 protein_id gnl|my_center|LOCUS_10220 9267 10214 gene locus_tag LOCUS_10230 gene rsmH 9267 10214 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888501.1 protein_id gnl|my_center|LOCUS_10230 10211 10534 gene locus_tag LOCUS_10240 10211 10534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 10531 12630 gene locus_tag LOCUS_10250 10531 12630 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_10250 12639 14009 gene locus_tag LOCUS_10260 12639 14009 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10260 >Feature sequence063 1693 557 gene locus_tag LOCUS_10270 1693 557 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_10270 3322 1778 gene locus_tag LOCUS_10280 3322 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 3590 5992 gene locus_tag LOCUS_10290 3590 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 7185 6046 gene locus_tag LOCUS_10300 7185 6046 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_10300 7672 7265 gene locus_tag LOCUS_10310 7672 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 8324 7788 gene locus_tag LOCUS_10320 8324 7788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 8551 11286 gene locus_tag LOCUS_10330 8551 11286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 11353 12540 gene locus_tag LOCUS_10340 11353 12540 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_10340 13099 12485 gene locus_tag LOCUS_10350 13099 12485 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence064 1517 165 gene locus_tag LOCUS_10360 gene hemA 1517 165 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_10360 2476 1514 gene locus_tag LOCUS_10370 gene ccsB 2476 1514 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_10370 2987 2634 gene locus_tag LOCUS_10380 2987 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 3814 3008 gene locus_tag LOCUS_10390 gene pssA 3814 3008 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_10390 4791 3919 gene locus_tag LOCUS_10400 gene prmC 4791 3919 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_10400 6203 4791 gene locus_tag LOCUS_10410 6203 4791 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_10410 6684 6259 gene locus_tag LOCUS_10420 6684 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 7649 6684 gene locus_tag LOCUS_10430 7649 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 7933 7655 gene locus_tag LOCUS_10440 7933 7655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 8024 9253 gene locus_tag LOCUS_10450 8024 9253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 10080 9364 gene locus_tag LOCUS_10460 10080 9364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 11128 10073 gene locus_tag LOCUS_10470 11128 10073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 11334 11125 gene locus_tag LOCUS_10480 11334 11125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 12216 11551 gene locus_tag LOCUS_10490 12216 11551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 13036 12290 gene locus_tag LOCUS_10500 13036 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 13308 13601 gene locus_tag LOCUS_10510 13308 13601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 13570 13746 gene locus_tag LOCUS_10520 13570 13746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence065 469 1170 gene locus_tag LOCUS_10530 469 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1254 3161 gene locus_tag LOCUS_10540 1254 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 3253 3648 gene locus_tag LOCUS_10550 3253 3648 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707313.1 protein_id gnl|my_center|LOCUS_10550 8404 3701 gene locus_tag LOCUS_10560 8404 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 8867 8424 gene locus_tag LOCUS_10570 8867 8424 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869889.1 protein_id gnl|my_center|LOCUS_10570 12061 8864 gene locus_tag LOCUS_10580 12061 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 12456 12863 gene locus_tag LOCUS_10590 12456 12863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence066 1799 873 gene locus_tag LOCUS_10600 gene oppB 1799 873 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816417.1 protein_id gnl|my_center|LOCUS_10600 4057 1796 gene locus_tag LOCUS_10610 4057 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 4229 8545 gene locus_tag LOCUS_10620 4229 8545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 8654 9892 gene locus_tag LOCUS_10630 8654 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 11215 9935 gene locus_tag LOCUS_10640 11215 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 12510 11362 gene locus_tag LOCUS_10650 12510 11362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 13078 12626 gene locus_tag LOCUS_10660 13078 12626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 13288 13692 gene locus_tag LOCUS_10670 13288 13692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence067 946 434 gene locus_tag LOCUS_10680 946 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 4402 1070 gene locus_tag LOCUS_10690 4402 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 8862 4399 gene locus_tag LOCUS_10700 8862 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 9795 8887 gene locus_tag LOCUS_10710 9795 8887 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397197.1 protein_id gnl|my_center|LOCUS_10710 10112 10501 gene locus_tag LOCUS_10720 gene folB 10112 10501 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897503.1 protein_id gnl|my_center|LOCUS_10720 10568 10831 gene locus_tag LOCUS_10730 10568 10831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940758.1 protein_id gnl|my_center|LOCUS_10730 11864 10857 gene locus_tag LOCUS_10740 11864 10857 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918341.1 protein_id gnl|my_center|LOCUS_10740 12447 11866 gene locus_tag LOCUS_10750 12447 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 13548 12490 gene locus_tag LOCUS_10760 13548 12490 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence068 990 1709 gene locus_tag LOCUS_10770 990 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1706 2362 gene locus_tag LOCUS_10780 1706 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 2359 2805 gene locus_tag LOCUS_10790 2359 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 4082 2973 gene locus_tag LOCUS_10800 4082 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 5420 4167 gene locus_tag LOCUS_10810 5420 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 8108 5577 gene locus_tag LOCUS_10820 8108 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 9565 8324 gene locus_tag LOCUS_10830 9565 8324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 9663 10643 gene locus_tag LOCUS_10840 9663 10643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 11211 10762 gene locus_tag LOCUS_10850 11211 10762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 12991 11240 gene locus_tag LOCUS_10860 12991 11240 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920988.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence069 1049 579 gene locus_tag LOCUS_10870 gene ptsN 1049 579 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527726.1 protein_id gnl|my_center|LOCUS_10870 1672 1325 gene locus_tag LOCUS_10880 1672 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 4056 2026 gene locus_tag LOCUS_10890 4056 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 6852 4186 gene locus_tag LOCUS_10900 6852 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 7838 7098 gene locus_tag LOCUS_10910 7838 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 8578 7835 gene locus_tag LOCUS_10920 gene udk 8578 7835 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403303.1 protein_id gnl|my_center|LOCUS_10920 8663 9085 gene locus_tag LOCUS_10930 8663 9085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 9082 9507 gene locus_tag LOCUS_10940 9082 9507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 10967 9648 gene locus_tag LOCUS_10950 10967 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 12970 10961 gene locus_tag LOCUS_10960 12970 10961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 <13550 13044 gene locus_tag LOCUS_10970 <13550 13044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990688.1:leucine-rich repeat protein >Feature sequence070 5522 3192 gene locus_tag LOCUS_10980 5522 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 5677 7077 gene locus_tag LOCUS_10990 5677 7077 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_10990 8538 7138 gene locus_tag LOCUS_11000 gene selA 8538 7138 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_11000 8677 12378 gene locus_tag LOCUS_11010 8677 12378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 13198 12431 gene locus_tag LOCUS_11020 13198 12431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence071 225 1112 gene locus_tag LOCUS_11030 gene ftsX 225 1112 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393643.1 protein_id gnl|my_center|LOCUS_11030 1171 2187 gene locus_tag LOCUS_11040 1171 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 2289 3485 gene locus_tag LOCUS_11050 gene aruH 2289 3485 CDS product arginine--pyruvate transaminase AruH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102073.1 protein_id gnl|my_center|LOCUS_11050 3482 6445 gene locus_tag LOCUS_11060 3482 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 6720 6358 gene locus_tag LOCUS_11070 6720 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 6601 7428 gene locus_tag LOCUS_11080 6601 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 8010 7465 gene locus_tag LOCUS_11090 8010 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 8149 8544 gene locus_tag LOCUS_11100 8149 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 10173 8551 gene locus_tag LOCUS_11110 10173 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 12242 10173 gene locus_tag LOCUS_11120 12242 10173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 12583 12239 gene locus_tag LOCUS_11130 12583 12239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 13129 12737 gene locus_tag LOCUS_11140 13129 12737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence072 827 3769 gene locus_tag LOCUS_11150 827 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 4344 3748 gene locus_tag LOCUS_11160 4344 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 5351 4449 gene locus_tag LOCUS_11170 5351 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 5305 6696 gene locus_tag LOCUS_11180 5305 6696 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681529.1 protein_id gnl|my_center|LOCUS_11180 7519 6761 gene locus_tag LOCUS_11190 7519 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 9222 7642 gene locus_tag LOCUS_11200 9222 7642 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459733.1 protein_id gnl|my_center|LOCUS_11200 9960 9292 gene locus_tag LOCUS_11210 9960 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 11437 10085 gene locus_tag LOCUS_11220 11437 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 13173 11650 gene locus_tag LOCUS_11230 13173 11650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence073 <1 1048 gene locus_tag LOCUS_11240 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719380.1:adenylosuccinate lyase 1045 2826 gene locus_tag LOCUS_11250 1045 2826 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141209.1 protein_id gnl|my_center|LOCUS_11250 3560 2889 gene locus_tag LOCUS_11260 3560 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 4969 3539 gene locus_tag LOCUS_11270 4969 3539 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_11270 6668 4989 gene locus_tag LOCUS_11280 6668 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 7666 6686 gene locus_tag LOCUS_11290 7666 6686 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965824.1 protein_id gnl|my_center|LOCUS_11290 12476 7722 gene locus_tag LOCUS_11300 12476 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence074 891 730 gene locus_tag LOCUS_11310 gene rpmG 891 730 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630505.1 protein_id gnl|my_center|LOCUS_11310 2122 1076 gene locus_tag LOCUS_11320 2122 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 2277 3491 gene locus_tag LOCUS_11330 2277 3491 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921042.1 protein_id gnl|my_center|LOCUS_11330 3611 5551 gene locus_tag LOCUS_11340 3611 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 7056 5563 gene locus_tag LOCUS_11350 7056 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 7113 8108 gene locus_tag LOCUS_11360 gene epmA 7113 8108 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_11360 8549 8112 gene locus_tag LOCUS_11370 8549 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 8715 10253 gene locus_tag LOCUS_11380 8715 10253 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031187.1 protein_id gnl|my_center|LOCUS_11380 10264 11043 gene locus_tag LOCUS_11390 gene surE 10264 11043 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889023.1 protein_id gnl|my_center|LOCUS_11390 11364 11056 gene locus_tag LOCUS_11400 11364 11056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 12864 11389 gene locus_tag LOCUS_11410 12864 11389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence075 129 869 gene locus_tag LOCUS_11420 129 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 884 2545 gene locus_tag LOCUS_11430 884 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2545 3549 gene locus_tag LOCUS_11440 2545 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 3574 4353 gene locus_tag LOCUS_11450 3574 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 4410 5573 gene locus_tag LOCUS_11460 4410 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 5786 6904 gene locus_tag LOCUS_11470 gene xerC 5786 6904 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_11470 7075 9270 gene locus_tag LOCUS_11480 7075 9270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 9934 9407 gene locus_tag LOCUS_11490 9934 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 10032 10865 gene locus_tag LOCUS_11500 10032 10865 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060390007.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence076 178 1440 gene locus_tag LOCUS_11510 178 1440 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_11510 1539 2330 gene locus_tag LOCUS_11520 gene tpiA 1539 2330 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_11520 2359 2634 gene locus_tag LOCUS_11530 2359 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 2644 5196 gene locus_tag LOCUS_11540 2644 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 5193 6083 gene locus_tag LOCUS_11550 5193 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 6095 6517 gene locus_tag LOCUS_11560 6095 6517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 6514 7026 gene locus_tag LOCUS_11570 6514 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 7036 9300 gene locus_tag LOCUS_11580 7036 9300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 9297 10649 gene locus_tag LOCUS_11590 9297 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 12371 10848 gene locus_tag LOCUS_11600 12371 10848 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393354.1 protein_id gnl|my_center|LOCUS_11600 <13102 12400 gene locus_tag LOCUS_11610 <13102 12400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703979.1:hydroxymethylbilane synthase >Feature sequence077 345 103 gene locus_tag LOCUS_11620 345 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 362 970 gene locus_tag LOCUS_11630 362 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 2410 1055 gene locus_tag LOCUS_11640 2410 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 3573 2503 gene locus_tag LOCUS_11650 3573 2503 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226829.1 protein_id gnl|my_center|LOCUS_11650 3661 5739 gene locus_tag LOCUS_11660 3661 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 6136 5828 gene locus_tag LOCUS_11670 6136 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 6135 6290 gene locus_tag LOCUS_11680 6135 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 6381 6593 gene locus_tag LOCUS_11690 6381 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 6714 9179 gene locus_tag LOCUS_11700 6714 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 9253 9621 gene locus_tag LOCUS_11710 9253 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 9618 10568 gene locus_tag LOCUS_11720 9618 10568 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529902.1 protein_id gnl|my_center|LOCUS_11720 10572 12041 gene locus_tag LOCUS_11730 10572 12041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 12677 12081 gene locus_tag LOCUS_11740 12677 12081 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence078 1298 507 gene locus_tag LOCUS_11750 1298 507 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330172.1 protein_id gnl|my_center|LOCUS_11750 1638 2600 gene locus_tag LOCUS_11760 gene arcC 1638 2600 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_11760 2803 4155 gene locus_tag LOCUS_11770 2803 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 4341 5417 gene locus_tag LOCUS_11780 4341 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 5901 5512 gene locus_tag LOCUS_11790 5901 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 6030 6746 gene locus_tag LOCUS_11800 6030 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 8198 6876 gene locus_tag LOCUS_11810 8198 6876 CDS product DUF5690 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918537.1 protein_id gnl|my_center|LOCUS_11810 12213 8299 gene locus_tag LOCUS_11820 12213 8299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence079 1053 58 gene locus_tag LOCUS_11830 1053 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1214 2101 gene locus_tag LOCUS_11840 gene dapA 1214 2101 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_11840 2171 3016 gene locus_tag LOCUS_11850 gene dapB 2171 3016 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119175.1 protein_id gnl|my_center|LOCUS_11850 3089 5155 gene locus_tag LOCUS_11860 gene glyS 3089 5155 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_11860 6599 5181 gene locus_tag LOCUS_11870 gene rsmB 6599 5181 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674551.1 protein_id gnl|my_center|LOCUS_11870 8281 6596 gene locus_tag LOCUS_11880 8281 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 9551 8304 gene locus_tag LOCUS_11890 9551 8304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 9756 10013 gene locus_tag LOCUS_11900 9756 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 9997 10635 gene locus_tag LOCUS_11910 9997 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 11335 10727 gene locus_tag LOCUS_11920 11335 10727 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_11920 12577 11477 gene locus_tag LOCUS_11930 gene atpG 12577 11477 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence080 1460 303 gene locus_tag LOCUS_11940 1460 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 2249 1677 gene locus_tag LOCUS_11950 2249 1677 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063748799.1 protein_id gnl|my_center|LOCUS_11950 2444 3487 gene locus_tag LOCUS_11960 2444 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 3484 4203 gene locus_tag LOCUS_11970 3484 4203 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267698.1 protein_id gnl|my_center|LOCUS_11970 4270 5457 gene locus_tag LOCUS_11980 4270 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 5703 7802 gene locus_tag LOCUS_11990 5703 7802 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_11990 8736 7903 gene locus_tag LOCUS_12000 8736 7903 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_12000 9264 10418 gene locus_tag LOCUS_12010 9264 10418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 10429 12051 gene locus_tag LOCUS_12020 10429 12051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 <12867 12078 gene locus_tag LOCUS_12030 <12867 12078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000498060.1:VWA domain-containing protein >Feature sequence081 164 928 gene locus_tag LOCUS_12040 gene phoU 164 928 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_12040 1000 2022 gene locus_tag LOCUS_12050 gene fbp 1000 2022 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171118.1 protein_id gnl|my_center|LOCUS_12050 2196 2804 gene locus_tag LOCUS_12060 2196 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 2810 3931 gene locus_tag LOCUS_12070 2810 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 4877 3942 gene locus_tag LOCUS_12080 4877 3942 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390361.1 protein_id gnl|my_center|LOCUS_12080 4996 5775 gene locus_tag LOCUS_12090 4996 5775 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941515.1 protein_id gnl|my_center|LOCUS_12090 5908 6402 gene locus_tag LOCUS_12100 5908 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 6392 7231 gene locus_tag LOCUS_12110 6392 7231 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920880.1 protein_id gnl|my_center|LOCUS_12110 7242 7634 gene locus_tag LOCUS_12120 7242 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence082 3219 2428 gene locus_tag LOCUS_12130 3219 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 3459 4766 gene locus_tag LOCUS_12140 3459 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 4763 5974 gene locus_tag LOCUS_12150 4763 5974 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228728.1 protein_id gnl|my_center|LOCUS_12150 6906 6040 gene locus_tag LOCUS_12160 6906 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 7277 8497 gene locus_tag LOCUS_12170 7277 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 9442 8540 gene locus_tag LOCUS_12180 9442 8540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 10296 9460 gene locus_tag LOCUS_12190 10296 9460 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_12190 10400 11047 gene locus_tag LOCUS_12200 10400 11047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence083 3918 4856 gene locus_tag LOCUS_12210 3918 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 4870 6006 gene locus_tag LOCUS_12220 4870 6006 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_12220 7374 6019 gene locus_tag LOCUS_12230 7374 6019 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 protein_id gnl|my_center|LOCUS_12230 7482 8483 gene locus_tag LOCUS_12240 7482 8483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_12240 8480 9211 gene locus_tag LOCUS_12250 8480 9211 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487316.1 protein_id gnl|my_center|LOCUS_12250 9202 11274 gene locus_tag LOCUS_12260 9202 11274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 10732 10659 gene locus_tag LOCUS_t00110 10732 10659 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence084 307 834 gene locus_tag LOCUS_12270 307 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 827 1018 gene locus_tag LOCUS_12280 827 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1933 1091 gene locus_tag LOCUS_12290 1933 1091 CDS product DUF3050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219159941.1 protein_id gnl|my_center|LOCUS_12290 3626 2019 gene locus_tag LOCUS_12300 3626 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 3697 5010 gene locus_tag LOCUS_12310 3697 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 5498 5163 gene locus_tag LOCUS_12320 5498 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 6758 5577 gene locus_tag LOCUS_12330 6758 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 7728 6850 gene locus_tag LOCUS_12340 7728 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 9118 7811 gene locus_tag LOCUS_12350 gene tyrS 9118 7811 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332625.1 protein_id gnl|my_center|LOCUS_12350 9257 9730 gene locus_tag LOCUS_12360 9257 9730 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405007.1 protein_id gnl|my_center|LOCUS_12360 9905 10984 gene locus_tag LOCUS_12370 9905 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence085 82 2088 gene locus_tag LOCUS_12380 82 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 2665 2168 gene locus_tag LOCUS_12390 2665 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 3377 2871 gene locus_tag LOCUS_12400 3377 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 4059 4135 gene locus_tag LOCUS_t00120 4059 4135 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5130 4219 gene locus_tag LOCUS_12410 5130 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 6056 5172 gene locus_tag LOCUS_12420 6056 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 6883 6053 gene locus_tag LOCUS_12430 6883 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 6988 9099 gene locus_tag LOCUS_12440 6988 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 10047 9295 gene locus_tag LOCUS_12450 10047 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 11699 10071 gene locus_tag LOCUS_12460 11699 10071 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence086 561 1061 gene locus_tag LOCUS_12470 561 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1134 1415 gene locus_tag LOCUS_12480 1134 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1445 2248 gene locus_tag LOCUS_12490 