>Feature sequence001 1883 567 gene locus_tag LOCUS_00010 1883 567 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_00010 2729 1911 gene locus_tag LOCUS_00020 gene trpA 2729 1911 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_00020 3853 2726 gene locus_tag LOCUS_00030 gene trpB 3853 2726 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_00030 4511 3906 gene locus_tag LOCUS_00040 4511 3906 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_00040 5293 4508 gene locus_tag LOCUS_00050 gene trpC 5293 4508 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337146.1 protein_id gnl|my_center|LOCUS_00050 6324 5290 gene locus_tag LOCUS_00060 gene trpD 6324 5290 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_00060 6917 6321 gene locus_tag LOCUS_00070 6917 6321 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_00070 8434 6914 gene locus_tag LOCUS_00080 gene trpE 8434 6914 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_00080 9249 8431 gene locus_tag LOCUS_00090 9249 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10761 10988 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11677 11216 gene locus_tag LOCUS_00100 gene rplQ 11677 11216 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943458.1 protein_id gnl|my_center|LOCUS_00100 12745 11681 gene locus_tag LOCUS_00110 12745 11681 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_00110 13397 12771 gene locus_tag LOCUS_00120 gene rpsD 13397 12771 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_00120 13836 13408 gene locus_tag LOCUS_00130 gene rpsK 13836 13408 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_00130 14187 13846 gene locus_tag LOCUS_00140 gene rpsM 14187 13846 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390416.1 protein_id gnl|my_center|LOCUS_00140 14578 14363 gene locus_tag LOCUS_00150 gene infA 14578 14363 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_00150 15354 14593 gene locus_tag LOCUS_00160 gene map 15354 14593 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_00160 15983 15351 gene locus_tag LOCUS_00170 15983 15351 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_00170 17305 15998 gene locus_tag LOCUS_00180 gene secY 17305 15998 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_00180 17753 17298 gene locus_tag LOCUS_00190 gene rplO 17753 17298 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943467.1 protein_id gnl|my_center|LOCUS_00190 17945 17763 gene locus_tag LOCUS_00200 gene rpmD 17945 17763 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776359.1 protein_id gnl|my_center|LOCUS_00200 18475 17945 gene locus_tag LOCUS_00210 gene rpsE 18475 17945 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810132.1 protein_id gnl|my_center|LOCUS_00210 18853 18488 gene locus_tag LOCUS_00220 gene rplR 18853 18488 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_00220 19401 18853 gene locus_tag LOCUS_00230 gene rplF 19401 18853 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943471.1 protein_id gnl|my_center|LOCUS_00230 19809 19414 gene locus_tag LOCUS_00240 gene rpsH 19809 19414 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_00240 20002 19817 gene locus_tag LOCUS_00250 20002 19817 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943473.1 protein_id gnl|my_center|LOCUS_00250 20558 20016 gene locus_tag LOCUS_00260 gene rplE 20558 20016 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393925.1 protein_id gnl|my_center|LOCUS_00260 20887 20561 gene locus_tag LOCUS_00270 gene rplX 20887 20561 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938609.1 protein_id gnl|my_center|LOCUS_00270 21259 20891 gene locus_tag LOCUS_00280 gene rplN 21259 20891 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943476.1 protein_id gnl|my_center|LOCUS_00280 21580 21263 gene locus_tag LOCUS_00290 gene rpsQ 21580 21263 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943477.1 protein_id gnl|my_center|LOCUS_00290 21771 21577 gene locus_tag LOCUS_00300 gene rpmC 21771 21577 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081820.1 protein_id gnl|my_center|LOCUS_00300 22201 21782 gene locus_tag LOCUS_00310 gene rplP 22201 21782 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_00310 22876 22214 gene locus_tag LOCUS_00320 gene rpsC 22876 22214 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_00320 23228 22878 gene locus_tag LOCUS_00330 gene rplV 23228 22878 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 protein_id gnl|my_center|LOCUS_00330 23581 23228 gene locus_tag LOCUS_00340 gene rpsS 23581 23228 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943482.1 protein_id gnl|my_center|LOCUS_00340 24414 23590 gene locus_tag LOCUS_00350 gene rplB 24414 23590 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081830.1 protein_id gnl|my_center|LOCUS_00350 24707 24420 gene locus_tag LOCUS_00360 24707 24420 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_00360 25366 24704 gene locus_tag LOCUS_00370 gene rplD 25366 24704 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_00370 26013 25363 gene locus_tag LOCUS_00380 gene rplC 26013 25363 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869928.1 protein_id gnl|my_center|LOCUS_00380 26324 26016 gene locus_tag LOCUS_00390 gene rpsJ 26324 26016 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_00390 27534 26344 gene locus_tag LOCUS_00400 gene tuf 27534 26344 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943488.1 protein_id gnl|my_center|LOCUS_00400 29668 27563 gene locus_tag LOCUS_00410 gene fusA 29668 27563 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_00410 30153 29683 gene locus_tag LOCUS_00420 gene rpsG 30153 29683 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938594.1 protein_id gnl|my_center|LOCUS_00420 30596 30225 gene locus_tag LOCUS_00430 gene rpsL 30596 30225 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943491.1 protein_id gnl|my_center|LOCUS_00430 34816 30653 gene locus_tag LOCUS_00440 gene rpoC 34816 30653 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_00440 39122 34977 gene locus_tag LOCUS_00450 gene rpoB 39122 34977 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_00450 39537 39151 gene locus_tag LOCUS_00460 gene rplL 39537 39151 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546672.1 protein_id gnl|my_center|LOCUS_00460 40116 39568 gene locus_tag LOCUS_00470 gene rplJ 40116 39568 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771616.1 protein_id gnl|my_center|LOCUS_00470 40834 40127 gene locus_tag LOCUS_00480 gene rplA 40834 40127 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_00480 41260 40838 gene locus_tag LOCUS_00490 gene rplK 41260 40838 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003718336.1 protein_id gnl|my_center|LOCUS_00490 41827 41276 gene locus_tag LOCUS_00500 gene nusG 41827 41276 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_00500 42039 41827 gene locus_tag LOCUS_00510 42039 41827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 42121 42047 gene locus_tag LOCUS_t00010 42121 42047 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 42300 42148 gene locus_tag LOCUS_00520 gene rpmG 42300 42148 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_00520 42389 42315 gene locus_tag LOCUS_t00020 42389 42315 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 42464 42390 gene locus_tag LOCUS_t00030 42464 42390 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 42555 42473 gene locus_tag LOCUS_t00040 42555 42473 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 42649 42577 gene locus_tag LOCUS_t00050 42649 42577 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 43583 42840 gene locus_tag LOCUS_00530 gene rlmB 43583 42840 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942108.1 protein_id gnl|my_center|LOCUS_00530 43721 44791 gene locus_tag LOCUS_00540 gene lptF 43721 44791 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_00540 44788 45885 gene locus_tag LOCUS_00550 gene lptG 44788 45885 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_00550 46944 45898 gene locus_tag LOCUS_00560 gene argC 46944 45898 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_00560 47392 46994 gene locus_tag LOCUS_00570 gene rpsI 47392 46994 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555064.1 protein_id gnl|my_center|LOCUS_00570 47836 47399 gene locus_tag LOCUS_00580 gene rplM 47836 47399 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943505.1 protein_id gnl|my_center|LOCUS_00580 47934 47858 gene locus_tag LOCUS_t00060 47934 47858 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 48088 48017 gene locus_tag LOCUS_t00070 48088 48017 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 48383 48111 gene locus_tag LOCUS_00590 48383 48111 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 protein_id gnl|my_center|LOCUS_00590 50910 48445 gene locus_tag LOCUS_00600 gene lon 50910 48445 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942434.1 protein_id gnl|my_center|LOCUS_00600 52181 50928 gene locus_tag LOCUS_00610 gene clpX 52181 50928 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_00610 52807 52199 gene locus_tag LOCUS_00620 gene clpP 52807 52199 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583450.1 protein_id gnl|my_center|LOCUS_00620 54188 52845 gene locus_tag LOCUS_00630 gene tig 54188 52845 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_00630 54267 54188 gene locus_tag LOCUS_t00080 54267 54188 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 56390 54315 gene locus_tag LOCUS_00640 56390 54315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 58289 56427 gene locus_tag LOCUS_00650 58289 56427 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198345.1 protein_id gnl|my_center|LOCUS_00650 58729 58286 gene locus_tag LOCUS_00660 58729 58286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 58960 58781 gene locus_tag LOCUS_00670 58960 58781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 60392 59022 gene locus_tag LOCUS_00680 60392 59022 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_00680 60798 60397 gene locus_tag LOCUS_00690 60798 60397 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810412.1 protein_id gnl|my_center|LOCUS_00690 62341 60950 gene locus_tag LOCUS_00700 62341 60950 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088534.1 protein_id gnl|my_center|LOCUS_00700 62933 62331 gene locus_tag LOCUS_00710 62933 62331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 63030 64901 gene locus_tag LOCUS_00720 gene bamA 63030 64901 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_00720 64904 68602 gene locus_tag LOCUS_00730 64904 68602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 69321 68596 gene locus_tag LOCUS_00740 gene pgl 69321 68596 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_00740 69397 70236 gene locus_tag LOCUS_00750 gene thiD 69397 70236 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392386.1 protein_id gnl|my_center|LOCUS_00750 70250 70570 gene locus_tag LOCUS_00760 70250 70570 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080382.1 protein_id gnl|my_center|LOCUS_00760 70603 71196 gene locus_tag LOCUS_00770 70603 71196 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351591.1 protein_id gnl|my_center|LOCUS_00770 74583 71410 gene locus_tag LOCUS_00780 74583 71410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 75652 74594 gene locus_tag LOCUS_00790 75652 74594 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142490.1 protein_id gnl|my_center|LOCUS_00790 76245 75649 gene locus_tag LOCUS_00800 76245 75649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 76729 76331 gene locus_tag LOCUS_00810 76729 76331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 78904 77171 gene locus_tag LOCUS_00820 78904 77171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00820 80302 78983 gene locus_tag LOCUS_00830 80302 78983 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_00830 <81130 80299 gene locus_tag LOCUS_00840 <81130 80299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970521.1:glycosyltransferase family 4 protein >Feature sequence002 2314 38 gene locus_tag LOCUS_00850 2314 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 3525 2374 gene locus_tag LOCUS_00860 3525 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 3604 4395 gene locus_tag LOCUS_00870 3604 4395 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_00870 4404 4940 gene locus_tag LOCUS_00880 4404 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 6889 5150 gene locus_tag LOCUS_00890 6889 5150 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908709.1 protein_id gnl|my_center|LOCUS_00890 6972 7355 gene locus_tag LOCUS_00900 6972 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 7433 7879 gene locus_tag LOCUS_00910 7433 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 7918 9099 gene locus_tag LOCUS_00920 7918 9099 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393008.1 protein_id gnl|my_center|LOCUS_00920 9348 9133 gene locus_tag LOCUS_00930 9348 9133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 9536 9847 gene locus_tag LOCUS_00940 9536 9847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 9841 10677 gene locus_tag LOCUS_00950 9841 10677 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942704.1 protein_id gnl|my_center|LOCUS_00950 10677 12197 gene locus_tag LOCUS_00960 10677 12197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 12366 12527 gene locus_tag LOCUS_00970 12366 12527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 13237 12518 gene locus_tag LOCUS_00980 13237 12518 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920819.1 protein_id gnl|my_center|LOCUS_00980 14043 13237 gene locus_tag LOCUS_00990 14043 13237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 14729 14040 gene locus_tag LOCUS_01000 14729 14040 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 protein_id gnl|my_center|LOCUS_01000 14943 15155 gene locus_tag LOCUS_01010 14943 15155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 15195 16292 gene locus_tag LOCUS_01020 15195 16292 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958086.1 protein_id gnl|my_center|LOCUS_01020 16305 17453 gene locus_tag LOCUS_01030 16305 17453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 17467 18180 gene locus_tag LOCUS_01040 17467 18180 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207075.1 protein_id gnl|my_center|LOCUS_01040 18213 18518 gene locus_tag LOCUS_01050 18213 18518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 19503 18523 gene locus_tag LOCUS_01060 19503 18523 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_01060 19805 19506 gene locus_tag LOCUS_01070 19805 19506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 20219 21076 gene locus_tag LOCUS_01080 20219 21076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 22200 21529 gene locus_tag LOCUS_01090 22200 21529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 23312 22533 gene locus_tag LOCUS_01100 gene menB 23312 22533 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 protein_id gnl|my_center|LOCUS_01100 23382 24422 gene locus_tag LOCUS_01110 23382 24422 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_01110 24461 24604 gene locus_tag LOCUS_01120 24461 24604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 24672 25403 gene locus_tag LOCUS_01130 24672 25403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 25438 26988 gene locus_tag LOCUS_01140 25438 26988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 26985 27752 gene locus_tag LOCUS_01150 26985 27752 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_01150 27767 27886 gene locus_tag LOCUS_01160 27767 27886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 27900 28400 gene locus_tag LOCUS_01170 gene coaD 27900 28400 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941899.1 protein_id gnl|my_center|LOCUS_01170 28827 28405 gene locus_tag LOCUS_01180 28827 28405 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_01180 29136 28894 gene locus_tag LOCUS_01190 29136 28894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 29447 29229 gene locus_tag LOCUS_01200 29447 29229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 29665 30156 gene locus_tag LOCUS_01210 29665 30156 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_01210 31038 30178 gene locus_tag LOCUS_01220 gene larE 31038 30178 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_01220 31982 31038 gene locus_tag LOCUS_01230 gene cysK 31982 31038 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_01230 32025 32987 gene locus_tag LOCUS_01240 32025 32987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 33068 33919 gene locus_tag LOCUS_01250 gene htpX 33068 33919 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360263.1 protein_id gnl|my_center|LOCUS_01250 33948 34382 gene locus_tag LOCUS_01260 33948 34382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 34413 35933 gene locus_tag LOCUS_01270 34413 35933 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_01270 36235 37248 gene locus_tag LOCUS_01280 gene tsaD 36235 37248 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_01280 37248 38081 gene locus_tag LOCUS_01290 gene rsmA 37248 38081 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_01290 38085 38897 gene locus_tag LOCUS_01300 gene mutM 38085 38897 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257743.1 protein_id gnl|my_center|LOCUS_01300 39657 38905 gene locus_tag LOCUS_01310 39657 38905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 40618 39788 gene locus_tag LOCUS_01320 40618 39788 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990759.1 protein_id gnl|my_center|LOCUS_01320 41538 40615 gene locus_tag LOCUS_01330 41538 40615 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_01330 43142 41538 gene locus_tag LOCUS_01340 43142 41538 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_01340 43132 44556 gene locus_tag LOCUS_01350 43132 44556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 44606 45259 gene locus_tag LOCUS_01360 44606 45259 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_01360 45262 46209 gene locus_tag LOCUS_01370 45262 46209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 46211 47506 gene locus_tag LOCUS_01380 gene hemA 46211 47506 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_01380 47506 48423 gene locus_tag LOCUS_01390 gene hemC 47506 48423 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_01390 48420 49973 gene locus_tag LOCUS_01400 gene cobA 48420 49973 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_01400 50072 51049 gene locus_tag LOCUS_01410 gene hemB 50072 51049 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_01410 51046 52476 gene locus_tag LOCUS_01420 51046 52476 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938869.1 protein_id gnl|my_center|LOCUS_01420 52515 53237 gene locus_tag LOCUS_01430 52515 53237 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867690.1 protein_id gnl|my_center|LOCUS_01430 53234 54253 gene locus_tag LOCUS_01440 53234 54253 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_01440 54253 55347 gene locus_tag LOCUS_01450 54253 55347 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_01450 55349 55924 gene locus_tag LOCUS_01460 55349 55924 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_01460 55921 57642 gene locus_tag LOCUS_01470 55921 57642 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_01470 58998 57826 gene locus_tag LOCUS_01480 58998 57826 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987008.1 protein_id gnl|my_center|LOCUS_01480 60018 59191 gene locus_tag LOCUS_01490 60018 59191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 60699 60256 gene locus_tag LOCUS_01500 60699 60256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 60879 61130 gene locus_tag LOCUS_01510 60879 61130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 61290 63662 gene locus_tag LOCUS_01520 61290 63662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 63710 64147 gene locus_tag LOCUS_01530 63710 64147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 64213 64416 gene locus_tag LOCUS_01540 64213 64416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 64406 65329 gene locus_tag LOCUS_01550 64406 65329 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076519.1 protein_id gnl|my_center|LOCUS_01550 65384 66601 gene locus_tag LOCUS_01560 65384 66601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 67990 66605 gene locus_tag LOCUS_01570 67990 66605 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_01570 68835 68005 gene locus_tag LOCUS_01580 68835 68005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 70648 68858 gene locus_tag LOCUS_01590 70648 68858 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088156.1 protein_id gnl|my_center|LOCUS_01590 71518 70700 gene locus_tag LOCUS_01600 71518 70700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 71697 71906 gene locus_tag LOCUS_01610 71697 71906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 72080 71913 gene locus_tag LOCUS_01620 72080 71913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01620 73125 72280 gene locus_tag LOCUS_01630 73125 72280 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_01630 >Feature sequence003 2882 1677 gene locus_tag LOCUS_01640 gene tyrS 2882 1677 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_01640 3667 2879 gene locus_tag LOCUS_01650 3667 2879 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_01650 5243 3675 gene locus_tag LOCUS_01660 gene rny 5243 3675 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_01660 5824 5240 gene locus_tag LOCUS_01670 5824 5240 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941797.1 protein_id gnl|my_center|LOCUS_01670 6419 6216 gene locus_tag LOCUS_01680 6419 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 7239 6460 gene locus_tag LOCUS_01690 7239 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 11094 7519 gene locus_tag LOCUS_01700 gene smc 11094 7519 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258775.1 protein_id gnl|my_center|LOCUS_01700 11728 11108 gene locus_tag LOCUS_01710 11728 11108 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_01710 13233 11773 gene locus_tag LOCUS_01720 gene gcvPB 13233 11773 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393440.1 protein_id gnl|my_center|LOCUS_01720 14598 13237 gene locus_tag LOCUS_01730 gene gcvPA 14598 13237 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_01730 14984 14595 gene locus_tag LOCUS_01740 gene gcvH 14984 14595 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_01740 16082 14994 gene locus_tag LOCUS_01750 gene gcvT 16082 14994 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398598.1 protein_id gnl|my_center|LOCUS_01750 16947 16087 gene locus_tag LOCUS_01760 gene folD 16947 16087 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941526.1 protein_id gnl|my_center|LOCUS_01760 17044 18156 gene locus_tag LOCUS_01770 gene ald 17044 18156 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479806.1 protein_id gnl|my_center|LOCUS_01770 19936 18149 gene locus_tag LOCUS_01780 gene aspS 19936 18149 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_01780 21234 19933 gene locus_tag LOCUS_01790 gene hisS 21234 19933 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_01790 21360 21938 gene locus_tag LOCUS_01800 21360 21938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 22835 22146 gene locus_tag LOCUS_01810 22835 22146 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119120.1 protein_id gnl|my_center|LOCUS_01810 23108 22917 gene locus_tag LOCUS_01820 23108 22917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 24200 23208 gene locus_tag LOCUS_01830 gene secF 24200 23208 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085009790.1 protein_id gnl|my_center|LOCUS_01830 25759 24197 gene locus_tag LOCUS_01840 gene secD 25759 24197 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_01840 26097 25756 gene locus_tag LOCUS_01850 gene yajC 26097 25756 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_01850 27208 26099 gene locus_tag LOCUS_01860 gene tgt 27208 26099 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393196.1 protein_id gnl|my_center|LOCUS_01860 28230 27205 gene locus_tag LOCUS_01870 gene queA 28230 27205 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943258.1 protein_id gnl|my_center|LOCUS_01870 28340 29344 gene locus_tag LOCUS_01880 28340 29344 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_01880 31060 29357 gene locus_tag LOCUS_01890 31060 29357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 32825 31119 gene locus_tag LOCUS_01900 32825 31119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 33772 32798 gene locus_tag LOCUS_01910 33772 32798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 34703 33783 gene locus_tag LOCUS_01920 34703 33783 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792065.1 protein_id gnl|my_center|LOCUS_01920 35694 34714 gene locus_tag LOCUS_01930 35694 34714 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939400.1 protein_id gnl|my_center|LOCUS_01930 37084 35708 gene locus_tag LOCUS_01940 37084 35708 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537977.1 protein_id gnl|my_center|LOCUS_01940 38292 37081 gene locus_tag LOCUS_01950 38292 37081 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120312.1 protein_id gnl|my_center|LOCUS_01950 39696 38335 gene locus_tag LOCUS_01960 39696 38335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 40571 39693 gene locus_tag LOCUS_01970 gene cpaB 40571 39693 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939395.1 protein_id gnl|my_center|LOCUS_01970 41099 40599 gene locus_tag LOCUS_01980 41099 40599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 41640 41113 gene locus_tag LOCUS_01990 41640 41113 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391876.1 protein_id gnl|my_center|LOCUS_01990 42262 41930 gene locus_tag LOCUS_02000 42262 41930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 42852 42628 gene locus_tag LOCUS_02010 42852 42628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 43379 42900 gene locus_tag LOCUS_02020 43379 42900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 43269 43691 gene locus_tag LOCUS_02030 43269 43691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 43725 43652 gene locus_tag LOCUS_t00090 43725 43652 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 43837 43762 gene locus_tag LOCUS_t00100 43837 43762 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 43960 43885 gene locus_tag LOCUS_t00110 43960 43885 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 44050 43976 gene locus_tag LOCUS_t00120 44050 43976 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 44691 44062 gene locus_tag LOCUS_02040 44691 44062 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392057.1 protein_id gnl|my_center|LOCUS_02040 45485 44688 gene locus_tag LOCUS_02050 gene rph 45485 44688 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942439.1 protein_id gnl|my_center|LOCUS_02050 45564 46616 gene locus_tag LOCUS_02060 45564 46616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 46613 47071 gene locus_tag LOCUS_02070 46613 47071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 47242 47427 gene locus_tag LOCUS_02080 47242 47427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 49240 47468 gene locus_tag LOCUS_02090 49240 47468 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_02090 49739 49275 gene locus_tag LOCUS_02100 49739 49275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 50061 49855 gene locus_tag LOCUS_02110 50061 49855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 49948 51675 gene locus_tag LOCUS_02120 49948 51675 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090509.1 protein_id gnl|my_center|LOCUS_02120 51835 53379 gene locus_tag LOCUS_02130 51835 53379 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113879.1 protein_id gnl|my_center|LOCUS_02130 53441 54211 gene locus_tag LOCUS_02140 53441 54211 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174155.1 protein_id gnl|my_center|LOCUS_02140 54259 55218 gene locus_tag LOCUS_02150 54259 55218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 56158 55235 gene locus_tag LOCUS_02160 56158 55235 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945998.1 protein_id gnl|my_center|LOCUS_02160 56049 56792 gene locus_tag LOCUS_02170 56049 56792 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_02170 56868 58016 gene locus_tag LOCUS_02180 56868 58016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 58905 58027 gene locus_tag LOCUS_02190 58905 58027 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038965.1 protein_id gnl|my_center|LOCUS_02190 60746 58890 gene locus_tag LOCUS_02200 gene asnB 60746 58890 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_02200 63089 60753 gene locus_tag LOCUS_02210 63089 60753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 64719 63292 gene locus_tag LOCUS_02220 64719 63292 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_02220 64767 65723 gene locus_tag LOCUS_02230 64767 65723 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143461.1 protein_id gnl|my_center|LOCUS_02230 65723 67360 gene locus_tag LOCUS_02240 65723 67360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 >Feature sequence004 67 1233 gene locus_tag LOCUS_02250 67 1233 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031081.1 protein_id gnl|my_center|LOCUS_02250 1253 2266 gene locus_tag LOCUS_02260 1253 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 2263 3891 gene locus_tag LOCUS_02270 gene boxC 2263 3891 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921378.1 protein_id gnl|my_center|LOCUS_02270 3895 5301 gene locus_tag LOCUS_02280 gene boxB 3895 5301 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_02280 5359 6720 gene locus_tag LOCUS_02290 5359 6720 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230332.1 protein_id gnl|my_center|LOCUS_02290 6732 7724 gene locus_tag LOCUS_02300 gene fabK 6732 7724 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392462.1 protein_id gnl|my_center|LOCUS_02300 9615 7969 gene locus_tag LOCUS_02310 9615 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 10730 9579 gene locus_tag LOCUS_02320 10730 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 10906 11634 gene locus_tag LOCUS_02330 10906 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 12467 11526 gene locus_tag LOCUS_02340 12467 11526 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257127.1 protein_id gnl|my_center|LOCUS_02340 12550 12984 gene locus_tag LOCUS_02350 12550 12984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 13040 13393 gene locus_tag LOCUS_02360 13040 13393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 13695 13414 gene locus_tag LOCUS_02370 13695 13414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 13832 14020 gene locus_tag LOCUS_02380 13832 14020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 14074 14448 gene locus_tag LOCUS_02390 14074 14448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 14787 16022 gene locus_tag LOCUS_02400 14787 16022 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_02400 16034 17509 gene locus_tag LOCUS_02410 16034 17509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 17510 20695 gene locus_tag LOCUS_02420 17510 20695 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946755.1 protein_id gnl|my_center|LOCUS_02420 20836 22113 gene locus_tag LOCUS_02430 20836 22113 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615837.1 protein_id gnl|my_center|LOCUS_02430 23152 22121 gene locus_tag LOCUS_02440 23152 22121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 23521 24648 gene locus_tag LOCUS_02450 23521 24648 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727437.1 protein_id gnl|my_center|LOCUS_02450 24681 25376 gene locus_tag LOCUS_02460 gene rnhB 24681 25376 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693388.1 protein_id gnl|my_center|LOCUS_02460 25430 26383 gene locus_tag LOCUS_02470 gene pdhA 25430 26383 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980946.1 protein_id gnl|my_center|LOCUS_02470 26376 27404 gene locus_tag LOCUS_02480 26376 27404 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_02480 27441 28697 gene locus_tag LOCUS_02490 27441 28697 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943072.1 protein_id gnl|my_center|LOCUS_02490 28700 29377 gene locus_tag LOCUS_02500 gene lipB 28700 29377 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144397.1 protein_id gnl|my_center|LOCUS_02500 29359 30234 gene locus_tag LOCUS_02510 gene lipA 29359 30234 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_02510 30337 30945 gene locus_tag LOCUS_02520 gene sspA 30337 30945 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948402.1 protein_id gnl|my_center|LOCUS_02520 31050 31478 gene locus_tag LOCUS_02530 31050 31478 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_02530 31480 32757 gene locus_tag LOCUS_02540 31480 32757 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_02540 32757 33380 gene locus_tag LOCUS_02550 32757 33380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 33370 33771 gene locus_tag LOCUS_02560 33370 33771 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392341.1 protein_id gnl|my_center|LOCUS_02560 33741 34409 gene locus_tag LOCUS_02570 33741 34409 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562559.1 protein_id gnl|my_center|LOCUS_02570 34786 35370 gene locus_tag LOCUS_02580 34786 35370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 35367 35591 gene locus_tag LOCUS_02590 35367 35591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 35595 36806 gene locus_tag LOCUS_02600 gene moeB 35595 36806 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_02600 37567 36992 gene locus_tag LOCUS_02610 37567 36992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 37652 38749 gene locus_tag LOCUS_02620 37652 38749 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_02620 39150 38830 gene locus_tag LOCUS_02630 39150 38830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 39957 39526 gene locus_tag LOCUS_02640 39957 39526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 40161 40352 gene locus_tag LOCUS_02650 40161 40352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 40489 40980 gene locus_tag LOCUS_02660 40489 40980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 41645 43273 gene locus_tag LOCUS_02670 gene groL 41645 43273 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_02670 43596 43429 gene locus_tag LOCUS_02680 43596 43429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 44754 43633 gene locus_tag LOCUS_02690 44754 43633 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210119.1 protein_id gnl|my_center|LOCUS_02690 45579 44995 gene locus_tag LOCUS_02700 45579 44995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 46124 45576 gene locus_tag LOCUS_02710 46124 45576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 46407 46628 gene locus_tag LOCUS_02720 46407 46628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 47479 46724 gene locus_tag LOCUS_02730 47479 46724 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869449.1 protein_id gnl|my_center|LOCUS_02730 47638 47492 gene locus_tag LOCUS_02740 47638 47492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 47918 47619 gene locus_tag LOCUS_02750 47918 47619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 48311 48568 gene locus_tag LOCUS_02760 48311 48568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 50349 48565 gene locus_tag LOCUS_02770 gene polX 50349 48565 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551361.1 protein_id gnl|my_center|LOCUS_02770 50496 51242 gene locus_tag LOCUS_02780 50496 51242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 52214 51249 gene locus_tag LOCUS_02790 52214 51249 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_02790 52885 53658 gene locus_tag LOCUS_02800 52885 53658 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921431.1 protein_id gnl|my_center|LOCUS_02800 >Feature sequence005 2726 1224 gene locus_tag LOCUS_02810 2726 1224 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_02810 4882 2729 gene locus_tag LOCUS_02820 gene nuoL 4882 2729 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_02820 5378 4884 gene locus_tag LOCUS_02830 5378 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 6472 5375 gene locus_tag LOCUS_02840 gene nuoH 6472 5375 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_02840 6965 6474 gene locus_tag LOCUS_02850 gene nuoE 6965 6474 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967798.1 protein_id gnl|my_center|LOCUS_02850 8154 6955 gene locus_tag LOCUS_02860 8154 6955 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990075.1 protein_id gnl|my_center|LOCUS_02860 8666 8151 gene locus_tag LOCUS_02870 8666 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 9046 8690 gene locus_tag LOCUS_02880 9046 8690 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_02880 8967 10229 gene locus_tag LOCUS_02890 8967 10229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 10226 10954 gene locus_tag LOCUS_02900 10226 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 11237 12589 gene locus_tag LOCUS_02910 11237 12589 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259127.1 protein_id gnl|my_center|LOCUS_02910 14119 12977 gene locus_tag LOCUS_02920 14119 12977 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 protein_id gnl|my_center|LOCUS_02920 14216 14908 gene locus_tag LOCUS_02930 14216 14908 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_02930 15704 14913 gene locus_tag LOCUS_02940 15704 14913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 16019 15816 gene locus_tag LOCUS_02950 16019 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 16242 16553 gene locus_tag LOCUS_02960 16242 16553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 16942 16556 gene locus_tag LOCUS_02970 16942 16556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 19904 17148 gene locus_tag LOCUS_02980 19904 17148 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_02980 19973 20308 gene locus_tag LOCUS_02990 19973 20308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 21520 20291 gene locus_tag LOCUS_03000 gene thiI 21520 20291 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173822.1 protein_id gnl|my_center|LOCUS_03000 21564 22139 gene locus_tag LOCUS_03010 21564 22139 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943986.1 protein_id gnl|my_center|LOCUS_03010 22139 23491 gene locus_tag LOCUS_03020 22139 23491 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_03020 23488 24654 gene locus_tag LOCUS_03030 23488 24654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 25348 24611 gene locus_tag LOCUS_03040 25348 24611 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_03040 25473 25772 gene locus_tag LOCUS_03050 25473 25772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 26075 25776 gene locus_tag LOCUS_03060 26075 25776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 30799 26072 gene locus_tag LOCUS_03070 30799 26072 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_03070 31321 30800 gene locus_tag LOCUS_03080 31321 30800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 31242 32753 gene locus_tag LOCUS_03090 31242 32753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 32750 33568 gene locus_tag LOCUS_03100 32750 33568 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942084.1 protein_id gnl|my_center|LOCUS_03100 33571 34134 gene locus_tag LOCUS_03110 33571 34134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 34127 35386 gene locus_tag LOCUS_03120 34127 35386 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224485.1 protein_id gnl|my_center|LOCUS_03120 35392 35706 gene locus_tag LOCUS_03130 35392 35706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 36060 35707 gene locus_tag LOCUS_03140 36060 35707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 37196 36081 gene locus_tag LOCUS_03150 37196 36081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 37532 37215 gene locus_tag LOCUS_03160 37532 37215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 38468 37590 gene locus_tag LOCUS_03170 38468 37590 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 protein_id gnl|my_center|LOCUS_03170 38857 38468 gene locus_tag LOCUS_03180 38857 38468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 39834 38854 gene locus_tag LOCUS_03190 gene thyX 39834 38854 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_03190 41038 39848 gene locus_tag LOCUS_03200 41038 39848 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_03200 41515 41039 gene locus_tag LOCUS_03210 41515 41039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 42152 41622 gene locus_tag LOCUS_03220 gene purE 42152 41622 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813948.1 protein_id gnl|my_center|LOCUS_03220 43440 42139 gene locus_tag LOCUS_03230 gene purD 43440 42139 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_03230 44985 43444 gene locus_tag LOCUS_03240 gene purH 44985 43444 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909162.1 protein_id gnl|my_center|LOCUS_03240 46210 44978 gene locus_tag LOCUS_03250 46210 44978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 46203 47699 gene locus_tag LOCUS_03260 46203 47699 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107859.1 protein_id gnl|my_center|LOCUS_03260 48760 47702 gene locus_tag LOCUS_03270 48760 47702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 49361 48993 gene locus_tag LOCUS_03280 49361 48993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 49596 49351 gene locus_tag LOCUS_03290 49596 49351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 49758 49958 gene locus_tag LOCUS_03300 gene thiS 49758 49958 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941252.1 protein_id gnl|my_center|LOCUS_03300 49955 50728 gene locus_tag LOCUS_03310 49955 50728 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_03310 50740 52173 gene locus_tag LOCUS_03320 50740 52173 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459002.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence006 1504 4743 gene locus_tag LOCUS_03330 1504 4743 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390311.1 protein_id gnl|my_center|LOCUS_03330 4755 6200 gene locus_tag LOCUS_03340 4755 6200 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340179.1 protein_id gnl|my_center|LOCUS_03340 6200 7120 gene locus_tag LOCUS_03350 6200 7120 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888673.1 protein_id gnl|my_center|LOCUS_03350 7865 7122 gene locus_tag LOCUS_03360 7865 7122 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 protein_id gnl|my_center|LOCUS_03360 7992 7918 gene locus_tag LOCUS_t00130 7992 7918 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11616 8119 gene locus_tag LOCUS_03370 11616 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 12039 11620 gene locus_tag LOCUS_03380 12039 11620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 13302 12094 gene locus_tag LOCUS_03390 13302 12094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 16286 13299 gene locus_tag LOCUS_03400 16286 13299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 16464 16288 gene locus_tag LOCUS_03410 16464 16288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 17079 16759 gene locus_tag LOCUS_03420 17079 16759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 17847 17314 gene locus_tag LOCUS_03430 gene pgsA 17847 17314 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_03430 18571 17912 gene locus_tag LOCUS_03440 18571 17912 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_03440 18657 20279 gene locus_tag LOCUS_03450 gene nadB 18657 20279 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_03450 21957 20548 gene locus_tag LOCUS_03460 gene purF 21957 20548 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_03460 24215 22005 gene locus_tag LOCUS_03470 gene purL 24215 22005 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_03470 24946 24212 gene locus_tag LOCUS_03480 gene purQ 24946 24212 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141325.1 protein_id gnl|my_center|LOCUS_03480 25211 24951 gene locus_tag LOCUS_03490 gene purS 25211 24951 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219409.1 protein_id gnl|my_center|LOCUS_03490 25924 25211 gene locus_tag LOCUS_03500 25924 25211 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393547.1 protein_id gnl|my_center|LOCUS_03500 27209 25911 gene locus_tag LOCUS_03510 gene purB 27209 25911 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_03510 27715 27215 gene locus_tag LOCUS_03520 gene dut 27715 27215 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942240.1 protein_id gnl|my_center|LOCUS_03520 28965 27712 gene locus_tag LOCUS_03530 28965 27712 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_03530 31090 28970 gene locus_tag LOCUS_03540 gene pnp 31090 28970 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_03540 31426 31157 gene locus_tag LOCUS_03550 gene rpsO 31426 31157 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_03550 32415 31519 gene locus_tag LOCUS_03560 gene truB 32415 31519 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_03560 32774 32412 gene locus_tag LOCUS_03570 32774 32412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 33080 32793 gene locus_tag LOCUS_03580 33080 32793 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583570.1 protein_id gnl|my_center|LOCUS_03580 35805 33100 gene locus_tag LOCUS_03590 gene infB 35805 33100 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942233.1 protein_id gnl|my_center|LOCUS_03590 36087 35812 gene locus_tag LOCUS_03600 36087 35812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 37439 36084 gene locus_tag LOCUS_03610 gene nusA 37439 36084 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_03610 37950 37456 gene locus_tag LOCUS_03620 gene rimP 37950 37456 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942230.1 protein_id gnl|my_center|LOCUS_03620 39878 38076 gene locus_tag LOCUS_03630 39878 38076 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156206934.1 protein_id gnl|my_center|LOCUS_03630 39911 40948 gene locus_tag LOCUS_03640 gene galT 39911 40948 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_03640 41439 40945 gene locus_tag LOCUS_03650 gene greA 41439 40945 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596757.1 protein_id gnl|my_center|LOCUS_03650 41890 41444 gene locus_tag LOCUS_03660 41890 41444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 41973 42680 gene locus_tag LOCUS_03670 41973 42680 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_03670 42733 43374 gene locus_tag LOCUS_03680 gene purN 42733 43374 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942403.1 protein_id gnl|my_center|LOCUS_03680 43424 44875 gene locus_tag LOCUS_03690 43424 44875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 45014 46888 gene locus_tag LOCUS_03700 45014 46888 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_03700 46885 47901 gene locus_tag LOCUS_03710 46885 47901 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324151.1 protein_id gnl|my_center|LOCUS_03710 48430 47903 gene locus_tag LOCUS_03720 48430 47903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 49152 48415 gene locus_tag LOCUS_03730 49152 48415 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_03730 49516 49169 gene locus_tag LOCUS_03740 49516 49169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 49743 49513 gene locus_tag LOCUS_03750 gene grxC 49743 49513 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024392.1 protein_id gnl|my_center|LOCUS_03750 >Feature sequence007 184 657 gene locus_tag LOCUS_03760 184 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 1975 668 gene locus_tag LOCUS_03770 1975 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 4709 1980 gene locus_tag LOCUS_03780 4709 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 5748 4714 gene locus_tag LOCUS_03790 5748 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 6933 5809 gene locus_tag LOCUS_03800 6933 5809 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064432.1 protein_id gnl|my_center|LOCUS_03800 7061 8008 gene locus_tag LOCUS_03810 7061 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 8089 8358 gene locus_tag LOCUS_03820 8089 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 8911 8369 gene locus_tag LOCUS_03830 8911 8369 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231441.1 protein_id gnl|my_center|LOCUS_03830 9921 8908 gene locus_tag LOCUS_03840 9921 8908 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228927.1 protein_id gnl|my_center|LOCUS_03840 12229 10772 gene locus_tag LOCUS_03850 12229 10772 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_03850 14721 12226 gene locus_tag LOCUS_03860 14721 12226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 14821 16167 gene locus_tag LOCUS_03870 14821 16167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 16295 17389 gene locus_tag LOCUS_03880 16295 17389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 18918 17701 gene locus_tag LOCUS_03890 18918 17701 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_03890 18965 19717 gene locus_tag LOCUS_03900 18965 19717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 19728 20489 gene locus_tag LOCUS_03910 19728 20489 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 protein_id gnl|my_center|LOCUS_03910 20689 20498 gene locus_tag LOCUS_03920 20689 20498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 20833 21348 gene locus_tag LOCUS_03930 20833 21348 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971899.1 protein_id gnl|my_center|LOCUS_03930 23019 21424 gene locus_tag LOCUS_03940 23019 21424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 23354 24763 gene locus_tag LOCUS_03950 23354 24763 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943160.1 protein_id gnl|my_center|LOCUS_03950 24780 25256 gene locus_tag LOCUS_03960 24780 25256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 25258 27288 gene locus_tag LOCUS_03970 25258 27288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 29732 27327 gene locus_tag LOCUS_03980 29732 27327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 28355 28270 gene locus_tag LOCUS_t00140 28355 28270 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 31048 29732 gene locus_tag LOCUS_03990 31048 29732 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940915.1 protein_id gnl|my_center|LOCUS_03990 31153 32709 gene locus_tag LOCUS_04000 gene lnt 31153 32709 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105186.1 protein_id gnl|my_center|LOCUS_04000 32744 33112 gene locus_tag LOCUS_04010 32744 33112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 33253 34584 gene locus_tag LOCUS_04020 33253 34584 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391470.1 protein_id gnl|my_center|LOCUS_04020 34687 34899 gene locus_tag LOCUS_04030 34687 34899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 34901 35881 gene locus_tag LOCUS_04040 34901 35881 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258336.1 protein_id gnl|my_center|LOCUS_04040 35888 36055 gene locus_tag LOCUS_04050 35888 36055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04050 36113 36367 gene locus_tag LOCUS_04060 36113 36367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04060 36844 36389 gene locus_tag LOCUS_04070 36844 36389 CDS product DUF6010 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225312.1 protein_id gnl|my_center|LOCUS_04070 36909 37895 gene locus_tag LOCUS_04080 36909 37895 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027239.1 protein_id gnl|my_center|LOCUS_04080 38630 37911 gene locus_tag LOCUS_04090 38630 37911 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230868.1 protein_id gnl|my_center|LOCUS_04090 40675 38633 gene locus_tag LOCUS_04100 40675 38633 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_04100 40763 41038 gene locus_tag LOCUS_04110 40763 41038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 41010 41636 gene locus_tag LOCUS_04120 41010 41636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 43527 41695 gene locus_tag LOCUS_04130 43527 41695 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729441.1 protein_id gnl|my_center|LOCUS_04130 44426 43530 gene locus_tag LOCUS_04140 44426 43530 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257607.1 protein_id gnl|my_center|LOCUS_04140 45040 44411 gene locus_tag LOCUS_04150 45040 44411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 45204 45431 gene locus_tag LOCUS_04160 45204 45431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 >Feature sequence008 2628 814 gene locus_tag LOCUS_04170 2628 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 2834 3319 gene locus_tag LOCUS_04180 2834 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 3316 3741 gene locus_tag LOCUS_04190 3316 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 4336 3923 gene locus_tag LOCUS_04200 4336 3923 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_04200 4557 4333 gene locus_tag LOCUS_04210 4557 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 4756 4980 gene locus_tag LOCUS_04220 gene rpmE 4756 4980 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_04220 5017 6081 gene locus_tag LOCUS_04230 gene prfA 5017 6081 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_04230 6078 6962 gene locus_tag LOCUS_04240 gene prmC 6078 6962 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_04240 6947 8212 gene locus_tag LOCUS_04250 gene murA 6947 8212 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_04250 8209 9522 gene locus_tag LOCUS_04260 gene hisD 8209 9522 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880475.1 protein_id gnl|my_center|LOCUS_04260 9519 10142 gene locus_tag LOCUS_04270 gene hisB 9519 10142 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_04270 10152 10778 gene locus_tag LOCUS_04280 gene hisH 10152 10778 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943718.1 protein_id gnl|my_center|LOCUS_04280 10775 11494 gene locus_tag LOCUS_04290 gene hisA 10775 11494 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391342.1 protein_id gnl|my_center|LOCUS_04290 11494 12264 gene locus_tag LOCUS_04300 gene hisF 11494 12264 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943716.1 protein_id gnl|my_center|LOCUS_04300 12266 13309 gene locus_tag LOCUS_04310 12266 13309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 14169 13225 gene locus_tag LOCUS_04320 gene trxB 14169 13225 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390648.1 protein_id gnl|my_center|LOCUS_04320 14270 14713 gene locus_tag LOCUS_04330 gene moaC 14270 14713 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_04330 14725 15894 gene locus_tag LOCUS_04340 gene rlmI 14725 15894 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116277.1 protein_id gnl|my_center|LOCUS_04340 15891 16655 gene locus_tag LOCUS_04350 gene radC 15891 16655 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941054.1 protein_id gnl|my_center|LOCUS_04350 16666 17700 gene locus_tag LOCUS_04360 16666 17700 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403477.1 protein_id gnl|my_center|LOCUS_04360 18395 17979 gene locus_tag LOCUS_04370 18395 17979 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_04370 18693 19466 gene locus_tag LOCUS_04380 18693 19466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 19463 21109 gene locus_tag LOCUS_04390 19463 21109 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_04390 21132 23357 gene locus_tag LOCUS_04400 21132 23357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 23402 24514 gene locus_tag LOCUS_04410 23402 24514 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014092.1 protein_id gnl|my_center|LOCUS_04410 24526 25164 gene locus_tag LOCUS_04420 gene lolA 24526 25164 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090414.1 protein_id gnl|my_center|LOCUS_04420 25174 25659 gene locus_tag LOCUS_04430 25174 25659 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_04430 25662 27014 gene locus_tag LOCUS_04440 gene rimO 25662 27014 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_04440 27066 27491 gene locus_tag LOCUS_04450 27066 27491 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943824.1 protein_id gnl|my_center|LOCUS_04450 28011 27493 gene locus_tag LOCUS_04460 28011 27493 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021733.1 protein_id gnl|my_center|LOCUS_04460 28066 29385 gene locus_tag LOCUS_04470 28066 29385 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938066.1 protein_id gnl|my_center|LOCUS_04470 29397 30149 gene locus_tag LOCUS_04480 29397 30149 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942366.1 protein_id gnl|my_center|LOCUS_04480 30146 31177 gene locus_tag LOCUS_04490 30146 31177 CDS product isocitrate dehydrogenase (NAD(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964290.1 protein_id gnl|my_center|LOCUS_04490 31219 32865 gene locus_tag LOCUS_04500 gene glpD 31219 32865 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226258.1 protein_id gnl|my_center|LOCUS_04500 32856 33554 gene locus_tag LOCUS_04510 gene nth 32856 33554 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013539.1 protein_id gnl|my_center|LOCUS_04510 34574 33837 gene locus_tag LOCUS_04520 34574 33837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 34787 35824 gene locus_tag LOCUS_04530 34787 35824 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390801.1 protein_id gnl|my_center|LOCUS_04530 35860 36771 gene locus_tag LOCUS_04540 gene metF 35860 36771 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174022.1 protein_id gnl|my_center|LOCUS_04540 36783 37340 gene locus_tag LOCUS_04550 gene folE 36783 37340 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932463.1 protein_id gnl|my_center|LOCUS_04550 37337 37783 gene locus_tag LOCUS_04560 37337 37783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 37808 39442 gene locus_tag LOCUS_04570 37808 39442 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640335.1 protein_id gnl|my_center|LOCUS_04570 41233 39449 gene locus_tag LOCUS_04580 41233 39449 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942254.1 protein_id gnl|my_center|LOCUS_04580 41459 42508 gene locus_tag LOCUS_04590 41459 42508 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_04590 42510 44099 gene locus_tag LOCUS_04600 gene serA 42510 44099 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_04600 44104 45393 gene locus_tag LOCUS_04610 44104 45393 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_04610 >Feature sequence009 348 3329 gene locus_tag LOCUS_04620 348 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 3290 4360 gene locus_tag LOCUS_04630 3290 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 4360 6528 gene locus_tag LOCUS_04640 gene nasC 4360 6528 CDS product assimilatory nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246484.1 protein_id gnl|my_center|LOCUS_04640 6525 7127 gene locus_tag LOCUS_04650 6525 7127 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251025.1 protein_id gnl|my_center|LOCUS_04650 7121 7543 gene locus_tag LOCUS_04660 7121 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 7554 8774 gene locus_tag LOCUS_04670 7554 8774 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246358.1 protein_id gnl|my_center|LOCUS_04670 8771 9529 gene locus_tag LOCUS_04680 gene cobA 8771 9529 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087845.1 protein_id gnl|my_center|LOCUS_04680 10452 9697 gene locus_tag LOCUS_04690 10452 9697 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142832.1 protein_id gnl|my_center|LOCUS_04690 10674 11837 gene locus_tag LOCUS_04700 10674 11837 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729293.1 protein_id gnl|my_center|LOCUS_04700 11950 12540 gene locus_tag LOCUS_04710 11950 12540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 14239 12554 gene locus_tag LOCUS_04720 14239 12554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 14429 14953 gene locus_tag LOCUS_04730 14429 14953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 15955 15017 gene locus_tag LOCUS_04740 gene sapM 15955 15017 CDS product phosphatidylinositol-3-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900013.1 protein_id gnl|my_center|LOCUS_04740 16424 16014 gene locus_tag LOCUS_04750 16424 16014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 16966 16421 gene locus_tag LOCUS_04760 16966 16421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 17574 16963 gene locus_tag LOCUS_04770 17574 16963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 18107 17571 gene locus_tag LOCUS_04780 18107 17571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 19372 18110 gene locus_tag LOCUS_04790 19372 18110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 19430 19795 gene locus_tag LOCUS_04800 19430 19795 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229084.1 protein_id gnl|my_center|LOCUS_04800 19792 20217 gene locus_tag LOCUS_04810 19792 20217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 20266 21006 gene locus_tag LOCUS_04820 20266 21006 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_04820 23024 21147 gene locus_tag LOCUS_04830 gene typA 23024 21147 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183842.1 protein_id gnl|my_center|LOCUS_04830 23397 28718 gene locus_tag LOCUS_04840 23397 28718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 28715 29371 gene locus_tag LOCUS_04850 28715 29371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 30341 29376 gene locus_tag LOCUS_04860 gene thiL 30341 29376 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_04860 31455 30349 gene locus_tag LOCUS_04870 gene dnaJ 31455 30349 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_04870 33470 31545 gene locus_tag LOCUS_04880 gene dnaK 33470 31545 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_04880 34073 33495 gene locus_tag LOCUS_04890 gene grpE 34073 33495 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940710.1 protein_id gnl|my_center|LOCUS_04890 34119 34934 gene locus_tag LOCUS_04900 gene recO 34119 34934 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941240.1 protein_id gnl|my_center|LOCUS_04900 34952 36250 gene locus_tag LOCUS_04910 34952 36250 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_04910 36273 39041 gene locus_tag LOCUS_04920 gene ppdK 36273 39041 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_04920 39120 40013 gene locus_tag LOCUS_04930 39120 40013 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_04930 40010 41695 gene locus_tag LOCUS_04940 gene pilB 40010 41695 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_04940 42068 43144 gene locus_tag LOCUS_04950 42068 43144 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_04950 43154 44374 gene locus_tag LOCUS_04960 43154 44374 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_04960 44583 44981 gene locus_tag LOCUS_04970 44583 44981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 >Feature sequence010 483 692 gene locus_tag LOCUS_04980 483 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 720 1589 gene locus_tag LOCUS_04990 720 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 1645 1812 gene locus_tag LOCUS_05000 1645 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 2385 1846 gene locus_tag LOCUS_05010 2385 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 2528 3955 gene locus_tag LOCUS_05020 2528 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 6268 3956 gene locus_tag LOCUS_05030 6268 3956 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489176.1 protein_id gnl|my_center|LOCUS_05030 6345 7748 gene locus_tag LOCUS_05040 6345 7748 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727401.1 protein_id gnl|my_center|LOCUS_05040 8682 7774 gene locus_tag LOCUS_05050 8682 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 9599 8868 gene locus_tag LOCUS_05060 9599 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 13237 9944 gene locus_tag LOCUS_05070 13237 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 13402 13770 gene locus_tag LOCUS_05080 13402 13770 CDS product limonene-1,2-epoxide hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920798.1 protein_id gnl|my_center|LOCUS_05080 13836 14774 gene locus_tag LOCUS_05090 13836 14774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 16627 14981 gene locus_tag LOCUS_05100 16627 14981 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728248.1 protein_id gnl|my_center|LOCUS_05100 16744 17760 gene locus_tag LOCUS_05110 16744 17760 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_05110 19512 17770 gene locus_tag LOCUS_05120 19512 17770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 19850 19509 gene locus_tag LOCUS_05130 19850 19509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 20030 21814 gene locus_tag LOCUS_05140 20030 21814 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_05140 21861 22502 gene locus_tag LOCUS_05150 21861 22502 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230645.1 protein_id gnl|my_center|LOCUS_05150 23877 22504 gene locus_tag LOCUS_05160 23877 22504 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227665.1 protein_id gnl|my_center|LOCUS_05160 23934 25145 gene locus_tag LOCUS_05170 23934 25145 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_05170 25228 26517 gene locus_tag LOCUS_05180 25228 26517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 26993 26535 gene locus_tag LOCUS_05190 26993 26535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 27319 27017 gene locus_tag LOCUS_05200 27319 27017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 27370 28635 gene locus_tag LOCUS_05210 27370 28635 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941190.1 protein_id gnl|my_center|LOCUS_05210 28890 28666 gene locus_tag LOCUS_05220 28890 28666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 29621 29070 gene locus_tag LOCUS_05230 29621 29070 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_05230 30631 29876 gene locus_tag LOCUS_05240 gene larB 30631 29876 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392116.1 protein_id gnl|my_center|LOCUS_05240 31797 30637 gene locus_tag LOCUS_05250 31797 30637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 32759 31794 gene locus_tag LOCUS_05260 32759 31794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 32695 33351 gene locus_tag LOCUS_05270 gene sufT 32695 33351 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_05270 34501 33371 gene locus_tag LOCUS_05280 34501 33371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 34632 36530 gene locus_tag LOCUS_05290 34632 36530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 36573 38186 gene locus_tag LOCUS_05300 36573 38186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 38236 39690 gene locus_tag LOCUS_05310 38236 39690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 39681 40100 gene locus_tag LOCUS_05320 39681 40100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 41295 40123 gene locus_tag LOCUS_05330 gene rnd 41295 40123 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919573.1 protein_id gnl|my_center|LOCUS_05330 41905 41303 gene locus_tag LOCUS_05340 41905 41303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 41998 42396 gene locus_tag LOCUS_05350 41998 42396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 42573 43979 gene locus_tag LOCUS_05360 gene zraR 42573 43979 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148522.1 protein_id gnl|my_center|LOCUS_05360 44642 43995 gene locus_tag LOCUS_05370 44642 43995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 >Feature sequence011 155 1012 gene locus_tag LOCUS_05380 155 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 1009 3006 gene locus_tag LOCUS_05390 gene gspD 1009 3006 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918062.1 protein_id gnl|my_center|LOCUS_05390 3003 4619 gene locus_tag LOCUS_05400 gene gspE 3003 4619 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_05400 4619 5809 gene locus_tag LOCUS_05410 gene gspF 4619 5809 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940995.1 protein_id gnl|my_center|LOCUS_05410 5806 6219 gene locus_tag LOCUS_05420 gene gspG 5806 6219 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_05420 6260 6718 gene locus_tag LOCUS_05430 6260 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 6738 7190 gene locus_tag LOCUS_05440 6738 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 7898 8590 gene locus_tag LOCUS_05450 7898 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 8587 9102 gene locus_tag LOCUS_05460 8587 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 9099 9941 gene locus_tag LOCUS_05470 9099 9941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 9961 10314 gene locus_tag LOCUS_05480 9961 10314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 10298 11194 gene locus_tag LOCUS_05490 10298 11194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 11439 11077 gene locus_tag LOCUS_05500 11439 11077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 11320 12444 gene locus_tag LOCUS_05510 11320 12444 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970459.1 protein_id gnl|my_center|LOCUS_05510 13511 12465 gene locus_tag LOCUS_05520 13511 12465 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 protein_id gnl|my_center|LOCUS_05520 14801 13551 gene locus_tag LOCUS_05530 14801 13551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 17071 14816 gene locus_tag LOCUS_05540 17071 14816 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940191.1 protein_id gnl|my_center|LOCUS_05540 17487 17278 gene locus_tag LOCUS_05550 17487 17278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 17486 18292 gene locus_tag LOCUS_05560 17486 18292 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246488.1 protein_id gnl|my_center|LOCUS_05560 18452 24706 gene locus_tag LOCUS_05570 18452 24706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 25813 24785 gene locus_tag LOCUS_05580 gene ruvB 25813 24785 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_05580 26479 25892 gene locus_tag LOCUS_05590 gene ruvA 26479 25892 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_05590 27174 26476 gene locus_tag LOCUS_05600 27174 26476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 27945 27193 gene locus_tag LOCUS_05610 27945 27193 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_05610 28051 28725 gene locus_tag LOCUS_05620 28051 28725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 28722 29972 gene locus_tag LOCUS_05630 28722 29972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 30017 31147 gene locus_tag LOCUS_05640 30017 31147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 33377 31152 gene locus_tag LOCUS_05650 33377 31152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 33935 33450 gene locus_tag LOCUS_05660 33935 33450 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640658.1 protein_id gnl|my_center|LOCUS_05660 34986 33949 gene locus_tag LOCUS_05670 34986 33949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 39265 35534 gene locus_tag LOCUS_05680 39265 35534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 39708 39376 gene locus_tag LOCUS_05690 39708 39376 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920728.1 protein_id gnl|my_center|LOCUS_05690 40781 39705 gene locus_tag LOCUS_05700 40781 39705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 41794 40778 gene locus_tag LOCUS_05710 gene plsX 41794 40778 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774380.1 protein_id gnl|my_center|LOCUS_05710 42043 41798 gene locus_tag LOCUS_05720 42043 41798 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191739.1 protein_id gnl|my_center|LOCUS_05720 42133 42444 gene locus_tag LOCUS_05730 gene rplU 42133 42444 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_05730 42444 42713 gene locus_tag LOCUS_05740 gene rpmA 42444 42713 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943850.1 protein_id gnl|my_center|LOCUS_05740 43454 42726 gene locus_tag LOCUS_05750 43454 42726 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085746.1 protein_id gnl|my_center|LOCUS_05750 44093 43572 gene locus_tag LOCUS_05760 44093 43572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence012 635 318 gene locus_tag LOCUS_05770 635 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 726 1370 gene locus_tag LOCUS_05780 726 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 2545 1457 gene locus_tag LOCUS_05790 gene ydiK 2545 1457 CDS product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011416681.1 protein_id gnl|my_center|LOCUS_05790 3168 2794 gene locus_tag LOCUS_05800 3168 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 3763 3200 gene locus_tag LOCUS_05810 3763 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 5372 3786 gene locus_tag LOCUS_05820 5372 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05820 5838 5560 gene locus_tag LOCUS_05830 5838 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 7878 6466 gene locus_tag LOCUS_05840 7878 6466 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938336.1 protein_id gnl|my_center|LOCUS_05840 9205 7889 gene locus_tag LOCUS_05850 9205 7889 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479749.1 protein_id gnl|my_center|LOCUS_05850 10264 9245 gene locus_tag LOCUS_05860 10264 9245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729272.1 protein_id gnl|my_center|LOCUS_05860 10823 10290 gene locus_tag LOCUS_05870 10823 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049746474.1 protein_id gnl|my_center|LOCUS_05870 11678 10851 gene locus_tag LOCUS_05880 11678 10851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 12706 11858 gene locus_tag LOCUS_05890 12706 11858 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022593.1 protein_id gnl|my_center|LOCUS_05890 12648 12950 gene locus_tag LOCUS_05900 12648 12950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 13353 13005 gene locus_tag LOCUS_tm00010 13353 13005 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 13884 13411 gene locus_tag LOCUS_05910 gene smpB 13884 13411 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942353.1 protein_id gnl|my_center|LOCUS_05910 14308 13898 gene locus_tag LOCUS_05920 14308 13898 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887363.1 protein_id gnl|my_center|LOCUS_05920 15168 14308 gene locus_tag LOCUS_05930 gene panC 15168 14308 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942350.1 protein_id gnl|my_center|LOCUS_05930 16013 15165 gene locus_tag LOCUS_05940 gene panB 16013 15165 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942349.1 protein_id gnl|my_center|LOCUS_05940 16948 16217 gene locus_tag LOCUS_05950 16948 16217 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_05950 16972 18057 gene locus_tag LOCUS_05960 gene nagZ 16972 18057 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887975.1 protein_id gnl|my_center|LOCUS_05960 19567 18383 gene locus_tag LOCUS_05970 gene yfdE 19567 18383 CDS product CoA:oxalate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296867.1 protein_id gnl|my_center|LOCUS_05970 19710 21056 gene locus_tag LOCUS_05980 19710 21056 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092177.1 protein_id gnl|my_center|LOCUS_05980 21072 22760 gene locus_tag LOCUS_05990 21072 22760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 22910 23881 gene locus_tag LOCUS_06000 22910 23881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 24437 23898 gene locus_tag LOCUS_06010 24437 23898 CDS product DUF3455 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223796.1 protein_id gnl|my_center|LOCUS_06010 25276 24437 gene locus_tag LOCUS_06020 25276 24437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 25766 25362 gene locus_tag LOCUS_06030 25766 25362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 26833 25781 gene locus_tag LOCUS_06040 gene mtnA 26833 25781 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_06040 26992 27435 gene locus_tag LOCUS_06050 26992 27435 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_06050 29595 27769 gene locus_tag LOCUS_06060 29595 27769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 31532 29598 gene locus_tag LOCUS_06070 31532 29598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 31705 32907 gene locus_tag LOCUS_06080 31705 32907 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_06080 34836 32917 gene locus_tag LOCUS_06090 34836 32917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 35350 35057 gene locus_tag LOCUS_06100 35350 35057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 35474 36355 gene locus_tag LOCUS_06110 35474 36355 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937965.1 protein_id gnl|my_center|LOCUS_06110 36366 37973 gene locus_tag LOCUS_06120 36366 37973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 38683 37982 gene locus_tag LOCUS_06130 38683 37982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 38822 40963 gene locus_tag LOCUS_06140 38822 40963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 41452 40964 gene locus_tag LOCUS_06150 41452 40964 CDS product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530718.1 protein_id gnl|my_center|LOCUS_06150 42049 41516 gene locus_tag LOCUS_06160 42049 41516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 42182 42475 gene locus_tag LOCUS_06170 42182 42475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 42475 43023 gene locus_tag LOCUS_06180 42475 43023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 43027 43212 gene locus_tag LOCUS_06190 43027 43212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 <43729 43152 gene locus_tag LOCUS_06200 <43729 43152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029872.1:alpha/beta fold hydrolase >Feature sequence013 61 516 gene locus_tag LOCUS_06210 61 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 632 1492 gene locus_tag LOCUS_06220 gene mtnP 632 1492 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_06220 1489 2391 gene locus_tag LOCUS_06230 1489 2391 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_06230 2388 3380 gene locus_tag LOCUS_06240 2388 3380 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_06240 3377 4693 gene locus_tag LOCUS_06250 3377 4693 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_06250 4700 5641 gene locus_tag LOCUS_06260 4700 5641 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_06260 5638 6567 gene locus_tag LOCUS_06270 5638 6567 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_06270 6730 8535 gene locus_tag LOCUS_06280 gene lepA 6730 8535 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_06280 8563 9231 gene locus_tag LOCUS_06290 gene lepB 8563 9231 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_06290 10352 9564 gene locus_tag LOCUS_06300 10352 9564 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943266.1 protein_id gnl|my_center|LOCUS_06300 10442 11278 gene locus_tag LOCUS_06310 10442 11278 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921324.1 protein_id gnl|my_center|LOCUS_06310 12917 11403 gene locus_tag LOCUS_06320 12917 11403 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640376.1 protein_id gnl|my_center|LOCUS_06320 12981 14006 gene locus_tag LOCUS_06330 12981 14006 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 protein_id gnl|my_center|LOCUS_06330 15187 14066 gene locus_tag LOCUS_06340 15187 14066 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929099.1 protein_id gnl|my_center|LOCUS_06340 15306 15380 gene locus_tag LOCUS_t00150 15306 15380 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15458 17401 gene locus_tag LOCUS_06350 gene thrS 15458 17401 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_06350 17458 17913 gene locus_tag LOCUS_06360 gene infC 17458 17913 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939807.1 protein_id gnl|my_center|LOCUS_06360 17926 18123 gene locus_tag LOCUS_06370 gene rpmI 17926 18123 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393258.1 protein_id gnl|my_center|LOCUS_06370 18138 18509 gene locus_tag LOCUS_06380 gene rplT 18138 18509 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_06380 18512 19558 gene locus_tag LOCUS_06390 gene pheS 18512 19558 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_06390 19570 21984 gene locus_tag LOCUS_06400 gene pheT 19570 21984 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_06400 21995 22309 gene locus_tag LOCUS_06410 21995 22309 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_06410 22306 22650 gene locus_tag LOCUS_06420 22306 22650 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082021182.1 protein_id gnl|my_center|LOCUS_06420 23354 22857 gene locus_tag LOCUS_06430 23354 22857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 23669 23743 gene locus_tag LOCUS_t00160 23669 23743 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 23832 24596 gene locus_tag LOCUS_06440 gene surE 23832 24596 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_06440 24598 25254 gene locus_tag LOCUS_06450 24598 25254 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_06450 25258 25962 gene locus_tag LOCUS_06460 gene actS 25258 25962 CDS product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301085.1 protein_id gnl|my_center|LOCUS_06460 25962 26480 gene locus_tag LOCUS_06470 25962 26480 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944687.1 protein_id gnl|my_center|LOCUS_06470 26493 27371 gene locus_tag LOCUS_06480 26493 27371 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723624.1 protein_id gnl|my_center|LOCUS_06480 27386 27796 gene locus_tag LOCUS_06490 gene mce 27386 27796 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879707.1 protein_id gnl|my_center|LOCUS_06490 27796 28434 gene locus_tag LOCUS_06500 27796 28434 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391792.1 protein_id gnl|my_center|LOCUS_06500 28593 30005 gene locus_tag LOCUS_06510 28593 30005 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_06510 30002 30979 gene locus_tag LOCUS_06520 gene sppA 30002 30979 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941487.1 protein_id gnl|my_center|LOCUS_06520 31180 32553 gene locus_tag LOCUS_06530 gene mgtE 31180 32553 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971322.1 protein_id gnl|my_center|LOCUS_06530 33309 32560 gene locus_tag LOCUS_06540 33309 32560 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113262.1 protein_id gnl|my_center|LOCUS_06540 33387 34247 gene locus_tag LOCUS_06550 33387 34247 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529020.1 protein_id gnl|my_center|LOCUS_06550 34290 35258 gene locus_tag LOCUS_06560 34290 35258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 36235 35261 gene locus_tag LOCUS_06570 36235 35261 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224686.1 protein_id gnl|my_center|LOCUS_06570 36318 36827 gene locus_tag LOCUS_06580 36318 36827 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920697.1 protein_id gnl|my_center|LOCUS_06580 37463 38005 gene locus_tag LOCUS_06590 gene pyrR 37463 38005 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_06590 38017 39018 gene locus_tag LOCUS_06600 38017 39018 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_06600 39015 40337 gene locus_tag LOCUS_06610 39015 40337 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_06610 40334 41479 gene locus_tag LOCUS_06620 gene carA 40334 41479 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence014 1132 116 gene locus_tag LOCUS_06630 1132 116 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114421.1 protein_id gnl|my_center|LOCUS_06630 1865 1248 gene locus_tag LOCUS_06640 1865 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 2072 2560 gene locus_tag LOCUS_06650 2072 2560 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095816.1 protein_id gnl|my_center|LOCUS_06650 2773 3189 gene locus_tag LOCUS_06660 2773 3189 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530041.1 protein_id gnl|my_center|LOCUS_06660 3214 4122 gene locus_tag LOCUS_06670 3214 4122 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226961.1 protein_id gnl|my_center|LOCUS_06670 4119 5000 gene locus_tag LOCUS_06680 4119 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 5955 5044 gene locus_tag LOCUS_06690 gene xerD 5955 5044 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_06690 8696 5967 gene locus_tag LOCUS_06700 gene glnD 8696 5967 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_06700 9891 8749 gene locus_tag LOCUS_06710 9891 8749 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942466.1 protein_id gnl|my_center|LOCUS_06710 11126 9936 gene locus_tag LOCUS_06720 gene metK 11126 9936 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142571.1 protein_id gnl|my_center|LOCUS_06720 14173 11123 gene locus_tag LOCUS_06730 14173 11123 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012596252.1 protein_id gnl|my_center|LOCUS_06730 16916 14388 gene locus_tag LOCUS_06740 gene mutS 16916 14388 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541545.1 protein_id gnl|my_center|LOCUS_06740 18561 16969 gene locus_tag LOCUS_06750 18561 16969 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_06750 20795 18576 gene locus_tag LOCUS_06760 20795 18576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 21108 20797 gene locus_tag LOCUS_06770 21108 20797 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_06770 22004 21114 gene locus_tag LOCUS_06780 gene sppA 22004 21114 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941890.1 protein_id gnl|my_center|LOCUS_06780 23725 22019 gene locus_tag LOCUS_06790 23725 22019 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_06790 24509 23832 gene locus_tag LOCUS_06800 gene cmk 24509 23832 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_06800 25807 24506 gene locus_tag LOCUS_06810 gene aroA 25807 24506 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_06810 26676 25804 gene locus_tag LOCUS_06820 26676 25804 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_06820 27805 26696 gene locus_tag LOCUS_06830 gene hisC 27805 26696 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_06830 28896 27802 gene locus_tag LOCUS_06840 gene pheA 28896 27802 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_06840 29862 28927 gene locus_tag LOCUS_06850 gene miaA 29862 28927 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_06850 31643 29859 gene locus_tag LOCUS_06860 gene mutL 31643 29859 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090225.1 protein_id gnl|my_center|LOCUS_06860 33257 31848 gene locus_tag LOCUS_06870 33257 31848 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_06870 33339 33818 gene locus_tag LOCUS_06880 33339 33818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 33823 34245 gene locus_tag LOCUS_06890 33823 34245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 34476 34135 gene locus_tag LOCUS_06900 34476 34135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 34735 34926 gene locus_tag LOCUS_06910 gene rpmB 34735 34926 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_06910 34973 35305 gene locus_tag LOCUS_06920 34973 35305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 35338 35850 gene locus_tag LOCUS_06930 35338 35850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 35971 36789 gene locus_tag LOCUS_06940 35971 36789 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100707.1 protein_id gnl|my_center|LOCUS_06940 37046 38308 gene locus_tag LOCUS_06950 37046 38308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 38417 38911 gene locus_tag LOCUS_06960 38417 38911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 40135 38915 gene locus_tag LOCUS_06970 40135 38915 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963509.1 protein_id gnl|my_center|LOCUS_06970 40328 40618 gene locus_tag LOCUS_06980 40328 40618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 40615 41001 gene locus_tag LOCUS_06990 40615 41001 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417998.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence015 474 1460 gene locus_tag LOCUS_07000 474 1460 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887575.1 protein_id gnl|my_center|LOCUS_07000 1541 2650 gene locus_tag LOCUS_07010 1541 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 2647 4287 gene locus_tag LOCUS_07020 2647 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 4850 4305 gene locus_tag LOCUS_07030 4850 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 4976 7945 gene locus_tag LOCUS_07040 4976 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 9079 7949 gene locus_tag LOCUS_07050 9079 7949 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811506.1 protein_id gnl|my_center|LOCUS_07050 9483 9076 gene locus_tag LOCUS_07060 9483 9076 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075834.1 protein_id gnl|my_center|LOCUS_07060 10328 9540 gene locus_tag LOCUS_07070 10328 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 10513 12675 gene locus_tag LOCUS_07080 10513 12675 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969651.1 protein_id gnl|my_center|LOCUS_07080 12678 13865 gene locus_tag LOCUS_07090 12678 13865 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975037.1 protein_id gnl|my_center|LOCUS_07090 14503 13931 gene locus_tag LOCUS_07100 14503 13931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 14834 14553 gene locus_tag LOCUS_07110 gene hupN 14834 14553 CDS product HU-related DNA-binding protein HupN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399274.1 protein_id gnl|my_center|LOCUS_07110 15190 15531 gene locus_tag LOCUS_07120 15190 15531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 15704 16444 gene locus_tag LOCUS_07130 15704 16444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 16459 17892 gene locus_tag LOCUS_07140 16459 17892 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941631.1 protein_id gnl|my_center|LOCUS_07140 18103 18738 gene locus_tag LOCUS_07150 18103 18738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 18899 19582 gene locus_tag LOCUS_07160 18899 19582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 19593 21086 gene locus_tag LOCUS_07170 19593 21086 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942628.1 protein_id gnl|my_center|LOCUS_07170 21100 21942 gene locus_tag LOCUS_07180 21100 21942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 22110 23555 gene locus_tag LOCUS_07190 22110 23555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 23552 24673 gene locus_tag LOCUS_07200 23552 24673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 24670 25470 gene locus_tag LOCUS_07210 24670 25470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 25520 27217 gene locus_tag LOCUS_07220 25520 27217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 27208 27462 gene locus_tag LOCUS_07230 27208 27462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 27459 28652 gene locus_tag LOCUS_07240 27459 28652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 28652 29743 gene locus_tag LOCUS_07250 28652 29743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 29740 30765 gene locus_tag LOCUS_07260 29740 30765 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_07260 30773 32722 gene locus_tag LOCUS_07270 gene asnB 30773 32722 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_07270 32719 34596 gene locus_tag LOCUS_07280 32719 34596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 34608 36557 gene locus_tag LOCUS_07290 34608 36557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 36560 37651 gene locus_tag LOCUS_07300 36560 37651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 37678 38907 gene locus_tag LOCUS_07310 37678 38907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 38933 39703 gene locus_tag LOCUS_07320 38933 39703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 >Feature sequence016 <1 612 gene locus_tag LOCUS_07330 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023994.1:pyrroline-5-carboxylate reductase 621 947 gene locus_tag LOCUS_07340 621 947 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938667.1 protein_id gnl|my_center|LOCUS_07340 937 1272 gene locus_tag LOCUS_07350 937 1272 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914001.1 protein_id gnl|my_center|LOCUS_07350 1282 1614 gene locus_tag LOCUS_07360 1282 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 1707 3584 gene locus_tag LOCUS_07370 1707 3584 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421608.1 protein_id gnl|my_center|LOCUS_07370 3584 5152 gene locus_tag LOCUS_07380 3584 5152 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_07380 5551 5156 gene locus_tag LOCUS_07390 5551 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 6076 5744 gene locus_tag LOCUS_07400 6076 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 6167 6240 gene locus_tag LOCUS_t00170 6167 6240 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6217 6609 gene locus_tag LOCUS_07410 6217 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 8702 6606 gene locus_tag LOCUS_07420 8702 6606 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_07420 9425 8706 gene locus_tag LOCUS_07430 gene rpe 9425 8706 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902077.1 protein_id gnl|my_center|LOCUS_07430 10526 9621 gene locus_tag LOCUS_07440 gene lsrF 10526 9621 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933433.1 protein_id gnl|my_center|LOCUS_07440 10655 11332 gene locus_tag LOCUS_07450 10655 11332 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966824.1 protein_id gnl|my_center|LOCUS_07450 12424 11336 gene locus_tag LOCUS_07460 12424 11336 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 protein_id gnl|my_center|LOCUS_07460 13647 12436 gene locus_tag LOCUS_07470 13647 12436 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225678.1 protein_id gnl|my_center|LOCUS_07470 13933 13718 gene locus_tag LOCUS_07480 13933 13718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 14036 16384 gene locus_tag LOCUS_07490 gene mrcB 14036 16384 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_07490 16416 16706 gene locus_tag LOCUS_07500 16416 16706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 16718 18073 gene locus_tag LOCUS_07510 16718 18073 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461538.1 protein_id gnl|my_center|LOCUS_07510 18081 18671 gene locus_tag LOCUS_07520 18081 18671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 18737 18940 gene locus_tag LOCUS_07530 18737 18940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 20927 18945 gene locus_tag LOCUS_07540 20927 18945 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942999.1 protein_id gnl|my_center|LOCUS_07540 21337 20933 gene locus_tag LOCUS_07550 21337 20933 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731384.1 protein_id gnl|my_center|LOCUS_07550 21502 22497 gene locus_tag LOCUS_07560 21502 22497 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085728.1 protein_id gnl|my_center|LOCUS_07560 22499 22891 gene locus_tag LOCUS_07570 22499 22891 CDS product DUF6285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728129.1 protein_id gnl|my_center|LOCUS_07570 23256 24149 gene locus_tag LOCUS_07580 23256 24149 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172854.1 protein_id gnl|my_center|LOCUS_07580 24208 24789 gene locus_tag LOCUS_07590 24208 24789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 24794 27535 gene locus_tag LOCUS_07600 24794 27535 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205537.1 protein_id gnl|my_center|LOCUS_07600 27959 27738 gene locus_tag LOCUS_07610 27959 27738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 28814 30478 gene locus_tag LOCUS_07620 28814 30478 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_07620 31008 30664 gene locus_tag LOCUS_07630 31008 30664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 31119 32588 gene locus_tag LOCUS_07640 31119 32588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 33812 32592 gene locus_tag LOCUS_07650 33812 32592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07650 35050 33809 gene locus_tag LOCUS_07660 35050 33809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07660 35365 36291 gene locus_tag LOCUS_07670 35365 36291 CDS product TIGR03564 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727013.1 protein_id gnl|my_center|LOCUS_07670 36781 38025 gene locus_tag LOCUS_07680 36781 38025 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173087.1 protein_id gnl|my_center|LOCUS_07680 <40113 38040 gene locus_tag LOCUS_07690 <40113 38040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943442.1:PAS domain S-box protein >Feature sequence017 368 180 gene locus_tag LOCUS_07700 368 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 466 699 gene locus_tag LOCUS_07710 466 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 2181 709 gene locus_tag LOCUS_07720 2181 709 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225339.1 protein_id gnl|my_center|LOCUS_07720 2317 3099 gene locus_tag LOCUS_07730 2317 3099 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878170.1 protein_id gnl|my_center|LOCUS_07730 3108 4688 gene locus_tag LOCUS_07740 gene malQ 3108 4688 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403431.1 protein_id gnl|my_center|LOCUS_07740 4946 4665 gene locus_tag LOCUS_07750 4946 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 5072 5956 gene locus_tag LOCUS_07760 5072 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 6045 7637 gene locus_tag LOCUS_07770 6045 7637 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028579.1 protein_id gnl|my_center|LOCUS_07770 8979 7642 gene locus_tag LOCUS_07780 8979 7642 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_07780 9275 9478 gene locus_tag LOCUS_07790 9275 9478 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017957.1 protein_id gnl|my_center|LOCUS_07790 9496 9753 gene locus_tag LOCUS_07800 9496 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 15409 9764 gene locus_tag LOCUS_07810 15409 9764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 16584 15406 gene locus_tag LOCUS_07820 gene glgC 16584 15406 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467118.1 protein_id gnl|my_center|LOCUS_07820 17867 16605 gene locus_tag LOCUS_07830 gene dnaA 17867 16605 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229057.1 protein_id gnl|my_center|LOCUS_07830 18734 18189 gene locus_tag LOCUS_07840 18734 18189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 20378 18801 gene locus_tag LOCUS_07850 20378 18801 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393415.1 protein_id gnl|my_center|LOCUS_07850 21215 20400 gene locus_tag LOCUS_07860 21215 20400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 21321 21533 gene locus_tag LOCUS_07870 21321 21533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 22247 21771 gene locus_tag LOCUS_07880 22247 21771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 22445 23089 gene locus_tag LOCUS_07890 22445 23089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 23095 24057 gene locus_tag LOCUS_07900 gene pfkA 23095 24057 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173968.1 protein_id gnl|my_center|LOCUS_07900 24057 25238 gene locus_tag LOCUS_07910 24057 25238 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939886.1 protein_id gnl|my_center|LOCUS_07910 26882 25659 gene locus_tag LOCUS_07920 26882 25659 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258129.1 protein_id gnl|my_center|LOCUS_07920 28039 26879 gene locus_tag LOCUS_07930 28039 26879 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926174.1 protein_id gnl|my_center|LOCUS_07930 28290 28042 gene locus_tag LOCUS_07940 28290 28042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 29011 28334 gene locus_tag LOCUS_07950 29011 28334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 30014 29016 gene locus_tag LOCUS_07960 gene moaA 30014 29016 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257065.1 protein_id gnl|my_center|LOCUS_07960 31143 30136 gene locus_tag LOCUS_07970 gene ispB 31143 30136 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038769.1 protein_id gnl|my_center|LOCUS_07970 31219 32289 gene locus_tag LOCUS_07980 gene apbC 31219 32289 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_07980 32370 32696 gene locus_tag LOCUS_07990 32370 32696 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_07990 32790 33893 gene locus_tag LOCUS_08000 32790 33893 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 protein_id gnl|my_center|LOCUS_08000 33896 34654 gene locus_tag LOCUS_08010 33896 34654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 34651 34854 gene locus_tag LOCUS_08020 34651 34854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 34769 35899 gene locus_tag LOCUS_08030 34769 35899 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_08030 35904 37133 gene locus_tag LOCUS_08040 gene coaBC 35904 37133 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_08040 37992 37141 gene locus_tag LOCUS_08050 37992 37141 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941786.1 protein_id gnl|my_center|LOCUS_08050 38010 38765 gene locus_tag LOCUS_08060 38010 38765 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence018 2182 347 gene locus_tag LOCUS_08070 2182 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2284 4332 gene locus_tag LOCUS_08080 2284 4332 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385793.1 protein_id gnl|my_center|LOCUS_08080 4325 6451 gene locus_tag LOCUS_08090 4325 6451 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533167.1 protein_id gnl|my_center|LOCUS_08090 6448 6789 gene locus_tag LOCUS_08100 6448 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 6777 7763 gene locus_tag LOCUS_08110 6777 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 7760 8890 gene locus_tag LOCUS_08120 7760 8890 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730134.1 protein_id gnl|my_center|LOCUS_08120 8908 10011 gene locus_tag LOCUS_08130 gene thiO 8908 10011 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_08130 10644 10132 gene locus_tag LOCUS_08140 10644 10132 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_08140 11511 10723 gene locus_tag LOCUS_08150 11511 10723 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419179.1 protein_id gnl|my_center|LOCUS_08150 12161 11520 gene locus_tag LOCUS_08160 12161 11520 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_08160 12922 12242 gene locus_tag LOCUS_08170 12922 12242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 13039 13635 gene locus_tag LOCUS_08180 13039 13635 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815398.1 protein_id gnl|my_center|LOCUS_08180 13640 14116 gene locus_tag LOCUS_08190 13640 14116 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928842.1 protein_id gnl|my_center|LOCUS_08190 14450 14142 gene locus_tag LOCUS_08200 14450 14142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 16024 14513 gene locus_tag LOCUS_08210 gene rng 16024 14513 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_08210 18834 16033 gene locus_tag LOCUS_08220 18834 16033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 18929 19129 gene locus_tag LOCUS_08230 18929 19129 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943808.1 protein_id gnl|my_center|LOCUS_08230 19958 19149 gene locus_tag LOCUS_08240 19958 19149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 21147 20074 gene locus_tag LOCUS_08250 21147 20074 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942544.1 protein_id gnl|my_center|LOCUS_08250 21895 21161 gene locus_tag LOCUS_08260 21895 21161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_08260 22701 21892 gene locus_tag LOCUS_08270 22701 21892 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545754.1 protein_id gnl|my_center|LOCUS_08270 23815 22736 gene locus_tag LOCUS_08280 23815 22736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 24800 23796 gene locus_tag LOCUS_08290 24800 23796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 25538 24864 gene locus_tag LOCUS_08300 25538 24864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 25894 26505 gene locus_tag LOCUS_08310 25894 26505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 27774 26530 gene locus_tag LOCUS_08320 27774 26530 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_08320 28442 27771 gene locus_tag LOCUS_08330 28442 27771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 29824 28457 gene locus_tag LOCUS_08340 29824 28457 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392880.1 protein_id gnl|my_center|LOCUS_08340 31160 29913 gene locus_tag LOCUS_08350 31160 29913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 31852 31184 gene locus_tag LOCUS_08360 31852 31184 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_08360 32853 31849 gene locus_tag LOCUS_08370 gene nadA 32853 31849 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546803.1 protein_id gnl|my_center|LOCUS_08370 32972 33988 gene locus_tag LOCUS_08380 gene bioB 32972 33988 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326296.1 protein_id gnl|my_center|LOCUS_08380 34092 34268 gene locus_tag LOCUS_08390 34092 34268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 35624 34281 gene locus_tag LOCUS_08400 35624 34281 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388333.1 protein_id gnl|my_center|LOCUS_08400 37069 35630 gene locus_tag LOCUS_08410 gene tldD 37069 35630 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039540.1 protein_id gnl|my_center|LOCUS_08410 37135 37383 gene locus_tag LOCUS_08420 37135 37383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 37447 38484 gene locus_tag LOCUS_08430 37447 38484 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942440.1 protein_id gnl|my_center|LOCUS_08430 39576 38488 gene locus_tag LOCUS_08440 gene queG 39576 38488 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338745.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence019 9 830 gene locus_tag LOCUS_08450 9 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 837 1778 gene locus_tag LOCUS_08460 837 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 1775 2674 gene locus_tag LOCUS_08470 gene cyoE 1775 2674 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_08470 2677 3288 gene locus_tag LOCUS_08480 2677 3288 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142159.1 protein_id gnl|my_center|LOCUS_08480 3288 3587 gene locus_tag LOCUS_08490 3288 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 3584 4192 gene locus_tag LOCUS_08500 3584 4192 CDS product heme-copper oxidase subunit III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394318.1 protein_id gnl|my_center|LOCUS_08500 4202 4549 gene locus_tag LOCUS_08510 4202 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4614 5162 gene locus_tag LOCUS_08520 4614 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 5967 5197 gene locus_tag LOCUS_08530 5967 5197 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405089.1 protein_id gnl|my_center|LOCUS_08530 6995 5964 gene locus_tag LOCUS_08540 6995 5964 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_08540 7306 6935 gene locus_tag LOCUS_08550 7306 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098264.1 protein_id gnl|my_center|LOCUS_08550 9183 7303 gene locus_tag LOCUS_08560 gene asnB 9183 7303 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_08560 10167 9187 gene locus_tag LOCUS_08570 10167 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 11248 10151 gene locus_tag LOCUS_08580 11248 10151 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_08580 12508 11252 gene locus_tag LOCUS_08590 12508 11252 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083269077.1 protein_id gnl|my_center|LOCUS_08590 13007 12672 gene locus_tag LOCUS_08600 13007 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 13048 14247 gene locus_tag LOCUS_08610 13048 14247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 15193 14210 gene locus_tag LOCUS_08620 15193 14210 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_08620 15250 17559 gene locus_tag LOCUS_08630 15250 17559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 17923 17462 gene locus_tag LOCUS_08640 17923 17462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 19143 17923 gene locus_tag LOCUS_08650 19143 17923 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040096.1 protein_id gnl|my_center|LOCUS_08650 20432 19185 gene locus_tag LOCUS_08660 20432 19185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 21472 20432 gene locus_tag LOCUS_08670 gene pdxA 21472 20432 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 protein_id gnl|my_center|LOCUS_08670 22596 21478 gene locus_tag LOCUS_08680 22596 21478 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941287.1 protein_id gnl|my_center|LOCUS_08680 24269 22596 gene locus_tag LOCUS_08690 24269 22596 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005575582.1 protein_id gnl|my_center|LOCUS_08690 26129 24273 gene locus_tag LOCUS_08700 26129 24273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 28099 26129 gene locus_tag LOCUS_08710 28099 26129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 28374 28117 gene locus_tag LOCUS_08720 28374 28117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 29685 28387 gene locus_tag LOCUS_08730 29685 28387 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_08730 31927 30068 gene locus_tag LOCUS_08740 31927 30068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 32076 31948 gene locus_tag LOCUS_08750 32076 31948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 33016 32069 gene locus_tag LOCUS_08760 33016 32069 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_08760 34480 33059 gene locus_tag LOCUS_08770 34480 33059 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_08770 35850 34513 gene locus_tag LOCUS_08780 35850 34513 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048114.1 protein_id gnl|my_center|LOCUS_08780 37738 35843 gene locus_tag LOCUS_08790 37738 35843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 38407 37859 gene locus_tag LOCUS_08800 38407 37859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence020 <1 2227 gene locus_tag LOCUS_08810 <1 2227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942301.1:DNA internalization-related competence protein ComEC/Rec2 2904 2224 gene locus_tag LOCUS_08820 2904 2224 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 protein_id gnl|my_center|LOCUS_08820 4688 2901 gene locus_tag LOCUS_08830 4688 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 4871 5230 gene locus_tag LOCUS_08840 gene erpA 4871 5230 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 protein_id gnl|my_center|LOCUS_08840 5241 5909 gene locus_tag LOCUS_08850 5241 5909 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113205.1 protein_id gnl|my_center|LOCUS_08850 7385 5922 gene locus_tag LOCUS_08860 gene glgA 7385 5922 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_08860 8344 7385 gene locus_tag LOCUS_08870 gene galT 8344 7385 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_08870 10842 8389 gene locus_tag LOCUS_08880 gene lon 10842 8389 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_08880 11052 11474 gene locus_tag LOCUS_08890 11052 11474 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227790.1 protein_id gnl|my_center|LOCUS_08890 11471 11938 gene locus_tag LOCUS_08900 11471 11938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 11944 12690 gene locus_tag LOCUS_08910 11944 12690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 12681 13211 gene locus_tag LOCUS_08920 12681 13211 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_08920 14122 13262 gene locus_tag LOCUS_08930 14122 13262 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393282.1 protein_id gnl|my_center|LOCUS_08930 14893 14132 gene locus_tag LOCUS_08940 14893 14132 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903333.1 protein_id gnl|my_center|LOCUS_08940 15754 14897 gene locus_tag LOCUS_08950 15754 14897 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_08950 16677 15751 gene locus_tag LOCUS_08960 16677 15751 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227962.1 protein_id gnl|my_center|LOCUS_08960 16898 16677 gene locus_tag LOCUS_08970 16898 16677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 17031 17201 gene locus_tag LOCUS_08980 17031 17201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 17219 17608 gene locus_tag LOCUS_08990 17219 17608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 18523 17612 gene locus_tag LOCUS_09000 18523 17612 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_09000 19374 18520 gene locus_tag LOCUS_09010 19374 18520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 19480 20553 gene locus_tag LOCUS_09020 19480 20553 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941859.1 protein_id gnl|my_center|LOCUS_09020 20553 23141 gene locus_tag LOCUS_09030 20553 23141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 23244 25550 gene locus_tag LOCUS_09040 23244 25550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 25660 27144 gene locus_tag LOCUS_09050 gene lysS 25660 27144 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_09050 27141 28412 gene locus_tag LOCUS_09060 27141 28412 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_09060 28419 29141 gene locus_tag LOCUS_09070 28419 29141 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_09070 29138 31483 gene locus_tag LOCUS_09080 gene bamA 29138 31483 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_09080 31493 32047 gene locus_tag LOCUS_09090 31493 32047 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942907.1 protein_id gnl|my_center|LOCUS_09090 32117 33232 gene locus_tag LOCUS_09100 32117 33232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 33234 34088 gene locus_tag LOCUS_09110 gene lpxI 33234 34088 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_09110 34085 35074 gene locus_tag LOCUS_09120 34085 35074 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_09120 35078 36268 gene locus_tag LOCUS_09130 gene lpxB 35078 36268 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_09130 36265 38058 gene locus_tag LOCUS_09140 36265 38058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence021 465 2267 gene locus_tag LOCUS_09150 465 2267 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979843.1 protein_id gnl|my_center|LOCUS_09150 2856 2191 gene locus_tag LOCUS_09160 2856 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 2947 3828 gene locus_tag LOCUS_09170 2947 3828 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 protein_id gnl|my_center|LOCUS_09170 4028 3840 gene locus_tag LOCUS_09180 4028 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 4109 5401 gene locus_tag LOCUS_09190 4109 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 6343 5738 gene locus_tag LOCUS_09200 6343 5738 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_09200 6658 6347 gene locus_tag LOCUS_09210 6658 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 6866 6648 gene locus_tag LOCUS_09220 6866 6648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 6944 7630 gene locus_tag LOCUS_09230 6944 7630 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258849.1 protein_id gnl|my_center|LOCUS_09230 7665 8243 gene locus_tag LOCUS_09240 7665 8243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 8291 10150 gene locus_tag LOCUS_09250 8291 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 10275 10829 gene locus_tag LOCUS_09260 10275 10829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 12891 11059 gene locus_tag LOCUS_09270 12891 11059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 13616 12909 gene locus_tag LOCUS_09280 13616 12909 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947313.1 protein_id gnl|my_center|LOCUS_09280 15450 13684 gene locus_tag LOCUS_09290 15450 13684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 17352 15970 gene locus_tag LOCUS_09300 17352 15970 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225694.1 protein_id gnl|my_center|LOCUS_09300 18122 17349 gene locus_tag LOCUS_09310 18122 17349 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 protein_id gnl|my_center|LOCUS_09310 19628 18165 gene locus_tag LOCUS_09320 gene glpK 19628 18165 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_09320 19620 20819 gene locus_tag LOCUS_09330 gene aroF 19620 20819 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_09330 20877 21332 gene locus_tag LOCUS_09340 20877 21332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 22739 21345 gene locus_tag LOCUS_09350 22739 21345 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878369.1 protein_id gnl|my_center|LOCUS_09350 24343 22736 gene locus_tag LOCUS_09360 gene glpD 24343 22736 CDS product aerobic glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672801.1 protein_id gnl|my_center|LOCUS_09360 24994 24356 gene locus_tag LOCUS_09370 24994 24356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 25406 25038 gene locus_tag LOCUS_09380 25406 25038 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_09380 26834 25449 gene locus_tag LOCUS_09390 gene sthA 26834 25449 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_09390 27018 29687 gene locus_tag LOCUS_09400 27018 29687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 31173 29692 gene locus_tag LOCUS_09410 31173 29692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 31295 31534 gene locus_tag LOCUS_09420 31295 31534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 31485 31682 gene locus_tag LOCUS_09430 31485 31682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 31679 32140 gene locus_tag LOCUS_09440 31679 32140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 32835 32146 gene locus_tag LOCUS_09450 32835 32146 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966631.1 protein_id gnl|my_center|LOCUS_09450 33299 32832 gene locus_tag LOCUS_09460 33299 32832 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061684.1 protein_id gnl|my_center|LOCUS_09460 33408 33995 gene locus_tag LOCUS_09470 gene coaE 33408 33995 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_09470 33992 34900 gene locus_tag LOCUS_09480 33992 34900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 34958 36484 gene locus_tag LOCUS_09490 34958 36484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence022 181 858 gene locus_tag LOCUS_09500 181 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 982 1251 gene locus_tag LOCUS_09510 982 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 2095 1193 gene locus_tag LOCUS_09520 2095 1193 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_09520 2344 3459 gene locus_tag LOCUS_09530 gene dprA 2344 3459 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_09530 3479 5878 gene locus_tag LOCUS_09540 gene topA 3479 5878 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_09540 5875 7215 gene locus_tag LOCUS_09550 gene trmFO 5875 7215 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_09550 7215 8186 gene locus_tag LOCUS_09560 7215 8186 CDS product Ppx/GppA phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391641.1 protein_id gnl|my_center|LOCUS_09560 8183 11188 gene locus_tag LOCUS_09570 gene glnE 8183 11188 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943989.1 protein_id gnl|my_center|LOCUS_09570 11227 12138 gene locus_tag LOCUS_09580 11227 12138 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_09580 12235 12453 gene locus_tag LOCUS_09590 12235 12453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 12628 13089 gene locus_tag LOCUS_09600 12628 13089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 13836 13132 gene locus_tag LOCUS_09610 13836 13132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 14168 13833 gene locus_tag LOCUS_09620 14168 13833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 14490 14182 gene locus_tag LOCUS_09630 14490 14182 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_09630 15490 14603 gene locus_tag LOCUS_09640 15490 14603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 16422 15490 gene locus_tag LOCUS_09650 16422 15490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 17376 16585 gene locus_tag LOCUS_09660 17376 16585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 17702 17385 gene locus_tag LOCUS_09670 17702 17385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 17804 18286 gene locus_tag LOCUS_09680 gene htdZ 17804 18286 CDS product 3-hydroxyacyl-thioester dehydratase HtdZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400912.1 protein_id gnl|my_center|LOCUS_09680 18844 18311 gene locus_tag LOCUS_09690 18844 18311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 18941 20281 gene locus_tag LOCUS_09700 18941 20281 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_09700 20278 21621 gene locus_tag LOCUS_09710 20278 21621 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225440.1 protein_id gnl|my_center|LOCUS_09710 21618 22574 gene locus_tag LOCUS_09720 21618 22574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 22898 22593 gene locus_tag LOCUS_09730 22898 22593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 24994 23228 gene locus_tag LOCUS_09740 24994 23228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 25377 34688 gene locus_tag LOCUS_09750 25377 34688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 34800 35822 gene locus_tag LOCUS_09760 34800 35822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 36218 35832 gene locus_tag LOCUS_09770 36218 35832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 37214 36372 gene locus_tag LOCUS_09780 37214 36372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence023 399 665 gene locus_tag LOCUS_09790 399 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 824 967 gene locus_tag LOCUS_09800 824 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1938 961 gene locus_tag LOCUS_09810 gene gshB 1938 961 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143671.1 protein_id gnl|my_center|LOCUS_09810 2698 1994 gene locus_tag LOCUS_09820 2698 1994 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809442.1 protein_id gnl|my_center|LOCUS_09820 3546 2698 gene locus_tag LOCUS_09830 3546 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3597 4367 gene locus_tag LOCUS_09840 3597 4367 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 protein_id gnl|my_center|LOCUS_09840 4452 4661 gene locus_tag LOCUS_09850 4452 