1445 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 2355 2618 gene locus_tag LOCUS_12500 2355 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 2615 3031 gene locus_tag LOCUS_12510 2615 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3224 6745 gene locus_tag LOCUS_12520 3224 6745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 7959 6733 gene locus_tag LOCUS_12530 7959 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 9686 7962 gene locus_tag LOCUS_12540 9686 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 9838 10572 gene locus_tag LOCUS_12550 9838 10572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 11497 10598 gene locus_tag LOCUS_12560 11497 10598 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_12560 11496 11819 gene locus_tag LOCUS_12570 11496 11819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence087 537 1355 gene locus_tag LOCUS_12580 537 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 2338 1382 gene locus_tag LOCUS_12590 2338 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2882 4318 gene locus_tag LOCUS_12600 2882 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 6093 4408 gene locus_tag LOCUS_12610 6093 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 6385 8247 gene locus_tag LOCUS_12620 6385 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 10775 8358 gene locus_tag LOCUS_12630 10775 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 11749 10772 gene locus_tag LOCUS_12640 gene fni 11749 10772 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259707.1 protein_id gnl|my_center|LOCUS_12640 11774 12046 gene locus_tag LOCUS_12650 11774 12046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence088 97 501 gene locus_tag LOCUS_12660 97 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1086 541 gene locus_tag LOCUS_12670 1086 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1241 1561 gene locus_tag LOCUS_12680 1241 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1558 2283 gene locus_tag LOCUS_12690 1558 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 2424 3356 gene locus_tag LOCUS_12700 2424 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 4232 3402 gene locus_tag LOCUS_12710 4232 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 5673 4246 gene locus_tag LOCUS_12720 5673 4246 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337399.1 protein_id gnl|my_center|LOCUS_12720 5806 6846 gene locus_tag LOCUS_12730 5806 6846 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257018.1 protein_id gnl|my_center|LOCUS_12730 7596 6886 gene locus_tag LOCUS_12740 7596 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 11745 7744 gene locus_tag LOCUS_12750 11745 7744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence089 1393 185 gene locus_tag LOCUS_12760 1393 185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064073.1 protein_id gnl|my_center|LOCUS_12760 2349 1393 gene locus_tag LOCUS_12770 2349 1393 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256819.1 protein_id gnl|my_center|LOCUS_12770 3534 2410 gene locus_tag LOCUS_12780 3534 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 3467 3634 gene locus_tag LOCUS_12790 3467 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 3838 4500 gene locus_tag LOCUS_12800 3838 4500 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098139.1 protein_id gnl|my_center|LOCUS_12800 4552 4974 gene locus_tag LOCUS_12810 4552 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 5126 7954 gene locus_tag LOCUS_12820 5126 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 8006 8971 gene locus_tag LOCUS_12830 8006 8971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 9503 10048 gene locus_tag LOCUS_12840 9503 10048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 10156 11748 gene locus_tag LOCUS_12850 10156 11748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence090 1152 628 gene locus_tag LOCUS_12860 1152 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1214 2674 gene locus_tag LOCUS_12870 1214 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 2684 3913 gene locus_tag LOCUS_12880 2684 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 4128 4412 gene locus_tag LOCUS_12890 4128 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 8833 4409 gene locus_tag LOCUS_12900 8833 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 9019 10248 gene locus_tag LOCUS_12910 9019 10248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 10342 11286 gene locus_tag LOCUS_12920 10342 11286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence091 133 1170 gene locus_tag LOCUS_12930 133 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 2965 1355 gene locus_tag LOCUS_12940 2965 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 4266 2965 gene locus_tag LOCUS_12950 4266 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 5731 4352 gene locus_tag LOCUS_12960 5731 4352 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_12960 8266 5936 gene locus_tag LOCUS_12970 8266 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 8294 8998 gene locus_tag LOCUS_12980 8294 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 9170 11137 gene locus_tag LOCUS_12990 9170 11137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence092 1502 282 gene locus_tag LOCUS_13000 1502 282 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_13000 1730 3310 gene locus_tag LOCUS_13010 1730 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 3429 3857 gene locus_tag LOCUS_13020 3429 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 3865 5061 gene locus_tag LOCUS_13030 3865 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 7493 5139 gene locus_tag LOCUS_13040 7493 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 9118 7694 gene locus_tag LOCUS_13050 9118 7694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 8123 8049 gene locus_tag LOCUS_t00130 8123 8049 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9454 9528 gene locus_tag LOCUS_t00140 9454 9528 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 9727 9912 gene locus_tag LOCUS_13060 9727 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 11764 10229 gene locus_tag LOCUS_13070 11764 10229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence093 <1 1008 gene locus_tag LOCUS_13080 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014876813.1:long-chain-fatty-acid--CoA ligase FadD2 1005 2111 gene locus_tag LOCUS_13090 gene dnaJ 1005 2111 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_13090 2111 2941 gene locus_tag LOCUS_13100 2111 2941 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941117.1 protein_id gnl|my_center|LOCUS_13100 3068 3646 gene locus_tag LOCUS_13110 3068 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 4443 3760 gene locus_tag LOCUS_13120 4443 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 4783 4445 gene locus_tag LOCUS_13130 4783 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 4916 7279 gene locus_tag LOCUS_13140 4916 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 7467 8393 gene locus_tag LOCUS_13150 gene hemH 7467 8393 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887774.1 protein_id gnl|my_center|LOCUS_13150 8494 11322 gene locus_tag LOCUS_13160 8494 11322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 11644 11384 gene locus_tag LOCUS_13170 11644 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence094 105 410 gene locus_tag LOCUS_13180 105 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1545 454 gene locus_tag LOCUS_13190 1545 454 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_13190 1752 3878 gene locus_tag LOCUS_13200 1752 3878 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073633.1 protein_id gnl|my_center|LOCUS_13200 4109 5005 gene locus_tag LOCUS_13210 4109 5005 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_13210 5002 6297 gene locus_tag LOCUS_13220 5002 6297 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876950.1 protein_id gnl|my_center|LOCUS_13220 6294 7421 gene locus_tag LOCUS_13230 6294 7421 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 protein_id gnl|my_center|LOCUS_13230 7429 8478 gene locus_tag LOCUS_13240 7429 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 10693 8534 gene locus_tag LOCUS_13250 10693 8534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence095 554 949 gene locus_tag LOCUS_13260 554 949 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939195.1 protein_id gnl|my_center|LOCUS_13260 946 2487 gene locus_tag LOCUS_13270 946 2487 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_13270 2797 3279 gene locus_tag LOCUS_13280 2797 3279 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_13280 3681 3325 gene locus_tag LOCUS_13290 3681 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 3793 4047 gene locus_tag LOCUS_13300 3793 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 4049 5527 gene locus_tag LOCUS_13310 4049 5527 CDS product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030516.1 protein_id gnl|my_center|LOCUS_13310 6752 5625 gene locus_tag LOCUS_13320 6752 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 8317 6920 gene locus_tag LOCUS_13330 8317 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 9474 8371 gene locus_tag LOCUS_13340 9474 8371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 9473 10057 gene locus_tag LOCUS_13350 9473 10057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 10443 10066 gene locus_tag LOCUS_13360 10443 10066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 10691 10440 gene locus_tag LOCUS_13370 10691 10440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 <11707 10824 gene locus_tag LOCUS_13380 <11707 10824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390713.1:bifunctional riboflavin kinase/FAD synthetase >Feature sequence096 237 1013 gene locus_tag LOCUS_13390 237 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 2012 1086 gene locus_tag LOCUS_13400 2012 1086 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 protein_id gnl|my_center|LOCUS_13400 2226 2561 gene locus_tag LOCUS_13410 2226 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2700 4085 gene locus_tag LOCUS_13420 2700 4085 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_13420 4246 4611 gene locus_tag LOCUS_13430 4246 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 5849 4647 gene locus_tag LOCUS_13440 gene gspE 5849 4647 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478662.1 protein_id gnl|my_center|LOCUS_13440 6070 6810 gene locus_tag LOCUS_13450 6070 6810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 6807 8309 gene locus_tag LOCUS_13460 6807 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 8344 9369 gene locus_tag LOCUS_13470 8344 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 9733 9434 gene locus_tag LOCUS_13480 9733 9434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 <11463 9793 gene locus_tag LOCUS_13490 <11463 9793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186939.1:choline-sulfatase >Feature sequence097 <1 741 gene locus_tag LOCUS_13500 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_044233899.1:polyphosphate kinase 1 738 2234 gene locus_tag LOCUS_13510 gene hemG 738 2234 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056229.1 protein_id gnl|my_center|LOCUS_13510 2311 3567 gene locus_tag LOCUS_13520 2311 3567 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809440.1 protein_id gnl|my_center|LOCUS_13520 4570 3605 gene locus_tag LOCUS_13530 gene argC 4570 3605 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037387.1 protein_id gnl|my_center|LOCUS_13530 5888 4563 gene locus_tag LOCUS_13540 5888 4563 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055042.1 protein_id gnl|my_center|LOCUS_13540 6883 5885 gene locus_tag LOCUS_13550 6883 5885 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037393.1 protein_id gnl|my_center|LOCUS_13550 9023 7263 gene locus_tag LOCUS_13560 9023 7263 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350815.1 protein_id gnl|my_center|LOCUS_13560 9158 10240 gene locus_tag LOCUS_13570 9158 10240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 10434 10180 gene locus_tag LOCUS_13580 10434 10180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence098 366 899 gene locus_tag LOCUS_13590 366 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1224 2372 gene locus_tag LOCUS_13600 1224 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 2928 2413 gene locus_tag LOCUS_13610 2928 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 2947 3657 gene locus_tag LOCUS_13620 2947 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 4217 3828 gene locus_tag LOCUS_13630 4217 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 5259 4234 gene locus_tag LOCUS_13640 5259 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 6657 5401 gene locus_tag LOCUS_13650 gene guaD 6657 5401 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189962.1 protein_id gnl|my_center|LOCUS_13650 7365 6748 gene locus_tag LOCUS_13660 7365 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 8354 7362 gene locus_tag LOCUS_13670 8354 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 10812 8539 gene locus_tag LOCUS_13680 10812 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 11171 10809 gene locus_tag LOCUS_13690 11171 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence099 <1 1216 gene locus_tag LOCUS_13700 <1 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940711.1:molecular chaperone DnaK 1240 2706 gene locus_tag LOCUS_13710 1240 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 2709 3296 gene locus_tag LOCUS_13720 gene thiE 2709 3296 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_13720 3370 7137 gene locus_tag LOCUS_13730 3370 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 8450 7233 gene locus_tag LOCUS_13740 8450 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 8503 9288 gene locus_tag LOCUS_13750 8503 9288 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529202.1 protein_id gnl|my_center|LOCUS_13750 9385 10047 gene locus_tag LOCUS_13760 9385 10047 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867275.1 protein_id gnl|my_center|LOCUS_13760 10155 10922 gene locus_tag LOCUS_13770 gene otsB 10155 10922 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942972.1 protein_id gnl|my_center|LOCUS_13770 10975 10902 gene locus_tag LOCUS_t00150 10975 10902 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence100 900 235 gene locus_tag LOCUS_13780 gene clpP 900 235 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 protein_id gnl|my_center|LOCUS_13780 2281 1025 gene locus_tag LOCUS_13790 gene tig 2281 1025 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942437.1 protein_id gnl|my_center|LOCUS_13790 2688 2488 gene locus_tag LOCUS_13800 2688 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 2810 3577 gene locus_tag LOCUS_13810 2810 3577 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_13810 3626 4576 gene locus_tag LOCUS_13820 3626 4576 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_13820 5806 4682 gene locus_tag LOCUS_13830 5806 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 8540 5790 gene locus_tag LOCUS_13840 gene glnD 8540 5790 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_13840 8703 9725 gene locus_tag LOCUS_13850 gene moaA 8703 9725 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417297.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence101 240 971 gene locus_tag LOCUS_13860 240 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 2083 1502 gene locus_tag LOCUS_13870 2083 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 2228 4366 gene locus_tag LOCUS_13880 2228 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 6071 4473 gene locus_tag LOCUS_13890 6071 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 7203 6097 gene locus_tag LOCUS_13900 7203 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 7294 8814 gene locus_tag LOCUS_13910 7294 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 8957 10276 gene locus_tag LOCUS_13920 8957 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 10433 10849 gene locus_tag LOCUS_13930 10433 10849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence102 846 256 gene locus_tag LOCUS_13940 846 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2042 843 gene locus_tag LOCUS_13950 2042 843 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761791.1 protein_id gnl|my_center|LOCUS_13950 2872 2039 gene locus_tag LOCUS_13960 2872 2039 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898971.1 protein_id gnl|my_center|LOCUS_13960 3462 3010 gene locus_tag LOCUS_13970 3462 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 4639 3473 gene locus_tag LOCUS_13980 4639 3473 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408274.1 protein_id gnl|my_center|LOCUS_13980 4910 6028 gene locus_tag LOCUS_13990 4910 6028 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088351.1 protein_id gnl|my_center|LOCUS_13990 6288 6866 gene locus_tag LOCUS_14000 6288 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 6959 7258 gene locus_tag LOCUS_14010 6959 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 7286 8584 gene locus_tag LOCUS_14020 7286 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 8613 8792 gene locus_tag LOCUS_14030 8613 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 9751 8918 gene locus_tag LOCUS_14040 gene ubiE 9751 8918 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_14040 10758 9748 gene locus_tag LOCUS_14050 gene aroF 10758 9748 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence103 447 887 gene locus_tag LOCUS_14060 447 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 2305 899 gene locus_tag LOCUS_14070 2305 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 2702 2322 gene locus_tag LOCUS_14080 2702 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 3347 2853 gene locus_tag LOCUS_14090 3347 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 3525 4553 gene locus_tag LOCUS_14100 3525 4553 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204915.1 protein_id gnl|my_center|LOCUS_14100 5477 4569 gene locus_tag LOCUS_14110 5477 4569 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878082.1 protein_id gnl|my_center|LOCUS_14110 5385 6785 gene locus_tag LOCUS_14120 5385 6785 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 protein_id gnl|my_center|LOCUS_14120 7818 6775 gene locus_tag LOCUS_14130 7818 6775 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388795.1 protein_id gnl|my_center|LOCUS_14130 8037 8432 gene locus_tag LOCUS_14140 8037 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 8456 8947 gene locus_tag LOCUS_14150 8456 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 9072 9737 gene locus_tag LOCUS_14160 9072 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 <11077 9785 gene locus_tag LOCUS_14170 <11077 9785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003118645.1:DEAD/DEAH box helicase >Feature sequence104 44 673 gene locus_tag LOCUS_14180 gene rpsD 44 673 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_14180 850 1869 gene locus_tag LOCUS_14190 850 1869 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_14190 1957 2451 gene locus_tag LOCUS_14200 gene rplQ 1957 2451 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036134.1 protein_id gnl|my_center|LOCUS_14200 4353 2470 gene locus_tag LOCUS_14210 4353 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 4635 4357 gene locus_tag LOCUS_14220 4635 4357 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_14220 4785 6569 gene locus_tag LOCUS_14230 4785 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 6599 7693 gene locus_tag LOCUS_14240 6599 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 9114 7765 gene locus_tag LOCUS_14250 9114 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 10297 9140 gene locus_tag LOCUS_14260 10297 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 11076 10408 gene locus_tag LOCUS_14270 11076 10408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence105 3060 757 gene locus_tag LOCUS_14280 3060 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 3134 4552 gene locus_tag LOCUS_14290 3134 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 6705 4582 gene locus_tag LOCUS_14300 6705 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 6873 7868 gene locus_tag LOCUS_14310 6873 7868 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_14310 7931 8782 gene locus_tag LOCUS_14320 gene nadC 7931 8782 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_14320 8869 9669 gene locus_tag LOCUS_14330 8869 9669 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877512.1 protein_id gnl|my_center|LOCUS_14330 9660 10334 gene locus_tag LOCUS_14340 gene queE 9660 10334 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_14340 <11066 10393 gene locus_tag LOCUS_14350 <11066 10393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005454699.1:class 1 fructose-bisphosphatase >Feature sequence106 1098 676 gene locus_tag LOCUS_14360 1098 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1204 1803 gene locus_tag LOCUS_14370 1204 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 2014 3618 gene locus_tag LOCUS_14380 2014 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 3632 4987 gene locus_tag LOCUS_14390 3632 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 5052 6566 gene locus_tag LOCUS_14400 5052 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 6563 7528 gene locus_tag LOCUS_14410 6563 7528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 7561 7989 gene locus_tag LOCUS_14420 7561 7989 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_14420 8015 8845 gene locus_tag LOCUS_14430 8015 8845 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057477.1 protein_id gnl|my_center|LOCUS_14430 8965 9600 gene locus_tag LOCUS_14440 8965 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 10821 9691 gene locus_tag LOCUS_14450 gene larC 10821 9691 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940817.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence107 509 99 gene locus_tag LOCUS_14460 509 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1224 511 gene locus_tag LOCUS_14470 1224 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 3036 1576 gene locus_tag LOCUS_14480 3036 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 5824 3050 gene locus_tag LOCUS_14490 5824 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 7460 5856 gene locus_tag LOCUS_14500 7460 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 7896 7504 gene locus_tag LOCUS_14510 7896 7504 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065296.1 protein_id gnl|my_center|LOCUS_14510 10041 7984 gene locus_tag LOCUS_14520 10041 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 10864 10403 gene locus_tag LOCUS_14530 10864 10403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence108 239 1156 gene locus_tag LOCUS_14540 239 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1330 2463 gene locus_tag LOCUS_14550 1330 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2721 3902 gene locus_tag LOCUS_14560 2721 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 4094 5248 gene locus_tag LOCUS_14570 gene pdhA 4094 5248 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535910.1 protein_id gnl|my_center|LOCUS_14570 5475 6449 gene locus_tag LOCUS_14580 5475 6449 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227794.1 protein_id gnl|my_center|LOCUS_14580 6475 7896 gene locus_tag LOCUS_14590 6475 7896 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227796.1 protein_id gnl|my_center|LOCUS_14590 8022 9077 gene locus_tag LOCUS_14600 8022 9077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence109 1907 555 gene locus_tag LOCUS_14610 1907 555 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925100.1 protein_id gnl|my_center|LOCUS_14610 2024 3688 gene locus_tag LOCUS_14620 2024 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 4257 3748 gene locus_tag LOCUS_14630 gene folK 4257 3748 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_14630 4290 5180 gene locus_tag LOCUS_14640 4290 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 5287 6693 gene locus_tag LOCUS_14650 gene lpdA 5287 6693 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118855.1 protein_id gnl|my_center|LOCUS_14650 7707 6730 gene locus_tag LOCUS_14660 7707 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 7803 7879 gene locus_tag LOCUS_t00160 7803 7879 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7825 8523 gene locus_tag LOCUS_14670 7825 8523 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_14670 10497 8629 gene locus_tag LOCUS_14680 10497 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence110 145 654 gene locus_tag LOCUS_14690 145 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 866 1087 gene locus_tag LOCUS_14700 866 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1170 2399 gene locus_tag LOCUS_14710 1170 2399 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038940.1 protein_id gnl|my_center|LOCUS_14710 2375 2599 gene locus_tag LOCUS_14720 2375 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 4473 2683 gene locus_tag LOCUS_14730 4473 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 5509 4631 gene locus_tag LOCUS_14740 5509 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 6513 5572 gene locus_tag LOCUS_14750 6513 5572 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388517.1 protein_id gnl|my_center|LOCUS_14750 6733 8529 gene locus_tag LOCUS_14760 6733 8529 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_14760 8537 9274 gene locus_tag LOCUS_14770 8537 9274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 10593 9337 gene locus_tag LOCUS_14780 10593 9337 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064064.