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4719 5240 gene locus_tag LOCUS_09860 4719 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 5249 6991 gene locus_tag LOCUS_09870 gene dnaG 5249 6991 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_09870 7049 8704 gene locus_tag LOCUS_09880 gene rpoD 7049 8704 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_09880 8761 8837 gene locus_tag LOCUS_t00180 8761 8837 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8888 9613 gene locus_tag LOCUS_09890 8888 9613 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938748.1 protein_id gnl|my_center|LOCUS_09890 10290 10769 gene locus_tag LOCUS_09900 gene mraZ 10290 10769 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_09900 10832 11824 gene locus_tag LOCUS_09910 gene rsmH 10832 11824 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_09910 11821 12183 gene locus_tag LOCUS_09920 11821 12183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 12180 14156 gene locus_tag LOCUS_09930 12180 14156 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_09930 14156 15661 gene locus_tag LOCUS_09940 14156 15661 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172762.1 protein_id gnl|my_center|LOCUS_09940 15658 17091 gene locus_tag LOCUS_09950 15658 17091 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_09950 17091 18167 gene locus_tag LOCUS_09960 gene mraY 17091 18167 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_09960 18167 19501 gene locus_tag LOCUS_09970 gene murD 18167 19501 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_09970 19498 20673 gene locus_tag LOCUS_09980 gene ftsW 19498 20673 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_09980 20670 21797 gene locus_tag LOCUS_09990 gene murG 20670 21797 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_09990 21913 23313 gene locus_tag LOCUS_10000 gene murC 21913 23313 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_10000 23322 24245 gene locus_tag LOCUS_10010 gene murB 23322 24245 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_10010 24242 25078 gene locus_tag LOCUS_10020 24242 25078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 25093 26325 gene locus_tag LOCUS_10030 gene ftsA 25093 26325 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_10030 26412 27590 gene locus_tag LOCUS_10040 gene ftsZ 26412 27590 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943688.1 protein_id gnl|my_center|LOCUS_10040 27841 29580 gene locus_tag LOCUS_10050 27841 29580 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_10050 29587 29997 gene locus_tag LOCUS_10060 29587 29997 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_10060 30265 30005 gene locus_tag LOCUS_10070 30265 30005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 30359 30691 gene locus_tag LOCUS_10080 30359 30691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 31831 30698 gene locus_tag LOCUS_10090 31831 30698 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_10090 32763 31828 gene locus_tag LOCUS_10100 32763 31828 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050545102.1 protein_id gnl|my_center|LOCUS_10100 32852 33826 gene locus_tag LOCUS_10110 32852 33826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 33829 35322 gene locus_tag LOCUS_10120 gene glpK 33829 35322 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_10120 35319 36164 gene locus_tag LOCUS_10130 35319 36164 CDS product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726751.1 protein_id gnl|my_center|LOCUS_10130 36600 36352 gene locus_tag LOCUS_10140 36600 36352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence024 492 220 gene locus_tag LOCUS_10150 492 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 491 1261 gene locus_tag LOCUS_10160 491 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1278 1994 gene locus_tag LOCUS_10170 1278 1994 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_10170 3813 2005 gene locus_tag LOCUS_10180 3813 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4583 3939 gene locus_tag LOCUS_10190 gene queC 4583 3939 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496801.1 protein_id gnl|my_center|LOCUS_10190 4656 5411 gene locus_tag LOCUS_10200 4656 5411 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582685.1 protein_id gnl|my_center|LOCUS_10200 5869 5432 gene locus_tag LOCUS_10210 5869 5432 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930086.1 protein_id gnl|my_center|LOCUS_10210 7062 5866 gene locus_tag LOCUS_10220 7062 5866 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089076.1 protein_id gnl|my_center|LOCUS_10220 7851 7108 gene locus_tag LOCUS_10230 7851 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 8480 7836 gene locus_tag LOCUS_10240 8480 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 8639 10432 gene locus_tag LOCUS_10250 8639 10432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 10519 11901 gene locus_tag LOCUS_10260 10519 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 11982 13007 gene locus_tag LOCUS_10270 11982 13007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 13291 14457 gene locus_tag LOCUS_10280 13291 14457 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695173.1 protein_id gnl|my_center|LOCUS_10280 15093 14569 gene locus_tag LOCUS_10290 15093 14569 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111489.1 protein_id gnl|my_center|LOCUS_10290 17063 15135 gene locus_tag LOCUS_10300 17063 15135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 17138 17785 gene locus_tag LOCUS_10310 17138 17785 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113262.1 protein_id gnl|my_center|LOCUS_10310 17990 18526 gene locus_tag LOCUS_10320 17990 18526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 18539 19354 gene locus_tag LOCUS_10330 18539 19354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 19364 19885 gene locus_tag LOCUS_10340 19364 19885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 19882 20277 gene locus_tag LOCUS_10350 19882 20277 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259041.1 protein_id gnl|my_center|LOCUS_10350 20285 21160 gene locus_tag LOCUS_10360 gene argB 20285 21160 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940826.1 protein_id gnl|my_center|LOCUS_10360 21180 22364 gene locus_tag LOCUS_10370 21180 22364 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940827.1 protein_id gnl|my_center|LOCUS_10370 22917 23159 gene locus_tag LOCUS_10380 22917 23159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 23236 23637 gene locus_tag LOCUS_10390 23236 23637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 25312 23645 gene locus_tag LOCUS_10400 25312 23645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 26049 25309 gene locus_tag LOCUS_10410 26049 25309 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_10410 27515 26046 gene locus_tag LOCUS_10420 27515 26046 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943972.1 protein_id gnl|my_center|LOCUS_10420 28471 27533 gene locus_tag LOCUS_10430 28471 27533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 28461 29702 gene locus_tag LOCUS_10440 28461 29702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 29686 31107 gene locus_tag LOCUS_10450 29686 31107 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002146066.1 protein_id gnl|my_center|LOCUS_10450 31154 32140 gene locus_tag LOCUS_10460 31154 32140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 32377 32162 gene locus_tag LOCUS_10470 32377 32162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 32575 33777 gene locus_tag LOCUS_10480 32575 33777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 34129 33785 gene locus_tag LOCUS_10490 34129 33785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 34370 34116 gene locus_tag LOCUS_10500 34370 34116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 34813 34451 gene locus_tag LOCUS_10510 34813 34451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 35465 34860 gene locus_tag LOCUS_10520 35465 34860 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312247.1 protein_id gnl|my_center|LOCUS_10520 <36505 35527 gene locus_tag LOCUS_10530 <36505 35527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193484207.1:questin oxidase family protein >Feature sequence025 1053 358 gene locus_tag LOCUS_10540 1053 358 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870007.1 protein_id gnl|my_center|LOCUS_10540 1615 1043 gene locus_tag LOCUS_10550 1615 1043 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869234.1 protein_id gnl|my_center|LOCUS_10550 1688 3721 gene locus_tag LOCUS_10560 1688 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 5284 3878 gene locus_tag LOCUS_10570 5284 3878 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_10570 6408 5281 gene locus_tag LOCUS_10580 6408 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 7291 6410 gene locus_tag LOCUS_10590 7291 6410 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_10590 7418 7711 gene locus_tag LOCUS_10600 7418 7711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 7786 7971 gene locus_tag LOCUS_10610 7786 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 8061 8354 gene locus_tag LOCUS_10620 gene groES 8061 8354 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_10620 8368 9996 gene locus_tag LOCUS_10630 gene groL 8368 9996 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_10630 10135 11484 gene locus_tag LOCUS_10640 gene ffh 10135 11484 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_10640 11475 11732 gene locus_tag LOCUS_10650 gene rpsP 11475 11732 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638633.1 protein_id gnl|my_center|LOCUS_10650 11757 11993 gene locus_tag LOCUS_10660 11757 11993 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_10660 12019 12525 gene locus_tag LOCUS_10670 gene rimM 12019 12525 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728341.1 protein_id gnl|my_center|LOCUS_10670 12529 13266 gene locus_tag LOCUS_10680 gene trmD 12529 13266 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_10680 13453 14013 gene locus_tag LOCUS_10690 13453 14013 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904383.1 protein_id gnl|my_center|LOCUS_10690 14027 14377 gene locus_tag LOCUS_10700 gene rplS 14027 14377 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_10700 14764 14384 gene locus_tag LOCUS_10710 14764 14384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 15778 14777 gene locus_tag LOCUS_10720 15778 14777 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_10720 16767 15775 gene locus_tag LOCUS_10730 16767 15775 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966002.1 protein_id gnl|my_center|LOCUS_10730 17594 16764 gene locus_tag LOCUS_10740 17594 16764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 19311 17566 gene locus_tag LOCUS_10750 19311 17566 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_10750 20214 19714 gene locus_tag LOCUS_10760 20214 19714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 20444 20226 gene locus_tag LOCUS_10770 20444 20226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 20536 21837 gene locus_tag LOCUS_10780 gene miaB 20536 21837 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114512.1 protein_id gnl|my_center|LOCUS_10780 21830 22372 gene locus_tag LOCUS_10790 21830 22372 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256454.1 protein_id gnl|my_center|LOCUS_10790 24204 22327 gene locus_tag LOCUS_10800 24204 22327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 24425 26512 gene locus_tag LOCUS_10810 24425 26512 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140814.1 protein_id gnl|my_center|LOCUS_10810 27334 26588 gene locus_tag LOCUS_10820 27334 26588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 27795 27331 gene locus_tag LOCUS_10830 27795 27331 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106151.1 protein_id gnl|my_center|LOCUS_10830 28736 27783 gene locus_tag LOCUS_10840 28736 27783 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545174.1 protein_id gnl|my_center|LOCUS_10840 28821 29942 gene locus_tag LOCUS_10850 28821 29942 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868783.1 protein_id gnl|my_center|LOCUS_10850 30892 29945 gene locus_tag LOCUS_10860 30892 29945 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140943.1 protein_id gnl|my_center|LOCUS_10860 30948 32348 gene locus_tag LOCUS_10870 30948 32348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 33178 32345 gene locus_tag LOCUS_10880 33178 32345 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_10880 33388 33194 gene locus_tag LOCUS_10890 33388 33194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 34206 33385 gene locus_tag LOCUS_10900 34206 33385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 34694 34281 gene locus_tag LOCUS_10910 34694 34281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 35122 34694 gene locus_tag LOCUS_10920 35122 34694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 35801 35163 gene locus_tag LOCUS_10930 35801 35163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 36214 35798 gene locus_tag LOCUS_10940 36214 35798 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812328.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence026 <1 2251 gene locus_tag LOCUS_10950 <1 2251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967947.1:adenylate/guanylate cyclase domain-containing protein 2338 3753 gene locus_tag LOCUS_10960 gene lnt 2338 3753 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083613.1 protein_id gnl|my_center|LOCUS_10960 4187 3798 gene locus_tag LOCUS_10970 4187 3798 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216361.1 protein_id gnl|my_center|LOCUS_10970 4599 4267 gene locus_tag LOCUS_10980 4599 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 5932 4649 gene locus_tag LOCUS_10990 5932 4649 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731195.1 protein_id gnl|my_center|LOCUS_10990 6365 5949 gene locus_tag LOCUS_11000 6365 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 6736 6416 gene locus_tag LOCUS_11010 6736 6416 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255937.1 protein_id gnl|my_center|LOCUS_11010 8166 6841 gene locus_tag LOCUS_11020 8166 6841 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459193.1 protein_id gnl|my_center|LOCUS_11020 8290 9288 gene locus_tag LOCUS_11030 8290 9288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069660.1 protein_id gnl|my_center|LOCUS_11030 10681 9296 gene locus_tag LOCUS_11040 10681 9296 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392880.1 protein_id gnl|my_center|LOCUS_11040 12478 10694 gene locus_tag LOCUS_11050 12478 10694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 13351 12638 gene locus_tag LOCUS_11060 13351 12638 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143260.1 protein_id gnl|my_center|LOCUS_11060 13815 13348 gene locus_tag LOCUS_11070 13815 13348 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388632.1 protein_id gnl|my_center|LOCUS_11070 14705 13812 gene locus_tag LOCUS_11080 14705 13812 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022700.1 protein_id gnl|my_center|LOCUS_11080 16297 14702 gene locus_tag LOCUS_11090 16297 14702 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404208.1 protein_id gnl|my_center|LOCUS_11090 16337 16774 gene locus_tag LOCUS_11100 gene mscL 16337 16774 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_11100 17794 16778 gene locus_tag LOCUS_11110 17794 16778 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_11110 18647 17856 gene locus_tag LOCUS_11120 18647 17856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 19045 18653 gene locus_tag LOCUS_11130 19045 18653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 19787 19035 gene locus_tag LOCUS_11140 19787 19035 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_11140 22144 19895 gene locus_tag LOCUS_11150 22144 19895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 22887 22474 gene locus_tag LOCUS_11160 22887 22474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 23219 22884 gene locus_tag LOCUS_11170 23219 22884 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_11170 24537 23554 gene locus_tag LOCUS_11180 24537 23554 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390645.1 protein_id gnl|my_center|LOCUS_11180 25226 24555 gene locus_tag LOCUS_11190 25226 24555 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_11190 25335 26081 gene locus_tag LOCUS_11200 25335 26081 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545422.1 protein_id gnl|my_center|LOCUS_11200 27443 26094 gene locus_tag LOCUS_11210 27443 26094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 27488 29002 gene locus_tag LOCUS_11220 27488 29002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 29112 32096 gene locus_tag LOCUS_11230 29112 32096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 32118 32816 gene locus_tag LOCUS_11240 32118 32816 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140670.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence027 1433 258 gene locus_tag LOCUS_11250 1433 258 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258129.1 protein_id gnl|my_center|LOCUS_11250 2629 1433 gene locus_tag LOCUS_11260 gene frc 2629 1433 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972395.1 protein_id gnl|my_center|LOCUS_11260 4179 2629 gene locus_tag LOCUS_11270 4179 2629 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048176.1 protein_id gnl|my_center|LOCUS_11270 5336 4179 gene locus_tag LOCUS_11280 5336 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 5398 6432 gene locus_tag LOCUS_11290 5398 6432 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922313.1 protein_id gnl|my_center|LOCUS_11290 6516 7670 gene locus_tag LOCUS_11300 6516 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 8934 7792 gene locus_tag LOCUS_11310 8934 7792 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_11310 9061 9246 gene locus_tag LOCUS_11320 9061 9246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 10056 9622 gene locus_tag LOCUS_11330 10056 9622 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100368.1 protein_id gnl|my_center|LOCUS_11330 11012 10053 gene locus_tag LOCUS_11340 11012 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 11569 11012 gene locus_tag LOCUS_11350 11569 11012 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 protein_id gnl|my_center|LOCUS_11350 11596 12369 gene locus_tag LOCUS_11360 11596 12369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 14547 12373 gene locus_tag LOCUS_11370 14547 12373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 15176 14769 gene locus_tag LOCUS_11380 gene tolR 15176 14769 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546534.1 protein_id gnl|my_center|LOCUS_11380 15813 15160 gene locus_tag LOCUS_11390 15813 15160 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_11390 17064 15838 gene locus_tag LOCUS_11400 17064 15838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 17195 17058 gene locus_tag LOCUS_11410 17195 17058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 17633 17214 gene locus_tag LOCUS_11420 17633 17214 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 protein_id gnl|my_center|LOCUS_11420 18805 17630 gene locus_tag LOCUS_11430 18805 17630 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 protein_id gnl|my_center|LOCUS_11430 19095 18814 gene locus_tag LOCUS_11440 19095 18814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 19429 19097 gene locus_tag LOCUS_11450 19429 19097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 19495 19836 gene locus_tag LOCUS_11460 19495 19836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 20230 19850 gene locus_tag LOCUS_11470 20230 19850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 20373 21521 gene locus_tag LOCUS_11480 20373 21521 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126863657.1 protein_id gnl|my_center|LOCUS_11480 21521 22312 gene locus_tag LOCUS_11490 21521 22312 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395936.1 protein_id gnl|my_center|LOCUS_11490 22989 22321 gene locus_tag LOCUS_11500 22989 22321 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064926.1 protein_id gnl|my_center|LOCUS_11500 23651 22986 gene locus_tag LOCUS_11510 23651 22986 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064926.1 protein_id gnl|my_center|LOCUS_11510 23856 24380 gene locus_tag LOCUS_11520 23856 24380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 24396 25190 gene locus_tag LOCUS_11530 24396 25190 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104327.1 protein_id gnl|my_center|LOCUS_11530 26590 25187 gene locus_tag LOCUS_11540 26590 25187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 27378 26569 gene locus_tag LOCUS_11550 27378 26569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 27436 28233 gene locus_tag LOCUS_11560 27436 28233 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446742.1 protein_id gnl|my_center|LOCUS_11560 29023 28346 gene locus_tag LOCUS_11570 29023 28346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 29177 29944 gene locus_tag LOCUS_11580 29177 29944 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392302.1 protein_id gnl|my_center|LOCUS_11580 29934 30698 gene locus_tag LOCUS_11590 29934 30698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence028 4804 2393 gene locus_tag LOCUS_11600 gene gyrB 4804 2393 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072047.1 protein_id gnl|my_center|LOCUS_11600 6099 4984 gene locus_tag LOCUS_11610 gene dnaN 6099 4984 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_11610 7590 6289 gene locus_tag LOCUS_11620 gene dnaA 7590 6289 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940678.1 protein_id gnl|my_center|LOCUS_11620 7856 9202 gene locus_tag LOCUS_11630 gene hemL 7856 9202 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_11630 9203 9433 gene locus_tag LOCUS_11640 9203 9433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 9456 9761 gene locus_tag LOCUS_11650 9456 9761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 9761 10447 gene locus_tag LOCUS_11660 9761 10447 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_11660 10508 10858 gene locus_tag LOCUS_11670 10508 10858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 11136 12011 gene locus_tag LOCUS_11680 11136 12011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 12014 12463 gene locus_tag LOCUS_11690 12014 12463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 13238 12474 gene locus_tag LOCUS_11700 13238 12474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 13413 13862 gene locus_tag LOCUS_11710 13413 13862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 13918 14994 gene locus_tag LOCUS_11720 gene purM 13918 14994 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876828.1 protein_id gnl|my_center|LOCUS_11720 14998 15453 gene locus_tag LOCUS_11730 14998 15453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 15970 15740 gene locus_tag LOCUS_11740 15970 15740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 16076 18139 gene locus_tag LOCUS_11750 16076 18139 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_11750 18132 18731 gene locus_tag LOCUS_11760 18132 18731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 19508 18735 gene locus_tag LOCUS_11770 19508 18735 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114596.1 protein_id gnl|my_center|LOCUS_11770 20297 19518 gene locus_tag LOCUS_11780 gene gloB 20297 19518 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143329.1 protein_id gnl|my_center|LOCUS_11780 21148 20306 gene locus_tag LOCUS_11790 21148 20306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 22334 21165 gene locus_tag LOCUS_11800 22334 21165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 23901 22417 gene locus_tag LOCUS_11810 23901 22417 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027210.1 protein_id gnl|my_center|LOCUS_11810 24822 24220 gene locus_tag LOCUS_11820 24822 24220 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640290.1 protein_id gnl|my_center|LOCUS_11820 25141 24851 gene locus_tag LOCUS_11830 25141 24851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 25251 26114 gene locus_tag LOCUS_11840 25251 26114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 26757 26077 gene locus_tag LOCUS_11850 gene pgeF 26757 26077 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_11850 26790 26936 gene locus_tag LOCUS_11860 26790 26936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 27406 26939 gene locus_tag LOCUS_11870 27406 26939 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932428.1 protein_id gnl|my_center|LOCUS_11870 28290 27403 gene locus_tag LOCUS_11880 28290 27403 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_11880 29075 28287 gene locus_tag LOCUS_11890 29075 28287 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_11890 30058 29072 gene locus_tag LOCUS_11900 30058 29072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_11900 29763 29857 gene locus_tag LOCUS_t00190 29763 29857 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 30648 30055 gene locus_tag LOCUS_11910 30648 30055 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546496.1 protein_id gnl|my_center|LOCUS_11910 31052 30648 gene locus_tag LOCUS_11920 gene hrp1 31052 30648 CDS product hypoxic response protein Hrp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413598.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence029 951 1286 gene locus_tag LOCUS_11930 951 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1554 2243 gene locus_tag LOCUS_11940 1554 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 5257 2159 gene locus_tag LOCUS_11950 5257 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 6342 5500 gene locus_tag LOCUS_11960 6342 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 8123 6339 gene locus_tag LOCUS_11970 8123 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 9055 8207 gene locus_tag LOCUS_11980 9055 8207 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886781.1 protein_id gnl|my_center|LOCUS_11980 9124 9891 gene locus_tag LOCUS_11990 9124 9891 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 protein_id gnl|my_center|LOCUS_11990 10757 9900 gene locus_tag LOCUS_12000 10757 9900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 12257 10761 gene locus_tag LOCUS_12010 12257 10761 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051218217.1 protein_id gnl|my_center|LOCUS_12010 12566 12303 gene locus_tag LOCUS_12020 12566 12303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 12713 13384 gene locus_tag LOCUS_12030 12713 13384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 15036 13621 gene locus_tag LOCUS_12040 gene hemG 15036 13621 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122777.1 protein_id gnl|my_center|LOCUS_12040 15953 15033 gene locus_tag LOCUS_12050 15953 15033 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728851.1 protein_id gnl|my_center|LOCUS_12050 16987 15962 gene locus_tag LOCUS_12060 16987 15962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 17072 18247 gene locus_tag LOCUS_12070 17072 18247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 18341 18748 gene locus_tag LOCUS_12080 18341 18748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 20049 18814 gene locus_tag LOCUS_12090 gene glgC 20049 18814 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227648.1 protein_id gnl|my_center|LOCUS_12090 20990 20055 gene locus_tag LOCUS_12100 20990 20055 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640552.1 protein_id gnl|my_center|LOCUS_12100 21874 21050 gene locus_tag LOCUS_12110 21874 21050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 21949 22146 gene locus_tag LOCUS_12120 21949 22146 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360265.1 protein_id gnl|my_center|LOCUS_12120 22150 22953 gene locus_tag LOCUS_12130 gene lpxA 22150 22953 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941664.1 protein_id gnl|my_center|LOCUS_12130 23021 23422 gene locus_tag LOCUS_12140 23021 23422 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938350.1 protein_id gnl|my_center|LOCUS_12140 23428 25416 gene locus_tag LOCUS_12150 23428 25416 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_12150 25422 25871 gene locus_tag LOCUS_12160 25422 25871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 25871 26161 gene locus_tag LOCUS_12170 25871 26161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 26158 26478 gene locus_tag LOCUS_12180 26158 26478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 26663 27379 gene locus_tag LOCUS_12190 26663 27379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 27385 28050 gene locus_tag LOCUS_12200 27385 28050 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_12200 28052 28741 gene locus_tag LOCUS_12210 gene ccsA 28052 28741 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_12210 28738 28875 gene locus_tag LOCUS_12220 28738 28875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 29126 29581 gene locus_tag LOCUS_12230 29126 29581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence030 835 287 gene locus_tag LOCUS_12240 835 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 932 1279 gene locus_tag LOCUS_12250 932 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 2433 1225 gene locus_tag LOCUS_12260 gene cofH 2433 1225 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060905.1 protein_id gnl|my_center|LOCUS_12260 3643 2441 gene locus_tag LOCUS_12270 3643 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12270 4553 3717 gene locus_tag LOCUS_12280 4553 3717 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_12280 5747 4638 gene locus_tag LOCUS_12290 5747 4638 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681602.1 protein_id gnl|my_center|LOCUS_12290 7267 5870 gene locus_tag LOCUS_12300 gene atoC 7267 5870 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125282.1 protein_id gnl|my_center|LOCUS_12300 8654 7281 gene locus_tag LOCUS_12310 8654 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 9738 8644 gene locus_tag LOCUS_12320 9738 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 10167 9814 gene locus_tag LOCUS_12330 10167 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 10262 11248 gene locus_tag LOCUS_12340 gene meaB 10262 11248 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_12340 11248 11967 gene locus_tag LOCUS_12350 11248 11967 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402807.1 protein_id gnl|my_center|LOCUS_12350 12037 15501 gene locus_tag LOCUS_12360 12037 15501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 15516 15590 gene locus_tag LOCUS_t00200 15516 15590 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 15691 15990 gene locus_tag LOCUS_12370 15691 15990 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626089.1 protein_id gnl|my_center|LOCUS_12370 16509 16111 gene locus_tag LOCUS_12380 16509 16111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 16670 16936 gene locus_tag LOCUS_12390 16670 16936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 17407 16940 gene locus_tag LOCUS_12400 17407 16940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 18637 17522 gene locus_tag LOCUS_12410 18637 17522 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064805.1 protein_id gnl|my_center|LOCUS_12410 19900 18647 gene locus_tag LOCUS_12420 19900 18647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 20439 19948 gene locus_tag LOCUS_12430 20439 19948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 20493 21869 gene locus_tag LOCUS_12440 gene tilS 20493 21869 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_12440 21889 23799 gene locus_tag LOCUS_12450 gene ftsH 21889 23799 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_12450 23837 24667 gene locus_tag LOCUS_12460 gene folP 23837 24667 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_12460 24664 25416 gene locus_tag LOCUS_12470 gene cdaA 24664 25416 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_12470 25413 26465 gene locus_tag LOCUS_12480 25413 26465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 26462 27847 gene locus_tag LOCUS_12490 gene glmM 26462 27847 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_12490 27844 28572 gene locus_tag LOCUS_12500 gene pdxJ 27844 28572 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772027.1 protein_id gnl|my_center|LOCUS_12500 28569 30101 gene locus_tag LOCUS_12510 28569 30101 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence031 1401 475 gene locus_tag LOCUS_12520 1401 475 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066484172.1 protein_id gnl|my_center|LOCUS_12520 1908 1447 gene locus_tag LOCUS_12530 1908 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 3192 2197 gene locus_tag LOCUS_12540 3192 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 3608 3366 gene locus_tag LOCUS_12550 3608 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 4164 3676 gene locus_tag LOCUS_12560 4164 3676 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_12560 4615 4349 gene locus_tag LOCUS_12570 4615 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 4979 5509 gene locus_tag LOCUS_12580 4979 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 5635 7533 gene locus_tag LOCUS_12590 5635 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 7730 7957 gene locus_tag LOCUS_12600 7730 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 7954 8346 gene locus_tag LOCUS_12610 7954 8346 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243822.1 protein_id gnl|my_center|LOCUS_12610 8441 8941 gene locus_tag LOCUS_12620 8441 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 8962 9645 gene locus_tag LOCUS_12630 8962 9645 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114590.1 protein_id gnl|my_center|LOCUS_12630 9775 9945 gene locus_tag LOCUS_12640 9775 9945 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942897.1 protein_id gnl|my_center|LOCUS_12640 9950 10987 gene locus_tag LOCUS_12650 9950 10987 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938354.1 protein_id gnl|my_center|LOCUS_12650 10984 11703 gene locus_tag LOCUS_12660 10984 11703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 11706 12455 gene locus_tag LOCUS_12670 11706 12455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 12443 13450 gene locus_tag LOCUS_12680 gene waaF 12443 13450 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526219.1 protein_id gnl|my_center|LOCUS_12680 13447 14262 gene locus_tag LOCUS_12690 13447 14262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 14259 15380 gene locus_tag LOCUS_12700 14259 15380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 15377 16273 gene locus_tag LOCUS_12710 15377 16273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 16273 17385 gene locus_tag LOCUS_12720 16273 17385 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_12720 17375 19009 gene locus_tag LOCUS_12730 17375 19009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 19006 19887 gene locus_tag LOCUS_12740 19006 19887 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_12740 19880 20833 gene locus_tag LOCUS_12750 19880 20833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 20830 22014 gene locus_tag LOCUS_12760 20830 22014 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_12760 22034 23437 gene locus_tag LOCUS_12770 22034 23437 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392197.1 protein_id gnl|my_center|LOCUS_12770 23439 24620 gene locus_tag LOCUS_12780 23439 24620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 24623 25693 gene locus_tag LOCUS_12790 24623 25693 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038728.1 protein_id gnl|my_center|LOCUS_12790 25690 26685 gene locus_tag LOCUS_12800 25690 26685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 26697 27566 gene locus_tag LOCUS_12810 26697 27566 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence032 826 1050 gene locus_tag LOCUS_12820 826 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1047 1355 gene locus_tag LOCUS_12830 1047 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 2286 1888 gene locus_tag LOCUS_12840 2286 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 2425 2871 gene locus_tag LOCUS_12850 2425 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 3620 3204 gene locus_tag LOCUS_12860 3620 3204 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142378.1 protein_id gnl|my_center|LOCUS_12860 3847 3617 gene locus_tag LOCUS_12870 3847 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 5389 4070 gene locus_tag LOCUS_12880 gene pyk 5389 4070 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393367.1 protein_id gnl|my_center|LOCUS_12880 6474 5464 gene locus_tag LOCUS_12890 6474 5464 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083827.1 protein_id gnl|my_center|LOCUS_12890 6764 7144 gene locus_tag LOCUS_12900 6764 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 7907 7035 gene locus_tag LOCUS_12910 7907 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 8010 9530 gene locus_tag LOCUS_12920 8010 9530 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088683.1 protein_id gnl|my_center|LOCUS_12920 9641 10027 gene locus_tag LOCUS_12930 9641 10027 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_12930 10084 11154 gene locus_tag LOCUS_12940 10084 11154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 12633 11164 gene locus_tag LOCUS_12950 12633 11164 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742093.1 protein_id gnl|my_center|LOCUS_12950 12709 14055 gene locus_tag LOCUS_12960 12709 14055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 15426 14065 gene locus_tag LOCUS_12970 gene hslU 15426 14065 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_12970 15995 15429 gene locus_tag LOCUS_12980 gene hslV 15995 15429 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_12980 16866 15970 gene locus_tag LOCUS_12990 gene xerC 16866 15970 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_12990 16876 17319 gene locus_tag LOCUS_13000 16876 17319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 17316 18836 gene locus_tag LOCUS_13010 17316 18836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 18841 20124 gene locus_tag LOCUS_13020 18841 20124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 20726 20917 gene locus_tag LOCUS_13030 20726 20917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 23764 21719 gene locus_tag LOCUS_13040 23764 21719 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404082.1 protein_id gnl|my_center|LOCUS_13040 24207 23704 gene locus_tag LOCUS_13050 24207 23704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 24276 24476 gene locus_tag LOCUS_13060 24276 24476 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_13060 24490 24696 gene locus_tag LOCUS_13070 24490 24696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 24702 26177 gene locus_tag LOCUS_13080 24702 26177 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104438.1 protein_id gnl|my_center|LOCUS_13080 26158 26979 gene locus_tag LOCUS_13090 26158 26979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence033 <1 2537 gene locus_tag LOCUS_13100 <1 2537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941931.1:carbamoyl-phosphate synthase large subunit 2534 4987 gene locus_tag LOCUS_13110 gene recG 2534 4987 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_13110 5305 5000 gene locus_tag LOCUS_13120 5305 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 5365 5616 gene locus_tag LOCUS_13130 5365 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 7357 6287 gene locus_tag LOCUS_13140 7357 6287 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_13140 8244 7354 gene locus_tag LOCUS_13150 8244 7354 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_13150 8875 8297 gene locus_tag LOCUS_13160 8875 8297 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063748799.1 protein_id gnl|my_center|LOCUS_13160 9010 10149 gene locus_tag LOCUS_13170 9010 10149 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228927.1 protein_id gnl|my_center|LOCUS_13170 10146 11054 gene locus_tag LOCUS_13180 10146 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 11051 11494 gene locus_tag LOCUS_13190 gene phnB 11051 11494 CDS product Dot/Icm type IV secretion system effector PhnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 protein_id gnl|my_center|LOCUS_13190 11517 11834 gene locus_tag LOCUS_13200 11517 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 13053 12004 gene locus_tag LOCUS_13210 13053 12004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 13214 14419 gene locus_tag LOCUS_13220 gene alaC 13214 14419 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931132.1 protein_id gnl|my_center|LOCUS_13220 14428 15741 gene locus_tag LOCUS_13230 14428 15741 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 protein_id gnl|my_center|LOCUS_13230 15795 16871 gene locus_tag LOCUS_13240 gene thrC 15795 16871 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546273.1 protein_id gnl|my_center|LOCUS_13240 16864 18096 gene locus_tag LOCUS_13250 16864 18096 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_13250 18109 19062 gene locus_tag LOCUS_13260 gene glpX 18109 19062 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214469.1 protein_id gnl|my_center|LOCUS_13260 19063 19842 gene locus_tag LOCUS_13270 19063 19842 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_13270 19844 20989 gene locus_tag LOCUS_13280 gene acdA 19844 20989 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_13280 20986 21231 gene locus_tag LOCUS_13290 20986 21231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 21228 22853 gene locus_tag LOCUS_13300 21228 22853 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_13300 22844 23257 gene locus_tag LOCUS_13310 22844 23257 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_13310 23261 24412 gene locus_tag LOCUS_13320 23261 24412 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229031.1 protein_id gnl|my_center|LOCUS_13320 24655 24398 gene locus_tag LOCUS_13330 24655 24398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 24796 25113 gene locus_tag LOCUS_13340 24796 25113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 26029 25115 gene locus_tag LOCUS_13350 26029 25115 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence034 1613 1188 gene locus_tag LOCUS_13360 1613 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1897 1610 gene locus_tag LOCUS_13370 1897 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 2021 2953 gene locus_tag LOCUS_13380 2021 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 2962 4077 gene locus_tag LOCUS_13390 2962 4077 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730665.1 protein_id gnl|my_center|LOCUS_13390 4579 4010 gene locus_tag LOCUS_13400 4579 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 5104 5790 gene locus_tag LOCUS_13410 5104 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 5865 6125 gene locus_tag LOCUS_13420 5865 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 6589 6131 gene locus_tag LOCUS_13430 6589 6131 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731409.1 protein_id gnl|my_center|LOCUS_13430 7477 6596 gene locus_tag LOCUS_13440 7477 6596 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975419.1 protein_id gnl|my_center|LOCUS_13440 8680 7505 gene locus_tag LOCUS_13450 8680 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 9048 8677 gene locus_tag LOCUS_13460 9048 8677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 9767 9042 gene locus_tag LOCUS_13470 9767 9042 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_13470 10993 9770 gene locus_tag LOCUS_13480 10993 9770 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_13480 11060 12079 gene locus_tag LOCUS_13490 11060 12079 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031370.1 protein_id gnl|my_center|LOCUS_13490 12150 12974 gene locus_tag LOCUS_13500 12150 12974 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235433858.1 protein_id gnl|my_center|LOCUS_13500 12978 13961 gene locus_tag LOCUS_13510 12978 13961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 14258 14004 gene locus_tag LOCUS_13520 14258 14004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 14381 15055 gene locus_tag LOCUS_13530 14381 15055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 15995 15060 gene locus_tag LOCUS_13540 15995 15060 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078606.1 protein_id gnl|my_center|LOCUS_13540 17264 16044 gene locus_tag LOCUS_13550 gene rpsA 17264 16044 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_13550 17350 18087 gene locus_tag LOCUS_13560 17350 18087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 19259 18129 gene locus_tag LOCUS_13570 19259 18129 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_13570 20434 19262 gene locus_tag LOCUS_13580 20434 19262 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_13580 20821 20438 gene locus_tag LOCUS_13590 20821 20438 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932868.1 protein_id gnl|my_center|LOCUS_13590 20970 21206 gene locus_tag LOCUS_13600 20970 21206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 21383 21234 gene locus_tag LOCUS_13610 21383 21234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 21681 22220 gene locus_tag LOCUS_13620 21681 22220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 23095 22235 gene locus_tag LOCUS_13630 23095 22235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 23166 23807 gene locus_tag LOCUS_13640 23166 23807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 24830 24015 gene locus_tag LOCUS_13650 24830 24015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence035 1809 718 gene locus_tag LOCUS_13660 1809 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 2941 1817 gene locus_tag LOCUS_13670 2941 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 3447 2938 gene locus_tag LOCUS_13680 3447 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 3482 4147 gene locus_tag LOCUS_13690 3482 4147 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_13690 4794 4150 gene locus_tag LOCUS_13700 4794 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 4956 5309 gene locus_tag LOCUS_13710 4956 5309 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083029.1 protein_id gnl|my_center|LOCUS_13710 6021 5314 gene locus_tag LOCUS_13720 6021 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 7196 6075 gene locus_tag LOCUS_13730 7196 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 7364 8395 gene locus_tag LOCUS_13740 7364 8395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 9350 8415 gene locus_tag LOCUS_13750 9350 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 9361 9723 gene locus_tag LOCUS_13760 9361 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 10028 9741 gene locus_tag LOCUS_13770 10028 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 11594 10362 gene locus_tag LOCUS_13780 11594 10362 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_13780 12295 11591 gene locus_tag LOCUS_13790 12295 11591 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_13790 13519 12302 gene locus_tag LOCUS_13800 13519 12302 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_13800 14959 13553 gene locus_tag LOCUS_13810 14959 13553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 15146 15397 gene locus_tag LOCUS_13820 15146 15397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 16937 15480 gene locus_tag LOCUS_13830 gene glnA 16937 15480 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_13830 17303 16965 gene locus_tag LOCUS_13840 17303 16965 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_13840 18844 17378 gene locus_tag LOCUS_13850 18844 17378 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_13850 19449 19024 gene locus_tag LOCUS_13860 19449 19024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 19573 19499 gene locus_tag LOCUS_t00210 19573 19499 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19779 20111 gene locus_tag LOCUS_13870 19779 20111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 20836 20183 gene locus_tag LOCUS_13880 gene rpe 20836 20183 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_13880 22247 20880 gene locus_tag LOCUS_13890 gene rsmB 22247 20880 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_13890 23176 22229 gene locus_tag LOCUS_13900 gene fmt 23176 22229 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_13900 23772 23200 gene locus_tag LOCUS_13910 gene def 23772 23200 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391097.1 protein_id gnl|my_center|LOCUS_13910 <25534 23777 gene locus_tag LOCUS_13920 <25534 23777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940804.1:primosomal protein N' >Feature sequence036 1734 163 gene locus_tag LOCUS_13930 1734 163 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056626.1 protein_id gnl|my_center|LOCUS_13930 2105 1833 gene locus_tag LOCUS_13940 2105 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 3776 2115 gene locus_tag LOCUS_13950 3776 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 3910 5007 gene locus_tag LOCUS_13960 3910 5007 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_13960 5364 5029 gene locus_tag LOCUS_13970 5364 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 5567 6526 gene locus_tag LOCUS_13980 5567 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 6523 7905 gene locus_tag LOCUS_13990 6523 7905 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_13990 8452 7868 gene locus_tag LOCUS_14000 8452 7868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 9693 8425 gene locus_tag LOCUS_14010 9693 8425 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950370.1 protein_id gnl|my_center|LOCUS_14010 9920 11404 gene locus_tag LOCUS_14020 9920 11404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 12676 11489 gene locus_tag LOCUS_14030 gene wecB 12676 11489 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734455.1 protein_id gnl|my_center|LOCUS_14030 13584 12673 gene locus_tag LOCUS_14040 13584 12673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 14336 13581 gene locus_tag LOCUS_14050 14336 13581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 14777 14337 gene locus_tag LOCUS_14060 14777 14337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 14933 16438 gene locus_tag LOCUS_14070 14933 16438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 17381 16464 gene locus_tag LOCUS_14080 17381 16464 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_14080 18150 17395 gene locus_tag LOCUS_14090 18150 17395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 19775 18207 gene locus_tag LOCUS_14100 19775 18207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 21181 19772 gene locus_tag LOCUS_14110 21181 19772 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942159.1 protein_id gnl|my_center|LOCUS_14110 21911 21192 gene locus_tag LOCUS_14120 21911 21192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 22044 23543 gene locus_tag LOCUS_14130 22044 23543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 23748 25322 gene locus_tag LOCUS_14140 gene lbuL 23748 25322 CDS product linear/branched/unsaturated fatty acid:CoA ligase LbuL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030732.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence037 225 491 gene locus_tag LOCUS_14150 225 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 525 851 gene locus_tag LOCUS_14160 525 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 986 1444 gene locus_tag LOCUS_14170 986 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 2539 1610 gene locus_tag LOCUS_14180 2539 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 3594 2536 gene locus_tag LOCUS_14190 3594 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 5324 3579 gene locus_tag LOCUS_14200 5324 3579 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 protein_id gnl|my_center|LOCUS_14200 6037 5321 gene locus_tag LOCUS_14210 6037 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 7770 6034 gene locus_tag LOCUS_14220 7770 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 9027 9176 gene locus_tag LOCUS_14230 9027 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 9920 9555 gene locus_tag LOCUS_14240 9920 9555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 10410 10129 gene locus_tag LOCUS_14250 10410 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 10794 10546 gene locus_tag LOCUS_14260 10794 10546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 12320 10818 gene locus_tag LOCUS_14270 12320 10818 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080787.1 protein_id gnl|my_center|LOCUS_14270 13114 12395 gene locus_tag LOCUS_14280 13114 12395 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633090.1 protein_id gnl|my_center|LOCUS_14280 13173 13544 gene locus_tag LOCUS_14290 13173 13544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 13919 13653 gene locus_tag LOCUS_14300 13919 13653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 14186 15337 gene locus_tag LOCUS_14310 14186 15337 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085196.1 protein_id gnl|my_center|LOCUS_14310 15337 16092 gene locus_tag LOCUS_14320 15337 16092 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_14320 16089 17843 gene locus_tag LOCUS_14330 16089 17843 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110557.1 protein_id gnl|my_center|LOCUS_14330 19583 18822 gene locus_tag LOCUS_14340 19583 18822 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419190.1 protein_id gnl|my_center|LOCUS_14340 21348 19633 gene locus_tag LOCUS_14350 21348 19633 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338456.1 protein_id gnl|my_center|LOCUS_14350 22659 21373 gene locus_tag LOCUS_14360 gene lipE 22659 21373 CDS product lipase LipE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731374.1 protein_id gnl|my_center|LOCUS_14360 22796 23593 gene locus_tag LOCUS_14370 22796 23593 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_14370 23761 24084 gene locus_tag LOCUS_14380 23761 24084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence038 <1 958 gene locus_tag LOCUS_14390 <1 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010901994.1:sulfatase-like hydrolase/transferase 1571 960 gene locus_tag LOCUS_14400 1571 960 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_14400 2076 1645 gene locus_tag LOCUS_14410 2076 1645 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_14410 2334 2540 gene locus_tag LOCUS_14420 2334 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 2736 2548 gene locus_tag LOCUS_14430 2736 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3344 2811 gene locus_tag LOCUS_14440 3344 2811 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 protein_id gnl|my_center|LOCUS_14440 3673 3341 gene locus_tag LOCUS_14450 3673 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 5065 3683 gene locus_tag LOCUS_14460 gene hpnE 5065 3683 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930255.1 protein_id gnl|my_center|LOCUS_14460 5958 5062 gene locus_tag LOCUS_14470 gene hpnD 5958 5062 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_14470 6854 5955 gene locus_tag LOCUS_14480 gene hpnC 6854 5955 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 protein_id gnl|my_center|LOCUS_14480 8092 6851 gene locus_tag LOCUS_14490 8092 6851 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101645.1 protein_id gnl|my_center|LOCUS_14490 10047 8089 gene locus_tag LOCUS_14500 gene shc 10047 8089 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_14500 10963 10049 gene locus_tag LOCUS_14510 gene mvk 10963 10049 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 protein_id gnl|my_center|LOCUS_14510 12243 10960 gene locus_tag LOCUS_14520 12243 10960 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256145.1 protein_id gnl|my_center|LOCUS_14520 13295 12240 gene locus_tag LOCUS_14530 gene fni 13295 12240 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 protein_id gnl|my_center|LOCUS_14530 14283 13288 gene locus_tag LOCUS_14540 14283 13288 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569800.1 protein_id gnl|my_center|LOCUS_14540 15260 14280 gene locus_tag LOCUS_14550 gene mvaD 15260 14280 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_14550 15969 15436 gene locus_tag LOCUS_14560 15969 15436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 16029 16790 gene locus_tag LOCUS_14570 16029 16790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 17166 16795 gene locus_tag LOCUS_14580 17166 16795 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140042.1 protein_id gnl|my_center|LOCUS_14580 18629 17214 gene locus_tag LOCUS_14590 18629 17214 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 protein_id gnl|my_center|LOCUS_14590 18811 18626 gene locus_tag LOCUS_14600 18811 18626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 20813 18813 gene locus_tag LOCUS_14610 20813 18813 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403289.1 protein_id gnl|my_center|LOCUS_14610 20914 22101 gene locus_tag LOCUS_14620 20914 22101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 23068 22049 gene locus_tag LOCUS_14630 23068 22049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 23080 24408 gene locus_tag LOCUS_14640 gene egtB 23080 24408 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027439.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence039 2754 1369 gene locus_tag LOCUS_14650 2754 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 2985 2845 gene locus_tag LOCUS_14660 2985 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 4115 3093 gene locus_tag LOCUS_14670 4115 3093 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730921.1 protein_id gnl|my_center|LOCUS_14670 4972 4112 gene locus_tag LOCUS_14680 4972 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 6336 5305 gene locus_tag LOCUS_14690 6336 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 8780 6408 gene locus_tag LOCUS_14700 8780 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 9151 8960 gene locus_tag LOCUS_14710 9151 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 9090 15317 gene locus_tag LOCUS_14720 9090 15317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 17845 15440 gene locus_tag LOCUS_14730 17845 15440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 18718 17939 gene locus_tag LOCUS_14740 18718 17939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776098.1 protein_id gnl|my_center|LOCUS_14740 19511 18723 gene locus_tag LOCUS_14750 19511 18723 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_14750 22043 19587 gene locus_tag LOCUS_14760 22043 19587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 22392 23309 gene locus_tag LOCUS_14770 22392 23309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 23341 23757 gene locus_tag LOCUS_14780 23341 23757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 23754 24776 gene locus_tag LOCUS_14790 23754 24776 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730921.