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence111 215 2053 gene locus_tag LOCUS_14790 215 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 2970 2122 gene locus_tag LOCUS_14800 2970 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 3213 4124 gene locus_tag LOCUS_14810 3213 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 4180 5226 gene locus_tag LOCUS_14820 4180 5226 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228908.1 protein_id gnl|my_center|LOCUS_14820 5265 6257 gene locus_tag LOCUS_14830 gene bioB 5265 6257 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125254.1 protein_id gnl|my_center|LOCUS_14830 7517 6297 gene locus_tag LOCUS_14840 7517 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 8611 7625 gene locus_tag LOCUS_14850 8611 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 9235 8615 gene locus_tag LOCUS_14860 9235 8615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 9729 9472 gene locus_tag LOCUS_14870 9729 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 9976 9794 gene locus_tag LOCUS_14880 9976 9794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 10118 10191 gene locus_tag LOCUS_t00170 10118 10191 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence112 2037 3107 gene locus_tag LOCUS_14890 2037 3107 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114124.1 protein_id gnl|my_center|LOCUS_14890 3164 3670 gene locus_tag LOCUS_14900 3164 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 5186 3771 gene locus_tag LOCUS_14910 5186 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 5469 5197 gene locus_tag LOCUS_14920 5469 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 6549 5770 gene locus_tag LOCUS_14930 6549 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 6542 7360 gene locus_tag LOCUS_14940 6542 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 7357 8157 gene locus_tag LOCUS_14950 gene map 7357 8157 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_14950 9971 8199 gene locus_tag LOCUS_14960 gene recN 9971 8199 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence113 1840 1328 gene locus_tag LOCUS_14970 1840 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 3899 1866 gene locus_tag LOCUS_14980 3899 1866 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888294.1 protein_id gnl|my_center|LOCUS_14980 4414 3980 gene locus_tag LOCUS_14990 4414 3980 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199022.1 protein_id gnl|my_center|LOCUS_14990 5773 4538 gene locus_tag LOCUS_15000 5773 4538 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963806.1 protein_id gnl|my_center|LOCUS_15000 6745 5936 gene locus_tag LOCUS_15010 gene dapF 6745 5936 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765061.1 protein_id gnl|my_center|LOCUS_15010 7273 6755 gene locus_tag LOCUS_15020 7273 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 8145 7270 gene locus_tag LOCUS_15030 8145 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 8951 8172 gene locus_tag LOCUS_15040 8951 8172 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence114 242 1231 gene locus_tag LOCUS_15050 242 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1410 2243 gene locus_tag LOCUS_15060 1410 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2767 2366 gene locus_tag LOCUS_15070 2767 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2850 3416 gene locus_tag LOCUS_15080 2850 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 4325 3534 gene locus_tag LOCUS_15090 4325 3534 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030841.1 protein_id gnl|my_center|LOCUS_15090 5433 4336 gene locus_tag LOCUS_15100 5433 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 8476 5468 gene locus_tag LOCUS_15110 8476 5468 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729310.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence115 769 215 gene locus_tag LOCUS_15120 769 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 860 2380 gene locus_tag LOCUS_15130 860 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 2824 2393 gene locus_tag LOCUS_15140 2824 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 7782 2941 gene locus_tag LOCUS_15150 7782 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 7970 9670 gene locus_tag LOCUS_15160 7970 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 10278 9850 gene locus_tag LOCUS_15170 10278 9850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence116 325 2097 gene locus_tag LOCUS_15180 325 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 2278 4455 gene locus_tag LOCUS_15190 2278 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 5352 4486 gene locus_tag LOCUS_15200 5352 4486 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289198.1 protein_id gnl|my_center|LOCUS_15200 5480 5845 gene locus_tag LOCUS_15210 5480 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 6341 7009 gene locus_tag LOCUS_15220 6341 7009 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 protein_id gnl|my_center|LOCUS_15220 7006 8310 gene locus_tag LOCUS_15230 7006 8310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 8663 8334 gene locus_tag LOCUS_15240 8663 8334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 8830 9765 gene locus_tag LOCUS_15250 8830 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence117 2086 308 gene locus_tag LOCUS_15260 2086 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 2219 3166 gene locus_tag LOCUS_15270 2219 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 3163 3948 gene locus_tag LOCUS_15280 3163 3948 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229158.1 protein_id gnl|my_center|LOCUS_15280 4817 3945 gene locus_tag LOCUS_15290 4817 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 6757 5003 gene locus_tag LOCUS_15300 6757 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 7263 7751 gene locus_tag LOCUS_15310 7263 7751 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083317.1 protein_id gnl|my_center|LOCUS_15310 <10037 7860 gene locus_tag LOCUS_15320 <10037 7860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940824.1:alanine--tRNA ligase >Feature sequence118 69 473 gene locus_tag LOCUS_15330 69 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 476 2617 gene locus_tag LOCUS_15340 476 2617 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_15340 2639 3082 gene locus_tag LOCUS_15350 2639 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 3175 4506 gene locus_tag LOCUS_15360 3175 4506 CDS product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038459.1 protein_id gnl|my_center|LOCUS_15360 4871 4545 gene locus_tag LOCUS_15370 4871 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 6100 4943 gene locus_tag LOCUS_15380 6100 4943 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095359.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence119 357 938 gene locus_tag LOCUS_15390 357 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 2310 1045 gene locus_tag LOCUS_15400 2310 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 3986 2307 gene locus_tag LOCUS_15410 3986 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 7244 4059 gene locus_tag LOCUS_15420 7244 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 7768 7310 gene locus_tag LOCUS_15430 gene greA 7768 7310 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390637.1 protein_id gnl|my_center|LOCUS_15430 8251 7892 gene locus_tag LOCUS_15440 8251 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 9162 8248 gene locus_tag LOCUS_15450 9162 8248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence120 318 611 gene locus_tag LOCUS_15460 318 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1727 654 gene locus_tag LOCUS_15470 1727 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3603 1834 gene locus_tag LOCUS_15480 3603 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 4783 3680 gene locus_tag LOCUS_15490 gene tsaD 4783 3680 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_15490 8997 4780 gene locus_tag LOCUS_15500 8997 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence121 1569 448 gene locus_tag LOCUS_15510 1569 448 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329631.1 protein_id gnl|my_center|LOCUS_15510 2347 1571 gene locus_tag LOCUS_15520 gene fliR 2347 1571 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705283.1 protein_id gnl|my_center|LOCUS_15520 2639 2370 gene locus_tag LOCUS_15530 2639 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 3418 2636 gene locus_tag LOCUS_15540 3418 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 4467 3424 gene locus_tag LOCUS_15550 4467 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 4793 4464 gene locus_tag LOCUS_15560 4793 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 5911 4865 gene locus_tag LOCUS_15570 5911 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 6414 5908 gene locus_tag LOCUS_15580 6414 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 7749 6454 gene locus_tag LOCUS_15590 7749 6454 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941087.1 protein_id gnl|my_center|LOCUS_15590 8561 7746 gene locus_tag LOCUS_15600 8561 7746 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941085.1 protein_id gnl|my_center|LOCUS_15600 9731 8595 gene locus_tag LOCUS_15610 9731 8595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence122 316 1164 gene locus_tag LOCUS_15620 316 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1407 3029 gene locus_tag LOCUS_15630 1407 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 3102 4058 gene locus_tag LOCUS_15640 3102 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 4058 4891 gene locus_tag LOCUS_15650 4058 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 5013 6479 gene locus_tag LOCUS_15660 5013 6479 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963862.1 protein_id gnl|my_center|LOCUS_15660 7396 6527 gene locus_tag LOCUS_15670 7396 6527 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405888.1 protein_id gnl|my_center|LOCUS_15670 7499 9415 gene locus_tag LOCUS_15680 gene htpG 7499 9415 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943026.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence123 1315 2826 gene locus_tag LOCUS_15690 1315 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 2823 4451 gene locus_tag LOCUS_15700 2823 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 6023 4503 gene locus_tag LOCUS_15710 6023 4503 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_15710 7606 6020 gene locus_tag LOCUS_15720 7606 6020 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_15720 8830 7637 gene locus_tag LOCUS_15730 8830 7637 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529879.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence124 234 1052 gene locus_tag LOCUS_15740 234 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1094 2347 gene locus_tag LOCUS_15750 1094 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2503 2751 gene locus_tag LOCUS_15760 2503 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 7017 2809 gene locus_tag LOCUS_15770 7017 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 8209 7181 gene locus_tag LOCUS_15780 8209 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 9167 8223 gene locus_tag LOCUS_15790 9167 8223 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932656.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence125 <1 708 gene locus_tag LOCUS_15800 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391688.1:pantoate--beta-alanine ligase 705 1361 gene locus_tag LOCUS_15810 gene tmk 705 1361 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_15810 2987 1440 gene locus_tag LOCUS_15820 2987 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 3194 5185 gene locus_tag LOCUS_15830 3194 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 5979 5248 gene locus_tag LOCUS_15840 5979 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 7049 5976 gene locus_tag LOCUS_15850 7049 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 8725 7082 gene locus_tag LOCUS_15860 8725 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 <9536 8793 gene locus_tag LOCUS_15870 <9536 8793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229645.1:acyl-CoA dehydrogenase family protein >Feature sequence126 <1 1078 gene locus_tag LOCUS_15880 <1 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037513.1:phosphoenolpyruvate--protein phosphotransferase 2778 1096 gene locus_tag LOCUS_15890 2778 1096 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090623.1 protein_id gnl|my_center|LOCUS_15890 2877 3596 gene locus_tag LOCUS_15900 gene thiF 2877 3596 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821634.1 protein_id gnl|my_center|LOCUS_15900 3608 3880 gene locus_tag LOCUS_15910 3608 3880 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_15910 3892 4272 gene locus_tag LOCUS_15920 3892 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 4269 4811 gene locus_tag LOCUS_15930 4269 4811 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106151.1 protein_id gnl|my_center|LOCUS_15930 4808 6097 gene locus_tag LOCUS_15940 4808 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 6171 7832 gene locus_tag LOCUS_15950 6171 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 7829 9283 gene locus_tag LOCUS_15960 7829 9283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence127 1812 1162 gene locus_tag LOCUS_15970 1812 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 2122 1727 gene locus_tag LOCUS_15980 2122 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 2559 2146 gene locus_tag LOCUS_15990 2559 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 5094 2578 gene locus_tag LOCUS_16000 5094 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 6040 5222 gene locus_tag LOCUS_16010 gene argB 6040 5222 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869561.1 protein_id gnl|my_center|LOCUS_16010 7107 6055 gene locus_tag LOCUS_16020 gene argC 7107 6055 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978134.1 protein_id gnl|my_center|LOCUS_16020 7312 8499 gene locus_tag LOCUS_16030 7312 8499 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267549.1 protein_id gnl|my_center|LOCUS_16030 9355 8573 gene locus_tag LOCUS_16040 9355 8573 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence128 299 2146 gene locus_tag LOCUS_16050 299 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 2281 2811 gene locus_tag LOCUS_16060 2281 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 3007 4113 gene locus_tag LOCUS_16070 3007 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 6022 4172 gene locus_tag LOCUS_16080 6022 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 6840 6022 gene locus_tag LOCUS_16090 6840 6022 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898651.1 protein_id gnl|my_center|LOCUS_16090 7730 6837 gene locus_tag LOCUS_16100 7730 6837 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066537.1 protein_id gnl|my_center|LOCUS_16100 9022 7730 gene locus_tag LOCUS_16110 9022 7730 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898649.1 protein_id gnl|my_center|LOCUS_16110 9360 9019 gene locus_tag LOCUS_16120 9360 9019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence129 69 1244 gene locus_tag LOCUS_16130 69 1244 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941824.1 protein_id gnl|my_center|LOCUS_16130 1319 2485 gene locus_tag LOCUS_16140 1319 2485 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941825.1 protein_id gnl|my_center|LOCUS_16140 2531 3139 gene locus_tag LOCUS_16150 2531 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 4191 3343 gene locus_tag LOCUS_16160 4191 3343 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_16160 4335 5597 gene locus_tag LOCUS_16170 4335 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 6762 5599 gene locus_tag LOCUS_16180 6762 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 6998 8182 gene locus_tag LOCUS_16190 6998 8182 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_16190 8334 9173 gene locus_tag LOCUS_16200 8334 9173 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971164.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence130 <1 549 gene locus_tag LOCUS_16210 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004200974.1:type VI secretion system contractile sheath large subunit 2736 784 gene locus_tag LOCUS_16220 2736 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 2783 4084 gene locus_tag LOCUS_16230 2783 4084 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 protein_id gnl|my_center|LOCUS_16230 4084 4935 gene locus_tag LOCUS_16240 gene murI 4084 4935 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_16240 6877 5120 gene locus_tag LOCUS_16250 6877 5120 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071884.1 protein_id gnl|my_center|LOCUS_16250 8326 6932 gene locus_tag LOCUS_16260 8326 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 9075 8341 gene locus_tag LOCUS_16270 9075 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence131 718 206 gene locus_tag LOCUS_16280 718 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1915 866 gene locus_tag LOCUS_16290 1915 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 2940 2161 gene locus_tag LOCUS_16300 2940 2161 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943654.1 protein_id gnl|my_center|LOCUS_16300 3219 2947 gene locus_tag LOCUS_16310 3219 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3432 3821 gene locus_tag LOCUS_16320 gene flgB 3432 3821 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097139.1 protein_id gnl|my_center|LOCUS_16320 3826 4272 gene locus_tag LOCUS_16330 gene flgC 3826 4272 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937622.1 protein_id gnl|my_center|LOCUS_16330 4343 4714 gene locus_tag LOCUS_16340 4343 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 4707 6482 gene locus_tag LOCUS_16350 gene fliF 4707 6482 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546552.1 protein_id gnl|my_center|LOCUS_16350 6608 7618 gene locus_tag LOCUS_16360 gene fliG 6608 7618 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420359.1 protein_id gnl|my_center|LOCUS_16360 7661 8383 gene locus_tag LOCUS_16370 7661 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence132 2595 1141 gene locus_tag LOCUS_16380 2595 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 3316 2606 gene locus_tag LOCUS_16390 3316 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 5100 3409 gene locus_tag LOCUS_16400 5100 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 5261 6643 gene locus_tag LOCUS_16410 5261 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 6699 8324 gene locus_tag LOCUS_16420 6699 8324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence133 971 1822 gene locus_tag LOCUS_16430 971 1822 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898866.1 protein_id gnl|my_center|LOCUS_16430 1819 2607 gene locus_tag LOCUS_16440 1819 2607 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837919.1 protein_id gnl|my_center|LOCUS_16440 2692 3843 gene locus_tag LOCUS_16450 2692 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 3905 5671 gene locus_tag LOCUS_16460 3905 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 7342 5687 gene locus_tag LOCUS_16470 7342 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 8799 7459 gene locus_tag LOCUS_16480 8799 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 8686 9015 gene locus_tag LOCUS_16490 8686 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 >Feature sequence134 1535 5815 gene locus_tag LOCUS_16500 1535 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 5888 6805 gene locus_tag LOCUS_16510 5888 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 8246 6819 gene locus_tag LOCUS_16520 8246 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 <9195 8343 gene locus_tag LOCUS_16530 <9195 8343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809743.1:formate--tetrahydrofolate ligase >Feature sequence135 382 1155 gene locus_tag LOCUS_16540 382 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1159 1959 gene locus_tag LOCUS_16550 1159 1959 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938949.1 protein_id gnl|my_center|LOCUS_16550 2256 3242 gene locus_tag LOCUS_16560 2256 3242 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_16560 3305 4261 gene locus_tag LOCUS_16570 3305 4261 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118888.1 protein_id gnl|my_center|LOCUS_16570 5479 4274 gene locus_tag LOCUS_16580 5479 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 5961 7136 gene locus_tag LOCUS_16590 5961 7136 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940254.1 protein_id gnl|my_center|LOCUS_16590 8005 7223 gene locus_tag LOCUS_16600 gene paaG 8005 7223 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186957.1 protein_id gnl|my_center|LOCUS_16600 <9115 8087 gene locus_tag LOCUS_16610 <9115 8087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941834.1:nucleoside triphosphate pyrophosphohydrolase >Feature sequence136 290 1303 gene locus_tag LOCUS_16620 290 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 1766 1398 gene locus_tag LOCUS_16630 1766 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1904 2653 gene locus_tag LOCUS_16640 1904 2653 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_16640 3165 2764 gene locus_tag LOCUS_16650 3165 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 5048 3192 gene locus_tag LOCUS_16660 5048 3192 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460338.1 protein_id gnl|my_center|LOCUS_16660 5214 6653 gene locus_tag LOCUS_16670 5214 6653 CDS product HAD-IG family 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405487.1 protein_id gnl|my_center|LOCUS_16670 7888 6767 gene locus_tag LOCUS_16680 7888 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 7995 8750 gene locus_tag LOCUS_16690 7995 8750 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108120.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence137 98 517 gene locus_tag LOCUS_16700 98 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1161 574 gene locus_tag LOCUS_16710 gene lepB 1161 574 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592828.1 protein_id gnl|my_center|LOCUS_16710 2655 1447 gene locus_tag LOCUS_16720 gene proB 2655 1447 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403542.1 protein_id gnl|my_center|LOCUS_16720 3420 2767 gene locus_tag LOCUS_16730 3420 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 4368 3472 gene locus_tag LOCUS_16740 4368 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 6890 4365 gene locus_tag LOCUS_16750 6890 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 7479 6961 gene locus_tag LOCUS_16760 7479 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 8762 7632 gene locus_tag LOCUS_16770 8762 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence138 210 503 gene locus_tag LOCUS_16780 210 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 517 1428 gene locus_tag LOCUS_16790 517 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 2093 1674 gene locus_tag LOCUS_16800 2093 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2086 2247 gene locus_tag LOCUS_16810 2086 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 4308 2284 gene locus_tag LOCUS_16820 4308 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 6953 4452 gene locus_tag LOCUS_16830 6953 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 7101 8321 gene locus_tag LOCUS_16840 7101 8321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence139 <1 1456 gene locus_tag LOCUS_16850 <1 1456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028569.1:ABC transporter ATP-binding protein 1527 2327 gene locus_tag LOCUS_16860 1527 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 2349 3185 gene locus_tag LOCUS_16870 2349 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 3182 4975 gene locus_tag LOCUS_16880 3182 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 5822 5049 gene locus_tag LOCUS_16890 5822 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 6469 7695 gene locus_tag LOCUS_16900 6469 7695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence140 763 3012 gene locus_tag LOCUS_16910 763 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 3016 3792 gene locus_tag LOCUS_16920 gene lipB 3016 3792 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405264.1 protein_id gnl|my_center|LOCUS_16920 3859 5892 gene locus_tag LOCUS_16930 3859 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 5889 6752 gene locus_tag LOCUS_16940 5889 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 6743 8842 gene locus_tag LOCUS_16950 6743 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 >Feature sequence141 <1 1335 gene locus_tag LOCUS_16960 <1 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004543942.1:error-prone DNA polymerase 1450 2133 gene locus_tag LOCUS_16970 1450 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 2133 4304 gene locus_tag LOCUS_16980 2133 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 4717 4310 gene locus_tag LOCUS_16990 4717 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 5184 4765 gene locus_tag LOCUS_17000 5184 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 6170 5340 gene locus_tag LOCUS_17010 gene larE 6170 5340 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_17010 6723 6229 gene locus_tag LOCUS_17020 6723 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 7985 6804 gene locus_tag LOCUS_17030 7985 6804 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942940.1 protein_id gnl|my_center|LOCUS_17030 <8900 8142 gene locus_tag LOCUS_17040 <8900 8142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041914012.1:polyribonucleotide nucleotidyltransferase >Feature sequence142 1698 1000 gene locus_tag LOCUS_17050 1698 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_17050 1853 2647 gene locus_tag LOCUS_17060 1853 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 2790 3644 gene locus_tag LOCUS_17070 2790 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 3676 4557 gene locus_tag LOCUS_17080 3676 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 4695 5660 gene locus_tag LOCUS_17090 gene grxD 4695 5660 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038466.1 protein_id gnl|my_center|LOCUS_17090 6605 5664 gene locus_tag LOCUS_17100 6605 5664 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229746.1 protein_id gnl|my_center|LOCUS_17100 7562 6681 gene locus_tag LOCUS_17110 7562 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence143 2293 563 gene locus_tag LOCUS_17120 2293 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 5393 2346 gene locus_tag LOCUS_17130 5393 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 5897 5499 gene locus_tag LOCUS_17140 5897 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence144 395 958 gene locus_tag LOCUS_17150 395 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 955 2556 gene locus_tag LOCUS_17160 955 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2655 3569 gene locus_tag LOCUS_17170 2655 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 4616 3594 gene locus_tag LOCUS_17180 4616 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 5013 5264 gene locus_tag LOCUS_17190 5013 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 5284 6726 gene locus_tag LOCUS_17200 5284 6726 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_17200 6864 7367 gene locus_tag LOCUS_17210 6864 7367 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_17210 8025 7393 gene locus_tag LOCUS_17220 8025 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence145 <1 591 gene locus_tag LOCUS_17230 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869041.1:methylmalonyl-CoA mutase family protein 752 1861 gene locus_tag LOCUS_17240 752 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1861 2967 gene locus_tag LOCUS_17250 1861 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 2984 4375 gene locus_tag LOCUS_17260 2984 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 4350 6119 gene locus_tag LOCUS_17270 4350 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 6354 8003 gene locus_tag LOCUS_17280 6354 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 8554 8066 gene locus_tag LOCUS_17290 8554 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence146 3497 138 gene locus_tag LOCUS_17300 3497 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 5252 3630 gene locus_tag LOCUS_17310 5252 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 6284 5358 gene locus_tag LOCUS_17320 6284 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 7716 6331 gene locus_tag LOCUS_17330 7716 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 8543 7806 gene locus_tag LOCUS_17340 8543 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence147 1019 1858 gene locus_tag LOCUS_17350 1019 1858 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967075.1 protein_id gnl|my_center|LOCUS_17350 2348 1911 gene locus_tag LOCUS_17360 2348 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 2529 4226 gene locus_tag LOCUS_17370 2529 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 4636 6120 gene locus_tag LOCUS_17380 4636 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 6276 8387 gene locus_tag LOCUS_17390 6276 8387 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206614.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence148 37 852 gene locus_tag LOCUS_17400 gene flgG 37 852 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_17400 849 1673 gene locus_tag LOCUS_17410 849 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1670 2368 gene locus_tag LOCUS_17420 1670 2368 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545249.1 protein_id gnl|my_center|LOCUS_17420 2417 3568 gene locus_tag LOCUS_17430 2417 3568 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_17430 3565 4008 gene locus_tag LOCUS_17440 3565 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 4179 4466 gene locus_tag LOCUS_17450 4179 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 4468 4806 gene locus_tag LOCUS_17460 4468 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 5019 6431 gene locus_tag LOCUS_17470 gene flgK 5019 6431 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_17470 6431 7303 gene locus_tag LOCUS_17480 gene flgL 6431 7303 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_17480 7358 7654 gene locus_tag LOCUS_17490 7358 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 7673 8221 gene locus_tag LOCUS_17500 7673 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence149 2543 135 gene locus_tag LOCUS_17510 2543 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 3184 2564 gene locus_tag LOCUS_17520 3184 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 4449 3412 gene locus_tag LOCUS_17530 4449 3412 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_17530 4607 5998 gene locus_tag LOCUS_17540 4607 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 6450 6028 gene locus_tag LOCUS_17550 6450 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 6803 6447 gene locus_tag LOCUS_17560 6803 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 6955 7197 gene locus_tag LOCUS_17570 6955 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 7194 7553 gene locus_tag LOCUS_17580 7194 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 <8578 7600 gene locus_tag LOCUS_17590 <8578 7600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966619.1:ABC transporter substrate-binding protein >Feature sequence150 1049 114 gene locus_tag LOCUS_17600 1049 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2481 1168 gene locus_tag LOCUS_17610 2481 1168 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_17610 3864 2578 gene locus_tag LOCUS_17620 3864 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 5264 3861 gene locus_tag LOCUS_17630 5264 3861 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905537.1 protein_id gnl|my_center|LOCUS_17630 5986 5375 gene locus_tag LOCUS_17640 5986 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 6104 6952 gene locus_tag LOCUS_17650 6104 6952 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173830.1 protein_id gnl|my_center|LOCUS_17650 6957 7376 gene locus_tag LOCUS_17660 gene msrB 6957 7376 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_17660 <8577 7386 gene locus_tag LOCUS_17670 <8577 7386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922281.1:methionine synthase >Feature sequence151 584 1459 gene locus_tag LOCUS_17680 584 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 1892 1506 gene locus_tag LOCUS_17690 1892 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17690 2096 1920 gene locus_tag LOCUS_17700 2096 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17700 2300 2704 gene locus_tag LOCUS_17710 2300 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 2830 4317 gene locus_tag LOCUS_17720 2830 4317 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_17720 4304 5560 gene locus_tag LOCUS_17730 4304 5560 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_17730 6559 5594 gene locus_tag LOCUS_17740 6559 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 6664 7077 gene locus_tag LOCUS_17750 6664 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 7798 7283 gene locus_tag LOCUS_17760 7798 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 <8420 7802 gene locus_tag LOCUS_17770 <8420 7802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969461.1:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence152 1399 1971 gene locus_tag LOCUS_17780 1399 1971 CDS product DUF2760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524145.1 protein_id gnl|my_center|LOCUS_17780 1968 3794 gene locus_tag LOCUS_17790 1968 3794 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539133.1 protein_id gnl|my_center|LOCUS_17790 3787 6636 gene locus_tag LOCUS_17800 3787 6636 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205537.1 protein_id gnl|my_center|LOCUS_17800 7461 6646 gene locus_tag LOCUS_17810 7461 6646 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275354.1 protein_id gnl|my_center|LOCUS_17810 7549 8037 gene locus_tag LOCUS_17820 7549 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence153 402 2747 gene locus_tag LOCUS_17830 402 2747 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_17830 3537 2776 gene locus_tag LOCUS_17840 3537 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 3779 4813 gene locus_tag LOCUS_17850 3779 4813 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_17850 5565 4810 gene locus_tag LOCUS_17860 5565 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 7918 5582 gene locus_tag LOCUS_17870 7918 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence154 1302 2714 gene locus_tag LOCUS_17880 1302 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2913 3767 gene locus_tag LOCUS_17890 gene modA 2913 3767 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144267.1 protein_id gnl|my_center|LOCUS_17890 3764 4435 gene locus_tag LOCUS_17900 gene modB 3764 4435 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888685.1 protein_id gnl|my_center|LOCUS_17900 4473 5258 gene locus_tag LOCUS_17910 4473 5258 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190506.1 protein_id gnl|my_center|LOCUS_17910 5317 6933 gene locus_tag LOCUS_17920 5317 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 7086 7385 gene locus_tag LOCUS_17930 gene eutM 7086 7385 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 protein_id gnl|my_center|LOCUS_17930 7399 7686 gene locus_tag LOCUS_17940 7399 7686 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence155 82 1224 gene locus_tag LOCUS_17950 82 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 1306 2469 gene locus_tag LOCUS_17960 1306 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 2507 3556 gene locus_tag LOCUS_17970 2507 3556 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036621.1 protein_id gnl|my_center|LOCUS_17970 3702 4640 gene locus_tag LOCUS_17980 gene cysM 3702 4640 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930733.1 protein_id gnl|my_center|LOCUS_17980 4967 4761 gene locus_tag LOCUS_17990 4967 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 4861 5595 gene locus_tag LOCUS_18000 4861 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 5708 5631 gene locus_tag LOCUS_t00180 5708 5631 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5898 6617 gene locus_tag LOCUS_18010 gene pspA 5898 6617 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705754.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence156 1254 1700 gene locus_tag LOCUS_18020 1254 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 2087 3082 gene locus_tag LOCUS_18030 2087 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 4198 3167 gene locus_tag LOCUS_18040 4198 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 5274 4279 gene locus_tag LOCUS_18050 5274 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 6025 5450 gene locus_tag LOCUS_18060 6025 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 6933 6025 gene locus_tag LOCUS_18070 6933 6025 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933345.1 protein_id gnl|my_center|LOCUS_18070 <8176 7001 gene locus_tag LOCUS_18080 <8176 7001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932871.1:ABC transporter permease >Feature sequence157 4599 1612 gene locus_tag LOCUS_18090 4599 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 6733 4622 gene locus_tag LOCUS_18100 6733 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 7944 6730 gene locus_tag LOCUS_18110 7944 6730 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence158 3103 665 gene locus_tag LOCUS_18120 3103 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 3475 4278 gene locus_tag LOCUS_18130 3475 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 6300 4378 gene locus_tag LOCUS_18140 6300 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 6717 7760 gene locus_tag LOCUS_18150 6717 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence159 2400 1849 gene locus_tag LOCUS_18160 2400 1849 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941955.1 protein_id gnl|my_center|LOCUS_18160 2681 4825 gene locus_tag LOCUS_18170 2681 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 4826 5632 gene locus_tag LOCUS_18180 4826 5632 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525698.1 protein_id gnl|my_center|LOCUS_18180 5629 6159 gene locus_tag LOCUS_18190 5629 6159 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359122.1 protein_id gnl|my_center|LOCUS_18190 6156 7028 gene locus_tag LOCUS_18200 6156 7028 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_18200 7025 7411 gene locus_tag LOCUS_18210 7025 7411 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_18210 7408 7869 gene locus_tag LOCUS_18220 7408 7869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence160 310 137 gene locus_tag LOCUS_18230 310 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1038 412 gene locus_tag LOCUS_18240 1038 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1270 2205 gene locus_tag LOCUS_18250 1270 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 3520 2297 gene locus_tag LOCUS_18260 3520 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 5154 3544 gene locus_tag LOCUS_18270 5154 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 5645 5223 gene locus_tag LOCUS_18280 5645 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 5724 6143 gene locus_tag LOCUS_18290 5724 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 6157 6936 gene locus_tag LOCUS_18300 6157 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 <8032 6949 gene locus_tag LOCUS_18310 <8032 6949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942540.1:CTP synthase >Feature sequence161 1659 631 gene locus_tag LOCUS_18320 gene hrcA 1659 631 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310175.1 protein_id gnl|my_center|LOCUS_18320 1804 2652 gene locus_tag LOCUS_18330 1804 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 2782 3999 gene locus_tag LOCUS_18340 2782 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 5721 4090 gene locus_tag LOCUS_18350 5721 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 6362 5718 gene locus_tag LOCUS_18360 6362 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 7894 6470 gene locus_tag LOCUS_18370 7894 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence162 2692 731 gene locus_tag LOCUS_18380 2692 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 4317 2689 gene locus_tag LOCUS_18390 4317 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 4914 4330 gene locus_tag LOCUS_18400 4914 4330 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114799.1 protein_id gnl|my_center|LOCUS_18400 7555 4928 gene locus_tag LOCUS_18410 7555 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence163 88 996 gene locus_tag LOCUS_18420 88 996 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972568.1 protein_id gnl|my_center|LOCUS_18420 2425 1082 gene locus_tag LOCUS_18430 2425 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2590 4011 gene locus_tag LOCUS_18440 2590 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 4545 4051 gene locus_tag LOCUS_18450 4545 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 4660 5577 gene locus_tag LOCUS_18460 4660 5577 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933711.1 protein_id gnl|my_center|LOCUS_18460 5681 6748 gene locus_tag LOCUS_18470 5681 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 6771 7604 gene locus_tag LOCUS_18480 6771 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence164 497 1072 gene locus_tag LOCUS_18490 gene def 497 1072 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116243.1 protein_id gnl|my_center|LOCUS_18490 1072 2703 gene locus_tag LOCUS_18500 1072 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 4777 2771 gene locus_tag LOCUS_18510 4777 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 6565 4901 gene locus_tag LOCUS_18520 6565 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 6672 7547 gene locus_tag LOCUS_18530 6672 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 7998 7705 gene locus_tag LOCUS_18540 7998 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence165 2485 926 gene locus_tag LOCUS_18550 2485 926 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_18550 3141 2482 gene locus_tag LOCUS_18560 3141 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 4082 3177 gene locus_tag LOCUS_18570 4082 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 6329 4164 gene locus_tag LOCUS_18580 6329 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 6908 6408 gene locus_tag LOCUS_18590 6908 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 <7841 6905 gene locus_tag LOCUS_18600 <7841 6905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206818210.1:sigma-54 dependent transcriptional regulator >Feature sequence166 748 1551 gene locus_tag LOCUS_18610 748 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 1978 1679 gene locus_tag LOCUS_18620 1978 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 2122 2826 gene locus_tag LOCUS_18630 2122 2826 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_18630 2820 3635 gene locus_tag LOCUS_18640 gene pcaD 2820 3635 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727990.1 protein_id gnl|my_center|LOCUS_18640 3724 4116 gene locus_tag LOCUS_18650 3724 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 5265 4159 gene locus_tag LOCUS_18660 5265 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 5467 5297 gene locus_tag LOCUS_18670 5467 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 6139 5630 gene locus_tag LOCUS_18680 6139 5630 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067265.1 protein_id gnl|my_center|LOCUS_18680 7200 6163 gene locus_tag LOCUS_18690 7200 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence167 1677 508 gene locus_tag LOCUS_18700 1677 508 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902696.1 protein_id gnl|my_center|LOCUS_18700 1733 3856 gene locus_tag LOCUS_18710 1733 3856 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403904.1 protein_id gnl|my_center|LOCUS_18710 6071 3840 gene locus_tag LOCUS_18720 6071 3840 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_18720 6268 6492 gene locus_tag LOCUS_18730 6268 6492 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence168 <1 1724 gene locus_tag LOCUS_18740 <1 1724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272458.1:calcium-transporting P-type ATPase, PMR1-type 2370 1765 gene locus_tag LOCUS_18750 2370 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2575 2363 gene locus_tag LOCUS_18760 2575 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 4102 2588 gene locus_tag LOCUS_18770 4102 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18770 4545 4285 gene locus_tag LOCUS_18780 4545 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 5102 4563 gene locus_tag LOCUS_18790 5102 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 5320 5171 gene locus_tag LOCUS_18800 gene rpmH 5320 5171 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776864.1 protein_id gnl|my_center|LOCUS_18800 7094 5466 gene locus_tag LOCUS_18810 7094 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 7172 7651 gene locus_tag LOCUS_18820 7172 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence169 659 1741 gene locus_tag LOCUS_18830 659 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 3187 1832 gene locus_tag LOCUS_18840 3187 1832 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224193226.1 protein_id gnl|my_center|LOCUS_18840 4953 3292 gene locus_tag LOCUS_18850 4953 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 7304 5016 gene locus_tag LOCUS_18860 7304 5016 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081570352.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence170 858 151 gene locus_tag LOCUS_18870 858 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 1068 2531 gene locus_tag LOCUS_18880 1068 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 4123 2612 gene locus_tag LOCUS_18890 4123 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 6972 4120 gene locus_tag LOCUS_18900 6972 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence171 249 1445 gene locus_tag LOCUS_18910 249 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 1442 2644 gene locus_tag LOCUS_18920 1442 2644 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_18920 2849 4156 gene locus_tag LOCUS_18930 2849 4156 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943373.1 protein_id gnl|my_center|LOCUS_18930 4957 4238 gene locus_tag LOCUS_18940 4957 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 5597 6109 gene locus_tag LOCUS_18950 5597 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 6247 7425 gene locus_tag LOCUS_18960 6247 7425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence172 389 1321 gene locus_tag LOCUS_18970 389 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 1566 2186 gene locus_tag LOCUS_18980 1566 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18980 2183 3574 gene locus_tag LOCUS_18990 2183 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 3636 4814 gene locus_tag LOCUS_19000 3636 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 5380 4964 gene locus_tag LOCUS_19010 5380 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 5682 5377 gene locus_tag LOCUS_19020 5682 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 5804 7081 gene locus_tag LOCUS_19030 gene hutI 5804 7081 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068174090.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence173 651 85 gene locus_tag LOCUS_19040 651 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1314 733 gene locus_tag LOCUS_19050 1314 733 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566395.1 protein_id gnl|my_center|LOCUS_19050 2207 1308 gene locus_tag LOCUS_19060 2207 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 2399 3547 gene locus_tag LOCUS_19070 2399 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 4963 3614 gene locus_tag LOCUS_19080 4963 3614 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258059.1 protein_id gnl|my_center|LOCUS_19080 6148 5255 gene locus_tag LOCUS_19090 gene truB 6148 5255 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414147.1 protein_id gnl|my_center|LOCUS_19090 6782 6162 gene locus_tag LOCUS_19100 6782 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 <7685 6779 gene locus_tag LOCUS_19110 <7685 6779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393505.