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence040 2789 1518 gene locus_tag LOCUS_14800 2789 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 3961 2786 gene locus_tag LOCUS_14810 3961 2786 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392196.1 protein_id gnl|my_center|LOCUS_14810 6300 3958 gene locus_tag LOCUS_14820 6300 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 7439 6315 gene locus_tag LOCUS_14830 7439 6315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 9271 7772 gene locus_tag LOCUS_14840 9271 7772 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941440.1 protein_id gnl|my_center|LOCUS_14840 10623 9397 gene locus_tag LOCUS_14850 10623 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 12536 10815 gene locus_tag LOCUS_14860 12536 10815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 13292 14206 gene locus_tag LOCUS_14870 13292 14206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 14352 15140 gene locus_tag LOCUS_14880 14352 15140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 15146 16081 gene locus_tag LOCUS_14890 15146 16081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 16255 18816 gene locus_tag LOCUS_14900 16255 18816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 18846 19304 gene locus_tag LOCUS_14910 18846 19304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 19555 20517 gene locus_tag LOCUS_14920 19555 20517 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932009.1 protein_id gnl|my_center|LOCUS_14920 20518 22452 gene locus_tag LOCUS_14930 gene asnB 20518 22452 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_14930 22494 24341 gene locus_tag LOCUS_14940 22494 24341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence041 3626 2262 gene locus_tag LOCUS_14950 gene selA 3626 2262 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967004.1 protein_id gnl|my_center|LOCUS_14950 3720 4979 gene locus_tag LOCUS_14960 3720 4979 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_14960 4951 6258 gene locus_tag LOCUS_14970 4951 6258 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_14970 7751 6501 gene locus_tag LOCUS_14980 7751 6501 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_14980 7647 7931 gene locus_tag LOCUS_14990 7647 7931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 8263 7985 gene locus_tag LOCUS_15000 8263 7985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 8760 8347 gene locus_tag LOCUS_15010 8760 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 9292 8813 gene locus_tag LOCUS_15020 9292 8813 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942284.1 protein_id gnl|my_center|LOCUS_15020 9508 9305 gene locus_tag LOCUS_15030 gene iscX 9508 9305 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004698764.1 protein_id gnl|my_center|LOCUS_15030 11319 9508 gene locus_tag LOCUS_15040 gene hscA 11319 9508 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193590.1 protein_id gnl|my_center|LOCUS_15040 11947 11297 gene locus_tag LOCUS_15050 gene hscB 11947 11297 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072279.1 protein_id gnl|my_center|LOCUS_15050 12292 11972 gene locus_tag LOCUS_15060 12292 11972 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_15060 12703 12302 gene locus_tag LOCUS_15070 gene iscU 12703 12302 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192918.1 protein_id gnl|my_center|LOCUS_15070 13979 12717 gene locus_tag LOCUS_15080 13979 12717 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_15080 16934 14046 gene locus_tag LOCUS_15090 gene uvrA 16934 14046 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_15090 18310 16946 gene locus_tag LOCUS_15100 18310 16946 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_15100 19236 18307 gene locus_tag LOCUS_15110 19236 18307 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_15110 22787 19251 gene locus_tag LOCUS_15120 gene mfd 22787 19251 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_15120 23724 22798 gene locus_tag LOCUS_15130 23724 22798 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence042 495 725 gene locus_tag LOCUS_15140 495 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 722 1114 gene locus_tag LOCUS_15150 gene vapC1 722 1114 CDS product type II toxin-antitoxin system ribonuclease VapC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400580.1 protein_id gnl|my_center|LOCUS_15150 2307 1462 gene locus_tag LOCUS_15160 gene pssA 2307 1462 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_15160 2957 2304 gene locus_tag LOCUS_15170 2957 2304 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532543.1 protein_id gnl|my_center|LOCUS_15170 3978 2962 gene locus_tag LOCUS_15180 gene ilvC 3978 2962 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942554.1 protein_id gnl|my_center|LOCUS_15180 4496 3975 gene locus_tag LOCUS_15190 gene ilvN 4496 3975 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_15190 4725 4501 gene locus_tag LOCUS_15200 4725 4501 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546280.1 protein_id gnl|my_center|LOCUS_15200 5394 4762 gene locus_tag LOCUS_15210 gene tsaB 5394 4762 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_15210 6547 5465 gene locus_tag LOCUS_15220 gene rseP 6547 5465 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942559.1 protein_id gnl|my_center|LOCUS_15220 7370 6570 gene locus_tag LOCUS_15230 7370 6570 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_15230 8260 7499 gene locus_tag LOCUS_15240 8260 7499 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766989.1 protein_id gnl|my_center|LOCUS_15240 8817 8260 gene locus_tag LOCUS_15250 gene frr 8817 8260 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_15250 9512 8814 gene locus_tag LOCUS_15260 gene pyrH 9512 8814 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_15260 10200 9556 gene locus_tag LOCUS_15270 gene tsf 10200 9556 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_15270 10994 10197 gene locus_tag LOCUS_15280 gene rpsB 10994 10197 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_15280 12417 11083 gene locus_tag LOCUS_15290 gene rho 12417 11083 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_15290 13533 12565 gene locus_tag LOCUS_15300 13533 12565 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_15300 14462 13536 gene locus_tag LOCUS_15310 14462 13536 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808857.1 protein_id gnl|my_center|LOCUS_15310 14397 14612 gene locus_tag LOCUS_15320 14397 14612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 15462 14668 gene locus_tag LOCUS_15330 15462 14668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 15989 15459 gene locus_tag LOCUS_15340 15989 15459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 17320 16019 gene locus_tag LOCUS_15350 gene tolB 17320 16019 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_15350 18396 17317 gene locus_tag LOCUS_15360 18396 17317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 18826 18401 gene locus_tag LOCUS_15370 gene tolR 18826 18401 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_15370 19590 18829 gene locus_tag LOCUS_15380 gene tolQ 19590 18829 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_15380 19746 20756 gene locus_tag LOCUS_15390 gene gap 19746 20756 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_15390 20770 21960 gene locus_tag LOCUS_15400 20770 21960 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_15400 21957 22724 gene locus_tag LOCUS_15410 gene tpiA 21957 22724 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_15410 22721 23119 gene locus_tag LOCUS_15420 22721 23119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 23179 23264 gene locus_tag LOCUS_t00220 23179 23264 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 23529 23245 gene locus_tag LOCUS_15430 23529 23245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence043 705 472 gene locus_tag LOCUS_15440 705 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 808 4293 gene locus_tag LOCUS_15450 gene metH 808 4293 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271582.1 protein_id gnl|my_center|LOCUS_15450 4377 6119 gene locus_tag LOCUS_15460 4377 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 6137 6469 gene locus_tag LOCUS_15470 6137 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 8825 6924 gene locus_tag LOCUS_15480 8825 6924 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330711.1 protein_id gnl|my_center|LOCUS_15480 11095 8825 gene locus_tag LOCUS_15490 11095 8825 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119377.1 protein_id gnl|my_center|LOCUS_15490 11299 11538 gene locus_tag LOCUS_15500 11299 11538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 12006 11674 gene locus_tag LOCUS_15510 12006 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 12319 11984 gene locus_tag LOCUS_15520 12319 11984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 13927 12482 gene locus_tag LOCUS_15530 13927 12482 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_15530 15994 13985 gene locus_tag LOCUS_15540 15994 13985 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence044 1676 936 gene locus_tag LOCUS_15550 1676 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 2905 1622 gene locus_tag LOCUS_15560 2905 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 3398 2907 gene locus_tag LOCUS_15570 3398 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 4250 3402 gene locus_tag LOCUS_15580 4250 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 5370 4330 gene locus_tag LOCUS_15590 5370 4330 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_15590 5525 7414 gene locus_tag LOCUS_15600 5525 7414 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_15600 7432 8214 gene locus_tag LOCUS_15610 7432 8214 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_15610 10093 8216 gene locus_tag LOCUS_15620 10093 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 11469 10090 gene locus_tag LOCUS_15630 gene radA 11469 10090 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_15630 11459 12712 gene locus_tag LOCUS_15640 gene bioF 11459 12712 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_15640 12709 14064 gene locus_tag LOCUS_15650 gene bioA 12709 14064 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939829.1 protein_id gnl|my_center|LOCUS_15650 14061 14711 gene locus_tag LOCUS_15660 gene bioD 14061 14711 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880330.1 protein_id gnl|my_center|LOCUS_15660 15876 14713 gene locus_tag LOCUS_15670 gene larC 15876 14713 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940817.1 protein_id gnl|my_center|LOCUS_15670 16018 16326 gene locus_tag LOCUS_15680 gene dksA 16018 16326 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_15680 16323 17189 gene locus_tag LOCUS_15690 gene galU 16323 17189 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817120.1 protein_id gnl|my_center|LOCUS_15690 17922 17365 gene locus_tag LOCUS_15700 17922 17365 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_15700 19319 17964 gene locus_tag LOCUS_15710 19319 17964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 19521 19817 gene locus_tag LOCUS_15720 19521 19817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 20096 19827 gene locus_tag LOCUS_15730 20096 19827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 20315 20388 gene locus_tag LOCUS_t00230 20315 20388 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20854 20447 gene locus_tag LOCUS_15740 20854 20447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 21060 20878 gene locus_tag LOCUS_15750 21060 20878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 21661 21302 gene locus_tag LOCUS_15760 21661 21302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence045 1423 2589 gene locus_tag LOCUS_15770 1423 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 4812 2659 gene locus_tag LOCUS_15780 4812 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 7041 4927 gene locus_tag LOCUS_15790 7041 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 7314 8288 gene locus_tag LOCUS_15800 7314 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 8555 9100 gene locus_tag LOCUS_15810 gene rfbC 8555 9100 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807148.1 protein_id gnl|my_center|LOCUS_15810 9981 9109 gene locus_tag LOCUS_15820 9981 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 11616 10288 gene locus_tag LOCUS_15830 11616 10288 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384203.1 protein_id gnl|my_center|LOCUS_15830 13013 11631 gene locus_tag LOCUS_15840 13013 11631 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_15840 13126 13362 gene locus_tag LOCUS_15850 13126 13362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 13362 13757 gene locus_tag LOCUS_15860 13362 13757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 15274 13775 gene locus_tag LOCUS_15870 15274 13775 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950408.1 protein_id gnl|my_center|LOCUS_15870 16128 15271 gene locus_tag LOCUS_15880 16128 15271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 17370 16231 gene locus_tag LOCUS_15890 17370 16231 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 protein_id gnl|my_center|LOCUS_15890 17948 17367 gene locus_tag LOCUS_15900 17948 17367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 17991 18131 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19321 18401 gene locus_tag LOCUS_15910 19321 18401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 20242 19325 gene locus_tag LOCUS_15920 20242 19325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393401.1 protein_id gnl|my_center|LOCUS_15920 21264 20239 gene locus_tag LOCUS_15930 21264 20239 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339091.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence046 2115 2339 gene locus_tag LOCUS_15940 2115 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 2906 2553 gene locus_tag LOCUS_15950 2906 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 3513 2920 gene locus_tag LOCUS_15960 3513 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 6890 3594 gene locus_tag LOCUS_15970 6890 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 7628 7089 gene locus_tag LOCUS_15980 7628 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 9056 8151 gene locus_tag LOCUS_15990 9056 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 11239 9026 gene locus_tag LOCUS_16000 11239 9026 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426795.1 protein_id gnl|my_center|LOCUS_16000 11391 12317 gene locus_tag LOCUS_16010 11391 12317 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731198.1 protein_id gnl|my_center|LOCUS_16010 12329 13105 gene locus_tag LOCUS_16020 12329 13105 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_16020 13121 13972 gene locus_tag LOCUS_16030 13121 13972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 14073 14495 gene locus_tag LOCUS_16040 14073 14495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 14492 15328 gene locus_tag LOCUS_16050 14492 15328 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839946.1 protein_id gnl|my_center|LOCUS_16050 16333 15737 gene locus_tag LOCUS_16060 gene recR 16333 15737 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_16060 16676 16344 gene locus_tag LOCUS_16070 16676 16344 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_16070 18266 16689 gene locus_tag LOCUS_16080 18266 16689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 18565 18479 gene locus_tag LOCUS_t00240 18565 18479 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18681 19523 gene locus_tag LOCUS_16090 18681 19523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 19510 20976 gene locus_tag LOCUS_16100 19510 20976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence047 666 328 gene locus_tag LOCUS_16110 666 328 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 protein_id gnl|my_center|LOCUS_16110 1387 1878 gene locus_tag LOCUS_16120 1387 1878 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793169.1 protein_id gnl|my_center|LOCUS_16120 1890 2867 gene locus_tag LOCUS_16130 gene fliM 1890 2867 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_16130 2883 3173 gene locus_tag LOCUS_16140 2883 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 3170 3394 gene locus_tag LOCUS_16150 3170 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 3391 4059 gene locus_tag LOCUS_16160 gene fliP 3391 4059 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_16160 4056 4325 gene locus_tag LOCUS_16170 gene fliQ 4056 4325 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367302.1 protein_id gnl|my_center|LOCUS_16170 4328 5107 gene locus_tag LOCUS_16180 gene fliR 4328 5107 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940492.1 protein_id gnl|my_center|LOCUS_16180 5100 6173 gene locus_tag LOCUS_16190 gene flhB 5100 6173 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392310.1 protein_id gnl|my_center|LOCUS_16190 6361 8460 gene locus_tag LOCUS_16200 gene flhA 6361 8460 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_16200 8450 9454 gene locus_tag LOCUS_16210 gene flhF 8450 9454 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946725.1 protein_id gnl|my_center|LOCUS_16210 9476 10321 gene locus_tag LOCUS_16220 9476 10321 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943679.1 protein_id gnl|my_center|LOCUS_16220 10324 11124 gene locus_tag LOCUS_16230 gene whiG 10324 11124 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_16230 11124 11297 gene locus_tag LOCUS_16240 11124 11297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 11315 11785 gene locus_tag LOCUS_16250 11315 11785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 11886 12638 gene locus_tag LOCUS_16260 gene flgF 11886 12638 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_16260 12635 13423 gene locus_tag LOCUS_16270 gene flgG 12635 13423 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_16270 13578 14516 gene locus_tag LOCUS_16280 13578 14516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 14516 15193 gene locus_tag LOCUS_16290 14516 15193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 15181 16341 gene locus_tag LOCUS_16300 15181 16341 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_16300 16338 16688 gene locus_tag LOCUS_16310 16338 16688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 16685 16990 gene locus_tag LOCUS_16320 16685 16990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 16994 17485 gene locus_tag LOCUS_16330 16994 17485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 17488 18909 gene locus_tag LOCUS_16340 gene flgK 17488 18909 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_16340 18906 19820 gene locus_tag LOCUS_16350 18906 19820 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405348.1 protein_id gnl|my_center|LOCUS_16350 20016 20258 gene locus_tag LOCUS_16360 gene csrA 20016 20258 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943667.1 protein_id gnl|my_center|LOCUS_16360 20231 20692 gene locus_tag LOCUS_16370 gene fliW 20231 20692 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460794.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence048 288 1487 gene locus_tag LOCUS_16380 288 1487 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402774.1 protein_id gnl|my_center|LOCUS_16380 2494 1484 gene locus_tag LOCUS_16390 2494 1484 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_16390 2591 2809 gene locus_tag LOCUS_16400 gene infA 2591 2809 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006583256.1 protein_id gnl|my_center|LOCUS_16400 5131 3053 gene locus_tag LOCUS_16410 5131 3053 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257258.1 protein_id gnl|my_center|LOCUS_16410 5690 5427 gene locus_tag LOCUS_16420 5690 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 5770 7020 gene locus_tag LOCUS_16430 5770 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 7047 7913 gene locus_tag LOCUS_16440 7047 7913 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_16440 7941 8723 gene locus_tag LOCUS_16450 7941 8723 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259198.1 protein_id gnl|my_center|LOCUS_16450 8758 9492 gene locus_tag LOCUS_16460 8758 9492 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_16460 9485 9682 gene locus_tag LOCUS_16470 9485 9682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 9682 10599 gene locus_tag LOCUS_16480 9682 10599 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723881.1 protein_id gnl|my_center|LOCUS_16480 10592 11440 gene locus_tag LOCUS_16490 10592 11440 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_16490 11437 13032 gene locus_tag LOCUS_16500 11437 13032 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969590.1 protein_id gnl|my_center|LOCUS_16500 13184 14146 gene locus_tag LOCUS_16510 13184 14146 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258665.1 protein_id gnl|my_center|LOCUS_16510 14168 15562 gene locus_tag LOCUS_16520 14168 15562 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088880.1 protein_id gnl|my_center|LOCUS_16520 15630 16124 gene locus_tag LOCUS_16530 15630 16124 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_16530 16091 16777 gene locus_tag LOCUS_16540 16091 16777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 17489 16839 gene locus_tag LOCUS_16550 17489 16839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 17981 18235 gene locus_tag LOCUS_16560 17981 18235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 18800 18432 gene locus_tag LOCUS_16570 18800 18432 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974579.1 protein_id gnl|my_center|LOCUS_16570 19286 18909 gene locus_tag LOCUS_16580 19286 18909 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_16580 19663 19289 gene locus_tag LOCUS_16590 gene crcB 19663 19289 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_16590 20799 19660 gene locus_tag LOCUS_16600 20799 19660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence049 3528 1630 gene locus_tag LOCUS_16610 3528 1630 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898626.1 protein_id gnl|my_center|LOCUS_16610 3931 5616 gene locus_tag LOCUS_16620 3931 5616 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 protein_id gnl|my_center|LOCUS_16620 5630 7318 gene locus_tag LOCUS_16630 5630 7318 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 protein_id gnl|my_center|LOCUS_16630 7315 8037 gene locus_tag LOCUS_16640 7315 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 8034 8456 gene locus_tag LOCUS_16650 8034 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 8446 8775 gene locus_tag LOCUS_16660 8446 8775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 8785 9993 gene locus_tag LOCUS_16670 8785 9993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 10450 9998 gene locus_tag LOCUS_16680 10450 9998 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079384.1 protein_id gnl|my_center|LOCUS_16680 11517 10501 gene locus_tag LOCUS_16690 11517 10501 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_16690 11818 12930 gene locus_tag LOCUS_16700 11818 12930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 12930 13565 gene locus_tag LOCUS_16710 12930 13565 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224283.1 protein_id gnl|my_center|LOCUS_16710 13655 14701 gene locus_tag LOCUS_16720 13655 14701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 14941 16428 gene locus_tag LOCUS_16730 gene mdoG 14941 16428 CDS product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367217.1 protein_id gnl|my_center|LOCUS_16730 16425 19031 gene locus_tag LOCUS_16740 gene mdoH 16425 19031 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103448.1 protein_id gnl|my_center|LOCUS_16740 19028 20296 gene locus_tag LOCUS_16750 19028 20296 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037351.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence050 80 1876 gene locus_tag LOCUS_16760 80 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 3482 1884 gene locus_tag LOCUS_16770 3482 1884 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_16770 3575 4462 gene locus_tag LOCUS_16780 3575 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 5622 4465 gene locus_tag LOCUS_16790 5622 4465 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_16790 6281 5832 gene locus_tag LOCUS_16800 gene rplI 6281 5832 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_16800 6579 6298 gene locus_tag LOCUS_16810 6579 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 6975 6580 gene locus_tag LOCUS_16820 6975 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 7546 6956 gene locus_tag LOCUS_16830 gene pth 7546 6956 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_16830 8242 7550 gene locus_tag LOCUS_16840 8242 7550 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_16840 9212 8268 gene locus_tag LOCUS_16850 9212 8268 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_16850 9310 9238 gene locus_tag LOCUS_t00250 9310 9238 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9355 10236 gene locus_tag LOCUS_16860 9355 10236 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_16860 10307 10379 gene locus_tag LOCUS_t00260 10307 10379 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10505 10687 gene locus_tag LOCUS_16870 10505 10687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 11301 10759 gene locus_tag LOCUS_16880 11301 10759 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_16880 11408 14146 gene locus_tag LOCUS_16890 11408 14146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 14202 14609 gene locus_tag LOCUS_16900 14202 14609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 15209 14619 gene locus_tag LOCUS_16910 gene ppiA 15209 14619 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099061.1 protein_id gnl|my_center|LOCUS_16910 15652 15281 gene locus_tag LOCUS_16920 15652 15281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 16857 15649 gene locus_tag LOCUS_16930 16857 15649 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_16930 16925 17806 gene locus_tag LOCUS_16940 16925 17806 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_16940 17803 18291 gene locus_tag LOCUS_16950 17803 18291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 20141 18288 gene locus_tag LOCUS_16960 20141 18288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 20321 20213 gene locus_tag LOCUS_r00010 20321 20213 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence051 432 1712 gene locus_tag LOCUS_16970 432 1712 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545697.1 protein_id gnl|my_center|LOCUS_16970 1801 2979 gene locus_tag LOCUS_16980 1801 2979 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_16980 2982 3716 gene locus_tag LOCUS_16990 2982 3716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393834.1 protein_id gnl|my_center|LOCUS_16990 3713 4939 gene locus_tag LOCUS_17000 3713 4939 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_17000 5186 4950 gene locus_tag LOCUS_17010 5186 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 5100 5453 gene locus_tag LOCUS_17020 5100 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 6442 5465 gene locus_tag LOCUS_17030 6442 5465 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614684.1 protein_id gnl|my_center|LOCUS_17030 8297 6606 gene locus_tag LOCUS_17040 8297 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 9217 8294 gene locus_tag LOCUS_17050 9217 8294 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869030.1 protein_id gnl|my_center|LOCUS_17050 10194 9214 gene locus_tag LOCUS_17060 10194 9214 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_17060 11126 10188 gene locus_tag LOCUS_17070 11126 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17070 12034 11111 gene locus_tag LOCUS_17080 12034 11111 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869033.1 protein_id gnl|my_center|LOCUS_17080 13406 12105 gene locus_tag LOCUS_17090 13406 12105 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869034.1 protein_id gnl|my_center|LOCUS_17090 13527 14195 gene locus_tag LOCUS_17100 13527 14195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 15321 14242 gene locus_tag LOCUS_17110 15321 14242 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640168.1 protein_id gnl|my_center|LOCUS_17110 15724 15347 gene locus_tag LOCUS_17120 15724 15347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 16107 16793 gene locus_tag LOCUS_17130 16107 16793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 16801 17499 gene locus_tag LOCUS_17140 16801 17499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 17516 18196 gene locus_tag LOCUS_17150 17516 18196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 19270 18200 gene locus_tag LOCUS_17160 19270 18200 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920865.1 protein_id gnl|my_center|LOCUS_17160 <20324 19282 gene locus_tag LOCUS_17170 <20324 19282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966466.1:cytochrome P450 >Feature sequence052 273 629 gene locus_tag LOCUS_17180 273 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 2111 690 gene locus_tag LOCUS_17190 2111 690 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730023.1 protein_id gnl|my_center|LOCUS_17190 2236 4608 gene locus_tag LOCUS_17200 2236 4608 CDS product glycerol-3-phosphate 1-O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917012.1 protein_id gnl|my_center|LOCUS_17200 5939 4674 gene locus_tag LOCUS_17210 5939 4674 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027746.1 protein_id gnl|my_center|LOCUS_17210 6037 6699 gene locus_tag LOCUS_17220 6037 6699 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_17220 6696 7178 gene locus_tag LOCUS_17230 6696 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 7188 8948 gene locus_tag LOCUS_17240 gene dauA 7188 8948 CDS product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817880.1 protein_id gnl|my_center|LOCUS_17240 9293 8952 gene locus_tag LOCUS_17250 9293 8952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 10107 9304 gene locus_tag LOCUS_17260 10107 9304 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225423.1 protein_id gnl|my_center|LOCUS_17260 11632 10109 gene locus_tag LOCUS_17270 11632 10109 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_17270 11948 11634 gene locus_tag LOCUS_17280 11948 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 12900 11959 gene locus_tag LOCUS_17290 12900 11959 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246890.1 protein_id gnl|my_center|LOCUS_17290 13214 12897 gene locus_tag LOCUS_17300 13214 12897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 13294 14010 gene locus_tag LOCUS_17310 13294 14010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 14010 14567 gene locus_tag LOCUS_17320 14010 14567 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867630.1 protein_id gnl|my_center|LOCUS_17320 14569 14799 gene locus_tag LOCUS_17330 14569 14799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 14819 15877 gene locus_tag LOCUS_17340 14819 15877 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545833.1 protein_id gnl|my_center|LOCUS_17340 15874 16614 gene locus_tag LOCUS_17350 15874 16614 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_17350 17119 16619 gene locus_tag LOCUS_17360 17119 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 17471 17133 gene locus_tag LOCUS_17370 17471 17133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 18112 17600 gene locus_tag LOCUS_17380 18112 17600 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486300.1 protein_id gnl|my_center|LOCUS_17380 18277 18504 gene locus_tag LOCUS_17390 18277 18504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 18672 18875 gene locus_tag LOCUS_17400 18672 18875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 18955 19614 gene locus_tag LOCUS_17410 18955 19614 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393845.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence053 <1 930 gene locus_tag LOCUS_17420 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730231.1:phosphotransferase family protein 934 1842 gene locus_tag LOCUS_17430 934 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 2426 1851 gene locus_tag LOCUS_17440 2426 1851 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_17440 2711 2502 gene locus_tag LOCUS_17450 2711 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 2781 3260 gene locus_tag LOCUS_17460 2781 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 3395 3973 gene locus_tag LOCUS_17470 3395 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 4528 5742 gene locus_tag LOCUS_17480 4528 5742 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466839.1 protein_id gnl|my_center|LOCUS_17480 5742 6869 gene locus_tag LOCUS_17490 5742 6869 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898921.1 protein_id gnl|my_center|LOCUS_17490 6866 7312 gene locus_tag LOCUS_17500 6866 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17500 7309 7815 gene locus_tag LOCUS_17510 7309 7815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17510 7815 8936 gene locus_tag LOCUS_17520 7815 8936 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419199.1 protein_id gnl|my_center|LOCUS_17520 8927 10084 gene locus_tag LOCUS_17530 8927 10084 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897320.1 protein_id gnl|my_center|LOCUS_17530 10074 10889 gene locus_tag LOCUS_17540 10074 10889 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_17540 10902 11336 gene locus_tag LOCUS_17550 10902 11336 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086784.1 protein_id gnl|my_center|LOCUS_17550 11336 13003 gene locus_tag LOCUS_17560 11336 13003 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729261.1 protein_id gnl|my_center|LOCUS_17560 12979 14148 gene locus_tag LOCUS_17570 12979 14148 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414139.1 protein_id gnl|my_center|LOCUS_17570 14148 14633 gene locus_tag LOCUS_17580 14148 14633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 14630 15754 gene locus_tag LOCUS_17590 14630 15754 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_17590 17675 15768 gene locus_tag LOCUS_17600 17675 15768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 18920 18150 gene locus_tag LOCUS_17610 18920 18150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 19150 19938 gene locus_tag LOCUS_17620 19150 19938 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043677442.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence054 1335 706 gene locus_tag LOCUS_17630 1335 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 2266 1346 gene locus_tag LOCUS_17640 2266 1346 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_17640 3035 2259 gene locus_tag LOCUS_17650 3035 2259 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_17650 4169 3039 gene locus_tag LOCUS_17660 4169 3039 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_17660 4734 4291 gene locus_tag LOCUS_17670 4734 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 4832 7081 gene locus_tag LOCUS_17680 gene scpA 4832 7081 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887727.1 protein_id gnl|my_center|LOCUS_17680 7062 8114 gene locus_tag LOCUS_17690 gene meaB 7062 8114 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_17690 9451 8174 gene locus_tag LOCUS_17700 9451 8174 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040369.1 protein_id gnl|my_center|LOCUS_17700 9576 11573 gene locus_tag LOCUS_17710 9576 11573 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428541.1 protein_id gnl|my_center|LOCUS_17710 11673 12596 gene locus_tag LOCUS_17720 11673 12596 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897127.1 protein_id gnl|my_center|LOCUS_17720 12593 14179 gene locus_tag LOCUS_17730 12593 14179 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965432.1 protein_id gnl|my_center|LOCUS_17730 14271 14501 gene locus_tag LOCUS_17740 14271 14501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 14498 14662 gene locus_tag LOCUS_17750 14498 14662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 16406 14664 gene locus_tag LOCUS_17760 16406 14664 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_17760 17226 16447 gene locus_tag LOCUS_17770 17226 16447 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_17770 17332 17565 gene locus_tag LOCUS_17780 17332 17565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877189.1 protein_id gnl|my_center|LOCUS_17780 18535 17810 gene locus_tag LOCUS_17790 18535 17810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 19588 18539 gene locus_tag LOCUS_17800 19588 18539 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222030.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence055 172 1725 gene locus_tag LOCUS_17810 172 1725 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_17810 1722 3023 gene locus_tag LOCUS_17820 1722 3023 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932301.1 protein_id gnl|my_center|LOCUS_17820 3020 3619 gene locus_tag LOCUS_17830 3020 3619 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932300.1 protein_id gnl|my_center|LOCUS_17830 3588 4718 gene locus_tag LOCUS_17840 gene leuB 3588 4718 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255951.1 protein_id gnl|my_center|LOCUS_17840 4768 5790 gene locus_tag LOCUS_17850 4768 5790 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957862.1 protein_id gnl|my_center|LOCUS_17850 5792 6529 gene locus_tag LOCUS_17860 gene truA 5792 6529 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_17860 7011 6523 gene locus_tag LOCUS_17870 7011 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 7733 7017 gene locus_tag LOCUS_17880 7733 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 7820 8674 gene locus_tag LOCUS_17890 7820 8674 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_17890 8685 10376 gene locus_tag LOCUS_17900 gene recN 8685 10376 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_17900 10388 10855 gene locus_tag LOCUS_17910 10388 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 10877 11245 gene locus_tag LOCUS_17920 10877 11245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 11319 11392 gene locus_tag LOCUS_t00270 11319 11392 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12050 12688 gene locus_tag LOCUS_17930 12050 12688 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039400.1 protein_id gnl|my_center|LOCUS_17930 12663 13166 gene locus_tag LOCUS_17940 12663 13166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 13179 13658 gene locus_tag LOCUS_17950 13179 13658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 13660 13986 gene locus_tag LOCUS_17960 13660 13986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 14261 15442 gene locus_tag LOCUS_17970 14261 15442 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928673.1 protein_id gnl|my_center|LOCUS_17970 15442 16515 gene locus_tag LOCUS_17980 15442 16515 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083269077.1 protein_id gnl|my_center|LOCUS_17980 16508 17821 gene locus_tag LOCUS_17990 16508 17821 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975627.1 protein_id gnl|my_center|LOCUS_17990 17818 19587 gene locus_tag LOCUS_18000 17818 19587 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence056 370 1107 gene locus_tag LOCUS_18010 370 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2098 1094 gene locus_tag LOCUS_18020 gene glpX 2098 1094 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632957.1 protein_id gnl|my_center|LOCUS_18020 3015 2095 gene locus_tag LOCUS_18030 3015 2095 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383967.1 protein_id gnl|my_center|LOCUS_18030 3300 3043 gene locus_tag LOCUS_18040 3300 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 3797 3297 gene locus_tag LOCUS_18050 3797 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 4850 3807 gene locus_tag LOCUS_18060 4850 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 6646 4847 gene locus_tag LOCUS_18070 6646 4847 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_18070 8397 6646 gene locus_tag LOCUS_18080 8397 6646 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_18080 8959 8453 gene locus_tag LOCUS_18090 8959 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 10374 8956 gene locus_tag LOCUS_18100 10374 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 10486 10857 gene locus_tag LOCUS_18110 10486 10857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 10862 11344 gene locus_tag LOCUS_18120 10862 11344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 12057 11359 gene locus_tag LOCUS_18130 12057 11359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 12949 12128 gene locus_tag LOCUS_18140 12949 12128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 13305 12946 gene locus_tag LOCUS_18150 gene copC 13305 12946 CDS product copper homeostasis periplasmic binding protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530770.1 protein_id gnl|my_center|LOCUS_18150 14228 13302 gene locus_tag LOCUS_18160 14228 13302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 15616 14645 gene locus_tag LOCUS_18170 15616 14645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 16375 15671 gene locus_tag LOCUS_18180 16375 15671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 17933 16383 gene locus_tag LOCUS_18190 17933 16383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence057 1596 742 gene locus_tag LOCUS_18200 1596 742 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_18200 1697 2338 gene locus_tag LOCUS_18210 1697 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 2349 3434 gene locus_tag LOCUS_18220 2349 3434 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_18220 3677 3447 gene locus_tag LOCUS_18230 3677 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 4792 3782 gene locus_tag LOCUS_18240 4792 3782 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545473.1 protein_id gnl|my_center|LOCUS_18240 5287 4796 gene locus_tag LOCUS_18250 5287 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 5679 5284 gene locus_tag LOCUS_18260 5679 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 5748 6050 gene locus_tag LOCUS_18270 5748 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 7883 6333 gene locus_tag LOCUS_18280 gene fadD4 7883 6333 CDS product fatty-acid--CoA ligase FadD4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726785.1 protein_id gnl|my_center|LOCUS_18280 8864 7929 gene locus_tag LOCUS_18290 8864 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 9147 12362 gene locus_tag LOCUS_18300 9147 12362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 14028 12388 gene locus_tag LOCUS_18310 14028 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 15477 14134 gene locus_tag LOCUS_18320 15477 14134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 17117 15501 gene locus_tag LOCUS_18330 17117 15501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 19213 17360 gene locus_tag LOCUS_18340 gene ilvB 19213 17360 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149674780.1 protein_id gnl|my_center|LOCUS_18340 19278 19631 gene locus_tag LOCUS_18350 19278 19631 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057535.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence058 303 1181 gene locus_tag LOCUS_18360 303 1181 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_18360 1287 1685 gene locus_tag LOCUS_18370 1287 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 1682 2023 gene locus_tag LOCUS_18380 1682 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 2020 2592 gene locus_tag LOCUS_18390 2020 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 2589 3611 gene locus_tag LOCUS_18400 2589 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 3752 4132 gene locus_tag LOCUS_18410 3752 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 4177 4851 gene locus_tag LOCUS_18420 gene tmk 4177 4851 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942869.1 protein_id gnl|my_center|LOCUS_18420 4848 5855 gene locus_tag LOCUS_18430 gene holB 4848 5855 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_18430 5852 6688 gene locus_tag LOCUS_18440 5852 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 6702 8237 gene locus_tag LOCUS_18450 gene metG 6702 8237 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_18450 8234 9034 gene locus_tag LOCUS_18460 8234 9034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 9171 9040 gene locus_tag LOCUS_18470 9171 9040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 10004 9186 gene locus_tag LOCUS_18480 10004 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 10859 10011 gene locus_tag LOCUS_18490 10859 10011 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813578.1 protein_id gnl|my_center|LOCUS_18490 11196 10864 gene locus_tag LOCUS_18500 11196 10864 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198127.1 protein_id gnl|my_center|LOCUS_18500 11746 11264 gene locus_tag LOCUS_18510 11746 11264 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_18510 12044 11760 gene locus_tag LOCUS_18520 12044 11760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 12140 12979 gene locus_tag LOCUS_18530 12140 12979 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880637.1 protein_id gnl|my_center|LOCUS_18530 13569 13015 gene locus_tag LOCUS_18540 13569 13015 CDS product polyhydroxyalkanoate synthesis regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405394.1 protein_id gnl|my_center|LOCUS_18540 13663 14475 gene locus_tag LOCUS_18550 13663 14475 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142937.1 protein_id gnl|my_center|LOCUS_18550 15270 14485 gene locus_tag LOCUS_18560 gene pyrF 15270 14485 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942107.1 protein_id gnl|my_center|LOCUS_18560 16976 15267 gene locus_tag LOCUS_18570 16976 15267 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_18570 17302 16973 gene locus_tag LOCUS_18580 17302 16973 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699221.1 protein_id gnl|my_center|LOCUS_18580 17414 18274 gene locus_tag LOCUS_18590 17414 18274 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867336.1 protein_id gnl|my_center|LOCUS_18590 <19127 18278 gene locus_tag LOCUS_18600 <19127 18278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005065932.1:diiron oxygenase >Feature sequence059 1393 2280 gene locus_tag LOCUS_18610 1393 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2411 2884 gene locus_tag LOCUS_18620 2411 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 2941 3288 gene locus_tag LOCUS_18630 2941 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 4273 3305 gene locus_tag LOCUS_18640 4273 3305 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942544.1 protein_id gnl|my_center|LOCUS_18640 5021 4284 gene locus_tag LOCUS_18650 5021 4284 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914047.1 protein_id gnl|my_center|LOCUS_18650 5872 5057 gene locus_tag LOCUS_18660 5872 5057 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942545.1 protein_id gnl|my_center|LOCUS_18660 7205 5862 gene locus_tag LOCUS_18670 7205 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942546.1 protein_id gnl|my_center|LOCUS_18670 7608 7189 gene locus_tag LOCUS_18680 7608 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 7734 9962 gene locus_tag LOCUS_18690 7734 9962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 9959 10630 gene locus_tag LOCUS_18700 9959 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 10627 11835 gene locus_tag LOCUS_18710 10627 11835 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869050.1 protein_id gnl|my_center|LOCUS_18710 12586 12035 gene locus_tag LOCUS_18720 12586 12035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 14041 12608 gene locus_tag LOCUS_18730 gene cysS 14041 12608 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_18730 16009 14048 gene locus_tag LOCUS_18740 gene acs 16009 14048 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140163.1 protein_id gnl|my_center|LOCUS_18740 16935 16048 gene locus_tag LOCUS_18750 16935 16048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 17339 16932 gene locus_tag LOCUS_18760 17339 16932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 17459 18682 gene locus_tag LOCUS_18770 17459 18682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence060 304 1104 gene locus_tag LOCUS_18780 304 1104 CDS product DUF4394 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928849.1 protein_id gnl|my_center|LOCUS_18780 1101 1691 gene locus_tag LOCUS_18790 1101 1691 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141762.1 protein_id gnl|my_center|LOCUS_18790 1696 2403 gene locus_tag LOCUS_18800 1696 2403 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141763.1 protein_id gnl|my_center|LOCUS_18800 3842 2409 gene locus_tag LOCUS_18810 3842 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 3920 4102 gene locus_tag LOCUS_18820 3920 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 4115 4306 gene locus_tag LOCUS_18830 4115 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 5648 4254 gene locus_tag LOCUS_18840 gene der 5648 4254 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_18840 6403 5648 gene locus_tag LOCUS_18850 gene era 6403 5648 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_18850 8670 6544 gene locus_tag LOCUS_18860 8670 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 9380 8682 gene locus_tag LOCUS_18870 gene rnc 9380 8682 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938733.1 protein_id gnl|my_center|LOCUS_18870 10687 9377 gene locus_tag LOCUS_18880 gene mtaB 10687 9377 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_18880 11742 10684 gene locus_tag LOCUS_18890 gene mnmA 11742 10684 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_18890 12881 11745 gene locus_tag LOCUS_18900 12881 11745 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257333.1 protein_id gnl|my_center|LOCUS_18900 14524 12908 gene locus_tag LOCUS_18910 gene cimA 14524 12908 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_18910 15741 14521 gene locus_tag LOCUS_18920 15741 14521 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_18920 17238 15823 gene locus_tag LOCUS_18930 17238 15823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 17334 18389 gene locus_tag LOCUS_18940 17334 18389 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104216.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence061 <1 769 gene locus_tag LOCUS_18950 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087631.1:carbonic anhydrase 1152 775 gene locus_tag LOCUS_18960 1152 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 1866 2201 gene locus_tag LOCUS_18970 1866 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 2890 5856 gene locus_tag LOCUS_18980 2890 5856 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742126.1 protein_id gnl|my_center|LOCUS_18980 7579 5885 gene locus_tag LOCUS_18990 7579 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 10041 7600 gene locus_tag LOCUS_19000 10041 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 11194 10388 gene locus_tag LOCUS_19010 11194 10388 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808019.1 protein_id gnl|my_center|LOCUS_19010 11590 11198 gene locus_tag LOCUS_19020 11590 11198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 13532 11598 gene locus_tag LOCUS_19030 13532 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 13954 13529 gene locus_tag LOCUS_19040 13954 13529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 15099 13951 gene locus_tag LOCUS_19050 15099 13951 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_19050 16320 15106 gene locus_tag LOCUS_19060 16320 15106 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105511.1 protein_id gnl|my_center|LOCUS_19060 16460 17581 gene locus_tag LOCUS_19070 16460 17581 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_19070 <18259 17618 gene locus_tag LOCUS_19080 <18259 17618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003107935.1:CmcJ/NvfI family oxidoreductase >Feature sequence062 438 280 gene locus_tag LOCUS_19090 438 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 542 1000 gene locus_tag LOCUS_19100 542 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 1499 1008 gene locus_tag LOCUS_19110 1499 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 1595 2377 gene locus_tag LOCUS_19120 1595 2377 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407737.1 protein_id gnl|my_center|LOCUS_19120 2374 2832 gene locus_tag LOCUS_19130 2374 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 3892 2798 gene locus_tag LOCUS_19140 3892 2798 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938186.1 protein_id gnl|my_center|LOCUS_19140 5070 3889 gene locus_tag LOCUS_19150 5070 3889 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481009.1 protein_id gnl|my_center|LOCUS_19150 5118 6545 gene locus_tag LOCUS_19160 5118 6545 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 protein_id gnl|my_center|LOCUS_19160 6542 7810 gene locus_tag LOCUS_19170 6542 7810 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257030.1 protein_id gnl|my_center|LOCUS_19170 7925 11146 gene locus_tag LOCUS_19180 7925 11146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 11308 11478 gene locus_tag LOCUS_19190 11308 11478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 11475 13064 gene locus_tag LOCUS_19200 11475 13064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 13121 13966 gene locus_tag LOCUS_19210 13121 13966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 14017 15240 gene locus_tag LOCUS_19220 14017 15240 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_19220 16081 15245 gene locus_tag LOCUS_19230 gene fabG 16081 15245 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392464.1 protein_id gnl|my_center|LOCUS_19230 16163 16426 gene locus_tag LOCUS_19240 16163 16426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 17248 16526 gene locus_tag LOCUS_19250 17248 16526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 17820 17311 gene locus_tag LOCUS_19260 17820 17311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence063 376 1398 gene locus_tag LOCUS_19270 376 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2756 1491 gene locus_tag LOCUS_19280 2756 1491 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941087.1 protein_id gnl|my_center|LOCUS_19280 3453 2770 gene locus_tag LOCUS_19290 gene flgD 3453 2770 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020450.1 protein_id gnl|my_center|LOCUS_19290 4006 3542 gene locus_tag LOCUS_19300 4006 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 5517 4963 gene locus_tag LOCUS_19310 5517 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 5942 5508 gene locus_tag LOCUS_19320 5942 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 7273 5942 gene locus_tag LOCUS_19330 7273 5942 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941081.1 protein_id gnl|my_center|LOCUS_19330 7899 7270 gene locus_tag LOCUS_19340 7899 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 8917 7892 gene locus_tag LOCUS_19350 gene fliG 8917 7892 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941079.1 protein_id gnl|my_center|LOCUS_19350 10459 8921 gene locus_tag LOCUS_19360 gene fliF 10459 8921 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_19360 10771 10463 gene locus_tag LOCUS_19370 10771 10463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 11229 10786 gene locus_tag LOCUS_19380 gene flgC 11229 10786 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_19380 11600 11229 gene locus_tag LOCUS_19390 gene flgB 11600 11229 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546345.1 protein_id gnl|my_center|LOCUS_19390 12978 11608 gene locus_tag LOCUS_19400 12978 11608 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842237.1 protein_id gnl|my_center|LOCUS_19400 13940 12975 gene locus_tag LOCUS_19410 13940 12975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 15792 13885 gene locus_tag LOCUS_19420 15792 13885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 16490 15942 gene locus_tag LOCUS_19430 16490 15942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 <18023 16474 gene locus_tag LOCUS_19440 <18023 16474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943652.1:glycosyltransferase family 9 protein >Feature sequence064 1471 716 gene locus_tag LOCUS_19450 gene kdsB 1471 716 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_19450 1926 2426 gene locus_tag LOCUS_19460 1926 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 2500 3693 gene locus_tag LOCUS_19470 2500 3693 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228927.1 protein_id gnl|my_center|LOCUS_19470 3690 4826 gene locus_tag LOCUS_19480 3690 4826 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 protein_id gnl|my_center|LOCUS_19480 7148 4836 gene locus_tag LOCUS_19490 7148 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 8075 7413 gene locus_tag LOCUS_19500 8075 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 9009 8254 gene locus_tag LOCUS_19510 9009 8254 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978344.1 protein_id gnl|my_center|LOCUS_19510 9082 9915 gene locus_tag LOCUS_19520 9082 9915 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224387.1 protein_id gnl|my_center|LOCUS_19520 9933 10313 gene locus_tag LOCUS_19530 9933 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 10318 10503 gene locus_tag LOCUS_19540 10318 10503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 10514 11365 gene locus_tag LOCUS_19550 10514 11365 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_19550 11425 13974 gene locus_tag LOCUS_19560 gene alaS 11425 13974 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_19560 13979 14947 gene locus_tag LOCUS_19570 13979 14947 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_19570 14944 15408 gene locus_tag LOCUS_19580 14944 15408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 15413 16990 gene locus_tag LOCUS_19590 gene lnt 15413 16990 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_19590 17201 17548 gene locus_tag LOCUS_19600 17201 17548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence065 <1 944 gene locus_tag LOCUS_19610 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533105.1:calcium-binding protein 1067 2134 gene locus_tag LOCUS_19620 1067 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 2426 2683 gene locus_tag LOCUS_19630 2426 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 3120 4115 gene locus_tag LOCUS_19640 3120 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 4130 6529 gene locus_tag LOCUS_19650 4130 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 6526 9108 gene locus_tag LOCUS_19660 6526 9108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 9105 9656 gene locus_tag LOCUS_19670 9105 9656 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_19670 9818 11908 gene locus_tag LOCUS_19680 9818 11908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 11892 13355 gene locus_tag LOCUS_19690 11892 13355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 13377 14789 gene locus_tag LOCUS_19700 13377 14789 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229151.1 protein_id gnl|my_center|LOCUS_19700 14768 16648 gene locus_tag LOCUS_19710 gene asnB 14768 16648 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence066 798 1271 gene locus_tag LOCUS_19720 798 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 2819 1287 gene locus_tag LOCUS_19730 2819 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 3461 2829 gene locus_tag LOCUS_19740 3461 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 4272 3472 gene locus_tag LOCUS_19750 4272 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 5048 4230 gene locus_tag LOCUS_19760 5048 4230 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_19760 5174 7435 gene locus_tag LOCUS_19770 5174 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 9084 7408 gene locus_tag LOCUS_19780 9084 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 10838 9273 gene locus_tag LOCUS_19790 10838 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 13186 10835 gene locus_tag LOCUS_19800 13186 10835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 14469 13273 gene locus_tag LOCUS_19810 14469 13273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 14530 14916 gene locus_tag LOCUS_19820 14530 14916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 14961 15248 gene locus_tag LOCUS_19830 14961 15248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 16155 15256 gene locus_tag LOCUS_19840 16155 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 16154 16909 gene locus_tag LOCUS_19850 16154 16909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence067 702 1655 gene locus_tag LOCUS_19860 702 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2665 2982 gene locus_tag LOCUS_19870 2665 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 3299 4318 gene locus_tag LOCUS_19880 3299 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 4885 4553 gene locus_tag LOCUS_19890 4885 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 5340 4858 gene locus_tag LOCUS_19900 5340 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 6077 6388 gene locus_tag LOCUS_19910 6077 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 6381 7373 gene locus_tag LOCUS_19920 6381 7373 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_19920 7604 8257 gene locus_tag LOCUS_19930 7604 8257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 8783 8193 gene locus_tag LOCUS_19940 8783 8193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 9495 8806 gene locus_tag LOCUS_19950 9495 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 10891 9584 gene locus_tag LOCUS_19960 10891 9584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 11123 10893 gene locus_tag LOCUS_19970 11123 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 11320 12399 gene locus_tag LOCUS_19980 11320 12399 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974646.1 protein_id gnl|my_center|LOCUS_19980 12875 12396 gene locus_tag LOCUS_19990 gene lspA 12875 12396 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_19990 15670 12896 gene locus_tag LOCUS_20000 gene ileS 15670 12896 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_20000 16665 15718 gene locus_tag LOCUS_20010 gene mer 16665 15718 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_20010 16740 17012 gene locus_tag LOCUS_20020 16740 17012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence068 1382 684 gene locus_tag LOCUS_20030 1382 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 1505 1717 gene locus_tag LOCUS_20040 1505 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 1772 2242 gene locus_tag LOCUS_20050 1772 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3121 2246 gene locus_tag LOCUS_20060 gene hisG 3121 2246 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942177.1 protein_id gnl|my_center|LOCUS_20060 3486 3121 gene locus_tag LOCUS_20070 3486 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 3561 4598 gene locus_tag LOCUS_20080 gene lpxD 3561 4598 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_20080 4672 5184 gene locus_tag LOCUS_20090 4672 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 5209 5391 gene locus_tag LOCUS_20100 gene rpmF 5209 5391 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_20100 5397 6332 gene locus_tag LOCUS_20110 gene fabD 5397 6332 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_20110 6329 7078 gene locus_tag LOCUS_20120 gene fabG 6329 7078 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392464.1 protein_id gnl|my_center|LOCUS_20120 7116 7352 gene locus_tag LOCUS_20130 gene acpP 7116 7352 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544465.1 protein_id gnl|my_center|LOCUS_20130 7360 8610 gene locus_tag LOCUS_20140 7360 8610 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_20140 8620 9129 gene locus_tag LOCUS_20150 gene nrdR 8620 9129 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_20150 9126 10268 gene locus_tag LOCUS_20160 gene ribD 9126 10268 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_20160 10319 11533 gene locus_tag LOCUS_20170 10319 11533 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_20170 11553 12026 gene locus_tag LOCUS_20180 gene ribE 11553 12026 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811752.1 protein_id gnl|my_center|LOCUS_20180 12026 12466 gene locus_tag LOCUS_20190 gene nusB 12026 12466 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_20190 12468 14954 gene locus_tag LOCUS_20200 gene leuS 12468 14954 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_20200 14951 15526 gene locus_tag LOCUS_20210 14951 15526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 15655 16533 gene locus_tag LOCUS_20220 15655 16533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 17190 16867 gene locus_tag LOCUS_20230 gene rpsT 17190 16867 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence069 2199 166 gene locus_tag LOCUS_20240 gene cstA 2199 166 CDS product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259563.1 protein_id gnl|my_center|LOCUS_20240 3365 2202 gene locus_tag LOCUS_20250 3365 2202 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728358.1 protein_id gnl|my_center|LOCUS_20250 3482 4360 gene locus_tag LOCUS_20260 3482 4360 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_20260 4357 5460 gene locus_tag LOCUS_20270 4357 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 5726 6709 gene locus_tag LOCUS_20280 5726 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 6790 7872 gene locus_tag LOCUS_20290 gene asd 6790 7872 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876434.1 protein_id gnl|my_center|LOCUS_20290 8569 7880 gene locus_tag LOCUS_20300 8569 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 8572 9393 gene locus_tag LOCUS_20310 8572 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 protein_id gnl|my_center|LOCUS_20310 9608 9414 gene locus_tag LOCUS_20320 9608 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 9558 9767 gene locus_tag LOCUS_20330 9558 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 9771 11345 gene locus_tag LOCUS_20340 9771 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 12620 11349 gene locus_tag LOCUS_20350 gene eno 12620 11349 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869074.1 protein_id gnl|my_center|LOCUS_20350 13296 12643 gene locus_tag LOCUS_20360 13296 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 14105 13677 gene locus_tag LOCUS_20370 14105 13677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 14951 14394 gene locus_tag LOCUS_20380 14951 14394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 16232 15030 gene locus_tag LOCUS_20390 16232 15030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence070 1199 39 gene locus_tag LOCUS_20400 1199 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 1828 1112 gene locus_tag LOCUS_20410 1828 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2666 1863 gene locus_tag LOCUS_20420 2666 1863 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170039298.1 protein_id gnl|my_center|LOCUS_20420 3790 2663 gene locus_tag LOCUS_20430 gene speY 3790 2663 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_20430 3873 4331 gene locus_tag LOCUS_20440 3873 4331 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546233.1 protein_id gnl|my_center|LOCUS_20440 4328 5605 gene locus_tag LOCUS_20450 4328 5605 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_20450 5612 6184 gene locus_tag LOCUS_20460 gene thpR 5612 6184 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867226.1 protein_id gnl|my_center|LOCUS_20460 6273 7367 gene locus_tag LOCUS_20470 gene recA 6273 7367 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_20470 7371 8522 gene locus_tag LOCUS_20480 7371 8522 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_20480 8551 8964 gene locus_tag LOCUS_20490 8551 8964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 9708 9157 gene locus_tag LOCUS_20500 9708 9157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 10313 9933 gene locus_tag LOCUS_20510 10313 9933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 11023 10319 gene locus_tag LOCUS_20520 11023 10319 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_20520 11088 11762 gene locus_tag LOCUS_20530 11088 11762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 11772 13250 gene locus_tag LOCUS_20540 11772 13250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 13656 13258 gene locus_tag LOCUS_20550 13656 13258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 13990 13658 gene locus_tag LOCUS_20560 13990 13658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 14016 17099 gene locus_tag LOCUS_20570 14016 17099 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922671.