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA >Feature sequence174 <1 904 gene locus_tag LOCUS_19120 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012437413.1:amidohydrolase 901 2232 gene locus_tag LOCUS_19130 901 2232 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919839.1 protein_id gnl|my_center|LOCUS_19130 3085 2342 gene locus_tag LOCUS_19140 gene pssA 3085 2342 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853992.1 protein_id gnl|my_center|LOCUS_19140 3211 4758 gene locus_tag LOCUS_19150 3211 4758 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_19150 4779 6137 gene locus_tag LOCUS_19160 4779 6137 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_19160 <7656 6184 gene locus_tag LOCUS_19170 <7656 6184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007247360.1:GTP diphosphokinase >Feature sequence175 1316 2995 gene locus_tag LOCUS_19180 1316 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 3295 3089 gene locus_tag LOCUS_19190 3295 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 3297 4235 gene locus_tag LOCUS_19200 3297 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 5541 4249 gene locus_tag LOCUS_19210 5541 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 6214 5552 gene locus_tag LOCUS_19220 6214 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 <7651 6348 gene locus_tag LOCUS_19230 <7651 6348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112752.1:preprotein translocase subunit SecA >Feature sequence176 2141 321 gene locus_tag LOCUS_19240 2141 321 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_19240 3169 2141 gene locus_tag LOCUS_19250 3169 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 4379 3216 gene locus_tag LOCUS_19260 4379 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 5576 4497 gene locus_tag LOCUS_19270 5576 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 7330 5585 gene locus_tag LOCUS_19280 7330 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence177 141 941 gene locus_tag LOCUS_19290 141 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 3003 1006 gene locus_tag LOCUS_19300 3003 1006 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821440.1 protein_id gnl|my_center|LOCUS_19300 3585 3067 gene locus_tag LOCUS_19310 3585 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 3742 5433 gene locus_tag LOCUS_19320 3742 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 5956 5453 gene locus_tag LOCUS_19330 5956 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 6356 6024 gene locus_tag LOCUS_19340 6356 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 6386 7309 gene locus_tag LOCUS_19350 gene xdhC 6386 7309 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267256.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence178 1777 1037 gene locus_tag LOCUS_19360 1777 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 3809 1932 gene locus_tag LOCUS_19370 3809 1932 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839780.1 protein_id gnl|my_center|LOCUS_19370 4043 5245 gene locus_tag LOCUS_19380 4043 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 5315 5800 gene locus_tag LOCUS_19390 5315 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 <7561 5900 gene locus_tag LOCUS_19400 <7561 5900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942876.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence179 884 294 gene locus_tag LOCUS_19410 884 294 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_19410 2749 1517 gene locus_tag LOCUS_19420 2749 1517 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_19420 2847 3800 gene locus_tag LOCUS_19430 gene glyQ 2847 3800 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_19430 4668 3868 gene locus_tag LOCUS_19440 4668 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 4867 6738 gene locus_tag LOCUS_19450 4867 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence180 2430 1090 gene locus_tag LOCUS_19460 2430 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 3220 2558 gene locus_tag LOCUS_19470 3220 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 4026 3292 gene locus_tag LOCUS_19480 4026 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 4739 4026 gene locus_tag LOCUS_19490 4739 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 5173 4748 gene locus_tag LOCUS_19500 5173 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 5635 5231 gene locus_tag LOCUS_19510 5635 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 6891 5647 gene locus_tag LOCUS_19520 6891 5647 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_19520 7523 6897 gene locus_tag LOCUS_19530 7523 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence181 1754 114 gene locus_tag LOCUS_19540 gene lnt 1754 114 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939146.1 protein_id gnl|my_center|LOCUS_19540 1788 3014 gene locus_tag LOCUS_19550 1788 3014 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257960.1 protein_id gnl|my_center|LOCUS_19550 3084 4253 gene locus_tag LOCUS_19560 3084 4253 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227949.1 protein_id gnl|my_center|LOCUS_19560 4465 5316 gene locus_tag LOCUS_19570 4465 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 6115 5375 gene locus_tag LOCUS_19580 6115 5375 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_19580 6211 7233 gene locus_tag LOCUS_19590 6211 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 >Feature sequence182 2512 1004 gene locus_tag LOCUS_19600 2512 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 4424 2520 gene locus_tag LOCUS_19610 4424 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 5233 4433 gene locus_tag LOCUS_19620 5233 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 5406 5645 gene locus_tag LOCUS_19630 5406 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 5642 6076 gene locus_tag LOCUS_19640 5642 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 <7515 6109 gene locus_tag LOCUS_19650 <7515 6109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000613941.1:FAD-dependent oxidoreductase >Feature sequence183 1057 281 gene locus_tag LOCUS_19660 1057 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 1510 1061 gene locus_tag LOCUS_19670 1510 1061 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228286.1 protein_id gnl|my_center|LOCUS_19670 1793 2962 gene locus_tag LOCUS_19680 1793 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 3239 3066 gene locus_tag LOCUS_19690 3239 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 4680 3718 gene locus_tag LOCUS_19700 4680 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 4913 5947 gene locus_tag LOCUS_19710 4913 5947 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073579.1 protein_id gnl|my_center|LOCUS_19710 6790 5975 gene locus_tag LOCUS_19720 6790 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence184 <1 638 gene locus_tag LOCUS_19730 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259250.1:MoxR family ATPase 641 1621 gene locus_tag LOCUS_19740 641 1621 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121418.1 protein_id gnl|my_center|LOCUS_19740 1637 3577 gene locus_tag LOCUS_19750 1637 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 3574 6582 gene locus_tag LOCUS_19760 3574 6582 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922073.1 protein_id gnl|my_center|LOCUS_19760 7308 6619 gene locus_tag LOCUS_19770 7308 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence185 3514 4890 gene locus_tag LOCUS_19780 3514 4890 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221819.1 protein_id gnl|my_center|LOCUS_19780 5024 6973 gene locus_tag LOCUS_19790 5024 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence186 1850 528 gene locus_tag LOCUS_19800 1850 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 4957 1913 gene locus_tag LOCUS_19810 4957 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 5095 5547 gene locus_tag LOCUS_19820 5095 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 6282 5572 gene locus_tag LOCUS_19830 6282 5572 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033678946.1 protein_id gnl|my_center|LOCUS_19830 <7463 6338 gene locus_tag LOCUS_19840 <7463 6338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705884.1:ABC-F family ATPase >Feature sequence187 191 898 gene locus_tag LOCUS_19850 191 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19850 955 2580 gene locus_tag LOCUS_19860 955 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2693 2610 gene locus_tag LOCUS_t00190 2693 2610 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4189 2879 gene locus_tag LOCUS_19870 4189 2879 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_19870 4070 5554 gene locus_tag LOCUS_19880 4070 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 5661 6884 gene locus_tag LOCUS_19890 5661 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence188 1223 156 gene locus_tag LOCUS_19900 1223 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 1355 2479 gene locus_tag LOCUS_19910 1355 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2540 4879 gene locus_tag LOCUS_19920 2540 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 6952 4982 gene locus_tag LOCUS_19930 6952 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence189 <1 606 gene locus_tag LOCUS_19940 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202499.1:acetyl-CoA carboxylase biotin carboxylase subunit 1092 649 gene locus_tag LOCUS_19950 gene ruvX 1092 649 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_19950 1153 2448 gene locus_tag LOCUS_19960 gene hisS 1153 2448 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057735.1 protein_id gnl|my_center|LOCUS_19960 2526 4262 gene locus_tag LOCUS_19970 2526 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 6589 4307 gene locus_tag LOCUS_19980 6589 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 <7442 6586 gene locus_tag LOCUS_19990 <7442 6586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545466.1:endopeptidase La >Feature sequence190 1871 348 gene locus_tag LOCUS_20000 gene rpoN 1871 348 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_20000 3150 2080 gene locus_tag LOCUS_20010 3150 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 3356 3916 gene locus_tag LOCUS_20020 3356 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 5259 3955 gene locus_tag LOCUS_20030 5259 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 6899 5259 gene locus_tag LOCUS_20040 gene gpmI 6899 5259 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140758.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence191 81 389 gene locus_tag LOCUS_20050 81 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 386 2896 gene locus_tag LOCUS_20060 386 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 3469 2903 gene locus_tag LOCUS_20070 3469 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 3636 4940 gene locus_tag LOCUS_20080 3636 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 5956 4922 gene locus_tag LOCUS_20090 5956 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 6789 6022 gene locus_tag LOCUS_20100 6789 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 7078 6884 gene locus_tag LOCUS_20110 7078 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence192 221 1066 gene locus_tag LOCUS_20120 221 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 1574 1104 gene locus_tag LOCUS_20130 1574 1104 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812496.1 protein_id gnl|my_center|LOCUS_20130 3841 1571 gene locus_tag LOCUS_20140 3841 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 3810 3998 gene locus_tag LOCUS_20150 3810 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 5152 4055 gene locus_tag LOCUS_20160 gene aroC 5152 4055 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_20160 6318 5215 gene locus_tag LOCUS_20170 6318 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence193 500 2143 gene locus_tag LOCUS_20180 500 2143 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228732.1 protein_id gnl|my_center|LOCUS_20180 2299 3069 gene locus_tag LOCUS_20190 2299 3069 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228731.1 protein_id gnl|my_center|LOCUS_20190 3418 3149 gene locus_tag LOCUS_20200 3418 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 4326 3520 gene locus_tag LOCUS_20210 4326 3520 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_20210 4923 4414 gene locus_tag LOCUS_20220 4923 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 6365 4950 gene locus_tag LOCUS_20230 6365 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence194 1818 592 gene locus_tag LOCUS_20240 1818 592 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902861.1 protein_id gnl|my_center|LOCUS_20240 2020 2478 gene locus_tag LOCUS_20250 gene rplM 2020 2478 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005336289.1 protein_id gnl|my_center|LOCUS_20250 2520 2921 gene locus_tag LOCUS_20260 gene rpsI 2520 2921 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939789.1 protein_id gnl|my_center|LOCUS_20260 4750 3014 gene locus_tag LOCUS_20270 4750 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 4957 6336 gene locus_tag LOCUS_20280 4957 6336 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence195 840 583 gene locus_tag LOCUS_20290 840 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 934 4872 gene locus_tag LOCUS_20300 934 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 2158 2254 gene locus_tag LOCUS_t00200 2158 2254 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4940 5515 gene locus_tag LOCUS_20310 4940 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 5582 7162 gene locus_tag LOCUS_20320 5582 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence196 3 335 gene locus_tag LOCUS_20330 3 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 1773 376 gene locus_tag LOCUS_20340 1773 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 1840 2172 gene locus_tag LOCUS_20350 1840 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 3279 2263 gene locus_tag LOCUS_20360 3279 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 3973 3299 gene locus_tag LOCUS_20370 3973 3299 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223021.1 protein_id gnl|my_center|LOCUS_20370 4328 4999 gene locus_tag LOCUS_20380 4328 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 4996 5940 gene locus_tag LOCUS_20390 4996 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 5933 6688 gene locus_tag LOCUS_20400 5933 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 >Feature sequence197 1018 626 gene locus_tag LOCUS_20410 1018 626 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014897.1 protein_id gnl|my_center|LOCUS_20410 1089 1265 gene locus_tag LOCUS_20420 1089 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 1475 2602 gene locus_tag LOCUS_20430 1475 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 3563 2694 gene locus_tag LOCUS_20440 gene folD 3563 2694 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338398.1 protein_id gnl|my_center|LOCUS_20440 3907 3593 gene locus_tag LOCUS_20450 3907 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 4701 4153 gene locus_tag LOCUS_20460 4701 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 4645 5622 gene locus_tag LOCUS_20470 4645 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 6498 5650 gene locus_tag LOCUS_20480 6498 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence198 3811 974 gene locus_tag LOCUS_20490 3811 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 3841 4704 gene locus_tag LOCUS_20500 3841 4704 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064443.1 protein_id gnl|my_center|LOCUS_20500 <7209 4782 gene locus_tag LOCUS_20510 <7209 4782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190681.1:type VI secretion system membrane subunit TssM >Feature sequence199 1699 110 gene locus_tag LOCUS_20520 1699 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 2476 1718 gene locus_tag LOCUS_20530 2476 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2475 2717 gene locus_tag LOCUS_20540 2475 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 4132 2714 gene locus_tag LOCUS_20550 4132 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 4714 5280 gene locus_tag LOCUS_20560 4714 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence200 100 1116 gene locus_tag LOCUS_20570 100 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 2026 1175 gene locus_tag LOCUS_20580 2026 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 1947 2243 gene locus_tag LOCUS_20590 1947 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 3662 2139 gene locus_tag LOCUS_20600 3662 2139 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704452.1 protein_id gnl|my_center|LOCUS_20600 4216 3839 gene locus_tag LOCUS_20610 4216 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 4288 6876 gene locus_tag LOCUS_20620 4288 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence201 1467 1985 gene locus_tag LOCUS_20630 1467 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 3771 2059 gene locus_tag LOCUS_20640 3771 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 4690 4025 gene locus_tag LOCUS_20650 4690 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 5109 4810 gene locus_tag LOCUS_20660 5109 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 5716 5093 gene locus_tag LOCUS_20670 5716 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 5947 7149 gene locus_tag LOCUS_20680 5947 7149 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 protein_id gnl|my_center|LOCUS_20680 >Feature sequence202 1152 490 gene locus_tag LOCUS_20690 1152 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 2377 1169 gene locus_tag LOCUS_20700 2377 1169 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262741.1 protein_id gnl|my_center|LOCUS_20700 2288 2467 gene locus_tag LOCUS_20710 2288 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2847 4943 gene locus_tag LOCUS_20720 2847 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 6302 5013 gene locus_tag LOCUS_20730 gene lysA 6302 5013 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940834.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence203 2729 459 gene locus_tag LOCUS_20740 2729 459 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057163.1 protein_id gnl|my_center|LOCUS_20740 4572 2854 gene locus_tag LOCUS_20750 4572 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 6014 4623 gene locus_tag LOCUS_20760 6014 4623 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_20760 <7086 6011 gene locus_tag LOCUS_20770 <7086 6011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263039.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence204 1965 46 gene locus_tag LOCUS_20780 1965 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 2741 2010 gene locus_tag LOCUS_20790 2741 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 3277 2738 gene locus_tag LOCUS_20800 3277 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 3451 5034 gene locus_tag LOCUS_20810 3451 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 5036 6883 gene locus_tag LOCUS_20820 5036 6883 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943274.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence205 654 1682 gene locus_tag LOCUS_20830 654 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2158 1919 gene locus_tag LOCUS_20840 2158 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 2106 2624 gene locus_tag LOCUS_20850 2106 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 5535 2629 gene locus_tag LOCUS_20860 5535 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 6785 5532 gene locus_tag LOCUS_20870 6785 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence206 4864 2903 gene locus_tag LOCUS_20880 4864 2903 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121419.1 protein_id gnl|my_center|LOCUS_20880 5763 4867 gene locus_tag LOCUS_20890 5763 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 5964 5815 gene locus_tag LOCUS_20900 5964 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence207 1515 124 gene locus_tag LOCUS_20910 gene dnaA 1515 124 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099214.1 protein_id gnl|my_center|LOCUS_20910 2362 3351 gene locus_tag LOCUS_20920 2362 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 3363 3965 gene locus_tag LOCUS_20930 3363 3965 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_20930 4013 5386 gene locus_tag LOCUS_20940 4013 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 5444 5728 gene locus_tag LOCUS_20950 5444 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 5725 6120 gene locus_tag LOCUS_20960 5725 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 6262 6729 gene locus_tag LOCUS_20970 6262 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence208 985 2814 gene locus_tag LOCUS_20980 985 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 4025 2841 gene locus_tag LOCUS_20990 4025 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 4149 6005 gene locus_tag LOCUS_21000 4149 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 <6985 6148 gene locus_tag LOCUS_21010 <6985 6148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070427.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence209 386 1222 gene locus_tag LOCUS_21020 386 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 1644 1288 gene locus_tag LOCUS_21030 1644 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2666 1650 gene locus_tag LOCUS_21040 2666 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2949 4916 gene locus_tag LOCUS_21050 2949 4916 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062080.1 protein_id gnl|my_center|LOCUS_21050 6157 4979 gene locus_tag LOCUS_21060 6157 4979 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141596.1 protein_id gnl|my_center|LOCUS_21060 6301 6792 gene locus_tag LOCUS_21070 6301 6792 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228204.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence210 116 1477 gene locus_tag LOCUS_21080 116 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 1470 2303 gene locus_tag LOCUS_21090 1470 2303 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142640.1 protein_id gnl|my_center|LOCUS_21090 3032 2370 gene locus_tag LOCUS_21100 3032 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 3116 6271 gene locus_tag LOCUS_21110 3116 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence211 1306 3480 gene locus_tag LOCUS_21120 1306 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 3477 5588 gene locus_tag LOCUS_21130 3477 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 5632 5955 gene locus_tag LOCUS_21140 5632 5955 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_21140 5942 6919 gene locus_tag LOCUS_21150 5942 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence212 1116 607 gene locus_tag LOCUS_21160 1116 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2609 1272 gene locus_tag LOCUS_21170 2609 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 4338 2800 gene locus_tag LOCUS_21180 4338 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 4454 4529 gene locus_tag LOCUS_t00210 4454 4529 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5655 5038 gene locus_tag LOCUS_21190 5655 5038 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809641.1 protein_id gnl|my_center|LOCUS_21190 <6906 5652 gene locus_tag LOCUS_21200 <6906 5652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920572.1:heavy metal translocating P-type ATPase >Feature sequence213 2381 30 gene locus_tag LOCUS_21210 2381 30 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_21210 2802 4385 gene locus_tag LOCUS_21220 2802 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 6064 4475 gene locus_tag LOCUS_21230 6064 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 6675 6070 gene locus_tag LOCUS_21240 6675 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence214 326 72 gene locus_tag LOCUS_21250 326 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 1561 344 gene locus_tag LOCUS_21260 1561 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2222 1548 gene locus_tag LOCUS_21270 2222 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2404 2493 gene locus_tag LOCUS_t00220 2404 2493 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4425 2785 gene locus_tag LOCUS_21280 4425 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 4595 5926 gene locus_tag LOCUS_21290 4595 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence215 418 1656 gene locus_tag LOCUS_21300 418 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 2501 2076 gene locus_tag LOCUS_21310 2501 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2525 3304 gene locus_tag LOCUS_21320 2525 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 3601 4932 gene locus_tag LOCUS_21330 3601 4932 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975508.1 protein_id gnl|my_center|LOCUS_21330 4929 5912 gene locus_tag LOCUS_21340 4929 5912 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029668.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence216 379 1080 gene locus_tag LOCUS_21350 gene cmk 379 1080 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_21350 1077 2147 gene locus_tag LOCUS_21360 1077 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 2173 3189 gene locus_tag LOCUS_21370 2173 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 3362 3907 gene locus_tag LOCUS_21380 3362 3907 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721773.1 protein_id gnl|my_center|LOCUS_21380 4207 6741 gene locus_tag LOCUS_21390 4207 6741 CDS product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114515.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence217 1898 681 gene locus_tag LOCUS_21400 1898 681 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_21400 2058 2771 gene locus_tag LOCUS_21410 2058 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2774 4165 gene locus_tag LOCUS_21420 2774 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence218 7 1137 gene locus_tag LOCUS_21430 gene ribD 7 1137 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_21430 1729 1208 gene locus_tag LOCUS_21440 gene def 1729 1208 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525852.1 protein_id gnl|my_center|LOCUS_21440 3732 1822 gene locus_tag LOCUS_21450 3732 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 4028 3825 gene locus_tag LOCUS_21460 4028 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 5132 4191 gene locus_tag LOCUS_21470 5132 4191 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534453.1 protein_id gnl|my_center|LOCUS_21470 6083 5148 gene locus_tag LOCUS_21480 6083 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 <6823 6114 gene locus_tag LOCUS_21490 <6823 6114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404704.1:pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase >Feature sequence219 490 2772 gene locus_tag LOCUS_21500 490 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2769 3671 gene locus_tag LOCUS_21510 2769 3671 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530307.1 protein_id gnl|my_center|LOCUS_21510 4031 3693 gene locus_tag LOCUS_21520 4031 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 5974 4031 gene locus_tag LOCUS_21530 5974 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 6344 6060 gene locus_tag LOCUS_21540 6344 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 6712 6299 gene locus_tag LOCUS_21550 6712 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence220 416 1723 gene locus_tag LOCUS_21560 416 1723 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_21560 1781 2932 gene locus_tag LOCUS_21570 1781 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 4606 3092 gene locus_tag LOCUS_21580 4606 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 5298 4603 gene locus_tag LOCUS_21590 5298 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 6460 5336 gene locus_tag LOCUS_21600 6460 5336 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence221 1194 1634 gene locus_tag LOCUS_21610 1194 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 3544 1631 gene locus_tag LOCUS_21620 3544 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 3698 4723 gene locus_tag LOCUS_21630 3698 4723 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_21630 4870 6411 gene locus_tag LOCUS_21640 4870 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 6675 6421 gene locus_tag LOCUS_21650 6675 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence222 227 2203 gene locus_tag LOCUS_21660 227 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 2210 3169 gene locus_tag LOCUS_21670 2210 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 4071 3301 gene locus_tag LOCUS_21680 4071 3301 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_21680 4737 4309 gene locus_tag LOCUS_21690 4737 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 5382 6047 gene locus_tag LOCUS_21700 gene rplC 5382 6047 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015720.1 protein_id gnl|my_center|LOCUS_21700 6065 6682 gene locus_tag LOCUS_21710 6065 6682 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939535.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence223 <1 1042 gene locus_tag LOCUS_21720 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838671.1:ATP-binding cassette domain-containing protein 1049 1789 gene locus_tag LOCUS_21730 1049 1789 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557338.1 protein_id gnl|my_center|LOCUS_21730 1809 3677 gene locus_tag LOCUS_21740 1809 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 3681 4784 gene locus_tag LOCUS_21750 3681 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 <6768 4932 gene locus_tag LOCUS_21760 <6768 4932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144184.1:SBBP repeat-containing protein >Feature sequence224 870 193 gene locus_tag LOCUS_21770 870 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 979 1770 gene locus_tag LOCUS_21780 979 1770 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 protein_id gnl|my_center|LOCUS_21780 3528 1783 gene locus_tag LOCUS_21790 3528 1783 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869365.1 protein_id gnl|my_center|LOCUS_21790 3932 4303 gene locus_tag LOCUS_21800 3932 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 4949 4287 gene locus_tag LOCUS_21810 4949 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 <6717 4965 gene locus_tag LOCUS_21820 <6717 4965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042440436.1:ATP-dependent helicase HrpB >Feature sequence225 1858 995 gene locus_tag LOCUS_21830 1858 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 2691 1855 gene locus_tag LOCUS_21840 2691 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 2858 3085 gene locus_tag LOCUS_21850 2858 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 4325 3240 gene locus_tag LOCUS_21860 4325 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 4854 4438 gene locus_tag LOCUS_21870 4854 4438 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061454.1 protein_id gnl|my_center|LOCUS_21870 6047 4911 gene locus_tag LOCUS_21880 6047 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 >Feature sequence226 1145 381 gene locus_tag LOCUS_21890 1145 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 2335 1169 gene locus_tag LOCUS_21900 2335 1169 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804042.1 protein_id gnl|my_center|LOCUS_21900 2558 3463 gene locus_tag LOCUS_21910 2558 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 3514 4968 gene locus_tag LOCUS_21920 3514 4968 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_21920 4965 6503 gene locus_tag LOCUS_21930 4965 6503 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972426.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence227 310 1755 gene locus_tag LOCUS_21940 310 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 1766 4411 gene locus_tag LOCUS_21950 gene plsB 1766 4411 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001909395.1 protein_id gnl|my_center|LOCUS_21950 4424 5332 gene locus_tag LOCUS_21960 4424 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 6119 5388 gene locus_tag LOCUS_21970 6119 5388 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019252.1 protein_id gnl|my_center|LOCUS_21970 >Feature sequence228 731 2101 gene locus_tag LOCUS_21980 731 2101 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948061.1 protein_id gnl|my_center|LOCUS_21980 2176 3483 gene locus_tag LOCUS_21990 2176 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 3500 4195 gene locus_tag LOCUS_22000 3500 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 4192 4866 gene locus_tag LOCUS_22010 4192 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 6585 4933 gene locus_tag LOCUS_22020 6585 4933 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_22020 >Feature sequence229 550 2241 gene locus_tag LOCUS_22030 550 2241 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940935.1 protein_id gnl|my_center|LOCUS_22030 2481 2407 gene locus_tag LOCUS_t00230 2481 2407 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2577 4622 gene locus_tag LOCUS_22040 2577 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 5137 4679 gene locus_tag LOCUS_22050 5137 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 5325 6326 gene locus_tag LOCUS_22060 5325 6326 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927122.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence230 284 1552 gene locus_tag LOCUS_22070 284 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 1646 2557 gene locus_tag LOCUS_22080 1646 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 4022 2541 gene locus_tag LOCUS_22090 4022 2541 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533311.1 protein_id gnl|my_center|LOCUS_22090 4651 4019 gene locus_tag LOCUS_22100 4651 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 4776 5657 gene locus_tag LOCUS_22110 4776 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 >Feature sequence231 151 864 gene locus_tag LOCUS_22120 151 864 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083303.1 protein_id gnl|my_center|LOCUS_22120 2161 884 gene locus_tag LOCUS_22130 2161 884 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032667864.1 protein_id gnl|my_center|LOCUS_22130 3363 2209 gene locus_tag LOCUS_22140 3363 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 4326 3397 gene locus_tag LOCUS_22150 4326 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 5324 4323 gene locus_tag LOCUS_22160 gene mvaD 5324 4323 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921869.1 protein_id gnl|my_center|LOCUS_22160 6325 5321 gene locus_tag LOCUS_22170 gene mvk 6325 5321 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774950.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence232 328 1662 gene locus_tag LOCUS_22180 328 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 1855 2022 gene locus_tag LOCUS_22190 1855 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2697 2050 gene locus_tag LOCUS_22200 gene purN 2697 2050 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942403.1 protein_id gnl|my_center|LOCUS_22200 3862 2828 gene locus_tag LOCUS_22210 gene purM 3862 2828 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381585.1 protein_id gnl|my_center|LOCUS_22210 5305 4058 gene locus_tag LOCUS_22220 5305 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 5636 6418 gene locus_tag LOCUS_22230 5636 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 >Feature sequence233 <1 651 gene locus_tag LOCUS_22240 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928794.1:thioredoxin domain-containing protein 1016 2212 gene locus_tag LOCUS_22250 gene add 1016 2212 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838307.1 protein_id gnl|my_center|LOCUS_22250 2214 2840 gene locus_tag LOCUS_22260 2214 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 3457 2885 gene locus_tag LOCUS_22270 3457 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 3609 4124 gene locus_tag LOCUS_22280 3609 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 4124 5146 gene locus_tag LOCUS_22290 4124 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 5962 5237 gene locus_tag LOCUS_22300 5962 5237 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903274.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence234 211 1962 gene locus_tag LOCUS_22310 211 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 2086 3252 gene locus_tag LOCUS_22320 2086 3252 CDS product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089071.1 protein_id gnl|my_center|LOCUS_22320 3331 4293 gene locus_tag LOCUS_22330 3331 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 4370 5113 gene locus_tag LOCUS_22340 4370 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 5194 5946 gene locus_tag LOCUS_22350 5194 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 <6473 5971 gene locus_tag LOCUS_22360 <6473 5971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943733.1:DNA translocase FtsK >Feature sequence235 2885 255 gene locus_tag LOCUS_22370 2885 255 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 protein_id gnl|my_center|LOCUS_22370 4781 3006 gene locus_tag LOCUS_22380 4781 3006 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142984.1 protein_id gnl|my_center|LOCUS_22380 5454 4915 gene locus_tag LOCUS_22390 gene orn 5454 4915 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 protein_id gnl|my_center|LOCUS_22390 5522 5983 gene locus_tag LOCUS_22400 5522 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence236 497 1537 gene locus_tag LOCUS_22410 497 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 1543 2565 gene locus_tag LOCUS_22420 1543 2565 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838116.1 protein_id gnl|my_center|LOCUS_22420 4126 2618 gene locus_tag LOCUS_22430 4126 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 5673 4123 gene locus_tag LOCUS_22440 5673 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 5797 6336 gene locus_tag LOCUS_22450 5797 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence237 2492 2100 gene locus_tag LOCUS_22460 2492 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 2881 5160 gene locus_tag LOCUS_22470 2881 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 5720 5298 gene locus_tag LOCUS_22480 5720 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 <6430 5925 gene locus_tag LOCUS_22490 <6430 5925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785787.1:recombinase RecA >Feature sequence238 454 149 gene locus_tag LOCUS_22500 454 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 624 2957 gene locus_tag LOCUS_22510 624 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 3752 3081 gene locus_tag LOCUS_22520 3752 3081 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064094285.1 protein_id gnl|my_center|LOCUS_22520 4901 3795 gene locus_tag LOCUS_22530 gene thiO 4901 3795 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_22530 <6423 4904 gene locus_tag LOCUS_22540 <6423 4904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530123.1:L,D-transpeptidase family protein >Feature sequence239 672 1331 gene locus_tag LOCUS_22550 672 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 1343 2848 gene locus_tag LOCUS_22560 1343 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 3003 4325 gene locus_tag LOCUS_22570 3003 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 4464 5531 gene locus_tag LOCUS_22580 4464 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 >Feature sequence240 801 1640 gene locus_tag LOCUS_22590 801 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 2045 1659 gene locus_tag LOCUS_22600 2045 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 3103 2171 gene locus_tag LOCUS_22610 3103 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 5520 3100 gene locus_tag LOCUS_22620 5520 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 5698 6096 gene locus_tag LOCUS_22630 5698 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence241 653 267 gene locus_tag LOCUS_22640 653 267 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_22640 937 650 gene locus_tag LOCUS_22650 937 650 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143545.1 protein_id gnl|my_center|LOCUS_22650 1331 1026 gene locus_tag LOCUS_22660 1331 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 1856 1356 gene locus_tag LOCUS_22670 1856 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 2892 2005 gene locus_tag LOCUS_22680 2892 2005 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226422.1 protein_id gnl|my_center|LOCUS_22680 3454 2933 gene locus_tag LOCUS_22690 3454 2933 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226423.1 protein_id gnl|my_center|LOCUS_22690 5745 3457 gene locus_tag LOCUS_22700 5745 3457 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869185.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence242 669 256 gene locus_tag LOCUS_22710 669 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 566 931 gene locus_tag LOCUS_22720 566 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 956 1297 gene locus_tag LOCUS_22730 956 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 1338 2225 gene locus_tag LOCUS_22740 gene truA 1338 2225 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_22740 2974 2222 gene locus_tag LOCUS_22750 gene gloB 2974 2222 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143329.1 protein_id gnl|my_center|LOCUS_22750 3494 3048 gene locus_tag LOCUS_22760 3494 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 3617 4381 gene locus_tag LOCUS_22770 3617 4381 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 protein_id gnl|my_center|LOCUS_22770 4543 4836 gene locus_tag LOCUS_22780 4543 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 4934 5398 gene locus_tag LOCUS_22790 gene bfrA 4934 5398 CDS product bacterioferritin BfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409398.1 protein_id gnl|my_center|LOCUS_22790 >Feature sequence243 992 87 gene locus_tag LOCUS_22800 992 87 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036194.1 protein_id gnl|my_center|LOCUS_22800 1165 2028 gene locus_tag LOCUS_22810 1165 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 2901 2083 gene locus_tag LOCUS_22820 2901 2083 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_22820 <6180 2983 gene locus_tag LOCUS_22830 <6180 2983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121781.1:bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase >Feature sequence244 1113 31 gene locus_tag LOCUS_22840 gene carA 1113 31 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 protein_id gnl|my_center|LOCUS_22840 2468 1110 gene locus_tag LOCUS_22850 2468 1110 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_22850 2663 3280 gene locus_tag LOCUS_22860 2663 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 3398 5089 gene locus_tag LOCUS_22870 3398 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 5110 5760 gene locus_tag LOCUS_22880 5110 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 >Feature sequence245 723 1865 gene locus_tag LOCUS_22890 723 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 2053 4320 gene locus_tag LOCUS_22900 2053 4320 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_22900 4317 4886 gene locus_tag LOCUS_22910 4317 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 4916 5362 gene locus_tag LOCUS_22920 4916 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 >Feature sequence246 2529 892 gene locus_tag LOCUS_22930 2529 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 3272 2526 gene locus_tag LOCUS_22940 3272 2526 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_22940 4249 3269 gene locus_tag LOCUS_22950 4249 3269 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_22950 4499 4969 gene locus_tag LOCUS_22960 4499 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 4966 5448 gene locus_tag LOCUS_22970 4966 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence247 163 576 gene locus_tag LOCUS_22980 163 576 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124292.1 protein_id gnl|my_center|LOCUS_22980 594 1169 gene locus_tag LOCUS_22990 594 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 1209 3155 gene locus_tag LOCUS_23000 gene hscA 1209 3155 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926439.1 protein_id gnl|my_center|LOCUS_23000 3227 3586 gene locus_tag LOCUS_23010 3227 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 3677 4891 gene locus_tag LOCUS_23020 3677 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 5904 4906 gene locus_tag LOCUS_23030 5904 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence248 3556 230 gene locus_tag LOCUS_23040 3556 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 3449 3712 gene locus_tag LOCUS_23050 3449 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 4066 3770 gene locus_tag LOCUS_23060 4066 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 >Feature sequence249 1316 123 gene locus_tag LOCUS_23070 1316 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23070 1456 2256 gene locus_tag LOCUS_23080 1456 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 2253 3197 gene locus_tag LOCUS_23090 gene fmt 2253 3197 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_23090 3184 3762 gene locus_tag LOCUS_23100 3184 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 4131 3862 gene locus_tag LOCUS_23110 4131 3862 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_23110 4441 4136 gene locus_tag LOCUS_23120 4441 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 5177 4491 gene locus_tag LOCUS_23130 5177 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 <5969 5198 gene locus_tag LOCUS_23140 <5969 5198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388669.1:aldehyde dehydrogenase EutE >Feature sequence250 1612 29 gene locus_tag LOCUS_23150 gene proS 1612 29 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921836.1 protein_id gnl|my_center|LOCUS_23150 2394 1708 gene locus_tag LOCUS_23160 2394 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 3416 2460 gene locus_tag LOCUS_23170 3416 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 5293 3413 gene locus_tag LOCUS_23180 5293 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence251 <1 597 gene locus_tag LOCUS_23190 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393792.1:adenylosuccinate synthase 709 1662 gene locus_tag LOCUS_23200 709 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 1659 2666 gene locus_tag LOCUS_23210 1659 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2788 4365 gene locus_tag LOCUS_23220 2788 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 4464 5762 gene locus_tag LOCUS_23230 4464 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence252 1766 2947 gene locus_tag LOCUS_23240 1766 2947 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081159250.1 protein_id gnl|my_center|LOCUS_23240 5293 3074 gene locus_tag LOCUS_23250 5293 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence253 2249 723 gene locus_tag LOCUS_23260 2249 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 3804 2308 gene locus_tag LOCUS_23270 3804 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 5092 4769 gene locus_tag LOCUS_23280 gene erpA 5092 4769 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115421.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence254 3885 4394 gene locus_tag LOCUS_23290 3885 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence255 547 2175 gene locus_tag LOCUS_23300 547 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 2172 3533 gene locus_tag LOCUS_23310 2172 3533 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119021.1 protein_id gnl|my_center|LOCUS_23310 3530 4393 gene locus_tag LOCUS_23320 3530 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 >Feature sequence256 511 1212 gene locus_tag LOCUS_23330 511 1212 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242863.1 protein_id gnl|my_center|LOCUS_23330 2183 1290 gene locus_tag LOCUS_23340 2183 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2074 2274 gene locus_tag LOCUS_23350 2074 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 2410 3729 gene locus_tag LOCUS_23360 2410 3729 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_23360 3853 4896 gene locus_tag LOCUS_23370 3853 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 5298 4981 gene locus_tag LOCUS_23380 5298 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 >Feature sequence257 422 1363 gene locus_tag LOCUS_23390 422 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 3016 1391 gene locus_tag LOCUS_23400 3016 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 3887 3147 gene locus_tag LOCUS_23410 3887 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 4605 3901 gene locus_tag LOCUS_23420 4605 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 5029 4712 gene locus_tag LOCUS_23430 5029 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 >Feature sequence258 5564 4980 gene locus_tag LOCUS_23440 5564 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 >Feature sequence259 <1 1354 gene locus_tag LOCUS_23450 <1 1354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404537.1:glutamine--tRNA ligase/YqeY domain fusion protein 1416 2768 gene locus_tag LOCUS_23460 1416 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 4115 2856 gene locus_tag LOCUS_23470 4115 2856 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266685.1 protein_id gnl|my_center|LOCUS_23470 <5666 4220 gene locus_tag LOCUS_23480 <5666 4220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943793.1:type VI secretion system contractile sheath large subunit >Feature sequence260 1323 1742 gene locus_tag LOCUS_23490 1323 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 1922 4231 gene locus_tag LOCUS_23500 1922 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 4276 5124 gene locus_tag LOCUS_23510 4276 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23510 >Feature sequence261 403 215 gene locus_tag LOCUS_23520 403 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 306 2282 gene locus_tag LOCUS_23530 306 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 4784 2301 gene locus_tag LOCUS_23540 gene rnr 4784 2301 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence262 2914 737 gene locus_tag LOCUS_23550 2914 737 CDS product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551232.1 protein_id gnl|my_center|LOCUS_23550 3312 2911 gene locus_tag LOCUS_23560 3312 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 3824 3312 gene locus_tag LOCUS_23570 3824 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 4927 3863 gene locus_tag LOCUS_23580 4927 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 <5623 4962 gene locus_tag LOCUS_23590 <5623 4962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000443134.1:peptide MFS transporter >Feature sequence263 3274 1070 gene locus_tag LOCUS_23600 gene secD 3274 1070 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_23600 3751 3284 gene locus_tag LOCUS_23610 3751 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 4640 3951 gene locus_tag LOCUS_23620 gene nth 4640 3951 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_23620 4685 4757 gene locus_tag LOCUS_t00240 4685 4757 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence264 1087 1440 gene locus_tag LOCUS_23630 1087 1440 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772151.1 protein_id gnl|my_center|LOCUS_23630 1437 1922 gene locus_tag LOCUS_23640 1437 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 1971 2483 gene locus_tag LOCUS_23650 1971 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 3605 2556 gene locus_tag LOCUS_23660 3605 2556 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870053.1 protein_id gnl|my_center|LOCUS_23660 4486 3602 gene locus_tag LOCUS_23670 4486 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 <5563 4635 gene locus_tag LOCUS_23680 <5563 4635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939350.1:chemotaxis protein CheA >Feature sequence265 3851 3621 gene locus_tag LOCUS_23690 3851 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 4453 3902 gene locus_tag LOCUS_23700 4453 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 <5561 4697 gene locus_tag LOCUS_23710 <5561 4697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941157.1:YifB family Mg chelatase-like AAA ATPase >Feature sequence266 1409 2539 gene locus_tag LOCUS_23720 1409 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 2814 3422 gene locus_tag LOCUS_23730 2814 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 3511 3939 gene locus_tag LOCUS_23740 3511 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 3940 4305 gene locus_tag LOCUS_23750 3940 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 4477 5418 gene locus_tag LOCUS_23760 gene pdhA 4477 5418 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980946.