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence071 450 1034 gene locus_tag LOCUS_20580 450 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 2108 1041 gene locus_tag LOCUS_20590 2108 1041 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057593.1 protein_id gnl|my_center|LOCUS_20590 2908 2108 gene locus_tag LOCUS_20600 2908 2108 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030645.1 protein_id gnl|my_center|LOCUS_20600 3735 2905 gene locus_tag LOCUS_20610 3735 2905 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_20610 4965 3739 gene locus_tag LOCUS_20620 4965 3739 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867150.1 protein_id gnl|my_center|LOCUS_20620 5148 11429 gene locus_tag LOCUS_20630 5148 11429 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085385.1 protein_id gnl|my_center|LOCUS_20630 11439 13481 gene locus_tag LOCUS_20640 11439 13481 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928427.1 protein_id gnl|my_center|LOCUS_20640 14007 13483 gene locus_tag LOCUS_20650 14007 13483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 14769 16037 gene locus_tag LOCUS_20660 14769 16037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 16106 16267 gene locus_tag LOCUS_20670 16106 16267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence072 1924 2790 gene locus_tag LOCUS_20680 1924 2790 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947815.1 protein_id gnl|my_center|LOCUS_20680 2871 3578 gene locus_tag LOCUS_20690 2871 3578 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_20690 7619 3942 gene locus_tag LOCUS_20700 7619 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 8689 7700 gene locus_tag LOCUS_20710 8689 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656251.1 protein_id gnl|my_center|LOCUS_20710 10884 8692 gene locus_tag LOCUS_20720 10884 8692 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791176.1 protein_id gnl|my_center|LOCUS_20720 11435 11013 gene locus_tag LOCUS_20730 11435 11013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 13042 11471 gene locus_tag LOCUS_20740 13042 11471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 13375 13154 gene locus_tag LOCUS_20750 13375 13154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 13931 14131 gene locus_tag LOCUS_20760 13931 14131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 14453 14166 gene locus_tag LOCUS_20770 14453 14166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 15362 14463 gene locus_tag LOCUS_20780 15362 14463 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023149.1 protein_id gnl|my_center|LOCUS_20780 16325 15891 gene locus_tag LOCUS_20790 16325 15891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 16352 16891 gene locus_tag LOCUS_20800 16352 16891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 >Feature sequence073 1558 1851 gene locus_tag LOCUS_20810 1558 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 1923 2216 gene locus_tag LOCUS_20820 gene groES 1923 2216 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_20820 2226 3866 gene locus_tag LOCUS_20830 gene groL 2226 3866 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_20830 4653 4309 gene locus_tag LOCUS_20840 4653 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 4594 4791 gene locus_tag LOCUS_20850 4594 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 4875 5312 gene locus_tag LOCUS_20860 4875 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 5788 6834 gene locus_tag LOCUS_20870 5788 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 8496 6910 gene locus_tag LOCUS_20880 8496 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 8578 8985 gene locus_tag LOCUS_20890 8578 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 9587 9315 gene locus_tag LOCUS_20900 9587 9315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 9541 9783 gene locus_tag LOCUS_20910 9541 9783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 12062 10161 gene locus_tag LOCUS_20920 12062 10161 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868795.1 protein_id gnl|my_center|LOCUS_20920 13246 12077 gene locus_tag LOCUS_20930 13246 12077 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256834.1 protein_id gnl|my_center|LOCUS_20930 13926 13246 gene locus_tag LOCUS_20940 13926 13246 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392275.1 protein_id gnl|my_center|LOCUS_20940 14909 13932 gene locus_tag LOCUS_20950 14909 13932 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_20950 15507 14923 gene locus_tag LOCUS_20960 15507 14923 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582959.1 protein_id gnl|my_center|LOCUS_20960 16673 15507 gene locus_tag LOCUS_20970 16673 15507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence074 911 390 gene locus_tag LOCUS_20980 911 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 2479 1082 gene locus_tag LOCUS_20990 gene lpdA 2479 1082 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388970.1 protein_id gnl|my_center|LOCUS_20990 3792 2479 gene locus_tag LOCUS_21000 gene odhB 3792 2479 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110041.1 protein_id gnl|my_center|LOCUS_21000 6554 3789 gene locus_tag LOCUS_21010 6554 3789 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388968.1 protein_id gnl|my_center|LOCUS_21010 6659 7423 gene locus_tag LOCUS_21020 6659 7423 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225418.1 protein_id gnl|my_center|LOCUS_21020 7639 8832 gene locus_tag LOCUS_21030 7639 8832 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114496.1 protein_id gnl|my_center|LOCUS_21030 8869 9078 gene locus_tag LOCUS_21040 8869 9078 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084181.1 protein_id gnl|my_center|LOCUS_21040 9161 9817 gene locus_tag LOCUS_21050 gene fkpA 9161 9817 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458290.1 protein_id gnl|my_center|LOCUS_21050 10740 9862 gene locus_tag LOCUS_21060 10740 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 11030 11932 gene locus_tag LOCUS_21070 11030 11932 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242776.1 protein_id gnl|my_center|LOCUS_21070 12631 11987 gene locus_tag LOCUS_21080 12631 11987 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230200.1 protein_id gnl|my_center|LOCUS_21080 14296 12803 gene locus_tag LOCUS_21090 gene dhaS 14296 12803 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080281.1 protein_id gnl|my_center|LOCUS_21090 14576 14872 gene locus_tag LOCUS_21100 14576 14872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 15096 15386 gene locus_tag LOCUS_21110 15096 15386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 15427 16179 gene locus_tag LOCUS_21120 15427 16179 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_21120 <16850 16192 gene locus_tag LOCUS_21130 <16850 16192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869068.1:PLP-dependent aminotransferase family protein >Feature sequence075 437 1408 gene locus_tag LOCUS_21140 437 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 1874 2155 gene locus_tag LOCUS_21150 1874 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 2140 2568 gene locus_tag LOCUS_21160 2140 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2568 3698 gene locus_tag LOCUS_21170 2568 3698 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 protein_id gnl|my_center|LOCUS_21170 4201 3845 gene locus_tag LOCUS_21180 4201 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 4698 4288 gene locus_tag LOCUS_21190 4698 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 5864 4731 gene locus_tag LOCUS_21200 5864 4731 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_21200 7269 5851 gene locus_tag LOCUS_21210 7269 5851 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_21210 7750 7523 gene locus_tag LOCUS_21220 7750 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 7981 8397 gene locus_tag LOCUS_21230 7981 8397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 8497 9579 gene locus_tag LOCUS_21240 8497 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 9596 12280 gene locus_tag LOCUS_21250 9596 12280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 12611 13546 gene locus_tag LOCUS_21260 12611 13546 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_21260 13548 14294 gene locus_tag LOCUS_21270 13548 14294 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_21270 14276 15658 gene locus_tag LOCUS_21280 14276 15658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 15668 16231 gene locus_tag LOCUS_21290 15668 16231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence076 541 453 gene locus_tag LOCUS_t00280 541 453 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1026 586 gene locus_tag LOCUS_21300 gene tadA 1026 586 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940742.1 protein_id gnl|my_center|LOCUS_21300 1355 1104 gene locus_tag LOCUS_21310 1355 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 1533 2948 gene locus_tag LOCUS_21320 1533 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2997 3194 gene locus_tag LOCUS_21330 2997 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 4646 3234 gene locus_tag LOCUS_21340 4646 3234 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030921.1 protein_id gnl|my_center|LOCUS_21340 4854 5039 gene locus_tag LOCUS_21350 4854 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 5125 6636 gene locus_tag LOCUS_21360 5125 6636 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967349.1 protein_id gnl|my_center|LOCUS_21360 6638 7021 gene locus_tag LOCUS_21370 6638 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 7018 7500 gene locus_tag LOCUS_21380 7018 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 8946 7519 gene locus_tag LOCUS_21390 8946 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 9067 10206 gene locus_tag LOCUS_21400 gene opgC 9067 10206 CDS product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841619.1 protein_id gnl|my_center|LOCUS_21400 10715 10224 gene locus_tag LOCUS_21410 10715 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 10829 12880 gene locus_tag LOCUS_21420 gene tkt 10829 12880 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_21420 12909 15779 gene locus_tag LOCUS_21430 12909 15779 CDS product bifunctional transaldolase/phosoglucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089497.1 protein_id gnl|my_center|LOCUS_21430 >Feature sequence077 562 813 gene locus_tag LOCUS_21440 562 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 810 1187 gene locus_tag LOCUS_21450 810 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 1391 1648 gene locus_tag LOCUS_21460 1391 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 3569 1650 gene locus_tag LOCUS_21470 3569 1650 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056358.1 protein_id gnl|my_center|LOCUS_21470 3626 3823 gene locus_tag LOCUS_21480 3626 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 4081 5145 gene locus_tag LOCUS_21490 4081 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 5499 6224 gene locus_tag LOCUS_21500 5499 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 6221 8953 gene locus_tag LOCUS_21510 6221 8953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 10300 8963 gene locus_tag LOCUS_21520 10300 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 11180 10533 gene locus_tag LOCUS_21530 11180 10533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791841.1 protein_id gnl|my_center|LOCUS_21530 11264 12367 gene locus_tag LOCUS_21540 11264 12367 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923292.1 protein_id gnl|my_center|LOCUS_21540 14099 12447 gene locus_tag LOCUS_21550 14099 12447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 15531 14164 gene locus_tag LOCUS_21560 15531 14164 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976259.1 protein_id gnl|my_center|LOCUS_21560 15695 16249 gene locus_tag LOCUS_21570 15695 16249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence078 514 1374 gene locus_tag LOCUS_21580 514 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 1727 1593 gene locus_tag LOCUS_21590 1727 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 3298 1847 gene locus_tag LOCUS_21600 3298 1847 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392040.1 protein_id gnl|my_center|LOCUS_21600 4053 3298 gene locus_tag LOCUS_21610 4053 3298 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930638.1 protein_id gnl|my_center|LOCUS_21610 4670 4050 gene locus_tag LOCUS_21620 4670 4050 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104261.1 protein_id gnl|my_center|LOCUS_21620 5740 4670 gene locus_tag LOCUS_21630 5740 4670 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742140.1 protein_id gnl|my_center|LOCUS_21630 6837 5755 gene locus_tag LOCUS_21640 6837 5755 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_21640 8543 6837 gene locus_tag LOCUS_21650 8543 6837 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_21650 9994 8540 gene locus_tag LOCUS_21660 9994 8540 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228971.1 protein_id gnl|my_center|LOCUS_21660 11125 10001 gene locus_tag LOCUS_21670 11125 10001 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173087.1 protein_id gnl|my_center|LOCUS_21670 11237 11881 gene locus_tag LOCUS_21680 11237 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 11936 14113 gene locus_tag LOCUS_21690 11936 14113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 14160 15407 gene locus_tag LOCUS_21700 14160 15407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 15404 16009 gene locus_tag LOCUS_21710 15404 16009 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098519.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence079 321 518 gene locus_tag LOCUS_21720 321 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 611 3202 gene locus_tag LOCUS_21730 611 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 3217 5007 gene locus_tag LOCUS_21740 3217 5007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 protein_id gnl|my_center|LOCUS_21740 4991 6160 gene locus_tag LOCUS_21750 4991 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 6161 7327 gene locus_tag LOCUS_21760 6161 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 7331 8491 gene locus_tag LOCUS_21770 7331 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 9495 8563 gene locus_tag LOCUS_21780 9495 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 10717 9530 gene locus_tag LOCUS_21790 10717 9530 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225183.1 protein_id gnl|my_center|LOCUS_21790 10786 13056 gene locus_tag LOCUS_21800 10786 13056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 13086 14003 gene locus_tag LOCUS_21810 13086 14003 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945844.1 protein_id gnl|my_center|LOCUS_21810 15691 13979 gene locus_tag LOCUS_21820 15691 13979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 <16388 15807 gene locus_tag LOCUS_21830 <16388 15807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259452.1:coenzyme F420-0:L-glutamate ligase >Feature sequence080 1425 508 gene locus_tag LOCUS_21840 1425 508 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_21840 2799 1438 gene locus_tag LOCUS_21850 2799 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 3185 2904 gene locus_tag LOCUS_21860 3185 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 3316 3753 gene locus_tag LOCUS_21870 3316 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 4490 3780 gene locus_tag LOCUS_21880 4490 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 4526 5335 gene locus_tag LOCUS_21890 4526 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 5402 6403 gene locus_tag LOCUS_21900 5402 6403 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533083.1 protein_id gnl|my_center|LOCUS_21900 6658 6455 gene locus_tag LOCUS_21910 6658 6455 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_21910 6840 7838 gene locus_tag LOCUS_21920 6840 7838 CDS product lauroyl/myristoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027687.1 protein_id gnl|my_center|LOCUS_21920 7903 8214 gene locus_tag LOCUS_21930 7903 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 8240 8890 gene locus_tag LOCUS_21940 8240 8890 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_21940 9010 9642 gene locus_tag LOCUS_21950 9010 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 9649 10650 gene locus_tag LOCUS_21960 gene serA 9649 10650 CDS product D-3-phosphoglycerate dehydrogenase SerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898565.1 protein_id gnl|my_center|LOCUS_21960 10658 12166 gene locus_tag LOCUS_21970 gene lsrK 10658 12166 CDS product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661593.1 protein_id gnl|my_center|LOCUS_21970 12183 12827 gene locus_tag LOCUS_21980 12183 12827 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383693.1 protein_id gnl|my_center|LOCUS_21980 12836 13780 gene locus_tag LOCUS_21990 12836 13780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 13777 14517 gene locus_tag LOCUS_22000 13777 14517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 14568 15896 gene locus_tag LOCUS_22010 14568 15896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence081 1102 431 gene locus_tag LOCUS_22020 1102 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 1893 1216 gene locus_tag LOCUS_22030 1893 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 2076 2351 gene locus_tag LOCUS_22040 2076 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 2388 2789 gene locus_tag LOCUS_22050 2388 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22050 2847 3656 gene locus_tag LOCUS_22060 2847 3656 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_22060 3979 5307 gene locus_tag LOCUS_22070 gene dnaA 3979 5307 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124720.1 protein_id gnl|my_center|LOCUS_22070 6081 5308 gene locus_tag LOCUS_22080 6081 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 6131 6706 gene locus_tag LOCUS_22090 6131 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 6708 7079 gene locus_tag LOCUS_22100 6708 7079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 7161 7589 gene locus_tag LOCUS_22110 7161 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 7586 8272 gene locus_tag LOCUS_22120 7586 8272 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_22120 8613 8269 gene locus_tag LOCUS_22130 8613 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 9179 8616 gene locus_tag LOCUS_22140 9179 8616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 9425 9497 gene locus_tag LOCUS_t00290 9425 9497 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10595 9591 gene locus_tag LOCUS_22150 10595 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 10998 11306 gene locus_tag LOCUS_22160 10998 11306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 12449 11313 gene locus_tag LOCUS_22170 12449 11313 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_22170 12475 13617 gene locus_tag LOCUS_22180 12475 13617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 14699 13857 gene locus_tag LOCUS_22190 14699 13857 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_22190 15560 14748 gene locus_tag LOCUS_22200 15560 14748 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395936.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence082 4020 5957 gene locus_tag LOCUS_22210 4020 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 6639 6001 gene locus_tag LOCUS_22220 6639 6001 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 protein_id gnl|my_center|LOCUS_22220 7626 6697 gene locus_tag LOCUS_22230 7626 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 7707 8177 gene locus_tag LOCUS_22240 7707 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 9602 8379 gene locus_tag LOCUS_22250 9602 8379 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730093.1 protein_id gnl|my_center|LOCUS_22250 9592 10155 gene locus_tag LOCUS_22260 9592 10155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 11369 10167 gene locus_tag LOCUS_22270 11369 10167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 11512 13884 gene locus_tag LOCUS_22280 11512 13884 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900424.1 protein_id gnl|my_center|LOCUS_22280 15046 13934 gene locus_tag LOCUS_22290 15046 13934 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_22290 >Feature sequence083 847 332 gene locus_tag LOCUS_22300 847 332 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399749.1 protein_id gnl|my_center|LOCUS_22300 1455 844 gene locus_tag LOCUS_22310 1455 844 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817332.1 protein_id gnl|my_center|LOCUS_22310 1541 2311 gene locus_tag LOCUS_22320 gene cobB 1541 2311 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249636.1 protein_id gnl|my_center|LOCUS_22320 3148 2330 gene locus_tag LOCUS_22330 3148 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 3206 3622 gene locus_tag LOCUS_22340 3206 3622 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926483.1 protein_id gnl|my_center|LOCUS_22340 3628 4770 gene locus_tag LOCUS_22350 3628 4770 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085742.1 protein_id gnl|my_center|LOCUS_22350 4770 4991 gene locus_tag LOCUS_22360 4770 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 5348 6169 gene locus_tag LOCUS_22370 5348 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 6576 6298 gene locus_tag LOCUS_22380 6576 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 8240 6573 gene locus_tag LOCUS_22390 8240 6573 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_22390 9908 8328 gene locus_tag LOCUS_22400 9908 8328 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_22400 11202 9895 gene locus_tag LOCUS_22410 gene nuoF 11202 9895 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967797.1 protein_id gnl|my_center|LOCUS_22410 11774 11223 gene locus_tag LOCUS_22420 11774 11223 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524416.1 protein_id gnl|my_center|LOCUS_22420 12855 11809 gene locus_tag LOCUS_22430 gene aroF 12855 11809 CDS product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098343.1 protein_id gnl|my_center|LOCUS_22430 12940 13416 gene locus_tag LOCUS_22440 12940 13416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 14332 13406 gene locus_tag LOCUS_22450 14332 13406 CDS product initiation factor 2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257268.1 protein_id gnl|my_center|LOCUS_22450 14307 15119 gene locus_tag LOCUS_22460 14307 15119 CDS product nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240366.1 protein_id gnl|my_center|LOCUS_22460 15130 15447 gene locus_tag LOCUS_22470 15130 15447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence084 542 48 gene locus_tag LOCUS_22480 542 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 426 818 gene locus_tag LOCUS_22490 426 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 8377 1187 gene locus_tag LOCUS_22500 8377 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 11196 8431 gene locus_tag LOCUS_22510 11196 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 11413 12360 gene locus_tag LOCUS_22520 11413 12360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 13272 12367 gene locus_tag LOCUS_22530 13272 12367 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411868.1 protein_id gnl|my_center|LOCUS_22530 13869 13708 gene locus_tag LOCUS_22540 13869 13708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 14180 14335 gene locus_tag LOCUS_22550 14180 14335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 >Feature sequence085 545 955 gene locus_tag LOCUS_22560 545 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2357 1053 gene locus_tag LOCUS_22570 2357 1053 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142321.1 protein_id gnl|my_center|LOCUS_22570 2637 2365 gene locus_tag LOCUS_22580 2637 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 3070 2753 gene locus_tag LOCUS_22590 3070 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 3400 3200 gene locus_tag LOCUS_22600 3400 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 3879 3430 gene locus_tag LOCUS_22610 3879 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 4497 4213 gene locus_tag LOCUS_22620 4497 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 4576 6603 gene locus_tag LOCUS_22630 4576 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 6932 6726 gene locus_tag LOCUS_22640 gene cspA 6932 6726 CDS product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860775.1 protein_id gnl|my_center|LOCUS_22640 7496 7311 gene locus_tag LOCUS_22650 7496 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 7932 8150 gene locus_tag LOCUS_22660 7932 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 8588 8256 gene locus_tag LOCUS_22670 8588 8256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 8673 8966 gene locus_tag LOCUS_22680 8673 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 9033 9299 gene locus_tag LOCUS_22690 9033 9299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 9296 9493 gene locus_tag LOCUS_22700 9296 9493 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140566.1 protein_id gnl|my_center|LOCUS_22700 9722 10042 gene locus_tag LOCUS_22710 9722 10042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 10992 10228 gene locus_tag LOCUS_22720 10992 10228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 13750 11003 gene locus_tag LOCUS_22730 13750 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 13939 14169 gene locus_tag LOCUS_22740 13939 14169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 14604 14260 gene locus_tag LOCUS_22750 14604 14260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 14919 14695 gene locus_tag LOCUS_22760 14919 14695 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024016.1 protein_id gnl|my_center|LOCUS_22760 15219 14923 gene locus_tag LOCUS_22770 15219 14923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence086 <1 547 gene locus_tag LOCUS_22780 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942188.1:transposase 1597 878 gene locus_tag LOCUS_22790 1597 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 4369 1613 gene locus_tag LOCUS_22800 4369 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 4542 4381 gene locus_tag LOCUS_22810 4542 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 5405 4575 gene locus_tag LOCUS_22820 5405 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 5571 5410 gene locus_tag LOCUS_22830 5571 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 6351 5578 gene locus_tag LOCUS_22840 6351 5578 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124522.1 protein_id gnl|my_center|LOCUS_22840 6960 6367 gene locus_tag LOCUS_22850 6960 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 7460 7089 gene locus_tag LOCUS_22860 7460 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 10354 7589 gene locus_tag LOCUS_22870 10354 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 11252 10494 gene locus_tag LOCUS_22880 11252 10494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 11339 12460 gene locus_tag LOCUS_22890 11339 12460 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259127.1 protein_id gnl|my_center|LOCUS_22890 13276 12521 gene locus_tag LOCUS_22900 13276 12521 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969404.1 protein_id gnl|my_center|LOCUS_22900 <15594 13279 gene locus_tag LOCUS_22910 <15594 13279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082594.1:glycoside hydrolase family 3 N-terminal domain-containing protein >Feature sequence087 <1 602 gene locus_tag LOCUS_22920 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943577.1:heavy metal response regulator transcription factor 599 1966 gene locus_tag LOCUS_22930 599 1966 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_22930 1982 2500 gene locus_tag LOCUS_22940 1982 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 2505 3611 gene locus_tag LOCUS_22950 2505 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 3644 4513 gene locus_tag LOCUS_22960 3644 4513 CDS product DUF1259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965726.1 protein_id gnl|my_center|LOCUS_22960 4530 5300 gene locus_tag LOCUS_22970 4530 5300 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545523.1 protein_id gnl|my_center|LOCUS_22970 5300 6595 gene locus_tag LOCUS_22980 5300 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 6592 7542 gene locus_tag LOCUS_22990 6592 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 7539 10613 gene locus_tag LOCUS_23000 7539 10613 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_23000 11239 10628 gene locus_tag LOCUS_23010 11239 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 11575 11306 gene locus_tag LOCUS_23020 11575 11306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 12157 11594 gene locus_tag LOCUS_23030 12157 11594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 12292 13446 gene locus_tag LOCUS_23040 12292 13446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 14274 13453 gene locus_tag LOCUS_23050 14274 13453 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641673.1 protein_id gnl|my_center|LOCUS_23050 <15428 14322 gene locus_tag LOCUS_23060 <15428 14322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228942.1:OB-fold domain-containing protein >Feature sequence088 <1 1076 gene locus_tag LOCUS_23070 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113855.1:multidrug efflux RND transporter periplasmic adaptor subunit MexJ 1850 1140 gene locus_tag LOCUS_23080 1850 1140 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314885.1 protein_id gnl|my_center|LOCUS_23080 2327 3880 gene locus_tag LOCUS_23090 2327 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 3893 4096 gene locus_tag LOCUS_23100 3893 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 4234 4680 gene locus_tag LOCUS_23110 4234 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 4677 6176 gene locus_tag LOCUS_23120 4677 6176 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666069.1 protein_id gnl|my_center|LOCUS_23120 6925 6611 gene locus_tag LOCUS_23130 6925 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 7239 6928 gene locus_tag LOCUS_23140 7239 6928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 7913 7455 gene locus_tag LOCUS_23150 7913 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 8300 10561 gene locus_tag LOCUS_23160 8300 10561 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467867.1 protein_id gnl|my_center|LOCUS_23160 11068 10568 gene locus_tag LOCUS_23170 11068 10568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 11588 11085 gene locus_tag LOCUS_23180 11588 11085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 12994 11630 gene locus_tag LOCUS_23190 12994 11630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 13454 13071 gene locus_tag LOCUS_23200 13454 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 14722 13445 gene locus_tag LOCUS_23210 14722 13445 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_23210 15002 14706 gene locus_tag LOCUS_23220 15002 14706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 >Feature sequence089 603 1562 gene locus_tag LOCUS_23230 603 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 1636 2445 gene locus_tag LOCUS_23240 1636 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 4017 2602 gene locus_tag LOCUS_23250 4017 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 4903 4025 gene locus_tag LOCUS_23260 4903 4025 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_23260 5846 5076 gene locus_tag LOCUS_23270 5846 5076 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 protein_id gnl|my_center|LOCUS_23270 7207 5849 gene locus_tag LOCUS_23280 7207 5849 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_23280 7328 7771 gene locus_tag LOCUS_23290 7328 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 8607 7762 gene locus_tag LOCUS_23300 8607 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 9841 8531 gene locus_tag LOCUS_23310 9841 8531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 13351 10172 gene locus_tag LOCUS_23320 13351 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 13667 13368 gene locus_tag LOCUS_23330 13667 13368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 13800 14831 gene locus_tag LOCUS_23340 13800 14831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 >Feature sequence090 1451 360 gene locus_tag LOCUS_23350 1451 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 2679 3086 gene locus_tag LOCUS_23360 2679 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 3187 3618 gene locus_tag LOCUS_23370 3187 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 4510 4941 gene locus_tag LOCUS_23380 4510 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 5593 5174 gene locus_tag LOCUS_23390 5593 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 6114 5581 gene locus_tag LOCUS_23400 6114 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 6543 6770 gene locus_tag LOCUS_23410 6543 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 6960 7751 gene locus_tag LOCUS_23420 6960 7751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 7789 8733 gene locus_tag LOCUS_23430 7789 8733 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923351.1 protein_id gnl|my_center|LOCUS_23430 8877 9905 gene locus_tag LOCUS_23440 8877 9905 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_23440 9924 10799 gene locus_tag LOCUS_23450 9924 10799 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_23450 10962 11513 gene locus_tag LOCUS_23460 gene sodC 10962 11513 CDS product superoxide dismutase [Cu-Zn] SodC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096917.1 protein_id gnl|my_center|LOCUS_23460 11626 11856 gene locus_tag LOCUS_23470 11626 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 11858 12790 gene locus_tag LOCUS_23480 11858 12790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 12777 13772 gene locus_tag LOCUS_23490 12777 13772 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_23490 >Feature sequence091 57 314 gene locus_tag LOCUS_23500 57 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 441 599 gene locus_tag LOCUS_23510 gene rpmH 441 599 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958535.1 protein_id gnl|my_center|LOCUS_23510 596 955 gene locus_tag LOCUS_23520 gene rnpA 596 955 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944077.1 protein_id gnl|my_center|LOCUS_23520 900 1208 gene locus_tag LOCUS_23530 900 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 1211 2788 gene locus_tag LOCUS_23540 gene yidC 1211 2788 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_23540 2802 3530 gene locus_tag LOCUS_23550 2802 3530 CDS product Jag N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432936.1 protein_id gnl|my_center|LOCUS_23550 3527 4201 gene locus_tag LOCUS_23560 3527 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 4235 5041 gene locus_tag LOCUS_23570 4235 5041 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_23570 5013 5879 gene locus_tag LOCUS_23580 5013 5879 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_23580 5972 6532 gene locus_tag LOCUS_23590 5972 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 6572 7003 gene locus_tag LOCUS_23600 6572 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 7003 7464 gene locus_tag LOCUS_23610 7003 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 7465 8007 gene locus_tag LOCUS_23620 gene atpH 7465 8007 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938079.1 protein_id gnl|my_center|LOCUS_23620 8026 9534 gene locus_tag LOCUS_23630 gene atpA 8026 9534 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_23630 9544 10398 gene locus_tag LOCUS_23640 gene atpG 9544 10398 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_23640 10401 11705 gene locus_tag LOCUS_23650 gene atpD 10401 11705 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032431.1 protein_id gnl|my_center|LOCUS_23650 11822 12091 gene locus_tag LOCUS_23660 11822 12091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 12265 12861 gene locus_tag LOCUS_23670 12265 12861 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029038.1 protein_id gnl|my_center|LOCUS_23670 13415 13026 gene locus_tag LOCUS_23680 13415 13026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 13585 14187 gene locus_tag LOCUS_23690 13585 14187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence092 987 1553 gene locus_tag LOCUS_23700 987 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 1934 1596 gene locus_tag LOCUS_23710 1934 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 2698 2210 gene locus_tag LOCUS_23720 2698 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 2583 3953 gene locus_tag LOCUS_23730 2583 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 4026 6932 gene locus_tag LOCUS_23740 4026 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 7037 8536 gene locus_tag LOCUS_23750 7037 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 8533 8985 gene locus_tag LOCUS_23760 8533 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 8982 10457 gene locus_tag LOCUS_23770 8982 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 10638 11696 gene locus_tag LOCUS_23780 10638 11696 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808265.1 protein_id gnl|my_center|LOCUS_23780 11937 12827 gene locus_tag LOCUS_23790 11937 12827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 12969 13739 gene locus_tag LOCUS_23800 12969 13739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence093 335 895 gene locus_tag LOCUS_23810 335 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 935 1993 gene locus_tag LOCUS_23820 935 1993 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338635.1 protein_id gnl|my_center|LOCUS_23820 1995 2408 gene locus_tag LOCUS_23830 1995 2408 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_23830 2409 2780 gene locus_tag LOCUS_23840 2409 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 3126 4214 gene locus_tag LOCUS_23850 3126 4214 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920865.1 protein_id gnl|my_center|LOCUS_23850 4272 5648 gene locus_tag LOCUS_23860 4272 5648 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_23860 6360 5932 gene locus_tag LOCUS_23870 6360 5932 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943168.1 protein_id gnl|my_center|LOCUS_23870 7489 6362 gene locus_tag LOCUS_23880 7489 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 7551 9344 gene locus_tag LOCUS_23890 7551 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 9341 10693 gene locus_tag LOCUS_23900 9341 10693 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_23900 11010 11378 gene locus_tag LOCUS_23910 11010 11378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 11429 12001 gene locus_tag LOCUS_23920 gene fixJ 11429 12001 CDS product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525376.1 protein_id gnl|my_center|LOCUS_23920 12066 12644 gene locus_tag LOCUS_23930 12066 12644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 12699 13922 gene locus_tag LOCUS_23940 12699 13922 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence094 713 979 gene locus_tag LOCUS_23950 713 979 CDS product TatA/E family twin arginine-targeting protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940700.1 protein_id gnl|my_center|LOCUS_23950 996 1775 gene locus_tag LOCUS_23960 996 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 2383 2111 gene locus_tag LOCUS_23970 2383 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 3976 2387 gene locus_tag LOCUS_23980 3976 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 3914 4165 gene locus_tag LOCUS_23990 3914 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 4842 4162 gene locus_tag LOCUS_24000 4842 4162 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942483.1 protein_id gnl|my_center|LOCUS_24000 4926 5951 gene locus_tag LOCUS_24010 4926 5951 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941710.1 protein_id gnl|my_center|LOCUS_24010 5914 6357 gene locus_tag LOCUS_24020 5914 6357 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400864.1 protein_id gnl|my_center|LOCUS_24020 6666 6938 gene locus_tag LOCUS_24030 6666 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 7932 7006 gene locus_tag LOCUS_24040 7932 7006 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_24040 8864 7935 gene locus_tag LOCUS_24050 8864 7935 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 protein_id gnl|my_center|LOCUS_24050 8982 10136 gene locus_tag LOCUS_24060 8982 10136 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704942.1 protein_id gnl|my_center|LOCUS_24060 <14420 10146 gene locus_tag LOCUS_24070 <14420 10146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001111655.1:Ig-like domain-containing protein >Feature sequence095 599 1765 gene locus_tag LOCUS_24080 599 1765 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_24080 1765 2487 gene locus_tag LOCUS_24090 1765 2487 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141998.1 protein_id gnl|my_center|LOCUS_24090 2484 3707 gene locus_tag LOCUS_24100 2484 3707 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_24100 4350 3721 gene locus_tag LOCUS_24110 4350 3721 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030700.1 protein_id gnl|my_center|LOCUS_24110 5284 4352 gene locus_tag LOCUS_24120 5284 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 5889 5281 gene locus_tag LOCUS_24130 5889 5281 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392982.1 protein_id gnl|my_center|LOCUS_24130 6368 5886 gene locus_tag LOCUS_24140 6368 5886 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258524.1 protein_id gnl|my_center|LOCUS_24140 6744 6358 gene locus_tag LOCUS_24150 6744 6358 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721457.1 protein_id gnl|my_center|LOCUS_24150 7722 6769 gene locus_tag LOCUS_24160 7722 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 8019 8288 gene locus_tag LOCUS_24170 8019 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 8531 8340 gene locus_tag LOCUS_24180 8531 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 9016 10047 gene locus_tag LOCUS_24190 9016 10047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 10078 11181 gene locus_tag LOCUS_24200 10078 11181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 11103 11744 gene locus_tag LOCUS_24210 11103 11744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 11719 11991 gene locus_tag LOCUS_24220 11719 11991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 12043 12411 gene locus_tag LOCUS_24230 12043 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 12408 13004 gene locus_tag LOCUS_24240 12408 13004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence096 1855 383 gene locus_tag LOCUS_24250 1855 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 2310 1861 gene locus_tag LOCUS_24260 2310 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 4294 3815 gene locus_tag LOCUS_24270 4294 3815 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005438733.1 protein_id gnl|my_center|LOCUS_24270 5995 4415 gene locus_tag LOCUS_24280 5995 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 6420 6013 gene locus_tag LOCUS_24290 6420 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 6567 7142 gene locus_tag LOCUS_24300 6567 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 7139 8002 gene locus_tag LOCUS_24310 7139 8002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 8043 8354 gene locus_tag LOCUS_24320 8043 8354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 9447 8476 gene locus_tag LOCUS_24330 9447 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 9558 10244 gene locus_tag LOCUS_24340 9558 10244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 10513 10337 gene locus_tag LOCUS_24350 10513 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 10999 10589 gene locus_tag LOCUS_24360 10999 10589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 11369 11608 gene locus_tag LOCUS_24370 11369 11608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 11608 11901 gene locus_tag LOCUS_24380 11608 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 12121 12438 gene locus_tag LOCUS_24390 12121 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 12475 12870 gene locus_tag LOCUS_24400 12475 12870 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204354659.1 protein_id gnl|my_center|LOCUS_24400 13167 13454 gene locus_tag LOCUS_24410 13167 13454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence097 1104 1304 gene locus_tag LOCUS_24420 1104 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 1403 2521 gene locus_tag LOCUS_24430 1403 2521 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206940.1 protein_id gnl|my_center|LOCUS_24430 3334 3507 gene locus_tag LOCUS_24440 3334 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 3891 3679 gene locus_tag LOCUS_24450 3891 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 4234 3917 gene locus_tag LOCUS_24460 4234 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 5286 4858 gene locus_tag LOCUS_24470 5286 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 5534 5283 gene locus_tag LOCUS_24480 5534 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 5881 7377 gene locus_tag LOCUS_24490 5881 7377 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038655.1 protein_id gnl|my_center|LOCUS_24490 7382 7801 gene locus_tag LOCUS_24500 7382 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 10296 8008 gene locus_tag LOCUS_24510 10296 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 11163 10384 gene locus_tag LOCUS_24520 11163 10384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 12474 11575 gene locus_tag LOCUS_24530 12474 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 13181 12399 gene locus_tag LOCUS_24540 13181 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 <14336 13823 gene locus_tag LOCUS_24550 <14336 13823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141892.1:aldo/keto reductase >Feature sequence098 74 292 gene locus_tag LOCUS_24560 74 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 289 510 gene locus_tag LOCUS_24570 289 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 1423 515 gene locus_tag LOCUS_24580 1423 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 2769 1420 gene locus_tag LOCUS_24590 2769 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 3616 2804 gene locus_tag LOCUS_24600 gene fabG 3616 2804 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_24600 3707 4915 gene locus_tag LOCUS_24610 3707 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 6439 4922 gene locus_tag LOCUS_24620 6439 4922 CDS product S53 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230264.1 protein_id gnl|my_center|LOCUS_24620 8380 6536 gene locus_tag LOCUS_24630 8380 6536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 9168 8671 gene locus_tag LOCUS_24640 9168 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 9088 9465 gene locus_tag LOCUS_24650 9088 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 10088 9462 gene locus_tag LOCUS_24660 10088 9462 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093224.1 protein_id gnl|my_center|LOCUS_24660 10117 10800 gene locus_tag LOCUS_24670 10117 10800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 10797 11189 gene locus_tag LOCUS_24680 10797 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 13861 11441 gene locus_tag LOCUS_24690 gene ptsP 13861 11441 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941826.