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence267 1569 97 gene locus_tag LOCUS_23770 1569 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 2964 1639 gene locus_tag LOCUS_23780 gene lysC 2964 1639 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931789.1 protein_id gnl|my_center|LOCUS_23780 3803 3060 gene locus_tag LOCUS_23790 3803 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence268 <1 2723 gene locus_tag LOCUS_23800 <1 2723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052279209.1:multiheme c-type cytochrome 2720 4939 gene locus_tag LOCUS_23810 2720 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence269 195 326 gene locus_tag LOCUS_23820 195 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 564 2174 gene locus_tag LOCUS_23830 564 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 2378 3346 gene locus_tag LOCUS_23840 2378 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 3483 4469 gene locus_tag LOCUS_23850 3483 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 >Feature sequence270 <1 687 gene locus_tag LOCUS_23860 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257750.1:fumarate reductase/succinate dehydrogenase flavoprotein subunit 687 1463 gene locus_tag LOCUS_23870 687 1463 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_23870 3527 1611 gene locus_tag LOCUS_23880 3527 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 3769 4449 gene locus_tag LOCUS_23890 gene mutH 3769 4449 CDS product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704633.1 protein_id gnl|my_center|LOCUS_23890 <5483 4522 gene locus_tag LOCUS_23900 <5483 4522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000510008.1:ferrous iron transport protein B >Feature sequence271 >Feature sequence272 3040 506 gene locus_tag LOCUS_23910 3040 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 3405 4385 gene locus_tag LOCUS_23920 3405 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 4530 5045 gene locus_tag LOCUS_23930 4530 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 >Feature sequence273 3561 2542 gene locus_tag LOCUS_23940 3561 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 4327 3653 gene locus_tag LOCUS_23950 4327 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 4988 4371 gene locus_tag LOCUS_23960 4988 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence274 <1 1001 gene locus_tag LOCUS_23970 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035620.1:3-oxoadipyl-CoA thiolase 2862 1114 gene locus_tag LOCUS_23980 2862 1114 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence275 <1 679 gene locus_tag LOCUS_23990 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189039.1:sigma-54 dependent transcriptional regulator 1162 758 gene locus_tag LOCUS_24000 gene nusB 1162 758 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_24000 1683 1219 gene locus_tag LOCUS_24010 gene ribE 1683 1219 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 protein_id gnl|my_center|LOCUS_24010 2943 1753 gene locus_tag LOCUS_24020 2943 1753 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_24020 3756 3034 gene locus_tag LOCUS_24030 3756 3034 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035934.1 protein_id gnl|my_center|LOCUS_24030 4138 3794 gene locus_tag LOCUS_24040 4138 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 <5463 4244 gene locus_tag LOCUS_24050 <5463 4244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943853.1:ribonuclease G >Feature sequence276 848 219 gene locus_tag LOCUS_24060 848 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 1999 854 gene locus_tag LOCUS_24070 1999 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2132 3592 gene locus_tag LOCUS_24080 2132 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 4099 3602 gene locus_tag LOCUS_24090 4099 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 4254 4889 gene locus_tag LOCUS_24100 4254 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 >Feature sequence277 <1 868 gene locus_tag LOCUS_24110 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797170.1:metallophosphoesterase 1818 910 gene locus_tag LOCUS_24120 1818 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 2917 1967 gene locus_tag LOCUS_24130 2917 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 4480 2999 gene locus_tag LOCUS_24140 4480 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 <5414 4565 gene locus_tag LOCUS_24150 <5414 4565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943240.1:30S ribosomal protein S1 >Feature sequence278 1516 524 gene locus_tag LOCUS_24160 1516 524 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404321.1 protein_id gnl|my_center|LOCUS_24160 1948 1598 gene locus_tag LOCUS_24170 1948 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 2774 1977 gene locus_tag LOCUS_24180 2774 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 4669 2771 gene locus_tag LOCUS_24190 4669 2771 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_24190 <5381 4666 gene locus_tag LOCUS_24200 <5381 4666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043552510.1:ABC transporter ATP-binding protein >Feature sequence279 6 923 gene locus_tag LOCUS_24210 6 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 920 3994 gene locus_tag LOCUS_24220 920 3994 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761136.1 protein_id gnl|my_center|LOCUS_24220 3982 4728 gene locus_tag LOCUS_24230 3982 4728 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919036.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence280 <1 1192 gene locus_tag LOCUS_24240 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197388.1:translation initiation factor IF-2 1195 1557 gene locus_tag LOCUS_24250 1195 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 1554 1982 gene locus_tag LOCUS_24260 1554 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 4676 2100 gene locus_tag LOCUS_24270 4676 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence281 1377 505 gene locus_tag LOCUS_24280 1377 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 2794 1364 gene locus_tag LOCUS_24290 2794 1364 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338785.1 protein_id gnl|my_center|LOCUS_24290 <5224 2791 gene locus_tag LOCUS_24300 <5224 2791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256390.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence282 940 407 gene locus_tag LOCUS_24310 gene pyrR 940 407 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941925.1 protein_id gnl|my_center|LOCUS_24310 1075 1923 gene locus_tag LOCUS_24320 1075 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 2002 2190 gene locus_tag LOCUS_24330 gene rpmF 2002 2190 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389355.1 protein_id gnl|my_center|LOCUS_24330 2330 3355 gene locus_tag LOCUS_24340 2330 3355 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_24340 3467 3787 gene locus_tag LOCUS_24350 3467 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 3876 4553 gene locus_tag LOCUS_24360 3876 4553 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_24360 >Feature sequence283 1880 765 gene locus_tag LOCUS_24370 1880 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 2703 2068 gene locus_tag LOCUS_24380 2703 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 3599 2718 gene locus_tag LOCUS_24390 3599 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 4267 3596 gene locus_tag LOCUS_24400 gene rpoE 4267 3596 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence284 113 904 gene locus_tag LOCUS_24410 113 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 1162 2733 gene locus_tag LOCUS_24420 1162 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 2738 3985 gene locus_tag LOCUS_24430 2738 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence285 1023 1991 gene locus_tag LOCUS_24440 1023 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 1988 2749 gene locus_tag LOCUS_24450 1988 2749 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704670.1 protein_id gnl|my_center|LOCUS_24450 4006 2783 gene locus_tag LOCUS_24460 4006 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 5084 4107 gene locus_tag LOCUS_24470 5084 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence286 1011 82 gene locus_tag LOCUS_24480 gene tsf 1011 82 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565808.1 protein_id gnl|my_center|LOCUS_24480 1881 1042 gene locus_tag LOCUS_24490 gene rpsB 1881 1042 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_24490 3805 2141 gene locus_tag LOCUS_24500 3805 2141 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_24500 3997 4416 gene locus_tag LOCUS_24510 3997 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence287 488 694 gene locus_tag LOCUS_24520 488 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 891 3368 gene locus_tag LOCUS_24530 891 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 3441 4391 gene locus_tag LOCUS_24540 gene gluQRS 3441 4391 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_24540 4499 4843 gene locus_tag LOCUS_24550 4499 4843 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932034.1 protein_id gnl|my_center|LOCUS_24550 >Feature sequence288 2203 128 gene locus_tag LOCUS_24560 2203 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 3165 2281 gene locus_tag LOCUS_24570 gene hflC 3165 2281 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390051.1 protein_id gnl|my_center|LOCUS_24570 4573 3167 gene locus_tag LOCUS_24580 4573 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 5078 4668 gene locus_tag LOCUS_24590 5078 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence289 <1 671 gene locus_tag LOCUS_24600 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039041.1:ATP-binding cassette domain-containing protein 668 1834 gene locus_tag LOCUS_24610 668 1834 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140055.1 protein_id gnl|my_center|LOCUS_24610 2968 1793 gene locus_tag LOCUS_24620 2968 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 3257 2958 gene locus_tag LOCUS_24630 3257 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 4330 3404 gene locus_tag LOCUS_24640 4330 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence290 1282 317 gene locus_tag LOCUS_24650 1282 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 1473 3302 gene locus_tag LOCUS_24660 1473 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 3833 3369 gene locus_tag LOCUS_24670 3833 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 <5051 3928 gene locus_tag LOCUS_24680 <5051 3928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942434.1:endopeptidase La >Feature sequence291 1557 1195 gene locus_tag LOCUS_24690 gene dksA 1557 1195 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095632.1 protein_id gnl|my_center|LOCUS_24690 1809 2630 gene locus_tag LOCUS_24700 1809 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069846.1 protein_id gnl|my_center|LOCUS_24700 4557 2662 gene locus_tag LOCUS_24710 4557 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 5023 4844 gene locus_tag LOCUS_24720 5023 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 >Feature sequence292 1701 919 gene locus_tag LOCUS_24730 1701 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 4061 1725 gene locus_tag LOCUS_24740 4061 1725 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_24740 4779 4309 gene locus_tag LOCUS_24750 4779 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence293 2504 915 gene locus_tag LOCUS_24760 2504 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 2632 3243 gene locus_tag LOCUS_24770 2632 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 3316 4359 gene locus_tag LOCUS_24780 3316 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 >Feature sequence294 216 902 gene locus_tag LOCUS_24790 216 902 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243018.1 protein_id gnl|my_center|LOCUS_24790 2383 956 gene locus_tag LOCUS_24800 2383 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 4543 2543 gene locus_tag LOCUS_24810 4543 2543 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence295 406 1131 gene locus_tag LOCUS_24820 406 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 1197 1805 gene locus_tag LOCUS_24830 gene pth 1197 1805 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_24830 1895 2440 gene locus_tag LOCUS_24840 1895 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 2444 2710 gene locus_tag LOCUS_24850 2444 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 2724 3179 gene locus_tag LOCUS_24860 gene rplI 2724 3179 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_24860 3363 4862 gene locus_tag LOCUS_24870 gene dnaB 3363 4862 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583712.1 protein_id gnl|my_center|LOCUS_24870 >Feature sequence296 1139 2149 gene locus_tag LOCUS_24880 1139 2149 CDS product IS1595-like element ISSod11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071113.1 protein_id gnl|my_center|LOCUS_24880 2215 3111 gene locus_tag LOCUS_24890 2215 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 4454 3183 gene locus_tag LOCUS_24900 4454 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 >Feature sequence297 1459 1175 gene locus_tag LOCUS_24910 1459 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 1667 2881 gene locus_tag LOCUS_24920 1667 2881 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454678.1 protein_id gnl|my_center|LOCUS_24920 2878 3654 gene locus_tag LOCUS_24930 2878 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 3690 4634 gene locus_tag LOCUS_24940 3690 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence298 465 1418 gene locus_tag LOCUS_24950 465 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 1461 2459 gene locus_tag LOCUS_24960 1461 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 4689 2476 gene locus_tag LOCUS_24970 gene fadJ 4689 2476 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072985.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence299 158 1783 gene locus_tag LOCUS_24980 gene nadB 158 1783 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_24980 1858 2757 gene locus_tag LOCUS_24990 1858 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 2873 4210 gene locus_tag LOCUS_25000 gene thrC 2873 4210 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122990.1 protein_id gnl|my_center|LOCUS_25000 <4819 4318 gene locus_tag LOCUS_25010 <4819 4318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022048.1:RND family transporter >Feature sequence300 1282 281 gene locus_tag LOCUS_25020 1282 281 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_25020 1410 2531 gene locus_tag LOCUS_25030 1410 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 2648 4090 gene locus_tag LOCUS_25040 2648 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 <4804 4155 gene locus_tag LOCUS_25050 <4804 4155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004539575.1:glycine C-acetyltransferase >Feature sequence301 1518 790 gene locus_tag LOCUS_25060 1518 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 1678 3267 gene locus_tag LOCUS_25070 gene murJ 1678 3267 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639869.1 protein_id gnl|my_center|LOCUS_25070 >Feature sequence302 109 2013 gene locus_tag LOCUS_25080 109 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 2444 2842 gene locus_tag LOCUS_25090 2444 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 2941 4128 gene locus_tag LOCUS_25100 2941 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 >Feature sequence303 425 2824 gene locus_tag LOCUS_25110 425 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 2978 3757 gene locus_tag LOCUS_25120 2978 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 3940 4374 gene locus_tag LOCUS_25130 3940 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 >Feature sequence304 1433 312 gene locus_tag LOCUS_25140 1433 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 1654 1502 gene locus_tag LOCUS_25150 1654 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 1798 3948 gene locus_tag LOCUS_25160 1798 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 <4702 4124 gene locus_tag LOCUS_25170 <4702 4124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388511.1:ATP-dependent chaperone ClpB >Feature sequence305 159 1841 gene locus_tag LOCUS_25180 159 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 2621 1932 gene locus_tag LOCUS_25190 2621 1932 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818985.1 protein_id gnl|my_center|LOCUS_25190 3276 2680 gene locus_tag LOCUS_25200 gene folE 3276 2680 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918347.1 protein_id gnl|my_center|LOCUS_25200 4136 3432 gene locus_tag LOCUS_25210 4136 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence306 202 1695 gene locus_tag LOCUS_25220 202 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 1754 2635 gene locus_tag LOCUS_25230 gene panB 1754 2635 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_25230 >Feature sequence307 <1 561 gene locus_tag LOCUS_25240 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_144080342.1:pyruvate kinase 1616 591 gene locus_tag LOCUS_25250 1616 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 2038 1673 gene locus_tag LOCUS_25260 2038 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 3520 2159 gene locus_tag LOCUS_25270 gene gcvPA 3520 2159 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921182.1 protein_id gnl|my_center|LOCUS_25270 3943 3557 gene locus_tag LOCUS_25280 gene gcvH 3943 3557 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222781.1 protein_id gnl|my_center|LOCUS_25280 <4626 4105 gene locus_tag LOCUS_25290 <4626 4105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764743.1:glycine cleavage system aminomethyltransferase GcvT >Feature sequence308 294 1502 gene locus_tag LOCUS_25300 294 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_25300 2496 1660 gene locus_tag LOCUS_25310 2496 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 3186 2833 gene locus_tag LOCUS_25320 3186 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 3398 4300 gene locus_tag LOCUS_25330 3398 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence309 3 359 gene locus_tag LOCUS_25340 3 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 1314 421 gene locus_tag LOCUS_25350 gene miaA 1314 421 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_25350 3344 1311 gene locus_tag LOCUS_25360 gene mutL 3344 1311 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929705.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence310 1266 2351 gene locus_tag LOCUS_25370 1266 2351 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_25370 2355 3317 gene locus_tag LOCUS_25380 gene pstC 2355 3317 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_25380 3329 4186 gene locus_tag LOCUS_25390 gene pstA 3329 4186 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405019.1 protein_id gnl|my_center|LOCUS_25390 >Feature sequence311 381 1520 gene locus_tag LOCUS_25400 381 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 1863 2618 gene locus_tag LOCUS_25410 1863 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence312 1059 67 gene locus_tag LOCUS_25420 1059 67 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256898.1 protein_id gnl|my_center|LOCUS_25420 1304 2314 gene locus_tag LOCUS_25430 1304 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 2352 3128 gene locus_tag LOCUS_25440 2352 3128 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975730.1 protein_id gnl|my_center|LOCUS_25440 3299 4120 gene locus_tag LOCUS_25450 3299 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 >Feature sequence313 1729 869 gene locus_tag LOCUS_25460 1729 869 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083222.1 protein_id gnl|my_center|LOCUS_25460 2868 1726 gene locus_tag LOCUS_25470 2868 1726 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197948963.1 protein_id gnl|my_center|LOCUS_25470 3343 2951 gene locus_tag LOCUS_25480 3343 2951 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918482.1 protein_id gnl|my_center|LOCUS_25480 4428 3373 gene locus_tag LOCUS_25490 4428 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 >Feature sequence314 1889 519 gene locus_tag LOCUS_25500 1889 519 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393140.1 protein_id gnl|my_center|LOCUS_25500 2886 1963 gene locus_tag LOCUS_25510 2886 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence315 <1 1278 gene locus_tag LOCUS_25520 <1 1278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928794.1:thioredoxin domain-containing protein 2909 1416 gene locus_tag LOCUS_25530 2909 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 4062 2944 gene locus_tag LOCUS_25540 gene dapE 4062 2944 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_25540 >Feature sequence316 <1 666 gene locus_tag LOCUS_25550 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015077.1:Hsp70 family protein 1011 1823 gene locus_tag LOCUS_25560 1011 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 3847 1877 gene locus_tag LOCUS_25570 3847 1877 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257258.1 protein_id gnl|my_center|LOCUS_25570 >Feature sequence317 <1 3797 gene locus_tag LOCUS_25580 <1 3797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583095.1:DUF3857 domain-containing protein >Feature sequence318 <1 1590 gene locus_tag LOCUS_25590 <1 1590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056567.1:NAD(P)H-quinone oxidoreductase subunit 5 1587 3569 gene locus_tag LOCUS_25600 1587 3569 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_25600 >Feature sequence319 639 1487 gene locus_tag LOCUS_25610 639 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 1994 1500 gene locus_tag LOCUS_25620 1994 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2050 2916 gene locus_tag LOCUS_25630 2050 2916 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920173.1 protein_id gnl|my_center|LOCUS_25630 4225 3218 gene locus_tag LOCUS_25640 4225 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence320 229 1809 gene locus_tag LOCUS_25650 229 1809 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908534.1 protein_id gnl|my_center|LOCUS_25650 1839 2867 gene locus_tag LOCUS_25660 gene ltaE 1839 2867 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_25660 2911 4110 gene locus_tag LOCUS_25670 2911 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 >Feature sequence321 1514 306 gene locus_tag LOCUS_25680 gene murG 1514 306 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035962.1 protein_id gnl|my_center|LOCUS_25680 2695 1511 gene locus_tag LOCUS_25690 gene ftsW 2695 1511 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_25690 4194 2743 gene locus_tag LOCUS_25700 gene murD 4194 2743 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_25700 >Feature sequence322 410 1591 gene locus_tag LOCUS_25710 410 1591 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112662.1 protein_id gnl|my_center|LOCUS_25710 1650 2819 gene locus_tag LOCUS_25720 gene meaB 1650 2819 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_25720 3964 2876 gene locus_tag LOCUS_25730 3964 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 >Feature sequence323 <1 1272 gene locus_tag LOCUS_25740 <1 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921330.1:PAS domain S-box protein 2679 1306 gene locus_tag LOCUS_25750 gene eat 2679 1306 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112038.1 protein_id gnl|my_center|LOCUS_25750 <4180 2812 gene locus_tag LOCUS_25760 <4180 2812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030377.1:FAD-dependent oxidoreductase >Feature sequence324 >Feature sequence325 1937 1852 gene locus_tag LOCUS_t00250 1937 1852 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2050 3855 gene locus_tag LOCUS_25770 2050 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence326 442 1380 gene locus_tag LOCUS_25780 442 1380 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037002.1 protein_id gnl|my_center|LOCUS_25780 3157 1520 gene locus_tag LOCUS_25790 3157 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 3714 3154 gene locus_tag LOCUS_25800 3714 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence327 >Feature sequence328 428 802 gene locus_tag LOCUS_25810 428 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 888 2585 gene locus_tag LOCUS_25820 888 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 >Feature sequence329 117 728 gene locus_tag LOCUS_25830 117 728 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532957.1 protein_id gnl|my_center|LOCUS_25830 2095 1046 gene locus_tag LOCUS_25840 2095 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 2419 2186 gene locus_tag LOCUS_25850 2419 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 3769 2570 gene locus_tag LOCUS_25860 gene hemW 3769 2570 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338802.1 protein_id gnl|my_center|LOCUS_25860 >Feature sequence330 <4023 3093 gene locus_tag LOCUS_25870 <4023 3093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230459.1:DUF2520 domain-containing protein >Feature sequence331 84 2759 gene locus_tag LOCUS_25880 84 2759 CDS product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038998.1 protein_id gnl|my_center|LOCUS_25880 2759 3823 gene locus_tag LOCUS_25890 2759 3823 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705434.1 protein_id gnl|my_center|LOCUS_25890 >Feature sequence332 1620 301 gene locus_tag LOCUS_25900 1620 301 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_25900 3390 1681 gene locus_tag LOCUS_25910 3390 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 >Feature sequence333 187 2181 gene locus_tag LOCUS_25920 187 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 3294 2308 gene locus_tag LOCUS_25930 3294 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 3870 3364 gene locus_tag LOCUS_25940 3870 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 >Feature sequence334 209 2437 gene locus_tag LOCUS_25950 209 2437 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728359.1 protein_id gnl|my_center|LOCUS_25950 3456 2623 gene locus_tag LOCUS_25960 3456 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 3821 3453 gene locus_tag LOCUS_25970 3821 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 >Feature sequence335 1384 647 gene locus_tag LOCUS_25980 1384 647 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_25980 3019 1418 gene locus_tag LOCUS_25990 3019 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 3617 3102 gene locus_tag LOCUS_26000 3617 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence336 1362 352 gene locus_tag LOCUS_26010 1362 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 1868 1449 gene locus_tag LOCUS_26020 1868 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 3586 1865 gene locus_tag LOCUS_26030 3586 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence337 <1 572 gene locus_tag LOCUS_26040 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393064.1:3-dehydroquinate synthase 696 2153 gene locus_tag LOCUS_26050 696 2153 CDS product bifunctional 3-dehydroquinate dehydratase/shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883668.1 protein_id gnl|my_center|LOCUS_26050 2221 3528 gene locus_tag LOCUS_26060 gene aroA 2221 3528 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332883.