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence099 <1 1047 gene locus_tag LOCUS_24700 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161270060.1:tetratricopeptide repeat protein 1044 2441 gene locus_tag LOCUS_24710 1044 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 2438 3142 gene locus_tag LOCUS_24720 2438 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 3152 3721 gene locus_tag LOCUS_24730 3152 3721 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_24730 3714 4436 gene locus_tag LOCUS_24740 3714 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 8823 4561 gene locus_tag LOCUS_24750 8823 4561 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147933.1 protein_id gnl|my_center|LOCUS_24750 8989 10869 gene locus_tag LOCUS_24760 8989 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 10915 11793 gene locus_tag LOCUS_24770 10915 11793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 12021 12704 gene locus_tag LOCUS_24780 12021 12704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 >Feature sequence100 1897 1634 gene locus_tag LOCUS_24790 1897 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 2525 1965 gene locus_tag LOCUS_24800 2525 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 2706 2954 gene locus_tag LOCUS_24810 2706 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 3045 3818 gene locus_tag LOCUS_24820 3045 3818 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932133.1 protein_id gnl|my_center|LOCUS_24820 3946 4932 gene locus_tag LOCUS_24830 3946 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 4922 6259 gene locus_tag LOCUS_24840 4922 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 6256 7677 gene locus_tag LOCUS_24850 6256 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 7781 9358 gene locus_tag LOCUS_24860 7781 9358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 9397 10338 gene locus_tag LOCUS_24870 9397 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 10470 12458 gene locus_tag LOCUS_24880 10470 12458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 12474 13367 gene locus_tag LOCUS_24890 12474 13367 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267772.1 protein_id gnl|my_center|LOCUS_24890 13386 13622 gene locus_tag LOCUS_24900 13386 13622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 >Feature sequence101 995 1837 gene locus_tag LOCUS_24910 995 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528731.1 protein_id gnl|my_center|LOCUS_24910 1842 2651 gene locus_tag LOCUS_24920 1842 2651 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 protein_id gnl|my_center|LOCUS_24920 3034 2693 gene locus_tag LOCUS_24930 3034 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 3329 5038 gene locus_tag LOCUS_24940 3329 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 5052 6131 gene locus_tag LOCUS_24950 5052 6131 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_24950 6152 7366 gene locus_tag LOCUS_24960 6152 7366 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348045.1 protein_id gnl|my_center|LOCUS_24960 7690 7412 gene locus_tag LOCUS_24970 7690 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 8875 7826 gene locus_tag LOCUS_24980 8875 7826 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_24980 10363 8921 gene locus_tag LOCUS_24990 10363 8921 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977913.1 protein_id gnl|my_center|LOCUS_24990 12553 10367 gene locus_tag LOCUS_25000 12553 10367 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_25000 12690 13424 gene locus_tag LOCUS_25010 12690 13424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 13495 13884 gene locus_tag LOCUS_25020 13495 13884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence102 260 379 gene locus_tag LOCUS_25030 260 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 609 430 gene locus_tag LOCUS_25040 609 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 1916 552 gene locus_tag LOCUS_25050 1916 552 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529689.1 protein_id gnl|my_center|LOCUS_25050 3534 1918 gene locus_tag LOCUS_25060 3534 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 6768 3598 gene locus_tag LOCUS_25070 6768 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 6770 7468 gene locus_tag LOCUS_25080 6770 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 8246 7578 gene locus_tag LOCUS_25090 8246 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 8530 9114 gene locus_tag LOCUS_25100 8530 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 9197 9952 gene locus_tag LOCUS_25110 gene modA 9197 9952 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101987.1 protein_id gnl|my_center|LOCUS_25110 9955 10635 gene locus_tag LOCUS_25120 gene modB 9955 10635 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553595.1 protein_id gnl|my_center|LOCUS_25120 10632 11696 gene locus_tag LOCUS_25130 gene modC 10632 11696 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836198.1 protein_id gnl|my_center|LOCUS_25130 13533 11950 gene locus_tag LOCUS_25140 13533 11950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 >Feature sequence103 210 1022 gene locus_tag LOCUS_25150 210 1022 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722373.1 protein_id gnl|my_center|LOCUS_25150 2703 1015 gene locus_tag LOCUS_25160 gene ilvD 2703 1015 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228538.1 protein_id gnl|my_center|LOCUS_25160 2745 3308 gene locus_tag LOCUS_25170 2745 3308 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_25170 3411 3872 gene locus_tag LOCUS_25180 3411 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 4025 4909 gene locus_tag LOCUS_25190 4025 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 4950 5432 gene locus_tag LOCUS_25200 4950 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 5429 6412 gene locus_tag LOCUS_25210 5429 6412 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110924.1 protein_id gnl|my_center|LOCUS_25210 7142 6423 gene locus_tag LOCUS_25220 7142 6423 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980407.1 protein_id gnl|my_center|LOCUS_25220 7672 7145 gene locus_tag LOCUS_25230 7672 7145 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201132289.1 protein_id gnl|my_center|LOCUS_25230 7769 10354 gene locus_tag LOCUS_25240 7769 10354 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928589.1 protein_id gnl|my_center|LOCUS_25240 10364 11569 gene locus_tag LOCUS_25250 gene lhgO 10364 11569 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_25250 <13694 11554 gene locus_tag LOCUS_25260 <13694 11554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921330.1:PAS domain S-box protein >Feature sequence104 <1 897 gene locus_tag LOCUS_25270 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479974.1:bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU 902 2728 gene locus_tag LOCUS_25280 gene glmS 902 2728 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_25280 2815 4701 gene locus_tag LOCUS_25290 gene asnB 2815 4701 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_25290 4698 6380 gene locus_tag LOCUS_25300 4698 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 6439 7641 gene locus_tag LOCUS_25310 6439 7641 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_25310 7653 9350 gene locus_tag LOCUS_25320 7653 9350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 9343 10227 gene locus_tag LOCUS_25330 gene hslO 9343 10227 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943960.1 protein_id gnl|my_center|LOCUS_25330 12536 10224 gene locus_tag LOCUS_25340 12536 10224 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880789.1 protein_id gnl|my_center|LOCUS_25340 <13436 12578 gene locus_tag LOCUS_25350 <13436 12578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003402902.1:flagellar motor protein MotB >Feature sequence105 833 687 gene locus_tag LOCUS_25360 833 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 832 1350 gene locus_tag LOCUS_25370 832 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 1663 3078 gene locus_tag LOCUS_25380 1663 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 3075 4070 gene locus_tag LOCUS_25390 3075 4070 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582647.1 protein_id gnl|my_center|LOCUS_25390 4067 4942 gene locus_tag LOCUS_25400 4067 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 4939 6759 gene locus_tag LOCUS_25410 4939 6759 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259247.1 protein_id gnl|my_center|LOCUS_25410 6756 9323 gene locus_tag LOCUS_25420 6756 9323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 10297 9320 gene locus_tag LOCUS_25430 gene prfB 10297 9320 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205591.1 protein_id gnl|my_center|LOCUS_25430 12254 10533 gene locus_tag LOCUS_25440 12254 10533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 12885 12451 gene locus_tag LOCUS_25450 12885 12451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 13306 12908 gene locus_tag LOCUS_25460 13306 12908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 >Feature sequence106 1965 2228 gene locus_tag LOCUS_25470 1965 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 2246 2401 gene locus_tag LOCUS_25480 2246 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 4728 2383 gene locus_tag LOCUS_25490 4728 2383 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_25490 4823 8137 gene locus_tag LOCUS_25500 4823 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 8241 8068 gene locus_tag LOCUS_25510 8241 8068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 8629 8285 gene locus_tag LOCUS_25520 8629 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 9644 8631 gene locus_tag LOCUS_25530 9644 8631 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230294.1 protein_id gnl|my_center|LOCUS_25530 9859 10869 gene locus_tag LOCUS_25540 9859 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 10866 11645 gene locus_tag LOCUS_25550 10866 11645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence107 353 54 gene locus_tag LOCUS_25560 353 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 1626 895 gene locus_tag LOCUS_25570 1626 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 1853 2752 gene locus_tag LOCUS_25580 gene nhaR 1853 2752 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_25580 2837 3145 gene locus_tag LOCUS_25590 2837 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 3142 3573 gene locus_tag LOCUS_25600 3142 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 3845 4561 gene locus_tag LOCUS_25610 3845 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 5134 4577 gene locus_tag LOCUS_25620 5134 4577 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200916.1 protein_id gnl|my_center|LOCUS_25620 5192 6052 gene locus_tag LOCUS_25630 5192 6052 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226787.1 protein_id gnl|my_center|LOCUS_25630 7246 6401 gene locus_tag LOCUS_25640 7246 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 7844 7446 gene locus_tag LOCUS_25650 7844 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 7879 8889 gene locus_tag LOCUS_25660 7879 8889 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647785.1 protein_id gnl|my_center|LOCUS_25660 11477 8910 gene locus_tag LOCUS_25670 11477 8910 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256996.1 protein_id gnl|my_center|LOCUS_25670 12710 11529 gene locus_tag LOCUS_25680 12710 11529 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201247873.1 protein_id gnl|my_center|LOCUS_25680 >Feature sequence108 1171 14 gene locus_tag LOCUS_25690 1171 14 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064155.1 protein_id gnl|my_center|LOCUS_25690 2448 1315 gene locus_tag LOCUS_25700 2448 1315 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_25700 4078 2678 gene locus_tag LOCUS_25710 4078 2678 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_25710 4198 5064 gene locus_tag LOCUS_25720 4198 5064 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921324.1 protein_id gnl|my_center|LOCUS_25720 5686 5075 gene locus_tag LOCUS_25730 5686 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 7764 5917 gene locus_tag LOCUS_25740 7764 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 9422 7761 gene locus_tag LOCUS_25750 9422 7761 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005575582.1 protein_id gnl|my_center|LOCUS_25750 10387 9566 gene locus_tag LOCUS_25760 10387 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 11343 10573 gene locus_tag LOCUS_25770 11343 10573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966641.1 protein_id gnl|my_center|LOCUS_25770 12140 11340 gene locus_tag LOCUS_25780 12140 11340 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_25780 12241 12897 gene locus_tag LOCUS_25790 12241 12897 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence109 2726 384 gene locus_tag LOCUS_25800 2726 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 5332 2915 gene locus_tag LOCUS_25810 5332 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 8121 5665 gene locus_tag LOCUS_25820 8121 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 12771 8197 gene locus_tag LOCUS_25830 12771 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 >Feature sequence110 <1 589 gene locus_tag LOCUS_25840 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038552.1:CsgG/HfaB family protein 611 835 gene locus_tag LOCUS_25850 611 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25850 832 1101 gene locus_tag LOCUS_25860 832 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 1354 1142 gene locus_tag LOCUS_25870 1354 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 3436 1409 gene locus_tag LOCUS_25880 3436 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 3796 3509 gene locus_tag LOCUS_25890 3796 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 5952 3793 gene locus_tag LOCUS_25900 5952 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 6899 5949 gene locus_tag LOCUS_25910 gene coxB 6899 5949 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258007.1 protein_id gnl|my_center|LOCUS_25910 7678 6896 gene locus_tag LOCUS_25920 7678 6896 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_25920 8052 7675 gene locus_tag LOCUS_25930 8052 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 9199 8042 gene locus_tag LOCUS_25940 9199 8042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062436.1 protein_id gnl|my_center|LOCUS_25940 9750 9196 gene locus_tag LOCUS_25950 9750 9196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 10276 9740 gene locus_tag LOCUS_25960 10276 9740 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256520.1 protein_id gnl|my_center|LOCUS_25960 11646 10273 gene locus_tag LOCUS_25970 gene nrfD 11646 10273 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_25970 <13173 11648 gene locus_tag LOCUS_25980 <13173 11648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258002.1:TAT-variant-translocated molybdopterin oxidoreductase >Feature sequence111 1108 326 gene locus_tag LOCUS_25990 1108 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 2366 1221 gene locus_tag LOCUS_26000 2366 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 3018 2518 gene locus_tag LOCUS_26010 3018 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26010 3169 4596 gene locus_tag LOCUS_26020 3169 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 5340 4612 gene locus_tag LOCUS_26030 5340 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 7147 5474 gene locus_tag LOCUS_26040 7147 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 7352 7188 gene locus_tag LOCUS_26050 7352 7188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 7339 8544 gene locus_tag LOCUS_26060 7339 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 8544 9320 gene locus_tag LOCUS_26070 8544 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 10004 9327 gene locus_tag LOCUS_26080 10004 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 10365 9994 gene locus_tag LOCUS_26090 gene fdx 10365 9994 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092818.1 protein_id gnl|my_center|LOCUS_26090 10444 11286 gene locus_tag LOCUS_26100 10444 11286 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083337.1 protein_id gnl|my_center|LOCUS_26100 11577 11296 gene locus_tag LOCUS_26110 11577 11296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 12559 11609 gene locus_tag LOCUS_26120 12559 11609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence112 787 2178 gene locus_tag LOCUS_26130 787 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2961 2302 gene locus_tag LOCUS_26140 2961 2302 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_26140 4120 3104 gene locus_tag LOCUS_26150 4120 3104 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_26150 4821 4117 gene locus_tag LOCUS_26160 4821 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 5314 4832 gene locus_tag LOCUS_26170 5314 4832 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102894.1 protein_id gnl|my_center|LOCUS_26170 5409 5900 gene locus_tag LOCUS_26180 5409 5900 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090577.1 protein_id gnl|my_center|LOCUS_26180 5897 8248 gene locus_tag LOCUS_26190 5897 8248 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729127.1 protein_id gnl|my_center|LOCUS_26190 8782 8327 gene locus_tag LOCUS_26200 8782 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 8951 10051 gene locus_tag LOCUS_26210 8951 10051 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112330.1 protein_id gnl|my_center|LOCUS_26210 10111 10719 gene locus_tag LOCUS_26220 10111 10719 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141890.1 protein_id gnl|my_center|LOCUS_26220 11941 10724 gene locus_tag LOCUS_26230 11941 10724 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192776.1 protein_id gnl|my_center|LOCUS_26230 >Feature sequence113 1093 89 gene locus_tag LOCUS_26240 1093 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 1401 1093 gene locus_tag LOCUS_26250 1401 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 1669 1944 gene locus_tag LOCUS_26260 1669 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 2576 1971 gene locus_tag LOCUS_26270 2576 1971 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086729.1 protein_id gnl|my_center|LOCUS_26270 2716 4236 gene locus_tag LOCUS_26280 2716 4236 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258085.1 protein_id gnl|my_center|LOCUS_26280 4233 5042 gene locus_tag LOCUS_26290 4233 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 5113 5943 gene locus_tag LOCUS_26300 5113 5943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_26300 5957 7093 gene locus_tag LOCUS_26310 5957 7093 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038987.1 protein_id gnl|my_center|LOCUS_26310 7098 8261 gene locus_tag LOCUS_26320 7098 8261 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941825.1 protein_id gnl|my_center|LOCUS_26320 8265 9491 gene locus_tag LOCUS_26330 8265 9491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 9725 10135 gene locus_tag LOCUS_26340 9725 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 10272 11222 gene locus_tag LOCUS_26350 10272 11222 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728191.1 protein_id gnl|my_center|LOCUS_26350 11335 12228 gene locus_tag LOCUS_26360 11335 12228 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950743.1 protein_id gnl|my_center|LOCUS_26360 12464 12778 gene locus_tag LOCUS_26370 12464 12778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence114 538 3039 gene locus_tag LOCUS_26380 538 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 3501 3046 gene locus_tag LOCUS_26390 3501 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 4236 3754 gene locus_tag LOCUS_26400 4236 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 5962 4316 gene locus_tag LOCUS_26410 5962 4316 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986845.1 protein_id gnl|my_center|LOCUS_26410 6150 5962 gene locus_tag LOCUS_26420 6150 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 6397 6161 gene locus_tag LOCUS_26430 6397 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 6885 6415 gene locus_tag LOCUS_26440 6885 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 7538 6963 gene locus_tag LOCUS_26450 7538 6963 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093084.1 protein_id gnl|my_center|LOCUS_26450 9519 7792 gene locus_tag LOCUS_26460 9519 7792 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080127.1 protein_id gnl|my_center|LOCUS_26460 10045 9722 gene locus_tag LOCUS_26470 10045 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 10434 10042 gene locus_tag LOCUS_26480 10434 10042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 10527 11822 gene locus_tag LOCUS_26490 10527 11822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence115 340 762 gene locus_tag LOCUS_26500 340 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 759 1148 gene locus_tag LOCUS_26510 759 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 2151 1138 gene locus_tag LOCUS_26520 2151 1138 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524613.1 protein_id gnl|my_center|LOCUS_26520 3190 2219 gene locus_tag LOCUS_26530 3190 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 4610 3162 gene locus_tag LOCUS_26540 4610 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 5342 4626 gene locus_tag LOCUS_26550 5342 4626 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029799.1 protein_id gnl|my_center|LOCUS_26550 5968 5339 gene locus_tag LOCUS_26560 5968 5339 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144143.1 protein_id gnl|my_center|LOCUS_26560 6380 8956 gene locus_tag LOCUS_26570 6380 8956 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942827.1 protein_id gnl|my_center|LOCUS_26570 9166 9801 gene locus_tag LOCUS_26580 9166 9801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 9939 10424 gene locus_tag LOCUS_26590 9939 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 10694 10503 gene locus_tag LOCUS_26600 10694 10503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 11003 10812 gene locus_tag LOCUS_26610 11003 10812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 11367 12113 gene locus_tag LOCUS_26620 11367 12113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 12103 12396 gene locus_tag LOCUS_26630 12103 12396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence116 492 82 gene locus_tag LOCUS_26640 492 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 1667 489 gene locus_tag LOCUS_26650 1667 489 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_26650 2410 1667 gene locus_tag LOCUS_26660 2410 1667 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_26660 3140 2412 gene locus_tag LOCUS_26670 3140 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 3204 3239 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3673 3263 gene locus_tag LOCUS_26680 3673 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 3950 3666 gene locus_tag LOCUS_26690 3950 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 4070 5329 gene locus_tag LOCUS_26700 4070 5329 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389729.1 protein_id gnl|my_center|LOCUS_26700 5326 6594 gene locus_tag LOCUS_26710 5326 6594 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022225.1 protein_id gnl|my_center|LOCUS_26710 6633 7568 gene locus_tag LOCUS_26720 gene lipA 6633 7568 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090955.1 protein_id gnl|my_center|LOCUS_26720 7573 8544 gene locus_tag LOCUS_26730 7573 8544 CDS product lipase secretion chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117631.1 protein_id gnl|my_center|LOCUS_26730 8696 9139 gene locus_tag LOCUS_26740 8696 9139 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222322.1 protein_id gnl|my_center|LOCUS_26740 9136 9633 gene locus_tag LOCUS_26750 9136 9633 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229065.1 protein_id gnl|my_center|LOCUS_26750 10713 9637 gene locus_tag LOCUS_26760 10713 9637 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366530.1 protein_id gnl|my_center|LOCUS_26760 11710 11261 gene locus_tag LOCUS_26770 11710 11261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 11802 12167 gene locus_tag LOCUS_26780 11802 12167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 >Feature sequence117 1506 1703 gene locus_tag LOCUS_26790 1506 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 1808 2047 gene locus_tag LOCUS_26800 1808 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 2484 2071 gene locus_tag LOCUS_26810 2484 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 3117 2578 gene locus_tag LOCUS_26820 3117 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 3925 3122 gene locus_tag LOCUS_26830 3925 3122 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_26830 4584 3970 gene locus_tag LOCUS_26840 4584 3970 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_26840 5861 4578 gene locus_tag LOCUS_26850 gene hflX 5861 4578 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_26850 9385 5858 gene locus_tag LOCUS_26860 gene dnaE 9385 5858 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_26860 9609 9770 gene locus_tag LOCUS_26870 9609 9770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 11768 9870 gene locus_tag LOCUS_26880 11768 9870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence118 1323 4034 gene locus_tag LOCUS_26890 1323 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 5163 4405 gene locus_tag LOCUS_26900 5163 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 6057 5164 gene locus_tag LOCUS_26910 6057 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 7286 6054 gene locus_tag LOCUS_26920 7286 6054 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119960.1 protein_id gnl|my_center|LOCUS_26920 7626 8603 gene locus_tag LOCUS_26930 7626 8603 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965384.1 protein_id gnl|my_center|LOCUS_26930 8614 9438 gene locus_tag LOCUS_26940 gene cysT 8614 9438 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_26940 9425 10303 gene locus_tag LOCUS_26950 gene cysW 9425 10303 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534651.1 protein_id gnl|my_center|LOCUS_26950 10300 11358 gene locus_tag LOCUS_26960 10300 11358 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942002.1 protein_id gnl|my_center|LOCUS_26960 12408 11368 gene locus_tag LOCUS_26970 12408 11368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence119 <1 767 gene locus_tag LOCUS_26980 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014327675.1:zinc-dependent alcohol dehydrogenase family protein 811 1680 gene locus_tag LOCUS_26990 811 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 3133 1697 gene locus_tag LOCUS_27000 gene atoC 3133 1697 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_27000 3533 3102 gene locus_tag LOCUS_27010 3533 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 4801 3530 gene locus_tag LOCUS_27020 4801 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 5128 4946 gene locus_tag LOCUS_27030 5128 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 5054 5704 gene locus_tag LOCUS_27040 5054 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 5768 6469 gene locus_tag LOCUS_27050 5768 6469 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545169.1 protein_id gnl|my_center|LOCUS_27050 7252 6473 gene locus_tag LOCUS_27060 7252 6473 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258719.1 protein_id gnl|my_center|LOCUS_27060 7442 8812 gene locus_tag LOCUS_27070 7442 8812 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016943.1 protein_id gnl|my_center|LOCUS_27070 10400 8847 gene locus_tag LOCUS_27080 10400 8847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 11135 10497 gene locus_tag LOCUS_27090 11135 10497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 11222 11761 gene locus_tag LOCUS_27100 gene def 11222 11761 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814412.1 protein_id gnl|my_center|LOCUS_27100 12092 11745 gene locus_tag LOCUS_27110 12092 11745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 12121 12303 gene locus_tag LOCUS_27120 12121 12303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 >Feature sequence120 <1 996 gene locus_tag LOCUS_27130 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259387.1:glycosyltransferase 993 1925 gene locus_tag LOCUS_27140 993 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 1922 2767 gene locus_tag LOCUS_27150 1922 2767 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942157.1 protein_id gnl|my_center|LOCUS_27150 2764 3636 gene locus_tag LOCUS_27160 2764 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 3633 5207 gene locus_tag LOCUS_27170 3633 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 5221 5895 gene locus_tag LOCUS_27180 5221 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 5947 6912 gene locus_tag LOCUS_27190 5947 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 6913 8814 gene locus_tag LOCUS_27200 6913 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 9343 10329 gene locus_tag LOCUS_27210 9343 10329 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037478.1 protein_id gnl|my_center|LOCUS_27210 12016 10379 gene locus_tag LOCUS_27220 12016 10379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence121 808 2457 gene locus_tag LOCUS_27230 808 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 3513 2506 gene locus_tag LOCUS_27240 3513 2506 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729474.1 protein_id gnl|my_center|LOCUS_27240 4624 3515 gene locus_tag LOCUS_27250 4624 3515 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_27250 6303 4621 gene locus_tag LOCUS_27260 6303 4621 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_27260 6387 6914 gene locus_tag LOCUS_27270 6387 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 8488 6899 gene locus_tag LOCUS_27280 gene glgP 8488 6899 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964175.1 protein_id gnl|my_center|LOCUS_27280 9287 8508 gene locus_tag LOCUS_27290 9287 8508 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229505.1 protein_id gnl|my_center|LOCUS_27290 9337 9846 gene locus_tag LOCUS_27300 gene dcd 9337 9846 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902137.1 protein_id gnl|my_center|LOCUS_27300 9941 12121 gene locus_tag LOCUS_27310 9941 12121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence122 1176 2462 gene locus_tag LOCUS_27320 1176 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 2459 3946 gene locus_tag LOCUS_27330 2459 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 3966 4805 gene locus_tag LOCUS_27340 3966 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 4802 5812 gene locus_tag LOCUS_27350 4802 5812 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897464.1 protein_id gnl|my_center|LOCUS_27350 5809 6597 gene locus_tag LOCUS_27360 5809 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 6775 6599 gene locus_tag LOCUS_27370 6775 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 7246 6818 gene locus_tag LOCUS_27380 7246 6818 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899952.1 protein_id gnl|my_center|LOCUS_27380 7521 7243 gene locus_tag LOCUS_27390 7521 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 7942 8373 gene locus_tag LOCUS_27400 gene ndhC 7942 8373 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_27400 8384 8881 gene locus_tag LOCUS_27410 8384 8881 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385029.1 protein_id gnl|my_center|LOCUS_27410 8887 9396 gene locus_tag LOCUS_27420 8887 9396 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932450.1 protein_id gnl|my_center|LOCUS_27420 9393 10553 gene locus_tag LOCUS_27430 gene nuoD 9393 10553 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_27430 10558 11784 gene locus_tag LOCUS_27440 gene nuoH 10558 11784 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932452.1 protein_id gnl|my_center|LOCUS_27440 >Feature sequence123 64 591 gene locus_tag LOCUS_27450 64 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 692 1099 gene locus_tag LOCUS_27460 692 1099 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085846.1 protein_id gnl|my_center|LOCUS_27460 1233 3167 gene locus_tag LOCUS_27470 1233 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 3380 3970 gene locus_tag LOCUS_27480 3380 3970 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_27480 4367 4053 gene locus_tag LOCUS_27490 4367 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 4655 4377 gene locus_tag LOCUS_27500 4655 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 5184 6218 gene locus_tag LOCUS_27510 5184 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 8332 6755 gene locus_tag LOCUS_27520 8332 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 8646 9722 gene locus_tag LOCUS_27530 8646 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 10651 9884 gene locus_tag LOCUS_27540 10651 9884 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897259.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence124 1698 169 gene locus_tag LOCUS_27550 gene hutH 1698 169 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681759.1 protein_id gnl|my_center|LOCUS_27550 1802 2578 gene locus_tag LOCUS_27560 gene nodB 1802 2578 CDS product chitooligosaccharide deacetylase NodB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875356.1 protein_id gnl|my_center|LOCUS_27560 2594 4033 gene locus_tag LOCUS_27570 2594 4033 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_27570 4026 5237 gene locus_tag LOCUS_27580 4026 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 5352 5954 gene locus_tag LOCUS_27590 5352 5954 CDS product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104390.1 protein_id gnl|my_center|LOCUS_27590 6971 5919 gene locus_tag LOCUS_27600 6971 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 8121 6949 gene locus_tag LOCUS_27610 8121 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 9522 8131 gene locus_tag LOCUS_27620 9522 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 9626 11236 gene locus_tag LOCUS_27630 9626 11236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27630 11237 11800 gene locus_tag LOCUS_27640 11237 11800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 >Feature sequence125 33 419 gene locus_tag LOCUS_27650 33 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 1065 442 gene locus_tag LOCUS_27660 1065 442 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920924.1 protein_id gnl|my_center|LOCUS_27660 1479 1123 gene locus_tag LOCUS_27670 1479 1123 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942852.1 protein_id gnl|my_center|LOCUS_27670 3071 1476 gene locus_tag LOCUS_27680 3071 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 4185 3328 gene locus_tag LOCUS_27690 4185 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 4399 4605 gene locus_tag LOCUS_27700 4399 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 5205 4585 gene locus_tag LOCUS_27710 5205 4585 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172637.1 protein_id gnl|my_center|LOCUS_27710 5279 5698 gene locus_tag LOCUS_27720 5279 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 5695 6915 gene locus_tag LOCUS_27730 5695 6915 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877816.1 protein_id gnl|my_center|LOCUS_27730 7138 6953 gene locus_tag LOCUS_27740 7138 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 7410 7955 gene locus_tag LOCUS_27750 7410 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 7955 9886 gene locus_tag LOCUS_27760 7955 9886 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225982.1 protein_id gnl|my_center|LOCUS_27760 >Feature sequence126 2 1015 gene locus_tag LOCUS_27770 2 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 1018 1947 gene locus_tag LOCUS_27780 1018 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 2713 1955 gene locus_tag LOCUS_27790 2713 1955 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383377.1 protein_id gnl|my_center|LOCUS_27790 5016 2794 gene locus_tag LOCUS_27800 5016 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 6815 5574 gene locus_tag LOCUS_27810 6815 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 8440 6782 gene locus_tag LOCUS_27820 8440 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 9478 8690 gene locus_tag LOCUS_27830 9478 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 10218 9592 gene locus_tag LOCUS_27840 10218 9592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 9953 9979 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10475 11440 gene locus_tag LOCUS_27850 10475 11440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 >Feature sequence127 <1 1365 gene locus_tag LOCUS_27860 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000039947.1:alginate lyase family protein 1362 2645 gene locus_tag LOCUS_27870 1362 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 2638 3855 gene locus_tag LOCUS_27880 2638 3855 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141066.1 protein_id gnl|my_center|LOCUS_27880 3831 5150 gene locus_tag LOCUS_27890 3831 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 5150 6490 gene locus_tag LOCUS_27900 5150 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 6651 7844 gene locus_tag LOCUS_27910 6651 7844 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141066.1 protein_id gnl|my_center|LOCUS_27910 7841 8584 gene locus_tag LOCUS_27920 7841 8584 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310727.1 protein_id gnl|my_center|LOCUS_27920 8584 9720 gene locus_tag LOCUS_27930 8584 9720 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027544.1 protein_id gnl|my_center|LOCUS_27930 9717 11012 gene locus_tag LOCUS_27940 9717 11012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence128 1852 2145 gene locus_tag LOCUS_27950 1852 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 2156 3286 gene locus_tag LOCUS_27960 2156 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 3301 5658 gene locus_tag LOCUS_27970 3301 5658 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389244.1 protein_id gnl|my_center|LOCUS_27970 5655 8186 gene locus_tag LOCUS_27980 5655 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 8183 8704 gene locus_tag LOCUS_27990 8183 8704 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_27990 8768 9481 gene locus_tag LOCUS_28000 8768 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 9459 10673 gene locus_tag LOCUS_28010 9459 10673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 10670 11743 gene locus_tag LOCUS_28020 10670 11743 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121410.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence129 617 405 gene locus_tag LOCUS_28030 617 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 788 1369 gene locus_tag LOCUS_28040 788 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 3681 1648 gene locus_tag LOCUS_28050 3681 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 3774 5201 gene locus_tag LOCUS_28060 3774 5201 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035887521.1 protein_id gnl|my_center|LOCUS_28060 5204 6385 gene locus_tag LOCUS_28070 5204 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 7562 6342 gene locus_tag LOCUS_28080 7562 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 7625 7981 gene locus_tag LOCUS_28090 7625 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 8089 8895 gene locus_tag LOCUS_28100 8089 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 8903 10057 gene locus_tag LOCUS_28110 8903 10057 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257829.1 protein_id gnl|my_center|LOCUS_28110 10231 11706 gene locus_tag LOCUS_28120 10231 11706 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120122.1 protein_id gnl|my_center|LOCUS_28120 >Feature sequence130 788 1573 gene locus_tag LOCUS_28130 788 1573 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065489.1 protein_id gnl|my_center|LOCUS_28130 2729 1581 gene locus_tag LOCUS_28140 2729 1581 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_28140 3368 2733 gene locus_tag LOCUS_28150 gene gstB 3368 2733 CDS product glutathione S-transferase GstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295292.1 protein_id gnl|my_center|LOCUS_28150 3652 3368 gene locus_tag LOCUS_28160 3652 3368 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057607.1 protein_id gnl|my_center|LOCUS_28160 3709 4680 gene locus_tag LOCUS_28170 3709 4680 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_28170 7257 4687 gene locus_tag LOCUS_28180 7257 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 7452 7874 gene locus_tag LOCUS_28190 7452 7874 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101529.1 protein_id gnl|my_center|LOCUS_28190 7871 8488 gene locus_tag LOCUS_28200 7871 8488 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140910.1 protein_id gnl|my_center|LOCUS_28200 8890 8489 gene locus_tag LOCUS_28210 8890 8489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 8969 9433 gene locus_tag LOCUS_28220 8969 9433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 9475 10260 gene locus_tag LOCUS_28230 9475 10260 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546873.1 protein_id gnl|my_center|LOCUS_28230 10297 10659 gene locus_tag LOCUS_28240 10297 10659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 10656 11486 gene locus_tag LOCUS_28250 10656 11486 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235433858.1 protein_id gnl|my_center|LOCUS_28250 >Feature sequence131 1 561 gene locus_tag LOCUS_28260 1 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 771 577 gene locus_tag LOCUS_28270 771 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 1128 1490 gene locus_tag LOCUS_28280 1128 1490 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123164.1 protein_id gnl|my_center|LOCUS_28280 1556 1855 gene locus_tag LOCUS_28290 1556 1855 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140928.1 protein_id gnl|my_center|LOCUS_28290 1940 1867 gene locus_tag LOCUS_t00300 1940 1867 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2167 2003 gene locus_tag LOCUS_28300 2167 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 2430 2173 gene locus_tag LOCUS_28310 2430 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 2849 2478 gene locus_tag LOCUS_28320 2849 2478 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530041.1 protein_id gnl|my_center|LOCUS_28320 2906 4219 gene locus_tag LOCUS_28330 2906 4219 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938462.1 protein_id gnl|my_center|LOCUS_28330 4345 4271 gene locus_tag LOCUS_t00310 4345 4271 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4682 5821 gene locus_tag LOCUS_28340 4682 5821 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_28340 5826 8429 gene locus_tag LOCUS_28350 5826 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 8426 10024 gene locus_tag LOCUS_28360 gene lnt 8426 10024 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_28360 10390 11295 gene locus_tag LOCUS_28370 10390 11295 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_28370 >Feature sequence132 <1 658 gene locus_tag LOCUS_28380 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250671.1:glycosyltransferase family 2 protein 651 3242 gene locus_tag LOCUS_28390 651 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 3235 4131 gene locus_tag LOCUS_28400 3235 4131 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_28400 4128 5174 gene locus_tag LOCUS_28410 4128 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 5171 6031 gene locus_tag LOCUS_28420 5171 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 6868 6038 gene locus_tag LOCUS_28430 6868 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 7179 6910 gene locus_tag LOCUS_28440 7179 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 7251 8705 gene locus_tag LOCUS_28450 7251 8705 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_28450 8707 9864 gene locus_tag LOCUS_28460 8707 9864 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731350.1 protein_id gnl|my_center|LOCUS_28460 10345 9887 gene locus_tag LOCUS_28470 10345 9887 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413432.1 protein_id gnl|my_center|LOCUS_28470 10652 10326 gene locus_tag LOCUS_28480 10652 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 11226 10642 gene locus_tag LOCUS_28490 11226 10642 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_28490 >Feature sequence133 1882 233 gene locus_tag LOCUS_28500 1882 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 3126 1840 gene locus_tag LOCUS_28510 3126 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 3595 3215 gene locus_tag LOCUS_28520 3595 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 4044 3727 gene locus_tag LOCUS_28530 4044 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 5190 4504 gene locus_tag LOCUS_28540 5190 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 5312 5818 gene locus_tag LOCUS_28550 5312 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 8377 6617 gene locus_tag LOCUS_28560 8377 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 9158 8481 gene locus_tag LOCUS_28570 9158 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 9781 9155 gene locus_tag LOCUS_28580 9781 9155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 10395 9769 gene locus_tag LOCUS_28590 10395 9769 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256807.1 protein_id gnl|my_center|LOCUS_28590 11207 10392 gene locus_tag LOCUS_28600 11207 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 >Feature sequence134 <1 1040 gene locus_tag LOCUS_28610 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679769.1:outer membrane lipoprotein-sorting protein 1174 2400 gene locus_tag LOCUS_28620 1174 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 3153 2404 gene locus_tag LOCUS_28630 3153 2404 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 protein_id gnl|my_center|LOCUS_28630 3289 5043 gene locus_tag LOCUS_28640 3289 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 5093 6235 gene locus_tag LOCUS_28650 5093 6235 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_28650 6237 7628 gene locus_tag LOCUS_28660 6237 7628 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296871.1 protein_id gnl|my_center|LOCUS_28660 7625 8767 gene locus_tag LOCUS_28670 7625 8767 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064155.1 protein_id gnl|my_center|LOCUS_28670 8778 9914 gene locus_tag LOCUS_28680 8778 9914 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 protein_id gnl|my_center|LOCUS_28680 9911 10426 gene locus_tag LOCUS_28690 9911 10426 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086612.1 protein_id gnl|my_center|LOCUS_28690 10423 10854 gene locus_tag LOCUS_28700 10423 10854 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086611.1 protein_id gnl|my_center|LOCUS_28700 10859 11611 gene locus_tag LOCUS_28710 10859 11611 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 protein_id gnl|my_center|LOCUS_28710 >Feature sequence135 1801 605 gene locus_tag LOCUS_28720 gene metK 1801 605 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_28720 2164 1874 gene locus_tag LOCUS_28730 2164 1874 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067453.1 protein_id gnl|my_center|LOCUS_28730 2563 2171 gene locus_tag LOCUS_28740 2563 2171 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_28740 3476 2613 gene locus_tag LOCUS_28750 gene rapZ 3476 2613 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942529.1 protein_id gnl|my_center|LOCUS_28750 4402 3479 gene locus_tag LOCUS_28760 gene hprK 4402 3479 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_28760 4860 4399 gene locus_tag LOCUS_28770 4860 4399 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_28770 5402 4857 gene locus_tag LOCUS_28780 gene raiA 5402 4857 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_28780 6949 5477 gene locus_tag LOCUS_28790 gene rpoN 6949 5477 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_28790 7703 6966 gene locus_tag LOCUS_28800 gene lptB 7703 6966 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_28800 8380 7700 gene locus_tag LOCUS_28810 8380 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 8924 8364 gene locus_tag LOCUS_28820 8924 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 9942 9025 gene locus_tag LOCUS_28830 9942 9025 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869059.1 protein_id gnl|my_center|LOCUS_28830 11028 10060 gene locus_tag LOCUS_28840 11028 10060 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_28840 <11620 11025 gene locus_tag LOCUS_28850 <11620 11025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003041978.1:3-deoxy-8-phosphooctulonate synthase >Feature sequence136 852 469 gene locus_tag LOCUS_28860 852 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 1057 1584 gene locus_tag LOCUS_28870 1057 1584 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_28870 1756 2139 gene locus_tag LOCUS_28880 1756 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 2691 2377 gene locus_tag LOCUS_28890 2691 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 2885 2975 gene locus_tag LOCUS_t00320 2885 2975 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3226 4740 gene locus_tag LOCUS_28900 3226 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 4733 5107 gene locus_tag LOCUS_28910 4733 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 5703 6578 gene locus_tag LOCUS_28920 5703 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 6469 8646 gene locus_tag LOCUS_28930 6469 8646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 >Feature sequence137 281 976 gene locus_tag LOCUS_28940 281 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 1823 981 gene locus_tag LOCUS_28950 1823 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 2795 1935 gene locus_tag LOCUS_28960 2795 1935 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229550.1 protein_id gnl|my_center|LOCUS_28960 4040 2862 gene locus_tag LOCUS_28970 4040 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 4948 4655 gene locus_tag LOCUS_28980 4948 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 5071 5241 gene locus_tag LOCUS_28990 5071 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 5278 6291 gene locus_tag LOCUS_29000 5278 6291 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822893.1 protein_id gnl|my_center|LOCUS_29000 6383 7840 gene locus_tag LOCUS_29010 6383 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 8737 7850 gene locus_tag LOCUS_29020 8737 7850 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182306545.1 protein_id gnl|my_center|LOCUS_29020 9339 8875 gene locus_tag LOCUS_29030 9339 8875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 10120 9893 gene locus_tag LOCUS_29040 10120 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 10023 10559 gene locus_tag LOCUS_29050 10023 10559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 >Feature sequence138 2 385 gene locus_tag LOCUS_29060 2 385 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_29060 473 2167 gene locus_tag LOCUS_29070 473 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 2242 2397 gene locus_tag LOCUS_29080 2242 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 3842 2409 gene locus_tag LOCUS_29090 3842 2409 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296542.1 protein_id gnl|my_center|LOCUS_29090 3967 5691 gene locus_tag LOCUS_29100 3967 5691 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969667.1 protein_id gnl|my_center|LOCUS_29100 5933 6541 gene locus_tag LOCUS_29110 5933 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 6656 7519 gene locus_tag LOCUS_29120 6656 7519 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067118245.1 protein_id gnl|my_center|LOCUS_29120 8468 7503 gene locus_tag LOCUS_29130 8468 7503 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284372.1 protein_id gnl|my_center|LOCUS_29130 10165 8465 gene locus_tag LOCUS_29140 10165 8465 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_29140 10396 10220 gene locus_tag LOCUS_29150 10396 10220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 10499 11365 gene locus_tag LOCUS_29160 10499 11365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 >Feature sequence139 <1 615 gene locus_tag LOCUS_29170 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227830.1:argininosuccinate lyase 627 1046 gene locus_tag LOCUS_29180 627 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 1043 2299 gene locus_tag LOCUS_29190 gene lysA 1043 2299 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940834.1 protein_id gnl|my_center|LOCUS_29190 2301 3140 gene locus_tag LOCUS_29200 gene dapF 2301 3140 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_29200 3143 4015 gene locus_tag LOCUS_29210 gene dapA 3143 4015 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_29210 4008 4817 gene locus_tag LOCUS_29220 gene dapB 4008 4817 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_29220 4853 6073 gene locus_tag LOCUS_29230 4853 6073 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546563.1 protein_id gnl|my_center|LOCUS_29230 6101 6598 gene locus_tag LOCUS_29240 gene folK 6101 6598 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_29240 7315 6800 gene locus_tag LOCUS_29250 7315 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 8066 7326 gene locus_tag LOCUS_29260 8066 7326 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 protein_id gnl|my_center|LOCUS_29260 9885 8071 gene locus_tag LOCUS_29270 9885 8071 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_29270 10581 9898 gene locus_tag LOCUS_29280 10581 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_29280 10950 11282 gene locus_tag LOCUS_29290 10950 11282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 >Feature sequence140 646 20 gene locus_tag LOCUS_29300 646 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 2535 904 gene locus_tag LOCUS_29310 2535 904 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_29310 3008 2610 gene locus_tag LOCUS_29320 3008 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 3145 4290 gene locus_tag LOCUS_29330 gene dinB 3145 4290 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119785.1 protein_id gnl|my_center|LOCUS_29330 4333 7563 gene locus_tag LOCUS_29340 4333 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 >Feature sequence141 3154 1529 gene locus_tag LOCUS_29350 3154 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 4407 3223 gene locus_tag LOCUS_29360 4407 3223 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439496.1 protein_id gnl|my_center|LOCUS_29360 5567 4410 gene locus_tag LOCUS_29370 5567 4410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038987.1 protein_id gnl|my_center|LOCUS_29370 6253 5564 gene locus_tag LOCUS_29380 6253 5564 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 protein_id gnl|my_center|LOCUS_29380 7483 6269 gene locus_tag LOCUS_29390 7483 6269 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275499.1 protein_id gnl|my_center|LOCUS_29390 9689 7518 gene locus_tag LOCUS_29400 9689 7518 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467867.1 protein_id gnl|my_center|LOCUS_29400 10580 9711 gene locus_tag LOCUS_29410 10580 9711 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966131.1 protein_id gnl|my_center|LOCUS_29410 <11141 10580 gene locus_tag LOCUS_29420 <11141 10580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815983.1:SDR family oxidoreductase >Feature sequence142 564 794 gene locus_tag LOCUS_29430 564 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 937 1098 gene locus_tag LOCUS_29440 937 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 1215 1703 gene locus_tag LOCUS_29450 1215 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 2454 1654 gene locus_tag LOCUS_29460 2454 1654 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_29460 2511 3044 gene locus_tag LOCUS_29470 2511 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 3096 3410 gene locus_tag LOCUS_29480 3096 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 4749 3559 gene locus_tag LOCUS_29490 4749 3559 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_29490 5015 4746 gene locus_tag LOCUS_29500 5015 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 5364 5020 gene locus_tag LOCUS_29510 5364 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 5445 6524 gene locus_tag LOCUS_29520 5445 6524 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 protein_id gnl|my_center|LOCUS_29520 6521 7780 gene locus_tag LOCUS_29530 6521 7780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 7777 8973 gene locus_tag LOCUS_29540 7777 8973 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_29540 >Feature sequence143 487 185 gene locus_tag LOCUS_29550 487 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 1212 535 gene locus_tag LOCUS_29560 1212 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 2886 1225 gene locus_tag LOCUS_29570 2886 1225 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_29570 3758 2910 gene locus_tag LOCUS_29580 3758 2910 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_29580 4753 3806 gene locus_tag LOCUS_29590 4753 3806 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086856.1 protein_id gnl|my_center|LOCUS_29590 4838 5737 gene locus_tag LOCUS_29600 4838 5737 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272323.1 protein_id gnl|my_center|LOCUS_29600 6388 5744 gene locus_tag LOCUS_29610 6388 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 7004 6531 gene locus_tag LOCUS_29620 7004 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 7345 8550 gene locus_tag LOCUS_29630 gene sucC 7345 8550 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228010.1 protein_id gnl|my_center|LOCUS_29630 8550 9443 gene locus_tag LOCUS_29640 gene sucD 8550 9443 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228009.1 protein_id gnl|my_center|LOCUS_29640 9440 9664 gene locus_tag LOCUS_29650 9440 9664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 10456 9665 gene locus_tag LOCUS_29660 10456 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 10684 10466 gene locus_tag LOCUS_29670 10684 10466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 >Feature sequence144 3208 1463 gene locus_tag LOCUS_29680 3208 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 3367 5217 gene locus_tag LOCUS_29690 3367 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 5220 8984 gene locus_tag LOCUS_29700 5220 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 10358 8997 gene locus_tag LOCUS_29710 10358 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 >Feature sequence145 1908 448 gene locus_tag LOCUS_29720 gene gnfM 1908 448 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_29720 3016 1886 gene locus_tag LOCUS_29730 gene gnfL 3016 1886 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_29730 3391 3017 gene locus_tag LOCUS_29740 3391 3017 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256377.1 protein_id gnl|my_center|LOCUS_29740 4864 3437 gene locus_tag LOCUS_29750 4864 3437 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518852.1 protein_id gnl|my_center|LOCUS_29750 6099 4870 gene locus_tag LOCUS_29760 gene yhbH 6099 4870 CDS product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963900.1 protein_id gnl|my_center|LOCUS_29760 8052 6118 gene locus_tag LOCUS_29770 8052 6118 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518851.1 protein_id gnl|my_center|LOCUS_29770 8567 8495 gene locus_tag LOCUS_t00330 8567 8495 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8651 8577 gene locus_tag LOCUS_t00340 8651 8577 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 10109 8688 gene locus_tag LOCUS_29780 gene gltX 10109 8688 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545418.1 protein_id gnl|my_center|LOCUS_29780 10234 10620 gene locus_tag LOCUS_29790 10234 10620 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975235.1 protein_id gnl|my_center|LOCUS_29790 >Feature sequence146 3025 398 gene locus_tag LOCUS_29800 3025 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 4668 3298 gene locus_tag LOCUS_29810 4668 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 5102 5345 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcgtggtcgtcgaagtcgt 7225 6101 gene locus_tag LOCUS_29820 7225 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 7808 7305 gene locus_tag LOCUS_29830 7808 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29830 9328 8531 gene locus_tag LOCUS_29840 9328 8531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 9738 9379 gene locus_tag LOCUS_29850 9738 9379 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_29850 9943 9725 gene locus_tag LOCUS_29860 9943 9725 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143788.1 protein_id gnl|my_center|LOCUS_29860 <10983 9963 gene locus_tag LOCUS_29870 <10983 9963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405092.