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence338 1724 447 gene locus_tag LOCUS_26070 gene ftsA 1724 447 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_26070 2718 1906 gene locus_tag LOCUS_26080 2718 1906 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943690.1 protein_id gnl|my_center|LOCUS_26080 <3806 2879 gene locus_tag LOCUS_26090 <3806 2879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943693.1:UDP-N-acetylmuramate--L-alanine ligase >Feature sequence339 438 770 gene locus_tag LOCUS_26100 438 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 2469 985 gene locus_tag LOCUS_26110 2469 985 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_26110 3409 2618 gene locus_tag LOCUS_26120 3409 2618 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403012.1 protein_id gnl|my_center|LOCUS_26120 >Feature sequence340 1102 1187 gene locus_tag LOCUS_t00260 1102 1187 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1781 1482 gene locus_tag LOCUS_26130 1781 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 >Feature sequence341 40 513 gene locus_tag LOCUS_26140 40 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 2045 531 gene locus_tag LOCUS_26150 2045 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2902 2042 gene locus_tag LOCUS_26160 2902 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 3329 2904 gene locus_tag LOCUS_26170 gene tolR 3329 2904 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940359.1 protein_id gnl|my_center|LOCUS_26170 >Feature sequence342 831 2594 gene locus_tag LOCUS_26180 831 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 2606 3529 gene locus_tag LOCUS_26190 2606 3529 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567718.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence343 2004 1207 gene locus_tag LOCUS_26200 2004 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 3383 2001 gene locus_tag LOCUS_26210 3383 2001 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071381.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence344 2371 470 gene locus_tag LOCUS_26220 gene menD 2371 470 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259491.1 protein_id gnl|my_center|LOCUS_26220 <3712 2368 gene locus_tag LOCUS_26230 <3712 2368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259490.1:isochorismate synthase >Feature sequence345 1331 426 gene locus_tag LOCUS_26240 1331 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence346 696 223 gene locus_tag LOCUS_26250 696 223 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_26250 798 2687 gene locus_tag LOCUS_26260 798 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 >Feature sequence347 389 87 gene locus_tag LOCUS_26270 389 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 736 386 gene locus_tag LOCUS_26280 736 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 917 2170 gene locus_tag LOCUS_26290 917 2170 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_26290 2271 2780 gene locus_tag LOCUS_26300 2271 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 2854 3285 gene locus_tag LOCUS_26310 gene rlmH 2854 3285 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243164.1 protein_id gnl|my_center|LOCUS_26310 >Feature sequence348 2667 3203 gene locus_tag LOCUS_26320 gene pal 2667 3203 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932322.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence349 1645 458 gene locus_tag LOCUS_26330 1645 458 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 protein_id gnl|my_center|LOCUS_26330 2463 1642 gene locus_tag LOCUS_26340 2463 1642 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228734.1 protein_id gnl|my_center|LOCUS_26340 2906 2463 gene locus_tag LOCUS_26350 2906 2463 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_26350 <3639 2921 gene locus_tag LOCUS_26360 <3639 2921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010927121.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence350 812 2572 gene locus_tag LOCUS_26370 812 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence351 354 1073 gene locus_tag LOCUS_26380 354 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 1181 1253 gene locus_tag LOCUS_t00270 1181 1253 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1370 1999 gene locus_tag LOCUS_26390 1370 1999 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393839.1 protein_id gnl|my_center|LOCUS_26390 1996 2370 gene locus_tag LOCUS_26400 1996 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 3205 2423 gene locus_tag LOCUS_26410 3205 2423 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_26410 >Feature sequence352 409 2100 gene locus_tag LOCUS_26420 gene recJ 409 2100 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257020.1 protein_id gnl|my_center|LOCUS_26420 2128 2907 gene locus_tag LOCUS_26430 2128 2907 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_26430 >Feature sequence353 3 248 gene locus_tag LOCUS_26440 3 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 292 1161 gene locus_tag LOCUS_26450 292 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 1218 2882 gene locus_tag LOCUS_26460 1218 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 3550 3011 gene locus_tag LOCUS_26470 3550 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence354 1239 2510 gene locus_tag LOCUS_26480 1239 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence355 1390 866 gene locus_tag LOCUS_26490 1390 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 1807 3444 gene locus_tag LOCUS_26500 1807 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 >Feature sequence356 970 2610 gene locus_tag LOCUS_26510 970 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 3114 2533 gene locus_tag LOCUS_26520 3114 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence357 65 1402 gene locus_tag LOCUS_26530 65 1402 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857633.1 protein_id gnl|my_center|LOCUS_26530 1399 2673 gene locus_tag LOCUS_26540 1399 2673 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532354.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence358 1194 106 gene locus_tag LOCUS_26550 1194 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 1241 1924 gene locus_tag LOCUS_26560 1241 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 <3466 2612 gene locus_tag LOCUS_26570 <3466 2612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941806.1:chemotaxis response regulator protein-glutamate methylesterase >Feature sequence359 2256 1171 gene locus_tag LOCUS_26580 2256 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122840.1 protein_id gnl|my_center|LOCUS_26580 2631 2362 gene locus_tag LOCUS_26590 2631 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 >Feature sequence360 1407 499 gene locus_tag LOCUS_26600 1407 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 1967 1539 gene locus_tag LOCUS_26610 gene ndk 1967 1539 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086893.1 protein_id gnl|my_center|LOCUS_26610 2277 3188 gene locus_tag LOCUS_26620 gene selD 2277 3188 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence361 619 161 gene locus_tag LOCUS_26630 619 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 1779 682 gene locus_tag LOCUS_26640 gene mltG 1779 682 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933876.1 protein_id gnl|my_center|LOCUS_26640 <3360 1947 gene locus_tag LOCUS_26650 <3360 1947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103037676.1:NAD(P)-binding domain-containing protein >Feature sequence362 344 649 gene locus_tag LOCUS_26660 344 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 664 1140 gene locus_tag LOCUS_26670 664 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 1137 1706 gene locus_tag LOCUS_26680 1137 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 1794 2411 gene locus_tag LOCUS_26690 1794 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence363 493 1383 gene locus_tag LOCUS_26700 gene mreC 493 1383 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_26700 1405 1929 gene locus_tag LOCUS_26710 1405 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 >Feature sequence364 379 104 gene locus_tag LOCUS_26720 379 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 2465 495 gene locus_tag LOCUS_26730 2465 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 3256 2492 gene locus_tag LOCUS_26740 3256 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence365 1239 2192 gene locus_tag LOCUS_26750 1239 2192 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_26750 2189 3109 gene locus_tag LOCUS_26760 2189 3109 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_26760 >Feature sequence366 1027 2538 gene locus_tag LOCUS_26770 1027 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 2644 2720 gene locus_tag LOCUS_t00280 2644 2720 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence367 2074 338 gene locus_tag LOCUS_26780 2074 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 <3269 2230 gene locus_tag LOCUS_26790 <3269 2230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330018.1:ABC transporter ATP-binding protein >Feature sequence368 249 794 gene locus_tag LOCUS_26800 249 794 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816386.1 protein_id gnl|my_center|LOCUS_26800 877 2196 gene locus_tag LOCUS_26810 877 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 >Feature sequence369 <1 762 gene locus_tag LOCUS_26820 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392848.1:3-deoxy-7-phosphoheptulonate synthase 930 3104 gene locus_tag LOCUS_26830 930 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 >Feature sequence370 <1 890 gene locus_tag LOCUS_26840 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090641.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A 1605 1093 gene locus_tag LOCUS_26850 1605 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 2236 1760 gene locus_tag LOCUS_26860 gene greB 2236 1760 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941858.1 protein_id gnl|my_center|LOCUS_26860 <3203 2275 gene locus_tag LOCUS_26870 <3203 2275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_075276545.1:valine--tRNA ligase >Feature sequence371 1075 2319 gene locus_tag LOCUS_26880 1075 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence372 396 1820 gene locus_tag LOCUS_26890 396 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 1891 2589 gene locus_tag LOCUS_26900 1891 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence373 953 1234 gene locus_tag LOCUS_26910 953 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 1314 2054 gene locus_tag LOCUS_26920 1314 2054 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314364.1 protein_id gnl|my_center|LOCUS_26920 >Feature sequence374 215 382 gene locus_tag LOCUS_26930 215 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 648 2003 gene locus_tag LOCUS_26940 648 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 1994 2452 gene locus_tag LOCUS_26950 1994 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 3022 2792 gene locus_tag LOCUS_26960 3022 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 >Feature sequence375 1003 2220 gene locus_tag LOCUS_26970 1003 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 2202 2999 gene locus_tag LOCUS_26980 2202 2999 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583447.1 protein_id gnl|my_center|LOCUS_26980 >Feature sequence376 <1 845 gene locus_tag LOCUS_26990 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582685.1:class I SAM-dependent methyltransferase 919 2988 gene locus_tag LOCUS_27000 919 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 >Feature sequence377 2371 1436 gene locus_tag LOCUS_27010 2371 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 2628 2972 gene locus_tag LOCUS_27020 2628 2972 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008139488.1 protein_id gnl|my_center|LOCUS_27020 >Feature sequence378 1401 2228 gene locus_tag LOCUS_27030 1401 2228 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066753.1 protein_id gnl|my_center|LOCUS_27030 >Feature sequence379 1390 230 gene locus_tag LOCUS_27040 1390 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 1352 1852 gene locus_tag LOCUS_27050 1352 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 1865 2554 gene locus_tag LOCUS_27060 1865 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence380 <1 984 gene locus_tag LOCUS_27070 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962740.1:cytochrome c peroxidase 2027 1083 gene locus_tag LOCUS_27080 2027 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 2937 2077 gene locus_tag LOCUS_27090 gene rsmI 2937 2077 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229988.1 protein_id gnl|my_center|LOCUS_27090 >Feature sequence381 215 1297 gene locus_tag LOCUS_27100 215 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 2620 1436 gene locus_tag LOCUS_27110 2620 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 2753 2980 gene locus_tag LOCUS_27120 2753 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 >Feature sequence382 188 901 gene locus_tag LOCUS_27130 188 901 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775698.1 protein_id gnl|my_center|LOCUS_27130 1361 912 gene locus_tag LOCUS_27140 gene dtd 1361 912 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941193.1 protein_id gnl|my_center|LOCUS_27140 1381 2346 gene locus_tag LOCUS_27150 1381 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence383 942 2396 gene locus_tag LOCUS_27160 942 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 >Feature sequence384 266 1138 gene locus_tag LOCUS_27170 gene hisG 266 1138 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903669.1 protein_id gnl|my_center|LOCUS_27170 1135 2844 gene locus_tag LOCUS_27180 1135 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 >Feature sequence385 998 2473 gene locus_tag LOCUS_27190 998 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence386 2106 97 gene locus_tag LOCUS_27200 2106 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 <2915 2129 gene locus_tag LOCUS_27210 <2915 2129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941019.1:NADH-quinone oxidoreductase subunit N >Feature sequence387 <1 1037 gene locus_tag LOCUS_27220 <1 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256390.1:Stk1 family PASTA domain-containing Ser/Thr kinase 1111 1938 gene locus_tag LOCUS_27230 1111 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 1981 2856 gene locus_tag LOCUS_27240 1981 2856 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 protein_id gnl|my_center|LOCUS_27240 >Feature sequence388 1166 207 gene locus_tag LOCUS_27250 gene hlyD 1166 207 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975723.1 protein_id gnl|my_center|LOCUS_27250 1842 1339 gene locus_tag LOCUS_27260 1842 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 2851 1847 gene locus_tag LOCUS_27270 2851 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 >Feature sequence389 1198 731 gene locus_tag LOCUS_27280 1198 731 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_27280 <2886 1223 gene locus_tag LOCUS_27290 <2886 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007338417.1:2-oxoglutarate dehydrogenase E1 component >Feature sequence390 >Feature sequence391 2525 1230 gene locus_tag LOCUS_27300 2525 1230 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970398.1 protein_id gnl|my_center|LOCUS_27300 >Feature sequence392 <1 772 gene locus_tag LOCUS_27310 <1 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869596.1:ATP-dependent zinc metalloprotease FtsH 769 2409 gene locus_tag LOCUS_27320 769 2409 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546491.1 protein_id gnl|my_center|LOCUS_27320 >Feature sequence393 1350 439 gene locus_tag LOCUS_27330 1350 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence394 <1 500 gene locus_tag LOCUS_27340 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922072.1:MoxR family ATPase 583 2778 gene locus_tag LOCUS_27350 583 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 >Feature sequence395 2055 277 gene locus_tag LOCUS_27360 2055 277 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_27360 <2847 2052 gene locus_tag LOCUS_27370 <2847 2052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942911.1:lysine--tRNA ligase >Feature sequence396 286 1329 gene locus_tag LOCUS_27380 286 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 2297 1371 gene locus_tag LOCUS_27390 2297 1371 CDS product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706778.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence397 3 707 gene locus_tag LOCUS_27400 3 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 2025 772 gene locus_tag LOCUS_27410 2025 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 <2838 2136 gene locus_tag LOCUS_27420 <2838 2136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942050.1:DNA polymerase III subunit alpha >Feature sequence398 229 939 gene locus_tag LOCUS_27430 229 939 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222396.1 protein_id gnl|my_center|LOCUS_27430 941 2344 gene locus_tag LOCUS_27440 941 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 >Feature sequence399 <1 2645 gene locus_tag LOCUS_27450 <1 2645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942908.1:outer membrane protein assembly factor BamA >Feature sequence400 312 1676 gene locus_tag LOCUS_27460 312 1676 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence401 1516 1938 gene locus_tag LOCUS_27470 1516 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 1959 2333 gene locus_tag LOCUS_27480 1959 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27480 >Feature sequence402 <1 1592 gene locus_tag LOCUS_27490 <1 1592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207265.1:M1 family metallopeptidase >Feature sequence403 1338 1027 gene locus_tag LOCUS_27500 gene nuoK 1338 1027 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_27500 1910 1335 gene locus_tag LOCUS_27510 1910 1335 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888135.1 protein_id gnl|my_center|LOCUS_27510 <2729 1907 gene locus_tag LOCUS_27520 <2729 1907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337550.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence404 >Feature sequence405 393 2201 gene locus_tag LOCUS_27530 gene phoR 393 2201 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence406 2336 1221 gene locus_tag LOCUS_27540 2336 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 >Feature sequence407 471 1496 gene locus_tag LOCUS_27550 471 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 1603 2622 gene locus_tag LOCUS_27560 1603 2622 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942309.1 protein_id gnl|my_center|LOCUS_27560 >Feature sequence408 <1 1101 gene locus_tag LOCUS_27570 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938632.1:endopeptidase La >Feature sequence409 2337 676 gene locus_tag LOCUS_27580 2337 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 >Feature sequence410 193 1170 gene locus_tag LOCUS_27590 193 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 1208 1933 gene locus_tag LOCUS_27600 1208 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 1899 2082 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgcggccgctcggcaagaag <2646 2116 gene locus_tag LOCUS_27610 <2646 2116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001181592.1:FMN-binding glutamate synthase family protein >Feature sequence411 68 928 gene locus_tag LOCUS_27620 68 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 1810 935 gene locus_tag LOCUS_27630 1810 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 <2608 1819 gene locus_tag LOCUS_27640 <2608 1819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941019.1:NADH-quinone oxidoreductase subunit N >Feature sequence412 173 685 gene locus_tag LOCUS_27650 173 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 1567 758 gene locus_tag LOCUS_27660 1567 758 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_27660 1940 1653 gene locus_tag LOCUS_27670 1940 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 >Feature sequence413 661 1512 gene locus_tag LOCUS_27680 661 1512 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_27680 <2547 1528 gene locus_tag LOCUS_27690 <2547 1528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929414.1:aminoglycoside phosphotransferase family protein >Feature sequence414 1570 557 gene locus_tag LOCUS_27700 1570 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 1740 2111 gene locus_tag LOCUS_27710 1740 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 2283 2468 gene locus_tag LOCUS_27720 2283 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 >Feature sequence415 693 1118 gene locus_tag LOCUS_27730 693 1118 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140128.1 protein_id gnl|my_center|LOCUS_27730 1656 1099 gene locus_tag LOCUS_27740 1656 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 1739 1811 gene locus_tag LOCUS_t00290 1739 1811 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2168 1938 gene locus_tag LOCUS_27750 2168 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 >Feature sequence416 <2530 1534 gene locus_tag LOCUS_27760 <2530 1534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004547201.1:biotin carboxylase N-terminal domain-containing protein >Feature sequence417 352 810 gene locus_tag LOCUS_27770 352 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 932 1504 gene locus_tag LOCUS_27780 932 1504 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_27780 1632 1796 gene locus_tag LOCUS_27790 1632 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 2107 1886 gene locus_tag LOCUS_27800 2107 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800