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence147 331 1695 gene locus_tag LOCUS_29880 331 1695 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_29880 2456 1707 gene locus_tag LOCUS_29890 2456 1707 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_29890 2628 3983 gene locus_tag LOCUS_29900 2628 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 4761 3871 gene locus_tag LOCUS_29910 4761 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 4865 5965 gene locus_tag LOCUS_29920 4865 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 6132 6404 gene locus_tag LOCUS_29930 6132 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 6401 6832 gene locus_tag LOCUS_29940 6401 6832 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141707.1 protein_id gnl|my_center|LOCUS_29940 7082 7993 gene locus_tag LOCUS_29950 7082 7993 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 protein_id gnl|my_center|LOCUS_29950 8037 8279 gene locus_tag LOCUS_29960 8037 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 >Feature sequence148 1297 431 gene locus_tag LOCUS_29970 1297 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 2500 1298 gene locus_tag LOCUS_29980 gene argJ 2500 1298 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_29980 6074 2511 gene locus_tag LOCUS_29990 6074 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 6915 6112 gene locus_tag LOCUS_30000 gene murI 6915 6112 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_30000 7536 6931 gene locus_tag LOCUS_30010 gene yihA 7536 6931 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_30010 8169 7549 gene locus_tag LOCUS_30020 8169 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 8653 8222 gene locus_tag LOCUS_30030 8653 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 8764 9210 gene locus_tag LOCUS_30040 8764 9210 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141481.1 protein_id gnl|my_center|LOCUS_30040 9646 9221 gene locus_tag LOCUS_30050 9646 9221 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867748.1 protein_id gnl|my_center|LOCUS_30050 <10707 9649 gene locus_tag LOCUS_30060 <10707 9649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942327.1:RtcB family protein >Feature sequence149 420 620 gene locus_tag LOCUS_30070 420 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 1892 645 gene locus_tag LOCUS_30080 1892 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 2089 2262 gene locus_tag LOCUS_30090 2089 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 2664 2374 gene locus_tag LOCUS_30100 2664 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 3047 2661 gene locus_tag LOCUS_30110 3047 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 3037 3228 gene locus_tag LOCUS_30120 3037 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 3291 3425 gene locus_tag LOCUS_30130 3291 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 4025 5923 gene locus_tag LOCUS_30140 4025 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 7540 6050 gene locus_tag LOCUS_30150 7540 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 8205 7537 gene locus_tag LOCUS_30160 8205 7537 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_30160 8377 9216 gene locus_tag LOCUS_30170 8377 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 9455 9234 gene locus_tag LOCUS_30180 9455 9234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 9638 9456 gene locus_tag LOCUS_30190 9638 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 >Feature sequence150 1695 2252 gene locus_tag LOCUS_30200 1695 2252 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_30200 2699 2256 gene locus_tag LOCUS_30210 gene tolR 2699 2256 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932318.1 protein_id gnl|my_center|LOCUS_30210 3173 2703 gene locus_tag LOCUS_30220 gene tolR 3173 2703 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390003.1 protein_id gnl|my_center|LOCUS_30220 3858 3157 gene locus_tag LOCUS_30230 gene tolQ 3858 3157 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814641.1 protein_id gnl|my_center|LOCUS_30230 3918 5672 gene locus_tag LOCUS_30240 3918 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 5690 5995 gene locus_tag LOCUS_30250 5690 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 6336 6040 gene locus_tag LOCUS_30260 6336 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 6801 6430 gene locus_tag LOCUS_30270 6801 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 6970 7329 gene locus_tag LOCUS_30280 6970 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 7417 8133 gene locus_tag LOCUS_30290 7417 8133 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_30290 8090 9967 gene locus_tag LOCUS_30300 gene phoR 8090 9967 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_30300 9981 10412 gene locus_tag LOCUS_30310 9981 10412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 >Feature sequence151 820 185 gene locus_tag LOCUS_30320 820 185 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206063.1 protein_id gnl|my_center|LOCUS_30320 4062 817 gene locus_tag LOCUS_30330 4062 817 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726759.1 protein_id gnl|my_center|LOCUS_30330 4167 4583 gene locus_tag LOCUS_30340 4167 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 5297 4602 gene locus_tag LOCUS_30350 5297 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 5833 8058 gene locus_tag LOCUS_30360 5833 8058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 8202 9383 gene locus_tag LOCUS_30370 8202 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 >Feature sequence152 <1 788 gene locus_tag LOCUS_30380 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_120708963.1:type IV toxin-antitoxin system AbiEi family antitoxin 1670 909 gene locus_tag LOCUS_30390 1670 909 CDS product DUF899 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521206.1 protein_id gnl|my_center|LOCUS_30390 2470 1667 gene locus_tag LOCUS_30400 2470 1667 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227519.1 protein_id gnl|my_center|LOCUS_30400 3381 2467 gene locus_tag LOCUS_30410 3381 2467 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172686.1 protein_id gnl|my_center|LOCUS_30410 4103 3378 gene locus_tag LOCUS_30420 4103 3378 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530510.1 protein_id gnl|my_center|LOCUS_30420 4741 4745 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5468 5232 gene locus_tag LOCUS_30430 5468 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 5954 5592 gene locus_tag LOCUS_30440 5954 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30440 6588 6070 gene locus_tag LOCUS_30450 6588 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30450 6740 9421 gene locus_tag LOCUS_30460 6740 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 9682 9861 gene locus_tag LOCUS_30470 9682 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 9914 10285 gene locus_tag LOCUS_30480 9914 10285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 >Feature sequence153 2674 815 gene locus_tag LOCUS_30490 gene uvrC 2674 815 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_30490 4933 2909 gene locus_tag LOCUS_30500 gene uvrB 4933 2909 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_30500 5278 4964 gene locus_tag LOCUS_30510 5278 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 5862 5275 gene locus_tag LOCUS_30520 5862 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 6581 5904 gene locus_tag LOCUS_30530 6581 5904 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_30530 6672 8354 gene locus_tag LOCUS_30540 6672 8354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 8240 9553 gene locus_tag LOCUS_30550 8240 9553 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_30550 10393 9638 gene locus_tag LOCUS_30560 10393 9638 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_30560 >Feature sequence154 2309 1128 gene locus_tag LOCUS_30570 2309 1128 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095742.1 protein_id gnl|my_center|LOCUS_30570 3289 2306 gene locus_tag LOCUS_30580 3289 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 3741 3286 gene locus_tag LOCUS_30590 3741 3286 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086620.1 protein_id gnl|my_center|LOCUS_30590 3824 4105 gene locus_tag LOCUS_30600 3824 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 4162 4722 gene locus_tag LOCUS_30610 4162 4722 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082498.1 protein_id gnl|my_center|LOCUS_30610 4833 5012 gene locus_tag LOCUS_30620 4833 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 5013 5174 gene locus_tag LOCUS_30630 5013 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 5212 7581 gene locus_tag LOCUS_30640 5212 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 7583 7957 gene locus_tag LOCUS_30650 7583 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 8292 8014 gene locus_tag LOCUS_30660 8292 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 8938 8360 gene locus_tag LOCUS_30670 gene pdxH 8938 8360 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_30670 9020 10066 gene locus_tag LOCUS_30680 9020 10066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 >Feature sequence155 586 3921 gene locus_tag LOCUS_30690 586 3921 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965449.1 protein_id gnl|my_center|LOCUS_30690 4002 4511 gene locus_tag LOCUS_30700 4002 4511 CDS product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_30700 4528 5502 gene locus_tag LOCUS_30710 4528 5502 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141923.1 protein_id gnl|my_center|LOCUS_30710 6341 5514 gene locus_tag LOCUS_30720 6341 5514 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726967.1 protein_id gnl|my_center|LOCUS_30720 6249 6752 gene locus_tag LOCUS_30730 6249 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 6767 7072 gene locus_tag LOCUS_30740 6767 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 7274 7735 gene locus_tag LOCUS_30750 7274 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 8784 7762 gene locus_tag LOCUS_30760 8784 7762 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_30760 9964 8789 gene locus_tag LOCUS_30770 9964 8789 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728241.1 protein_id gnl|my_center|LOCUS_30770 >Feature sequence156 1374 508 gene locus_tag LOCUS_30780 1374 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 1599 1399 gene locus_tag LOCUS_30790 1599 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 2543 1731 gene locus_tag LOCUS_30800 2543 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 protein_id gnl|my_center|LOCUS_30800 3287 2553 gene locus_tag LOCUS_30810 3287 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 3322 3879 gene locus_tag LOCUS_30820 3322 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 4801 4376 gene locus_tag LOCUS_30830 4801 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 4940 5377 gene locus_tag LOCUS_30840 4940 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 5374 7233 gene locus_tag LOCUS_30850 5374 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 7230 8375 gene locus_tag LOCUS_30860 gene ydiK 7230 8375 CDS product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011416681.1 protein_id gnl|my_center|LOCUS_30860 9035 8385 gene locus_tag LOCUS_30870 9035 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 9126 9443 gene locus_tag LOCUS_30880 9126 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 9458 10093 gene locus_tag LOCUS_30890 9458 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 >Feature sequence157 114 1682 gene locus_tag LOCUS_30900 114 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 1679 1837 gene locus_tag LOCUS_30910 1679 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 2319 1855 gene locus_tag LOCUS_30920 2319 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 2549 2758 gene locus_tag LOCUS_30930 2549 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 6251 3147 gene locus_tag LOCUS_30940 gene mdtC 6251 3147 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815800.1 protein_id gnl|my_center|LOCUS_30940 9358 6248 gene locus_tag LOCUS_30950 gene muxB 9358 6248 CDS product multidrug efflux RND transporter permease subunit MuxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089920.1 protein_id gnl|my_center|LOCUS_30950 <10144 9355 gene locus_tag LOCUS_30960 <10144 9355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931666.1:MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit >Feature sequence158 890 1645 gene locus_tag LOCUS_30970 890 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 4055 1800 gene locus_tag LOCUS_30980 4055 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 4936 4052 gene locus_tag LOCUS_30990 gene arsS 4936 4052 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_30990 5793 5008 gene locus_tag LOCUS_31000 5793 5008 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_31000 5922 6530 gene locus_tag LOCUS_31010 5922 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 6661 6945 gene locus_tag LOCUS_31020 6661 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 7438 7043 gene locus_tag LOCUS_31030 7438 7043 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_31030 7674 7438 gene locus_tag LOCUS_31040 7674 7438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 9050 7986 gene locus_tag LOCUS_31050 9050 7986 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441684.1 protein_id gnl|my_center|LOCUS_31050 9236 9940 gene locus_tag LOCUS_31060 9236 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 >Feature sequence159 5011 779 gene locus_tag LOCUS_31070 5011 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 5558 5250 gene locus_tag LOCUS_31080 5558 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 5645 6949 gene locus_tag LOCUS_31090 gene galK 5645 6949 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812003.1 protein_id gnl|my_center|LOCUS_31090 7723 7283 gene locus_tag LOCUS_31100 7723 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 9000 7879 gene locus_tag LOCUS_31110 9000 7879 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940154.1 protein_id gnl|my_center|LOCUS_31110 9698 9297 gene locus_tag LOCUS_31120 9698 9297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 >Feature sequence160 1009 188 gene locus_tag LOCUS_31130 1009 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 1332 1168 gene locus_tag LOCUS_31140 1332 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 3227 1404 gene locus_tag LOCUS_31150 gene rpoD 3227 1404 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_31150 4138 3428 gene locus_tag LOCUS_31160 4138 3428 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538576.1 protein_id gnl|my_center|LOCUS_31160 4213 4869 gene locus_tag LOCUS_31170 gene npdG 4213 4869 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_31170 6489 4876 gene locus_tag LOCUS_31180 6489 4876 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545924.1 protein_id gnl|my_center|LOCUS_31180 8153 6486 gene locus_tag LOCUS_31190 8153 6486 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_31190 9039 8161 gene locus_tag LOCUS_31200 9039 8161 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639891.1 protein_id gnl|my_center|LOCUS_31200 >Feature sequence161 <1 1230 gene locus_tag LOCUS_31210 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929319.1:tetratricopeptide repeat protein 1364 3049 gene locus_tag LOCUS_31220 1364 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 3049 4080 gene locus_tag LOCUS_31230 3049 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 4047 5000 gene locus_tag LOCUS_31240 4047 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 6808 5372 gene locus_tag LOCUS_31250 6808 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 7371 6808 gene locus_tag LOCUS_31260 7371 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 7652 9487 gene locus_tag LOCUS_31270 7652 9487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 >Feature sequence162 200 294 gene locus_tag LOCUS_t00350 200 294 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1823 672 gene locus_tag LOCUS_31280 1823 672 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222756.1 protein_id gnl|my_center|LOCUS_31280 2446 1937 gene locus_tag LOCUS_31290 2446 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 2743 3759 gene locus_tag LOCUS_31300 2743 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 3763 4764 gene locus_tag LOCUS_31310 3763 4764 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944069.1 protein_id gnl|my_center|LOCUS_31310 4816 5973 gene locus_tag LOCUS_31320 4816 5973 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930720.1 protein_id gnl|my_center|LOCUS_31320 5967 6656 gene locus_tag LOCUS_31330 5967 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 6847 6662 gene locus_tag LOCUS_31340 6847 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 6943 7317 gene locus_tag LOCUS_31350 6943 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 8689 7319 gene locus_tag LOCUS_31360 8689 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 8769 9869 gene locus_tag LOCUS_31370 8769 9869 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729698.1 protein_id gnl|my_center|LOCUS_31370 >Feature sequence163 1177 29 gene locus_tag LOCUS_31380 1177 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 1895 1227 gene locus_tag LOCUS_31390 1895 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 2341 1892 gene locus_tag LOCUS_31400 2341 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 2762 2313 gene locus_tag LOCUS_31410 2762 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 2954 3436 gene locus_tag LOCUS_31420 2954 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 4259 3381 gene locus_tag LOCUS_31430 4259 3381 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416061.1 protein_id gnl|my_center|LOCUS_31430 4520 4266 gene locus_tag LOCUS_31440 4520 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 5132 4656 gene locus_tag LOCUS_31450 5132 4656 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206712.1 protein_id gnl|my_center|LOCUS_31450 5953 5141 gene locus_tag LOCUS_31460 5953 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 6121 7239 gene locus_tag LOCUS_31470 6121 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 >Feature sequence164 985 377 gene locus_tag LOCUS_31480 985 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 2213 1074 gene locus_tag LOCUS_31490 gene acdA 2213 1074 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_31490 2298 3590 gene locus_tag LOCUS_31500 gene asnS 2298 3590 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257312.1 protein_id gnl|my_center|LOCUS_31500 3630 4100 gene locus_tag LOCUS_31510 3630 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 4629 4042 gene locus_tag LOCUS_31520 4629 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 5786 4641 gene locus_tag LOCUS_31530 5786 4641 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064155.1 protein_id gnl|my_center|LOCUS_31530 7197 5806 gene locus_tag LOCUS_31540 7197 5806 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296871.1 protein_id gnl|my_center|LOCUS_31540 7178 7423 gene locus_tag LOCUS_31550 7178 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 7389 7889 gene locus_tag LOCUS_31560 7389 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 8319 7909 gene locus_tag LOCUS_31570 8319 7909 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945928.1 protein_id gnl|my_center|LOCUS_31570 9086 8319 gene locus_tag LOCUS_31580 9086 8319 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403433.1 protein_id gnl|my_center|LOCUS_31580 9179 9274 gene locus_tag LOCUS_t00360 9179 9274 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence165 600 1565 gene locus_tag LOCUS_31590 600 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 2026 1589 gene locus_tag LOCUS_31600 2026 1589 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530756.1 protein_id gnl|my_center|LOCUS_31600 2153 4150 gene locus_tag LOCUS_31610 2153 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 5230 4157 gene locus_tag LOCUS_31620 5230 4157 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730637.1 protein_id gnl|my_center|LOCUS_31620 6015 5239 gene locus_tag LOCUS_31630 6015 5239 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224179.1 protein_id gnl|my_center|LOCUS_31630 5905 6117 gene locus_tag LOCUS_31640 5905 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 6176 7234 gene locus_tag LOCUS_31650 6176 7234 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932947.1 protein_id gnl|my_center|LOCUS_31650 7288 9795 gene locus_tag LOCUS_31660 7288 9795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 >Feature sequence166 1457 102 gene locus_tag LOCUS_31670 1457 102 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937466.1 protein_id gnl|my_center|LOCUS_31670 3200 1506 gene locus_tag LOCUS_31680 gene gspE 3200 1506 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024666356.1 protein_id gnl|my_center|LOCUS_31680 4090 3260 gene locus_tag LOCUS_31690 4090 3260 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_31690 4001 4300 gene locus_tag LOCUS_31700 4001 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 5310 4318 gene locus_tag LOCUS_31710 gene gmd 5310 4318 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_31710 5681 5316 gene locus_tag LOCUS_31720 5681 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 6724 5678 gene locus_tag LOCUS_31730 gene rfbB 6724 5678 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_31730 7531 6728 gene locus_tag LOCUS_31740 7531 6728 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022168.1 protein_id gnl|my_center|LOCUS_31740 <9692 7531 gene locus_tag LOCUS_31750 <9692 7531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943003.1:LPS assembly protein LptD >Feature sequence167 3450 3013 gene locus_tag LOCUS_31760 3450 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 3340 7029 gene locus_tag LOCUS_31770 3340 7029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 7045 8325 gene locus_tag LOCUS_31780 7045 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 >Feature sequence168 639 1766 gene locus_tag LOCUS_31790 639 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 2678 1773 gene locus_tag LOCUS_31800 2678 1773 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_31800 5089 2681 gene locus_tag LOCUS_31810 5089 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 5303 8278 gene locus_tag LOCUS_31820 5303 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 8578 8300 gene locus_tag LOCUS_31830 8578 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 9207 8623 gene locus_tag LOCUS_31840 9207 8623 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802006.1 protein_id gnl|my_center|LOCUS_31840 >Feature sequence169 3297 2119 gene locus_tag LOCUS_31850 3297 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 4664 3411 gene locus_tag LOCUS_31860 4664 3411 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613585.1 protein_id gnl|my_center|LOCUS_31860 4904 5881 gene locus_tag LOCUS_31870 gene trpS 4904 5881 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942477.1 protein_id gnl|my_center|LOCUS_31870 5878 6690 gene locus_tag LOCUS_31880 5878 6690 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_31880 6665 7372 gene locus_tag LOCUS_31890 gene scpB 6665 7372 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942475.1 protein_id gnl|my_center|LOCUS_31890 <9598 8094 gene locus_tag LOCUS_31900 <9598 8094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946821.1:murein biosynthesis integral membrane protein MurJ >Feature sequence170 799 1734 gene locus_tag LOCUS_31910 799 1734 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086138.1 protein_id gnl|my_center|LOCUS_31910 4266 1741 gene locus_tag LOCUS_31920 4266 1741 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_31920 6487 4259 gene locus_tag LOCUS_31930 6487 4259 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121932.1 protein_id gnl|my_center|LOCUS_31930 6615 7634 gene locus_tag LOCUS_31940 6615 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 7797 9317 gene locus_tag LOCUS_31950 7797 9317 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_31950 >Feature sequence171 1934 846 gene locus_tag LOCUS_31960 gene aroB 1934 846 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_31960 2472 1960 gene locus_tag LOCUS_31970 2472 1960 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_31970 3641 2475 gene locus_tag LOCUS_31980 gene aroC 3641 2475 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_31980 5850 3649 gene locus_tag LOCUS_31990 5850 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 6374 5868 gene locus_tag LOCUS_32000 6374 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 6997 6371 gene locus_tag LOCUS_32010 gene pilO 6997 6371 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403037.1 protein_id gnl|my_center|LOCUS_32010 7602 6994 gene locus_tag LOCUS_32020 7602 6994 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_32020 8717 7599 gene locus_tag LOCUS_32030 gene pilM 8717 7599 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_32030 >Feature sequence172 1167 2378 gene locus_tag LOCUS_32040 1167 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 2395 4155 gene locus_tag LOCUS_32050 2395 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 4210 4458 gene locus_tag LOCUS_32060 4210 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 4460 4801 gene locus_tag LOCUS_32070 4460 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 4847 5671 gene locus_tag LOCUS_32080 4847 5671 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083381.1 protein_id gnl|my_center|LOCUS_32080 6364 6714 gene locus_tag LOCUS_32090 6364 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 9000 6805 gene locus_tag LOCUS_32100 9000 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 9034 9276 gene locus_tag LOCUS_32110 9034 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 >Feature sequence173 318 1421 gene locus_tag LOCUS_32120 318 1421 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727980.1 protein_id gnl|my_center|LOCUS_32120 1435 2532 gene locus_tag LOCUS_32130 1435 2532 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223974.1 protein_id gnl|my_center|LOCUS_32130 2884 4086 gene locus_tag LOCUS_32140 2884 4086 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230306.1 protein_id gnl|my_center|LOCUS_32140 5172 4276 gene locus_tag LOCUS_32150 gene pqqB 5172 4276 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269163.1 protein_id gnl|my_center|LOCUS_32150 7123 5453 gene locus_tag LOCUS_32160 7123 5453 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112322.1 protein_id gnl|my_center|LOCUS_32160 7550 7110 gene locus_tag LOCUS_32170 7550 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 8085 7561 gene locus_tag LOCUS_32180 8085 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 8880 8455 gene locus_tag LOCUS_32190 8880 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 >Feature sequence174 <1 782 gene locus_tag LOCUS_32200 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058222.1:adenosylhomocysteinase 2108 957 gene locus_tag LOCUS_32210 gene hemW 2108 957 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_32210 2701 2105 gene locus_tag LOCUS_32220 gene lexA 2701 2105 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_32220 2835 3074 gene locus_tag LOCUS_32230 2835 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 3076 4761 gene locus_tag LOCUS_32240 3076 4761 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027650.1 protein_id gnl|my_center|LOCUS_32240 4809 5597 gene locus_tag LOCUS_32250 4809 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 6605 5604 gene locus_tag LOCUS_32260 gene mltG 6605 5604 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_32260 7051 6602 gene locus_tag LOCUS_32270 gene ruvX 7051 6602 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393142.1 protein_id gnl|my_center|LOCUS_32270 7149 8480 gene locus_tag LOCUS_32280 7149 8480 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129241.1 protein_id gnl|my_center|LOCUS_32280 >Feature sequence175 617 1468 gene locus_tag LOCUS_32290 617 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 2542 1550 gene locus_tag LOCUS_32300 2542 1550 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114567.1 protein_id gnl|my_center|LOCUS_32300 2661 5036 gene locus_tag LOCUS_32310 2661 5036 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_32310 5038 6012 gene locus_tag LOCUS_32320 5038 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 6009 7019 gene locus_tag LOCUS_32330 6009 7019 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046116578.1 protein_id gnl|my_center|LOCUS_32330 7328 8068 gene locus_tag LOCUS_32340 gene thiF 7328 8068 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056327.1 protein_id gnl|my_center|LOCUS_32340 >Feature sequence176 1002 1913 gene locus_tag LOCUS_32350 1002 1913 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072010.1 protein_id gnl|my_center|LOCUS_32350 2834 1980 gene locus_tag LOCUS_32360 2834 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 3461 3027 gene locus_tag LOCUS_32370 3461 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 4369 3458 gene locus_tag LOCUS_32380 4369 3458 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_32380 4752 4366 gene locus_tag LOCUS_32390 4752 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 5488 4874 gene locus_tag LOCUS_32400 5488 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 5746 6885 gene locus_tag LOCUS_32410 5746 6885 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_32410 6890 7672 gene locus_tag LOCUS_32420 6890 7672 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_32420 7665 8594 gene locus_tag LOCUS_32430 7665 8594 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_32430 >Feature sequence177 <1 1092 gene locus_tag LOCUS_32440 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986412.1:NADH-quinone oxidoreductase subunit NuoF 1089 3308 gene locus_tag LOCUS_32450 1089 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 3370 4245 gene locus_tag LOCUS_32460 3370 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 4259 5680 gene locus_tag LOCUS_32470 4259 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 7403 6018 gene locus_tag LOCUS_32480 gene sthA 7403 6018 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_32480 7944 7420 gene locus_tag LOCUS_32490 7944 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 8468 8142 gene locus_tag LOCUS_32500 8468 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32500 8488 8844 gene locus_tag LOCUS_32510 8488 8844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 >Feature sequence178 492 719 gene locus_tag LOCUS_32520 492 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 849 1145 gene locus_tag LOCUS_32530 849 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 1415 1209 gene locus_tag LOCUS_32540 1415 1209 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393634.1 protein_id gnl|my_center|LOCUS_32540 2147 1707 gene locus_tag LOCUS_32550 2147 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 2240 2905 gene locus_tag LOCUS_32560 2240 2905 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965913.1 protein_id gnl|my_center|LOCUS_32560 3395 3195 gene locus_tag LOCUS_32570 3395 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32570 3367 3627 gene locus_tag LOCUS_32580 3367 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 4309 4103 gene locus_tag LOCUS_32590 4309 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 4413 4925 gene locus_tag LOCUS_32600 4413 4925 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265987.1 protein_id gnl|my_center|LOCUS_32600 4922 5308 gene locus_tag LOCUS_32610 4922 5308 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921473.1 protein_id gnl|my_center|LOCUS_32610 5793 5383 gene locus_tag LOCUS_32620 5793 5383 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582722.1 protein_id gnl|my_center|LOCUS_32620 6127 5729 gene locus_tag LOCUS_32630 6127 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 6412 6218 gene locus_tag LOCUS_32640 6412 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 7587 6403 gene locus_tag LOCUS_32650 7587 6403 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403911.1 protein_id gnl|my_center|LOCUS_32650 <9071 7641 gene locus_tag LOCUS_32660 <9071 7641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003895348.1:pup deamidase/depupylase >Feature sequence179 498 259 gene locus_tag LOCUS_32670 498 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 4789 740 gene locus_tag LOCUS_32680 4789 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 5309 6508 gene locus_tag LOCUS_32690 5309 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 6552 7373 gene locus_tag LOCUS_32700 6552 7373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 8601 7837 gene locus_tag LOCUS_32710 8601 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 >Feature sequence180 1929 2585 gene locus_tag LOCUS_32720 1929 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 2775 3722 gene locus_tag LOCUS_32730 2775 3722 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031134.1 protein_id gnl|my_center|LOCUS_32730 3719 6274 gene locus_tag LOCUS_32740 3719 6274 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 protein_id gnl|my_center|LOCUS_32740 6271 7215 gene locus_tag LOCUS_32750 6271 7215 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_32750 7212 7955 gene locus_tag LOCUS_32760 gene gldF 7212 7955 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_32760 >Feature sequence181 129 353 gene locus_tag LOCUS_32770 129 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 440 928 gene locus_tag LOCUS_32780 440 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 936 1793 gene locus_tag LOCUS_32790 936 1793 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_32790 2123 1812 gene locus_tag LOCUS_32800 2123 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 2748 3299 gene locus_tag LOCUS_32810 2748 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 3552 3370 gene locus_tag LOCUS_32820 3552 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 3551 3865 gene locus_tag LOCUS_32830 3551 3865 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945172.1 protein_id gnl|my_center|LOCUS_32830 4469 3948 gene locus_tag LOCUS_32840 4469 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 4584 6440 gene locus_tag LOCUS_32850 4584 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 7975 6431 gene locus_tag LOCUS_32860 7975 6431 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_32860 8762 8031 gene locus_tag LOCUS_32870 8762 8031 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031430.1 protein_id gnl|my_center|LOCUS_32870 >Feature sequence182 2344 2997 gene locus_tag LOCUS_32880 2344 2997 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970077.1 protein_id gnl|my_center|LOCUS_32880 3181 2975 gene locus_tag LOCUS_32890 3181 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 3418 3606 gene locus_tag LOCUS_32900 3418 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 4015 3584 gene locus_tag LOCUS_32910 4015 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 3908 4219 gene locus_tag LOCUS_32920 3908 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 5079 4339 gene locus_tag LOCUS_32930 5079 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 6655 6032 gene locus_tag LOCUS_32940 6655 6032 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223118.1 protein_id gnl|my_center|LOCUS_32940 6843 8678 gene locus_tag LOCUS_32950 6843 8678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 >Feature sequence183 1196 174 gene locus_tag LOCUS_32960 1196 174 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_32960 2875 2021 gene locus_tag LOCUS_32970 2875 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 3102 3461 gene locus_tag LOCUS_32980 3102 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 3524 5146 gene locus_tag LOCUS_32990 3524 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 6602 5175 gene locus_tag LOCUS_33000 6602 5175 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 protein_id gnl|my_center|LOCUS_33000 8481 6799 gene locus_tag LOCUS_33010 8481 6799 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_33010 >Feature sequence184 <1 1074 gene locus_tag LOCUS_33020 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056271.1:L-glutamate gamma-semialdehyde dehydrogenase 1135 1728 gene locus_tag LOCUS_33030 1135 1728 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142691.1 protein_id gnl|my_center|LOCUS_33030 2861 1725 gene locus_tag LOCUS_33040 2861 1725 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_33040 3129 2893 gene locus_tag LOCUS_33050 3129 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 3023 3229 gene locus_tag LOCUS_33060 3023 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 3246 4697 gene locus_tag LOCUS_33070 3246 4697 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224377.1 protein_id gnl|my_center|LOCUS_33070 5499 4765 gene locus_tag LOCUS_33080 5499 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 5616 6341 gene locus_tag LOCUS_33090 5616 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 6342 7289 gene locus_tag LOCUS_33100 6342 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 7289 8068 gene locus_tag LOCUS_33110 7289 8068 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224716.1 protein_id gnl|my_center|LOCUS_33110 8521 8306 gene locus_tag LOCUS_33120 8521 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 >Feature sequence185 546 40 gene locus_tag LOCUS_33130 546 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 1732 548 gene locus_tag LOCUS_33140 1732 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 1830 2069 gene locus_tag LOCUS_33150 1830 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 2069 2992 gene locus_tag LOCUS_33160 2069 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 3818 2958 gene locus_tag LOCUS_33170 3818 2958 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728081.1 protein_id gnl|my_center|LOCUS_33170 4075 5643 gene locus_tag LOCUS_33180 4075 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 5913 6188 gene locus_tag LOCUS_33190 5913 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 6407 6871 gene locus_tag LOCUS_33200 6407 6871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 6949 8121 gene locus_tag LOCUS_33210 6949 8121 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947551.1 protein_id gnl|my_center|LOCUS_33210 >Feature sequence186 802 407 gene locus_tag LOCUS_33220 802 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 981 814 gene locus_tag LOCUS_33230 981 814 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887299.1 protein_id gnl|my_center|LOCUS_33230 1556 1819 gene locus_tag LOCUS_33240 1556 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 1816 2037 gene locus_tag LOCUS_33250 1816 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 3911 2046 gene locus_tag LOCUS_33260 3911 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 4821 3916 gene locus_tag LOCUS_33270 4821 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 5976 4825 gene locus_tag LOCUS_33280 5976 4825 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389970.1 protein_id gnl|my_center|LOCUS_33280 7010 5973 gene locus_tag LOCUS_33290 7010 5973 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_33290 8379 7027 gene locus_tag LOCUS_33300 8379 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 >Feature sequence187 <1 763 gene locus_tag LOCUS_33310 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868152.1:bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase 931 1554 gene locus_tag LOCUS_33320 gene ispD 931 1554 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966461.1 protein_id gnl|my_center|LOCUS_33320 1554 2672 gene locus_tag LOCUS_33330 1554 2672 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476685.1 protein_id gnl|my_center|LOCUS_33330 2683 3954 gene locus_tag LOCUS_33340 2683 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 4100 6001 gene locus_tag LOCUS_33350 4100 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 5998 7386 gene locus_tag LOCUS_33360 5998 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 >Feature sequence188 1141 1347 gene locus_tag LOCUS_33370 1141 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 1372 1803 gene locus_tag LOCUS_33380 1372 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 1920 2210 gene locus_tag LOCUS_33390 1920 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 2244 2477 gene locus_tag LOCUS_33400 2244 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 2856 2383 gene locus_tag LOCUS_33410 2856 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33410 4481 3015 gene locus_tag LOCUS_33420 4481 3015 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 protein_id gnl|my_center|LOCUS_33420 6355 4520 gene locus_tag LOCUS_33430 6355 4520 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267573.1 protein_id gnl|my_center|LOCUS_33430 8007 6355 gene locus_tag LOCUS_33440 gene pgm 8007 6355 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268077.1 protein_id gnl|my_center|LOCUS_33440 <8577 8010 gene locus_tag LOCUS_33450 <8577 8010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920652.1:ABC transporter ATP-binding protein/permease >Feature sequence189 128 1984 gene locus_tag LOCUS_33460 128 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 2422 4938 gene locus_tag LOCUS_33470 2422 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 7543 5330 gene locus_tag LOCUS_33480 7543 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 >Feature sequence190 2585 1566 gene locus_tag LOCUS_33490 2585 1566 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141161.1 protein_id gnl|my_center|LOCUS_33490 4148 2601 gene locus_tag LOCUS_33500 4148 2601 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 protein_id gnl|my_center|LOCUS_33500 4650 4159 gene locus_tag LOCUS_33510 4650 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 5438 4647 gene locus_tag LOCUS_33520 5438 4647 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530129.1 protein_id gnl|my_center|LOCUS_33520 6208 6047 gene locus_tag LOCUS_33530 6208 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 6427 6239 gene locus_tag LOCUS_33540 6427 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 7719 6424 gene locus_tag LOCUS_33550 7719 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 7907 8227 gene locus_tag LOCUS_33560 7907 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 >Feature sequence191 218 1417 gene locus_tag LOCUS_33570 218 1417 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189027735.1 protein_id gnl|my_center|LOCUS_33570 1414 2310 gene locus_tag LOCUS_33580 1414 2310 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228893.1 protein_id gnl|my_center|LOCUS_33580 2325 3746 gene locus_tag LOCUS_33590 gene betB 2325 3746 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532682.1 protein_id gnl|my_center|LOCUS_33590 3746 4885 gene locus_tag LOCUS_33600 3746 4885 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225722.1 protein_id gnl|my_center|LOCUS_33600 5396 4899 gene locus_tag LOCUS_33610 5396 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 5561 5397 gene locus_tag LOCUS_33620 5561 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 6705 5620 gene locus_tag LOCUS_33630 gene tal 6705 5620 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_33630 7370 6702 gene locus_tag LOCUS_33640 7370 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 <8530 7367 gene locus_tag LOCUS_33650 <8530 7367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528919.1:glucose-6-phosphate dehydrogenase >Feature sequence192 865 311 gene locus_tag LOCUS_33660 865 311 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_33660 1428 922 gene locus_tag LOCUS_33670 1428 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 2962 1421 gene locus_tag LOCUS_33680 gene accC 2962 1421 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761157.1 protein_id gnl|my_center|LOCUS_33680 4493 2943 gene locus_tag LOCUS_33690 4493 2943 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_33690 5000 4533 gene locus_tag LOCUS_33700 5000 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 4966 7065 gene locus_tag LOCUS_33710 4966 7065 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462072.1 protein_id gnl|my_center|LOCUS_33710 7830 6955 gene locus_tag LOCUS_33720 7830 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 >Feature sequence193 948 331 gene locus_tag LOCUS_33730 948 331 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966252.1 protein_id gnl|my_center|LOCUS_33730 1733 945 gene locus_tag LOCUS_33740 1733 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 2792 1821 gene locus_tag LOCUS_33750 2792 1821 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091099.1 protein_id gnl|my_center|LOCUS_33750 3550 2795 gene locus_tag LOCUS_33760 3550 2795 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529425.1 protein_id gnl|my_center|LOCUS_33760 4384 3584 gene locus_tag LOCUS_33770 4384 3584 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941182.1 protein_id gnl|my_center|LOCUS_33770 4571 5275 gene locus_tag LOCUS_33780 4571 5275 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 protein_id gnl|my_center|LOCUS_33780 5282 6202 gene locus_tag LOCUS_33790 gene fmt 5282 6202 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_33790 7137 6199 gene locus_tag LOCUS_33800 7137 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 <8421 7249 gene locus_tag LOCUS_33810 <8421 7249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930426.1:sigma-54 dependent transcriptional regulator >Feature sequence194 195 656 gene locus_tag LOCUS_33820 195 656 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486580.1 protein_id gnl|my_center|LOCUS_33820 826 1710 gene locus_tag LOCUS_33830 826 1710 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726700.1 protein_id gnl|my_center|LOCUS_33830 1829 2293 gene locus_tag LOCUS_33840 1829 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 2359 2871 gene locus_tag LOCUS_33850 2359 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 2999 3871 gene locus_tag LOCUS_33860 2999 3871 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689435.1 protein_id gnl|my_center|LOCUS_33860 4034 4423 gene locus_tag LOCUS_33870 4034 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 4592 5377 gene locus_tag LOCUS_33880 4592 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 5576 6427 gene locus_tag LOCUS_33890 5576 6427 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_33890 6580 7125 gene locus_tag LOCUS_33900 6580 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 7326 7598 gene locus_tag LOCUS_33910 7326 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 7585 7854 gene locus_tag LOCUS_33920 7585 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 7940 8386 gene locus_tag LOCUS_33930 7940 8386 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965703.1 protein_id gnl|my_center|LOCUS_33930 >Feature sequence195 209 937 gene locus_tag LOCUS_33940 209 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 930 1667 gene locus_tag LOCUS_33950 930 1667 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080600.1 protein_id gnl|my_center|LOCUS_33950 1679 2245 gene locus_tag LOCUS_33960 1679 2245 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272666.1 protein_id gnl|my_center|LOCUS_33960 2398 3819 gene locus_tag LOCUS_33970 2398 3819 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889294.1 protein_id gnl|my_center|LOCUS_33970 3809 4942 gene locus_tag LOCUS_33980 3809 4942 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929836.1 protein_id gnl|my_center|LOCUS_33980 5198 5977 gene locus_tag LOCUS_33990 5198 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 5971 7368 gene locus_tag LOCUS_34000 5971 7368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 7374 8309 gene locus_tag LOCUS_34010 7374 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 >Feature sequence196 524 78 gene locus_tag LOCUS_34020 gene dtd 524 78 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_34020 668 2344 gene locus_tag LOCUS_34030 668 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 2431 3186 gene locus_tag LOCUS_34040 gene lgt 2431 3186 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_34040 3165 3725 gene locus_tag LOCUS_34050 3165 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 4068 3667 gene locus_tag LOCUS_34060 4068 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 4242 5603 gene locus_tag LOCUS_34070 4242 5603 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_34070 5994 7340 gene locus_tag LOCUS_34080 gene xseA 5994 7340 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_34080 7340 7576 gene locus_tag LOCUS_34090 7340 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 >Feature sequence197 1594 239 gene locus_tag LOCUS_34100 1594 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 4849 1736 gene locus_tag LOCUS_34110 4849 1736 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765563.1 protein_id gnl|my_center|LOCUS_34110 5071 5367 gene locus_tag LOCUS_34120 gene groES 5071 5367 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918572.1 protein_id gnl|my_center|LOCUS_34120 5378 7000 gene locus_tag LOCUS_34130 gene groL 5378 7000 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_34130 >Feature sequence198 >Feature sequence199 435 647 gene locus_tag LOCUS_34140 435 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 744 3590 gene locus_tag LOCUS_34150 744 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 5536 4010 gene locus_tag LOCUS_34160 gene ggt 5536 4010 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929162.1 protein_id gnl|my_center|LOCUS_34160 5657 6856 gene locus_tag LOCUS_34170 5657 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 6856 7146 gene locus_tag LOCUS_34180 6856 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 7527 7201 gene locus_tag LOCUS_34190 7527 7201 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 protein_id gnl|my_center|LOCUS_34190 <8236 7611 gene locus_tag LOCUS_34200 <8236 7611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403241.1:DUF72 domain-containing protein >Feature sequence200 1225 458 gene locus_tag LOCUS_34210 1225 458 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225704.1 protein_id gnl|my_center|LOCUS_34210 1304 2308 gene locus_tag LOCUS_34220 1304 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 2371 2691 gene locus_tag LOCUS_34230 gene clpS 2371 2691 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383707.1 protein_id gnl|my_center|LOCUS_34230 2691 4982 gene locus_tag LOCUS_34240 gene clpA 2691 4982 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_34240 5842 4937 gene locus_tag LOCUS_34250 5842 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 6384 5932 gene locus_tag LOCUS_34260 6384 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 7523 6381 gene locus_tag LOCUS_34270 7523 6381 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531771.1 protein_id gnl|my_center|LOCUS_34270 >Feature sequence201 33 542 gene locus_tag LOCUS_34280 33 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 539 985 gene locus_tag LOCUS_34290 539 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 985 1290 gene locus_tag LOCUS_34300 985 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 1287 1664 gene locus_tag LOCUS_34310 1287 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 2853 1678 gene locus_tag LOCUS_34320 gene sat 2853 1678 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_34320 4351 2894 gene locus_tag LOCUS_34330 4351 2894 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_34330 5595 4351 gene locus_tag LOCUS_34340 5595 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 6038 5592 gene locus_tag LOCUS_34350 6038 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 6487 6215 gene locus_tag LOCUS_34360 6487 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 7464 6484 gene locus_tag LOCUS_34370 gene cysM 7464 6484 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930733.1 protein_id gnl|my_center|LOCUS_34370 7748 7473 gene locus_tag LOCUS_34380 7748 7473 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 protein_id gnl|my_center|LOCUS_34380 >Feature sequence202 71 532 gene locus_tag LOCUS_34390 71 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 560 1963 gene locus_tag LOCUS_34400 560 1963 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946795.1 protein_id gnl|my_center|LOCUS_34400 2061 2309 gene locus_tag LOCUS_34410 2061 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 2446 4002 gene locus_tag LOCUS_34420 2446 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 4059 5366 gene locus_tag LOCUS_34430 gene zraR 4059 5366 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148522.1 protein_id gnl|my_center|LOCUS_34430 5430 5960 gene locus_tag LOCUS_34440 5430 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 6037 7311 gene locus_tag LOCUS_34450 6037 7311 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941495.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence203 1294 2172 gene locus_tag LOCUS_34460 1294 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 2675 2283 gene locus_tag LOCUS_34470 gene rsfS 2675 2283 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943827.1 protein_id gnl|my_center|LOCUS_34470 3340 2672 gene locus_tag LOCUS_34480 gene nadD 3340 2672 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943828.1 protein_id gnl|my_center|LOCUS_34480 4607 3333 gene locus_tag LOCUS_34490 4607 3333 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_34490 5770 4619 gene locus_tag LOCUS_34500 gene proB 5770 4619 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_34500 6810 5767 gene locus_tag LOCUS_34510 gene obgE 6810 5767 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943831.1 protein_id gnl|my_center|LOCUS_34510 7034 7327 gene locus_tag LOCUS_34520 7034 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 7361 8074 gene locus_tag LOCUS_34530 7361 8074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 >Feature sequence204 934 3252 gene locus_tag LOCUS_34540 934 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 4703 3588 gene locus_tag LOCUS_34550 4703 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 4809 5390 gene locus_tag LOCUS_34560 4809 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 5773 5387 gene locus_tag LOCUS_34570 5773 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 5812 6603 gene locus_tag LOCUS_34580 5812 6603 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_34580 6896 6618 gene locus_tag LOCUS_34590 6896 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 >Feature sequence205 1051 1857 gene locus_tag LOCUS_34600 gene atpB 1051 1857 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546836.1 protein_id gnl|my_center|LOCUS_34600 1924 2112 gene locus_tag LOCUS_34610 1924 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 2174 2716 gene locus_tag LOCUS_34620 2174 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 2713 3105 gene locus_tag LOCUS_34630 2713 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 3140 4672 gene locus_tag LOCUS_34640 gene atpA 3140 4672 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880405.1 protein_id gnl|my_center|LOCUS_34640 4676 5542 gene locus_tag LOCUS_34650 gene atpG 4676 5542 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_34650 5600 6970 gene locus_tag LOCUS_34660 gene atpD 5600 6970 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383730.1 protein_id gnl|my_center|LOCUS_34660 6974 7384 gene locus_tag LOCUS_34670 6974 7384 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687159.1 protein_id gnl|my_center|LOCUS_34670 >Feature sequence206 416 2626 gene locus_tag LOCUS_34680 416 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 3219 2629 gene locus_tag LOCUS_34690 3219 2629 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_34690 4188 3775 gene locus_tag LOCUS_34700 4188 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 4117 4800 gene locus_tag LOCUS_34710 4117 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 6728 4890 gene locus_tag LOCUS_34720 6728 4890 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_34720 7806 6850 gene locus_tag LOCUS_34730 7806 6850 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618895.1 protein_id gnl|my_center|LOCUS_34730 >Feature sequence207 794 315 gene locus_tag LOCUS_34740 gene rimI 794 315 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_34740 1815 805 gene locus_tag LOCUS_34750 1815 805 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_34750 2815 1823 gene locus_tag LOCUS_34760 2815 1823 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524613.1 protein_id gnl|my_center|LOCUS_34760 4230 2827 gene locus_tag LOCUS_34770 4230 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 5010 4381 gene locus_tag LOCUS_34780 5010 4381 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_34780 5055 6446 gene locus_tag LOCUS_34790 5055 6446 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_34790 6609 7376 gene locus_tag LOCUS_34800 6609 7376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 7699 7427 gene locus_tag LOCUS_34810 7699 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 >Feature sequence208 3715 2003 gene locus_tag LOCUS_34820 3715 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 5738 4194 gene locus_tag LOCUS_34830 5738 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 7717 5960 gene locus_tag LOCUS_34840 7717 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 >Feature sequence209 150 1286 gene locus_tag LOCUS_34850 150 1286 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454927.1 protein_id gnl|my_center|LOCUS_34850 1270 2016 gene locus_tag LOCUS_34860 1270 2016 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390199.1 protein_id gnl|my_center|LOCUS_34860 2018 2923 gene locus_tag LOCUS_34870 2018 2923 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454833.1 protein_id gnl|my_center|LOCUS_34870 2971 3528 gene locus_tag LOCUS_34880 2971 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 3537 6629 gene locus_tag LOCUS_34890 3537 6629 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275353.1 protein_id gnl|my_center|LOCUS_34890 >Feature sequence210 709 155 gene locus_tag LOCUS_34900 709 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34900 1167 640 gene locus_tag LOCUS_34910 1167 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34910 1585 1433 gene locus_tag LOCUS_34920 1585 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 1535 3220 gene locus_tag LOCUS_34930 1535 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 4354 3350 gene locus_tag LOCUS_34940 4354 3350 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188847679.1 protein_id gnl|my_center|LOCUS_34940 5472 4495 gene locus_tag LOCUS_34950 5472 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 7344 5482 gene locus_tag LOCUS_34960 7344 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 >Feature sequence211 2074 1235 gene locus_tag LOCUS_34970 2074 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 2709 2089 gene locus_tag LOCUS_34980 2709 2089 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207649561.1 protein_id gnl|my_center|LOCUS_34980 3446 2706 gene locus_tag LOCUS_34990 3446 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 3940 3485 gene locus_tag LOCUS_35000 3940 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 4875 3937 gene locus_tag LOCUS_35010 4875 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 7177 4859 gene locus_tag LOCUS_35020 7177 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 7627 7205 gene locus_tag LOCUS_35030 7627 7205 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_35030 >Feature sequence212 561 2054 gene locus_tag LOCUS_35040 561 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 2631 2912 gene locus_tag LOCUS_35050 2631 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 3059 3769 gene locus_tag LOCUS_35060 3059 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 4033 5052 gene locus_tag LOCUS_35070 4033 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 5138 5398 gene locus_tag LOCUS_35080 5138 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 5909 5712 gene locus_tag LOCUS_35090 5909 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 5812 7392 gene locus_tag LOCUS_35100 5812 7392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 >Feature sequence213 1210 782 gene locus_tag LOCUS_35110 1210 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 1098 1760 gene locus_tag LOCUS_35120 1098 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 2060 3814 gene locus_tag LOCUS_35130 2060 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 4364 5953 gene locus_tag LOCUS_35140 4364 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 >Feature sequence214 396 737 gene locus_tag LOCUS_35150 396 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 1854 955 gene locus_tag LOCUS_35160 1854 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 2279 1854 gene locus_tag LOCUS_35170 2279 1854 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987100.1 protein_id gnl|my_center|LOCUS_35170 2658 2326 gene locus_tag LOCUS_35180 2658 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 4492 2774 gene locus_tag LOCUS_35190 4492 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 4936 4634 gene locus_tag LOCUS_35200 4936 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 5035 6153 gene locus_tag LOCUS_35210 5035 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 6246 6494 gene locus_tag LOCUS_35220 6246 6494 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_35220 6497 6880 gene locus_tag LOCUS_35230 6497 6880 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_35230 >Feature sequence215 295 489 gene locus_tag LOCUS_35240 295 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 669 1088 gene locus_tag LOCUS_35250 669 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 1085 1927 gene locus_tag LOCUS_35260 1085 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 2065 3084 gene locus_tag LOCUS_35270 2065 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 3249 5057 gene locus_tag LOCUS_35280 3249 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 5404 5066 gene locus_tag LOCUS_35290 5404 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 6190 5444 gene locus_tag LOCUS_35300 6190 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 >Feature sequence216 143 970 gene locus_tag LOCUS_35310 143 970 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_35310 1059 2402 gene locus_tag LOCUS_35320 gene fliD 1059 2402 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943664.1 protein_id gnl|my_center|LOCUS_35320 2414 2800 gene locus_tag LOCUS_35330 gene fliS 2414 2800 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073117.1 protein_id gnl|my_center|LOCUS_35330 2802 3224 gene locus_tag LOCUS_35340 2802 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 3571 3272 gene locus_tag LOCUS_35350 3571 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 3679 4092 gene locus_tag LOCUS_35360 3679 4092 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_35360 5532 4099 gene locus_tag LOCUS_35370 5532 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 <7569 5529 gene locus_tag LOCUS_35380 <7569 5529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940252.1:glycosyltransferase >Feature sequence217 715 2445 gene locus_tag LOCUS_35390 715 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 2417 3811 gene locus_tag LOCUS_35400 2417 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 4712 3819 gene locus_tag LOCUS_35410 4712 3819 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409255.1 protein_id gnl|my_center|LOCUS_35410 5806 4727 gene locus_tag LOCUS_35420 5806 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 6347 5820 gene locus_tag LOCUS_35430 6347 5820 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140228.1 protein_id gnl|my_center|LOCUS_35430 6556 6386 gene locus_tag LOCUS_35440 6556 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 7338 6823 gene locus_tag LOCUS_35450 7338 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 >Feature sequence218 840 523 gene locus_tag LOCUS_35460 840 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 839 1744 gene locus_tag LOCUS_35470 839 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 1744 3789 gene locus_tag LOCUS_35480 1744 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 4027 4980 gene locus_tag LOCUS_35490 4027 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 7180 5240 gene locus_tag LOCUS_35500 7180 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 >Feature sequence219 1862 879 gene locus_tag LOCUS_35510 1862 879 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038157782.1 protein_id gnl|my_center|LOCUS_35510 2158 2571 gene locus_tag LOCUS_35520 2158 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 2568 3905 gene locus_tag LOCUS_35530 gene ltrA 2568 3905 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393716.1 protein_id gnl|my_center|LOCUS_35530 3959 4792 gene locus_tag LOCUS_35540 3959 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 5955 4798 gene locus_tag LOCUS_35550 5955 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 6224 6445 gene locus_tag LOCUS_35560 6224 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 6442 6858 gene locus_tag LOCUS_35570 6442 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 >Feature sequence220 <1 627 gene locus_tag LOCUS_35580 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141113.1:glucosidase 627 1103 gene locus_tag LOCUS_35590 627 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 1100 1348 gene locus_tag LOCUS_35600 1100 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 1710 1976 gene locus_tag LOCUS_35610 1710 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 2817 2047 gene locus_tag LOCUS_35620 2817 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 3637 2795 gene locus_tag LOCUS_35630 3637 2795 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_35630 3944 3684 gene locus_tag LOCUS_35640 3944 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947964.1 protein_id gnl|my_center|LOCUS_35640 4972 3944 gene locus_tag LOCUS_35650 4972 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 5981 5040 gene locus_tag LOCUS_35660 5981 5040 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038034.1 protein_id gnl|my_center|LOCUS_35660 >Feature sequence221 1596 1324 gene locus_tag LOCUS_35670 1596 1324 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_35670 3605 1596 gene locus_tag LOCUS_35680 gene ligA 3605 1596 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_35680 3703 5061 gene locus_tag LOCUS_35690 3703 5061 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074152.1 protein_id gnl|my_center|LOCUS_35690 5058 6455 gene locus_tag LOCUS_35700 5058 6455 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074151.1 protein_id gnl|my_center|LOCUS_35700 >Feature sequence222 410 1993 gene locus_tag LOCUS_35710 410 1993 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_35710 1990 3441 gene locus_tag LOCUS_35720 1990 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 3456 4355 gene locus_tag LOCUS_35730 3456 4355 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207225.1 protein_id gnl|my_center|LOCUS_35730 5021 4356 gene locus_tag LOCUS_35740 5021 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 6945 5041 gene locus_tag LOCUS_35750 6945 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 >Feature sequence223 2 3205 gene locus_tag LOCUS_35760 2 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 3471 3196 gene locus_tag LOCUS_35770 3471 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 3952 5685 gene locus_tag LOCUS_35780 3952 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 5682 6341 gene locus_tag LOCUS_35790 5682 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 >Feature sequence224 1681 656 gene locus_tag LOCUS_35800 1681 656 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172666.1 protein_id gnl|my_center|LOCUS_35800 2595 1771 gene locus_tag LOCUS_35810 2595 1771 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021030.1 protein_id gnl|my_center|LOCUS_35810 3007 2618 gene locus_tag LOCUS_35820 3007 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 3445 3119 gene locus_tag LOCUS_35830 3445 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 5511 3442 gene locus_tag LOCUS_35840 gene flhA 5511 3442 CDS product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816738.1 protein_id gnl|my_center|LOCUS_35840 5747 6070 gene locus_tag LOCUS_35850 5747 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 6079 6879 gene locus_tag LOCUS_35860 6079 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 >Feature sequence225 191 1459 gene locus_tag LOCUS_35870 191 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 1456 2460 gene locus_tag LOCUS_35880 1456 2460 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259591.1 protein_id gnl|my_center|LOCUS_35880 2457 3809 gene locus_tag LOCUS_35890 2457 3809 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_35890 4465 3797 gene locus_tag LOCUS_35900 4465 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 5165 4431 gene locus_tag LOCUS_35910 5165 4431 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_35910 5285 6808 gene locus_tag LOCUS_35920 5285 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 >Feature sequence226 888 283 gene locus_tag LOCUS_35930 888 283 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067574.1 protein_id gnl|my_center|LOCUS_35930 2495 876 gene locus_tag LOCUS_35940 2495 876 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_35940 3130 2492 gene locus_tag LOCUS_35950 3130 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 4041 3184 gene locus_tag LOCUS_35960 4041 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 5795 4038 gene locus_tag LOCUS_35970 5795 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 5858 6064 gene locus_tag LOCUS_35980 5858 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 6083 6622 gene locus_tag LOCUS_35990 6083 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 6553 7044 gene locus_tag LOCUS_36000 6553 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 >Feature sequence227 <1 1371 gene locus_tag LOCUS_36010 <1 1371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014400094.1:HAMP domain-containing protein 1364 2635 gene locus_tag LOCUS_36020 1364 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 2635 4647 gene locus_tag LOCUS_36030 2635 4647 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928427.1 protein_id gnl|my_center|LOCUS_36030 5602 4664 gene locus_tag LOCUS_36040 5602 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 5699 7036 gene locus_tag LOCUS_36050 5699 7036 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879259.1 protein_id gnl|my_center|LOCUS_36050 >Feature sequence228 1116 19 gene locus_tag LOCUS_36060 1116 19 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_36060 1841 1113 gene locus_tag LOCUS_36070 1841 1113 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402414.1 protein_id gnl|my_center|LOCUS_36070 1883 2965 gene locus_tag LOCUS_36080 1883 2965 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_36080 3078 2887 gene locus_tag LOCUS_36090 3078 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 3175 3909 gene locus_tag LOCUS_36100 3175 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 3842 4756 gene locus_tag LOCUS_36110 3842 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 5401 4823 gene locus_tag LOCUS_36120 5401 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 <7161 5436 gene locus_tag LOCUS_36130 <7161 5436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730132.1:CoA transferase >Feature sequence229 37 1254 gene locus_tag LOCUS_36140 37 1254 CDS product phthiodiolone/phenolphthiodiolone dimycocerosates ketoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414891.1 protein_id gnl|my_center|LOCUS_36140 1309 1545 gene locus_tag LOCUS_36150 1309 1545 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417286.1 protein_id gnl|my_center|LOCUS_36150 1545 1973 gene locus_tag LOCUS_36160 1545 1973 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417282.1 protein_id gnl|my_center|LOCUS_36160 5364 2026 gene locus_tag LOCUS_36170 5364 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 6696 5434 gene locus_tag LOCUS_36180 6696 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 >Feature sequence230 1401 124 gene locus_tag LOCUS_36190 1401 124 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770365.1 protein_id gnl|my_center|LOCUS_36190 1838 1398 gene locus_tag LOCUS_36200 1838 1398 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770367.1 protein_id gnl|my_center|LOCUS_36200 2571 1843 gene locus_tag LOCUS_36210 gene fabG 2571 1843 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_36210 3155 2568 gene locus_tag LOCUS_36220 gene fabA 3155 2568 CDS product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770369.1 protein_id gnl|my_center|LOCUS_36220 4150 3152 gene locus_tag LOCUS_36230 4150 3152 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772652.1 protein_id gnl|my_center|LOCUS_36230 5094 4147 gene locus_tag LOCUS_36240 5094 4147 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_36240 5981 5091 gene locus_tag LOCUS_36250 gene fabD 5981 5091 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_36250 6344 6799 gene locus_tag LOCUS_36260 6344 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 6824 7063 gene locus_tag LOCUS_36270 6824 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 >Feature sequence231 968 666 gene locus_tag LOCUS_36280 968 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 936 3152 gene locus_tag LOCUS_36290 936 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 3195 3959 gene locus_tag LOCUS_36300 3195 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 3978 4670 gene locus_tag LOCUS_36310 3978 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 4667 5011 gene locus_tag LOCUS_36320 4667 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 5008 5469 gene locus_tag LOCUS_36330 gene tolR 5008 5469 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126827401.1 protein_id gnl|my_center|LOCUS_36330 5473 5925 gene locus_tag LOCUS_36340 gene tolR 5473 5925 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932318.1 protein_id gnl|my_center|LOCUS_36340 5939 6580 gene locus_tag LOCUS_36350 5939 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 >Feature sequence232 402 1223 gene locus_tag LOCUS_36360 402 1223 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384269.1 protein_id gnl|my_center|LOCUS_36360 1220 2203 gene locus_tag LOCUS_36370 gene msrP 1220 2203 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889161.1 protein_id gnl|my_center|LOCUS_36370 2205 2816 gene locus_tag LOCUS_36380 2205 2816 CDS product sulfoxide reductase heme-binding subunit YedZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388352.1 protein_id gnl|my_center|LOCUS_36380 3501 2818 gene locus_tag LOCUS_36390 3501 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 2917 2983 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4649 3501 gene locus_tag LOCUS_36400 4649 3501 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388935.1 protein_id gnl|my_center|LOCUS_36400 5248 4646 gene locus_tag LOCUS_36410 5248 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 5504 5250 gene locus_tag LOCUS_36420 5504 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 >Feature sequence233 472 104 gene locus_tag LOCUS_36430 472 104 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528640.1 protein_id gnl|my_center|LOCUS_36430 1093 599 gene locus_tag LOCUS_36440 1093 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 1477 1857 gene locus_tag LOCUS_36450 1477 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 1867 2472 gene locus_tag LOCUS_36460 1867 2472 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112465.1 protein_id gnl|my_center|LOCUS_36460 4582 2492 gene locus_tag LOCUS_36470 gene flhA 4582 2492 CDS product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816738.1 protein_id gnl|my_center|LOCUS_36470 5144 4584 gene locus_tag LOCUS_36480 5144 4584 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038743.1 protein_id gnl|my_center|LOCUS_36480 6577 5174 gene locus_tag LOCUS_36490 6577 5174 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114759.1 protein_id gnl|my_center|LOCUS_36490 6960 6628 gene locus_tag LOCUS_36500 6960 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 >Feature sequence234 354 1064 gene locus_tag LOCUS_36510 354 1064 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_36510 1081 2253 gene locus_tag LOCUS_36520 1081 2253 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393099.1 protein_id gnl|my_center|LOCUS_36520 2278 3501 gene locus_tag LOCUS_36530 2278 3501 CDS product oxalate oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393098.1 protein_id gnl|my_center|LOCUS_36530 3523 4554 gene locus_tag LOCUS_36540 3523 4554 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393097.1 protein_id gnl|my_center|LOCUS_36540 4614 6314 gene locus_tag LOCUS_36550 4614 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 6510 6776 gene locus_tag LOCUS_36560 6510 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 >Feature sequence235 514 813 gene locus_tag LOCUS_36570 514 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 816 1187 gene locus_tag LOCUS_36580 816 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 2577 1237 gene locus_tag LOCUS_36590 gene algB 2577 1237 CDS product sigma-54-dependent response regulator transcription factor AlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318895.1 protein_id gnl|my_center|LOCUS_36590 3499 2579 gene locus_tag LOCUS_36600 3499 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 3844 4242 gene locus_tag LOCUS_36610 3844 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 4255 4578 gene locus_tag LOCUS_36620 4255 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 6171 4813 gene locus_tag LOCUS_36630 6171 4813 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041958803.1 protein_id gnl|my_center|LOCUS_36630 6737 6447 gene locus_tag LOCUS_36640 6737 6447 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_36640 >Feature sequence236 <1 1062 gene locus_tag LOCUS_36650 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071802696.1:multicopper oxidase family protein 1059 1664 gene locus_tag LOCUS_36660 1059 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 2497 1667 gene locus_tag LOCUS_36670 2497 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 3472 2600 gene locus_tag LOCUS_36680 3472 2600 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_36680 5117 3786 gene locus_tag LOCUS_36690 5117 3786 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_36690 5462 5145 gene locus_tag LOCUS_36700 5462 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 <6772 5475 gene locus_tag LOCUS_36710 <6772 5475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259175.1:aldehyde dehydrogenase family protein >Feature sequence237 <1 1995 gene locus_tag LOCUS_36720 <1 1995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268123.1:efflux RND transporter permease subunit 1997 2395 gene locus_tag LOCUS_36730 1997 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 2772 2416 gene locus_tag LOCUS_36740 2772 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 2874 3275 gene locus_tag LOCUS_36750 2874 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 3296 5062 gene locus_tag LOCUS_36760 3296 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 >Feature sequence238 1184 477 gene locus_tag LOCUS_36770 gene tatC 1184 477 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729395.1 protein_id gnl|my_center|LOCUS_36770 1519 1304 gene locus_tag LOCUS_36780 1519 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 2390 1530 gene locus_tag LOCUS_36790 2390 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 2779 2402 gene locus_tag LOCUS_36800 2779 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 3694 2783 gene locus_tag LOCUS_36810 3694 2783 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192197.1 protein_id gnl|my_center|LOCUS_36810 4208 4408 gene locus_tag LOCUS_36820 4208 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 4492 5829 gene locus_tag LOCUS_36830 4492 5829 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225610.1 protein_id gnl|my_center|LOCUS_36830 5991 6461 gene locus_tag LOCUS_36840 5991 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 >Feature sequence239 <1 667 gene locus_tag LOCUS_36850 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728229.1:enoyl-CoA hydratase/isomerase family protein 1473 670 gene locus_tag LOCUS_36860 1473 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 3783 1552 gene locus_tag LOCUS_36870 3783 1552 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404295.1 protein_id gnl|my_center|LOCUS_36870 4631 3750 gene locus_tag LOCUS_36880 4631 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 4708 5211 gene locus_tag LOCUS_36890 4708 5211 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398479.1 protein_id gnl|my_center|LOCUS_36890 5216 5452 gene locus_tag LOCUS_36900 gene moaD 5216 5452 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257741.1 protein_id gnl|my_center|LOCUS_36900 6353 5439 gene locus_tag LOCUS_36910 6353 5439 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123518.1 protein_id gnl|my_center|LOCUS_36910 >Feature sequence240 262 1482 gene locus_tag LOCUS_36920 262 1482 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907859.1 protein_id gnl|my_center|LOCUS_36920 1521 2819 gene locus_tag LOCUS_36930 1521 2819 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681425.1 protein_id gnl|my_center|LOCUS_36930 3399 2821 gene locus_tag LOCUS_36940 gene pyrE 3399 2821 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546400.1 protein_id gnl|my_center|LOCUS_36940 3866 3396 gene locus_tag LOCUS_36950 3866 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 4815 3868 gene locus_tag LOCUS_36960 4815 3868 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_36960 5475 4825 gene locus_tag LOCUS_36970 5475 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 >Feature sequence241 561 2243 gene locus_tag LOCUS_36980 561 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 2252 4096 gene locus_tag LOCUS_36990 2252 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 4106 5143 gene locus_tag LOCUS_37000 4106 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 >Feature sequence242 283 209 gene locus_tag LOCUS_t00370 283 209 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 355 528 gene locus_tag LOCUS_37010 355 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 1507 545 gene locus_tag LOCUS_37020 1507 545 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022783.1 protein_id gnl|my_center|LOCUS_37020 3780 1504 gene locus_tag LOCUS_37030 3780 1504 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119132.1 protein_id gnl|my_center|LOCUS_37030 4384 4250 gene locus_tag LOCUS_37040 4384 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 4975 5886 gene locus_tag LOCUS_37050 4975 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 >Feature sequence243 1193 1606 gene locus_tag LOCUS_37060 1193 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 1677 3719 gene locus_tag LOCUS_37070 1677 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 4529 4299 gene locus_tag LOCUS_37080 4529 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 >Feature sequence244 1629 205 gene locus_tag LOCUS_37090 1629 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 2017 2346 gene locus_tag LOCUS_37100 2017 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 2484 3389 gene locus_tag LOCUS_37110 2484 3389 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057545.1 protein_id gnl|my_center|LOCUS_37110 3392 5095 gene locus_tag LOCUS_37120 3392 5095 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086257.1 protein_id gnl|my_center|LOCUS_37120 5246 5950 gene locus_tag LOCUS_37130 5246 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 >Feature sequence245 437 21 gene locus_tag LOCUS_37140 437 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 610 948 gene locus_tag LOCUS_37150 610 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 1772 1095 gene locus_tag LOCUS_37160 1772 1095 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706194.1 protein_id gnl|my_center|LOCUS_37160 2203 1763 gene locus_tag LOCUS_37170 2203 1763 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525097.1 protein_id gnl|my_center|LOCUS_37170 2602 3807 gene locus_tag LOCUS_37180 2602 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 4299 3988 gene locus_tag LOCUS_37190 4299 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 5413 4433 gene locus_tag LOCUS_37200 5413 4433 CDS product protochlorophyllide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900117.1 protein_id gnl|my_center|LOCUS_37200 >Feature sequence246 3742 2966 gene locus_tag LOCUS_37210 3742 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 3623 3889 gene locus_tag LOCUS_37220 3623 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 4181 4582 gene locus_tag LOCUS_37230 4181 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 4880 5074 gene locus_tag LOCUS_37240 4880 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 5064 5981 gene locus_tag LOCUS_37250 5064 5981 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755958.1 protein_id gnl|my_center|LOCUS_37250 6040 6264 gene locus_tag LOCUS_37260 6040 6264 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 protein_id gnl|my_center|LOCUS_37260 >Feature sequence247 428 2512 gene locus_tag LOCUS_37270 428 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 3919 2516 gene locus_tag LOCUS_37280 3919 2516 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089663.1 protein_id gnl|my_center|LOCUS_37280 <6348 3927 gene locus_tag LOCUS_37290 <6348 3927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein >Feature sequence248 1709 4384 gene locus_tag LOCUS_37300 1709 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 4392 5249 gene locus_tag LOCUS_37310 4392 5249 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892776.1 protein_id gnl|my_center|LOCUS_37310 5259 6107 gene locus_tag LOCUS_37320 5259 6107 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_37320 >Feature sequence249 1202 2332 gene locus_tag LOCUS_37330 1202 2332 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_37330 2329 3267 gene locus_tag LOCUS_37340 2329 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 3267 4286 gene locus_tag LOCUS_37350 3267 4286 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061730.1 protein_id gnl|my_center|LOCUS_37350 4255 5274 gene locus_tag LOCUS_37360 4255 5274 CDS product HpnL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206084.1 protein_id gnl|my_center|LOCUS_37360 5271 6272 gene locus_tag LOCUS_37370 5271 6272 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325827.1 protein_id gnl|my_center|LOCUS_37370 >Feature sequence250 158 1333 gene locus_tag LOCUS_37380 158 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 1359 1961 gene locus_tag LOCUS_37390 1359 1961 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256807.1 protein_id gnl|my_center|LOCUS_37390 1958 2908 gene locus_tag LOCUS_37400 1958 2908 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 protein_id gnl|my_center|LOCUS_37400 3071 3934 gene locus_tag LOCUS_37410 3071 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 3991 5373 gene locus_tag LOCUS_37420 3991 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 >Feature sequence251 1378 212 gene locus_tag LOCUS_37430 gene sucC 1378 212 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 protein_id gnl|my_center|LOCUS_37430 2150 1386 gene locus_tag LOCUS_37440 gene sdhB 2150 1386 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139712.1 protein_id gnl|my_center|LOCUS_37440 3897 2143 gene locus_tag LOCUS_37450 gene sdhA 3897 2143 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808703.1 protein_id gnl|my_center|LOCUS_37450 4535 3900 gene locus_tag LOCUS_37460 gene sdhC 4535 3900 CDS product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678351.1 protein_id gnl|my_center|LOCUS_37460 4709 4803 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6051 5482 gene locus_tag LOCUS_37470 6051 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 >Feature sequence252 849 1574 gene locus_tag LOCUS_37480 849 1574 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325539.1 protein_id gnl|my_center|LOCUS_37480 1586 2374 gene locus_tag LOCUS_37490 1586 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 2515 3447 gene locus_tag LOCUS_37500 2515 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 3449 4285 gene locus_tag LOCUS_37510 3449 4285 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_37510 4282 5931 gene locus_tag LOCUS_37520 4282 5931 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168296.1 protein_id gnl|my_center|LOCUS_37520 >Feature sequence253 596 51 gene locus_tag LOCUS_37530 596 51 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403162.1 protein_id gnl|my_center|LOCUS_37530 783 3149 gene locus_tag LOCUS_37540 783 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 3808 3194 gene locus_tag LOCUS_37550 gene cysC 3808 3194 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643136.1 protein_id gnl|my_center|LOCUS_37550 3914 4765 gene locus_tag LOCUS_37560 3914 4765 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 protein_id gnl|my_center|LOCUS_37560 <6160 4934 gene locus_tag LOCUS_37570 <6160 4934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389348.1:acyl-CoA synthetase >Feature sequence254 1107 379 gene locus_tag LOCUS_37580 1107 379 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920524.1 protein_id gnl|my_center|LOCUS_37580 2769 1123 gene locus_tag LOCUS_37590 2769 1123 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_37590 3479 2772 gene locus_tag LOCUS_37600 3479 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 3444 3755 gene locus_tag LOCUS_37610 3444 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 4818 3745 gene locus_tag LOCUS_37620 gene dnaJ 4818 3745 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546226.1 protein_id gnl|my_center|LOCUS_37620 5032 4841 gene locus_tag LOCUS_37630 gene rpoZ 5032 4841 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_37630 5163 5621 gene locus_tag LOCUS_37640 5163 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 <6153 5590 gene locus_tag LOCUS_37650 <6153 5590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942068.1:TlyA family rRNA (cytidine-2'-O)-methyltransferase >Feature sequence255 <1 1757 gene locus_tag LOCUS_37660 <1 1757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_179943936.1:PKD domain-containing protein 1955 3724 gene locus_tag LOCUS_37670 1955 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 5539 3872 gene locus_tag LOCUS_37680 5539 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 >Feature sequence256 433 1644 gene locus_tag LOCUS_37690 433 1644 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_37690 1652 4825 gene locus_tag LOCUS_37700 1652 4825 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532875.1 protein_id gnl|my_center|LOCUS_37700 >Feature sequence257 <1 798 gene locus_tag LOCUS_37710 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000115178.1:succinate--CoA ligase subunit alpha 795 1229 gene locus_tag LOCUS_37720 gene ndk 795 1229 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_37720 1809 2237 gene locus_tag LOCUS_37730 1809 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 2259 2768 gene locus_tag LOCUS_37740 2259 2768 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926777.1 protein_id gnl|my_center|LOCUS_37740 2792 3223 gene locus_tag LOCUS_37750 2792 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 3216 3545 gene locus_tag LOCUS_37760 3216 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 3580 4644 gene locus_tag LOCUS_37770 gene rlmN 3580 4644 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_37770 4646 5584 gene locus_tag LOCUS_37780 4646 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 >Feature sequence258 1624 371 gene locus_tag LOCUS_37790 1624 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 2025 1621 gene locus_tag LOCUS_37800 2025 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 2962 2030 gene locus_tag LOCUS_37810 2962 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 4192 2978 gene locus_tag LOCUS_37820 4192 2978 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940269.1 protein_id gnl|my_center|LOCUS_37820 4451 4179 gene locus_tag LOCUS_37830 4451 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 4453 5172 gene locus_tag LOCUS_37840 4453 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 5978 5169 gene locus_tag LOCUS_37850 5978 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 5862 6074 gene locus_tag LOCUS_37860 5862 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 >Feature sequence259 621 124 gene locus_tag LOCUS_37870 gene rpoE 621 124 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_37870 698 1264 gene locus_tag LOCUS_37880 698 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 1261 1941 gene locus_tag LOCUS_37890 1261 1941 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391105.1 protein_id gnl|my_center|LOCUS_37890 1829 2980 gene locus_tag LOCUS_37900 1829 2980 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_37900 4634 3027 gene locus_tag LOCUS_37910 4634 3027 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730669.1 protein_id gnl|my_center|LOCUS_37910 >Feature sequence260 925 946 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1004 2569 gene locus_tag LOCUS_37920 1004 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 2909 4387 gene locus_tag LOCUS_37930 2909 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 >Feature sequence261 1785 934 gene locus_tag LOCUS_37940 1785 934 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 protein_id gnl|my_center|LOCUS_37940 1838 3190 gene locus_tag LOCUS_37950 1838 3190 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004402712.1 protein_id gnl|my_center|LOCUS_37950 4513 3197 gene locus_tag LOCUS_37960 4513 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 >Feature sequence262 525 833 gene locus_tag LOCUS_37970 525 833 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256599.1 protein_id gnl|my_center|LOCUS_37970 878 1120 gene locus_tag LOCUS_37980 878 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 1425 1153 gene locus_tag LOCUS_37990 1425 1153 CDS product DUF3303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532573.1 protein_id gnl|my_center|LOCUS_37990 2954 2697 gene locus_tag LOCUS_38000 2954 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 2982 3503 gene locus_tag LOCUS_38010 2982 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 4018 3434 gene locus_tag LOCUS_38020 4018 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 4756 4190 gene locus_tag LOCUS_38030 4756 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 4872 5114 gene locus_tag LOCUS_38040 4872 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 >Feature sequence263 1 186 gene locus_tag LOCUS_38050 1 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 183 1052 gene locus_tag LOCUS_38060 gene pstA 183 1052 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_38060 1106 1864 gene locus_tag LOCUS_38070 gene pstB 1106 1864 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962535.1 protein_id gnl|my_center|LOCUS_38070 1864 2547 gene locus_tag LOCUS_38080 gene phoU 1864 2547 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_38080 3073 2492 gene locus_tag LOCUS_38090 3073 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 5645 3477 gene locus_tag LOCUS_38100 5645 3477 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056504.1 protein_id gnl|my_center|LOCUS_38100 >Feature sequence264 337 249 gene locus_tag LOCUS_t00380 337 249 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1385 381 gene locus_tag LOCUS_38110 1385 381 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_38110 1493 1855 gene locus_tag LOCUS_38120 1493 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 3086 1848 gene locus_tag LOCUS_38130 gene serS 3086 1848 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256350.1 protein_id gnl|my_center|LOCUS_38130 3477 3118 gene locus_tag LOCUS_38140 3477 3118 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_38140 3564 3851 gene locus_tag LOCUS_38150 gene gatC 3564 3851 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_38150 3848 5308 gene locus_tag LOCUS_38160 gene gatA 3848 5308 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257583.1 protein_id gnl|my_center|LOCUS_38160 >Feature sequence265 577 2556 gene locus_tag LOCUS_38170 577 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 2797 2561 gene locus_tag LOCUS_38180 2797 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 3048 3305 gene locus_tag LOCUS_38190 3048 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 3302 3730 gene locus_tag LOCUS_38200 3302 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 4187 3981 gene locus_tag LOCUS_38210 4187 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 4431 4518 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5330 4656 gene locus_tag LOCUS_38220 5330 4656 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920739.1 protein_id gnl|my_center|LOCUS_38220 5526 5834 gene locus_tag LOCUS_38230 5526 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 >Feature sequence266 2735 1173 gene locus_tag LOCUS_38240 2735 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 3036 3551 gene locus_tag LOCUS_38250 3036 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 >Feature sequence267 334 1506 gene locus_tag LOCUS_38260 334 1506 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418997.1 protein_id gnl|my_center|LOCUS_38260 1515 2603 gene locus_tag LOCUS_38270 1515 2603 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224294.1 protein_id gnl|my_center|LOCUS_38270 2600 3340 gene locus_tag LOCUS_38280 2600 3340 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057504658.1 protein_id gnl|my_center|LOCUS_38280 >Feature sequence268 12 182 gene locus_tag LOCUS_38290 12 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 1572 253 gene locus_tag LOCUS_38300 1572 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 2911 1634 gene locus_tag LOCUS_38310 2911 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 4158 2938 gene locus_tag LOCUS_38320 4158 2938 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141066.1 protein_id gnl|my_center|LOCUS_38320 4510 4151 gene locus_tag LOCUS_38330 4510 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 >Feature sequence269 384 1496 gene locus_tag LOCUS_38340 384 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 1523 2176 gene locus_tag LOCUS_38350 1523 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 2625 2182 gene locus_tag LOCUS_38360 2625 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 3425 2628 gene locus_tag LOCUS_38370 gene paaG 3425 2628 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_38370 4219 3428 gene locus_tag LOCUS_38380 4219 3428 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_38380 5406 4216 gene locus_tag LOCUS_38390 5406 4216 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900438.1 protein_id gnl|my_center|LOCUS_38390 >Feature sequence270 1459 281 gene locus_tag LOCUS_38400 1459 281 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941825.1 protein_id gnl|my_center|LOCUS_38400 2631 1462 gene locus_tag LOCUS_38410 2631 1462 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941824.1 protein_id gnl|my_center|LOCUS_38410 3389 2628 gene locus_tag LOCUS_38420 3389 2628 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_38420 4023 3511 gene locus_tag LOCUS_38430 4023 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 5321 4044 gene locus_tag LOCUS_38440 5321 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 >Feature sequence271 2 157 gene locus_tag LOCUS_38450 2 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 1189 245 gene locus_tag LOCUS_38460 1189 245 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192895.1 protein_id gnl|my_center|LOCUS_38460 1622 1206 gene locus_tag LOCUS_38470 1622 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 1955 4990 gene locus_tag LOCUS_38480 1955 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941637.1 protein_id gnl|my_center|LOCUS_38480 >Feature sequence272 2 130 gene locus_tag LOCUS_38490 2 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 364 954 gene locus_tag LOCUS_38500 364 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 1865 1242 gene locus_tag LOCUS_38510 1865 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930591.1 protein_id gnl|my_center|LOCUS_38510 2162 3811 gene locus_tag LOCUS_38520 2162 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38520 3808 4347 gene locus_tag LOCUS_38530 3808 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 4756 5517 gene locus_tag LOCUS_38540 4756 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161491309.1 protein_id gnl|my_center|LOCUS_38540 >Feature sequence273 297 1148 gene locus_tag LOCUS_38550 297 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 1145 1903 gene locus_tag LOCUS_38560 1145 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 2139 4157 gene locus_tag LOCUS_38570 2139 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 4250 5038 gene locus_tag LOCUS_38580 4250 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 5349 5077 gene locus_tag LOCUS_38590 5349 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 >Feature sequence274 1621 2634 gene locus_tag LOCUS_38600 1621 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 3044 2646 gene locus_tag LOCUS_38610 gene fabZ 3044 2646 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811776.1 protein_id gnl|my_center|LOCUS_38610 4210 3041 gene locus_tag LOCUS_38620 4210 3041 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388141.1 protein_id gnl|my_center|LOCUS_38620 5427 4207 gene locus_tag LOCUS_38630 5427 4207 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941128.1 protein_id gnl|my_center|LOCUS_38630 5697 5437 gene locus_tag LOCUS_38640 5697 5437 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940916.1 protein_id gnl|my_center|LOCUS_38640 >Feature sequence275 874 1347 gene locus_tag LOCUS_38650 874 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 2587 1331 gene locus_tag LOCUS_38660 2587 1331 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259400.1 protein_id gnl|my_center|LOCUS_38660 2668 3441 gene locus_tag LOCUS_38670 2668 3441 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027790.1 protein_id gnl|my_center|LOCUS_38670 4445 3360 gene locus_tag LOCUS_38680 4445 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 <5675 5102 gene locus_tag LOCUS_38690 <5675 5102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226841.1:LLM class F420-dependent oxidoreductase >Feature sequence276 3494 309 gene locus_tag LOCUS_38700 3494 309 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275353.1 protein_id gnl|my_center|LOCUS_38700 4318 3497 gene locus_tag LOCUS_38710 4318 3497 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_38710 5199 4315 gene locus_tag LOCUS_38720 5199 4315 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037350.1 protein_id gnl|my_center|LOCUS_38720 >Feature sequence277 1324 1058 gene locus_tag LOCUS_38730 1324 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 1616 1479 gene locus_tag LOCUS_38740 1616 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 2099 1710 gene locus_tag LOCUS_38750 2099 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 2612 2127 gene locus_tag LOCUS_38760 2612 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 3265 2618 gene locus_tag LOCUS_38770 3265 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 3480 3893 gene locus_tag LOCUS_38780 3480 3893 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228700.1 protein_id gnl|my_center|LOCUS_38780 3932 4771 gene locus_tag LOCUS_38790 3932 4771 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971021.1 protein_id gnl|my_center|LOCUS_38790 5542 4817 gene locus_tag LOCUS_38800 5542 4817 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040854.1 protein_id gnl|my_center|LOCUS_38800 >Feature sequence278 1651 542 gene locus_tag LOCUS_38810 1651 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 2921 1644 gene locus_tag LOCUS_38820 2921 1644 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_38820 3029 4420 gene locus_tag LOCUS_38830 3029 4420 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225960.1 protein_id gnl|my_center|LOCUS_38830 5113 4529 gene locus_tag LOCUS_38840 5113 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 >Feature sequence279 1506 778 gene locus_tag LOCUS_38850 1506 778 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_38850 1532 3442 gene locus_tag LOCUS_38860 1532 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 3629 4039 gene locus_tag LOCUS_38870 3629 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 >Feature sequence280 <1 610 gene locus_tag LOCUS_38880 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193485851.1:penicillin acylase family protein 1062 826 gene locus_tag LOCUS_38890 1062 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 1553 2113 gene locus_tag LOCUS_38900 1553 2113 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192474.1 protein_id gnl|my_center|LOCUS_38900 2302 3987 gene locus_tag LOCUS_38910 2302 3987 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_38910 3988 4623 gene locus_tag LOCUS_38920 3988 4623 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460450.1 protein_id gnl|my_center|LOCUS_38920 5091 4630 gene locus_tag LOCUS_38930 5091 4630 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081451.1 protein_id gnl|my_center|LOCUS_38930 >Feature sequence281 1136 1423 gene locus_tag LOCUS_38940 1136 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 2276 1389 gene locus_tag LOCUS_38950 2276 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 5020 2741 gene locus_tag LOCUS_38960 5020 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 >Feature sequence282 332 748 gene locus_tag LOCUS_38970 332 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 891 2297 gene locus_tag LOCUS_38980 891 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 2294 3349 gene locus_tag LOCUS_38990 2294 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 >Feature sequence283 1260 379 gene locus_tag LOCUS_39000 gene hpnK 1260 379 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_39000 2921 1257 gene locus_tag LOCUS_39010 2921 1257 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404191.1 protein_id gnl|my_center|LOCUS_39010 3949 3152 gene locus_tag LOCUS_39020 3949 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 4039 4374 gene locus_tag LOCUS_39030 4039 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 4652 5185 gene locus_tag LOCUS_39040 4652 5185 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267057.1 protein_id gnl|my_center|LOCUS_39040 >Feature sequence284 1284 109 gene locus_tag LOCUS_39050 1284 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 1681 1899 gene locus_tag LOCUS_39060 1681 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 1896 2654 gene locus_tag LOCUS_39070 1896 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 3580 2669 gene locus_tag LOCUS_39080 3580 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 3676 4890 gene locus_tag LOCUS_39090 3676 4890 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_39090 >Feature sequence285 1121 1567 gene locus_tag LOCUS_39100 1121 1567 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_39100 1718 2803 gene locus_tag LOCUS_39110 1718 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 2810 3004 gene locus_tag LOCUS_39120 2810 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 3039 3407 gene locus_tag LOCUS_39130 3039 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 3992 3594 gene locus_tag LOCUS_39140 3992 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 4264 3989 gene locus_tag LOCUS_39150 4264 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 4614 4264 gene locus_tag LOCUS_39160 4614 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 4970 4611 gene locus_tag LOCUS_39170 4970 4611 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031215.1 protein_id gnl|my_center|LOCUS_39170 >Feature sequence286 194 955 gene locus_tag LOCUS_39180 194 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 1232 963 gene locus_tag LOCUS_39190 1232 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 3631 1232 gene locus_tag LOCUS_39200 3631 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 4291 3647 gene locus_tag LOCUS_39210 4291 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 5031 4294 gene locus_tag LOCUS_39220 5031 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 >Feature sequence287 335 4855 gene locus_tag LOCUS_39230 gene gltB 335 4855 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_39230 >Feature sequence288 1260 121 gene locus_tag LOCUS_39240 1260 121 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870391.1 protein_id gnl|my_center|LOCUS_39240 2126 1257 gene locus_tag LOCUS_39250 gene amrB 2126 1257 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005130.1 protein_id gnl|my_center|LOCUS_39250 2389 2123 gene locus_tag LOCUS_39260 2389 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 2486 4807 gene locus_tag LOCUS_39270 2486 4807 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943755.1 protein_id gnl|my_center|LOCUS_39270 <5374 4828 gene locus_tag LOCUS_39280 <5374 4828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083453276.1:universal stress protein >Feature sequence289 2003 519 gene locus_tag LOCUS_39290 2003 519 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728228.1 protein_id gnl|my_center|LOCUS_39290 3520 2003 gene locus_tag LOCUS_39300 gene fadD5 3520 2003 CDS product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726688.1 protein_id gnl|my_center|LOCUS_39300 4635 3520 gene locus_tag LOCUS_39310 4635 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 4910 4752 gene locus_tag LOCUS_39320 4910 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 4885 5124 gene locus_tag LOCUS_39330 4885 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 >Feature sequence290 3265 656 gene locus_tag LOCUS_39340 3265 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 3495 3352 gene locus_tag LOCUS_39350 3495 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 5350 3467 gene locus_tag LOCUS_39360 5350 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 >Feature sequence291 1202 1254 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2002 1277 gene locus_tag LOCUS_39370 2002 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 2190 2014 gene locus_tag LOCUS_39380 2190 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 3006 2431 gene locus_tag LOCUS_39390 3006 2431 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231280.1 protein_id gnl|my_center|LOCUS_39390 3365 3685 gene locus_tag LOCUS_39400 3365 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 3883 4110 gene locus_tag LOCUS_39410 3883 4110 CDS product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907085.1 protein_id gnl|my_center|LOCUS_39410 4579 4355 gene locus_tag LOCUS_39420 4579 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 4961 4518 gene locus_tag LOCUS_39430 4961 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 >Feature sequence292 <1 1348 gene locus_tag LOCUS_39440 <1 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941133.1:elongation factor P 1461 2465 gene locus_tag LOCUS_39450 1461 2465 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937980.1 protein_id gnl|my_center|LOCUS_39450 3636 2518 gene locus_tag LOCUS_39460 3636 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 4546 3710 gene locus_tag LOCUS_39470 4546 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 4808 5188 gene locus_tag LOCUS_39480 4808 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 >Feature sequence293 3188 4441 gene locus_tag LOCUS_39490 3188 4441 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729152.1 protein_id gnl|my_center|LOCUS_39490 4503 5084 gene locus_tag LOCUS_39500 4503 5084 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141208.1 protein_id gnl|my_center|LOCUS_39500 >Feature sequence294 413 135 gene locus_tag LOCUS_39510 413 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 334 702 gene locus_tag LOCUS_39520 334 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 705 1583 gene locus_tag LOCUS_39530 705 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 2549 1680 gene locus_tag LOCUS_39540 2549 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 3451 2546 gene locus_tag LOCUS_39550 3451 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 4925 3525 gene locus_tag LOCUS_39560 4925 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 >Feature sequence295 2165 426 gene locus_tag LOCUS_39570 2165 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 2268 2717 gene locus_tag LOCUS_39580 2268 2717 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071234.1 protein_id gnl|my_center|LOCUS_39580 4525 2714 gene locus_tag LOCUS_39590 4525 2714 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_39590 <5212 4578 gene locus_tag LOCUS_39600 <5212 4578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902286.1:glucose 1-dehydrogenase >Feature sequence296 578 162 gene locus_tag LOCUS_39610 578 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 1111 575 gene locus_tag LOCUS_39620 1111 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 3197 1104 gene locus_tag LOCUS_39630 gene fusA 3197 1104 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_39630 3972 3187 gene locus_tag LOCUS_39640 3972 3187 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_39640 4937 3969 gene locus_tag LOCUS_39650 4937 3969 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942580.1 protein_id gnl|my_center|LOCUS_39650 >Feature sequence297 698 126 gene locus_tag LOCUS_39660 698 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 947 723 gene locus_tag LOCUS_39670 947 723 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079902.1 protein_id gnl|my_center|LOCUS_39670 1191 961 gene locus_tag LOCUS_39680 1191 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 1416 1204 gene locus_tag LOCUS_39690 1416 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 2759 1602 gene locus_tag LOCUS_39700 2759 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 3217 2741 gene locus_tag LOCUS_39710 3217 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 4044 3286 gene locus_tag LOCUS_39720 4044 3286 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974147.1 protein_id gnl|my_center|LOCUS_39720 4945 4277 gene locus_tag LOCUS_39730 4945 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 >Feature sequence298 728 2605 gene locus_tag LOCUS_39740 728 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 2608 3093 gene locus_tag LOCUS_39750 2608 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 <5165 3566 gene locus_tag LOCUS_39760 <5165 3566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969278.1:N-acetylglutaminylglutamine amidotransferase >Feature sequence299 1181 990 gene locus_tag LOCUS_39770 1181 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 1472 3472 gene locus_tag LOCUS_39780 1472 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 3469 4863 gene locus_tag LOCUS_39790 3469 4863 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_39790 >Feature sequence300 425 2014 gene locus_tag LOCUS_39800 425 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 3179 2025 gene locus_tag LOCUS_39810 3179 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 3434 3589 gene locus_tag LOCUS_39820 3434 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 3609 4304 gene locus_tag LOCUS_39830 3609 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 >Feature sequence301 1372 257 gene locus_tag LOCUS_39840 1372 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_39840 1741 1439 gene locus_tag LOCUS_39850 1741 1439 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529430.1 protein_id gnl|my_center|LOCUS_39850 2075 1761 gene locus_tag LOCUS_39860 2075 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 2029 2598 gene locus_tag LOCUS_39870 2029 2598 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_39870 2692 3249 gene locus_tag LOCUS_39880 2692 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 4507 3254 gene locus_tag LOCUS_39890 4507 3254 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798684.1 protein_id gnl|my_center|LOCUS_39890 >Feature sequence302 523 320 gene locus_tag LOCUS_39900 523 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 2115 607 gene locus_tag LOCUS_39910 2115 607 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401279.1 protein_id gnl|my_center|LOCUS_39910 4647 2116 gene locus_tag LOCUS_39920 gene hrpB 4647 2116 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_39920 >Feature sequence303 1359 208 gene locus_tag LOCUS_39930 1359 208 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225678.1 protein_id gnl|my_center|LOCUS_39930 1416 2579 gene locus_tag LOCUS_39940 1416 2579 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225242.1 protein_id gnl|my_center|LOCUS_39940 2585 3442 gene locus_tag LOCUS_39950 2585 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 3439 4620 gene locus_tag LOCUS_39960 3439 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 4750 5064 gene locus_tag LOCUS_39970 4750 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 >Feature sequence304 178 858 gene locus_tag LOCUS_39980 178 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 962 1372 gene locus_tag LOCUS_39990 962 1372 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808387.1 protein_id gnl|my_center|LOCUS_39990 1548 1985 gene locus_tag LOCUS_40000 1548 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 2031 2681 gene locus_tag LOCUS_40010 2031 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 2765 3166 gene locus_tag LOCUS_40020 2765 3166 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142140.1 protein_id gnl|my_center|LOCUS_40020 4203 3247 gene locus_tag LOCUS_40030 4203 3247 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225228.1 protein_id gnl|my_center|LOCUS_40030 <5104 4329 gene locus_tag LOCUS_40040 <5104 4329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275299.1:DUF3014 domain-containing protein >Feature sequence305 1187 1699 gene locus_tag LOCUS_40050 1187 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 3205 1760 gene locus_tag LOCUS_40060 3205 1760 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_40060 3301 4311 gene locus_tag LOCUS_40070 3301 4311 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900173.1 protein_id gnl|my_center|LOCUS_40070 4330 4830 gene locus_tag LOCUS_40080 4330 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 >Feature sequence306 2548 2174 gene locus_tag LOCUS_40090 2548 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 4040 2877 gene locus_tag LOCUS_40100 4040 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 >Feature sequence307 1751 456 gene locus_tag LOCUS_40110 1751 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 3268 1748 gene locus_tag LOCUS_40120 3268 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 3515 3261 gene locus_tag LOCUS_40130 3515 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 3976 3512 gene locus_tag LOCUS_40140 3976 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 4941 3976 gene locus_tag LOCUS_40150 4941 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 >Feature sequence308 137 1489 gene locus_tag LOCUS_40160 137 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 1486 2451 gene locus_tag LOCUS_40170 1486 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 2567 4594 gene locus_tag LOCUS_40180 2567 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 >Feature sequence309 2566 830 gene locus_tag LOCUS_40190 2566 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 2682 2909 gene locus_tag LOCUS_40200 2682 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 4759 3833 gene locus_tag LOCUS_40210 4759 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 >Feature sequence310 791 1975 gene locus_tag LOCUS_40220 791 1975 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_40220 1975 3123 gene locus_tag LOCUS_40230 1975 3123 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_40230 3139 3615 gene locus_tag LOCUS_40240 3139 3615 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944057.1 protein_id gnl|my_center|LOCUS_40240 >Feature sequence311 <1 703 gene locus_tag LOCUS_40250 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392230.1:QueT transporter family protein 700 2376 gene locus_tag LOCUS_40260 700 2376 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392228.1 protein_id gnl|my_center|LOCUS_40260 2381 3145 gene locus_tag LOCUS_40270 2381 3145 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249696.1 protein_id gnl|my_center|LOCUS_40270 3178 4437 gene locus_tag LOCUS_40280 gene fabF 3178 4437 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_40280 >Feature sequence312 262 861 gene locus_tag LOCUS_40290 262 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 1077 2249 gene locus_tag LOCUS_40300 1077 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 2289 3227 gene locus_tag LOCUS_40310 2289 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 >Feature sequence313 949 230 gene locus_tag LOCUS_40320 949 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 1112 1534 gene locus_tag LOCUS_40330 1112 1534 CDS product DUF3237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206153.1 protein_id gnl|my_center|LOCUS_40330 2409 1519 gene locus_tag LOCUS_40340 2409 1519 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704730.1 protein_id gnl|my_center|LOCUS_40340 2466 3635 gene locus_tag LOCUS_40350 2466 3635 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728241.1 protein_id gnl|my_center|LOCUS_40350 4668 3637 gene locus_tag LOCUS_40360 4668 3637 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122762.1 protein_id gnl|my_center|LOCUS_40360 >Feature sequence314 9 941 gene locus_tag LOCUS_40370 9 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 949 2484 gene locus_tag LOCUS_40380 949 2484 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_40380 2489 3976 gene locus_tag LOCUS_40390 2489 3976 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932458.1 protein_id gnl|my_center|LOCUS_40390 4345 4878 gene locus_tag LOCUS_40400 4345 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 >Feature sequence315 2269 443 gene locus_tag LOCUS_40410 2269 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 >Feature sequence316 809 402 gene locus_tag LOCUS_40420 809 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 1975 812 gene locus_tag LOCUS_40430 1975 812 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419287.1 protein_id gnl|my_center|LOCUS_40430 3347 2163 gene locus_tag LOCUS_40440 3347 2163 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113133.1 protein_id gnl|my_center|LOCUS_40440 >Feature sequence317 70 1626 gene locus_tag LOCUS_40450 70 1626 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933376.1 protein_id gnl|my_center|LOCUS_40450 1634 2353 gene locus_tag LOCUS_40460 gene tmk 1634 2353 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_40460 2340 3146 gene locus_tag LOCUS_40470 2340 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 3150 4097 gene locus_tag LOCUS_40480 3150 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 4094 4594 gene locus_tag LOCUS_40490 4094 4594 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943199.1 protein_id gnl|my_center|LOCUS_40490 >Feature sequence318 1545 130 gene locus_tag LOCUS_40500 1545 130 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869326.1 protein_id gnl|my_center|LOCUS_40500 1661 2557 gene locus_tag LOCUS_40510 1661 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 2557 4419 gene locus_tag LOCUS_40520 2557 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 4365 4568 gene locus_tag LOCUS_40530 4365 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 >Feature sequence319 <1 716 gene locus_tag LOCUS_40540 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004537977.1:CpaF family protein 730 1692 gene locus_tag LOCUS_40550 730 1692 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939400.1 protein_id gnl|my_center|LOCUS_40550 1705 2637 gene locus_tag LOCUS_40560 1705 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 2646 3638 gene locus_tag LOCUS_40570 2646 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 >Feature sequence320 1554 3254 gene locus_tag LOCUS_40580 1554 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 3656 3312 gene locus_tag LOCUS_40590 3656 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 >Feature sequence321 <1 1362 gene locus_tag LOCUS_40600 <1 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056543.1:NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta 1382 1819 gene locus_tag LOCUS_40610 1382 1819 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762782.1 protein_id gnl|my_center|LOCUS_40610 2684 1851 gene locus_tag LOCUS_40620 2684 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 3066 3689 gene locus_tag LOCUS_40630 3066 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 <4696 4019 gene locus_tag LOCUS_40640 <4696 4019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226360.1:FAD-binding oxidoreductase >Feature sequence322 <1 1018 gene locus_tag LOCUS_40650 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967234.1:PAS domain S-box protein 1015 1638 gene locus_tag LOCUS_40660 1015 1638 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087542.1 protein_id gnl|my_center|LOCUS_40660 1721 2155 gene locus_tag LOCUS_40670 1721 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 2139 3209 gene locus_tag LOCUS_40680 2139 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 3818 3384 gene locus_tag LOCUS_40690 3818 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 4103 3831 gene locus_tag LOCUS_40700 4103 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 4102 4260 gene locus_tag LOCUS_40710 4102 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 >Feature sequence323 2249 1368 gene locus_tag LOCUS_40720 2249 1368 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_40720 4251 2320 gene locus_tag LOCUS_40730 4251 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 >Feature sequence324 72 341 gene locus_tag LOCUS_40740 72 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 355 1155 gene locus_tag LOCUS_40750 355 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 2904 1189 gene locus_tag LOCUS_40760 2904 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 3048 3070 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <4639 3199 gene locus_tag LOCUS_40770 <4639 3199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226015.1:biotin carboxylase N-terminal domain-containing protein >Feature sequence325 <1 1595 gene locus_tag LOCUS_40780 <1 1595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_091308744.1:S8 family serine peptidase 3134 1629 gene locus_tag LOCUS_40790 3134 1629 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122406836.1 protein_id gnl|my_center|LOCUS_40790 3556 3170 gene locus_tag LOCUS_40800 3556 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 3918 3553 gene locus_tag LOCUS_40810 3918 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 4026 4520 gene locus_tag LOCUS_40820 4026 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 >Feature sequence326 4078 3500 gene locus_tag LOCUS_40830 4078 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 <4598 4075 gene locus_tag LOCUS_40840 <4598 4075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770694.1:lysophospholipid acyltransferase family protein >Feature sequence327 1514 642 gene locus_tag LOCUS_40850 gene ilvE 1514 642 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583718.1 protein_id gnl|my_center|LOCUS_40850 2833 1499 gene locus_tag LOCUS_40860 gene pabB 2833 1499 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267422.1 protein_id gnl|my_center|LOCUS_40860 4360 2885 gene locus_tag LOCUS_40870 4360 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 >Feature sequence328 2011 368 gene locus_tag LOCUS_40880 gene aepX 2011 368 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525540.1 protein_id gnl|my_center|LOCUS_40880 2224 3678 gene locus_tag LOCUS_40890 gene hpnJ 2224 3678 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196953.1 protein_id gnl|my_center|LOCUS_40890 >Feature sequence329 3293 990 gene locus_tag LOCUS_40900 3293 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 >Feature sequence330 1154 2194 gene locus_tag LOCUS_40910 1154 2194 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024160.1 protein_id gnl|my_center|LOCUS_40910 3262 2213 gene locus_tag LOCUS_40920 3262 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 4204 3266 gene locus_tag LOCUS_40930 4204 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 >Feature sequence331 739 527 gene locus_tag LOCUS_40940 739 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 857 1399 gene locus_tag LOCUS_40950 857 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 2192 1362 gene locus_tag LOCUS_40960 2192 1362 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011326545.1 protein_id gnl|my_center|LOCUS_40960 2503 2192 gene locus_tag LOCUS_40970 2503 2192 CDS product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816713.1 protein_id gnl|my_center|LOCUS_40970 >Feature sequence332 1323 3092 gene locus_tag LOCUS_40980 1323 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 >Feature sequence333 <1 689 gene locus_tag LOCUS_40990 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528466.1:cation diffusion facilitator family transporter 885 1820 gene locus_tag LOCUS_41000 885 1820 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216725787.1 protein_id gnl|my_center|LOCUS_41000 1832 2188 gene locus_tag LOCUS_41010 1832 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 3425 2409 gene locus_tag LOCUS_41020 3425 2409 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421550.1 protein_id gnl|my_center|LOCUS_41020 4251 3625 gene locus_tag LOCUS_41030 4251 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 >Feature sequence334 1049 1843 gene locus_tag LOCUS_41040 1049 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 2237 2554 gene locus_tag LOCUS_41050 2237 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 3406 2591 gene locus_tag LOCUS_41060 3406 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 >Feature sequence335 840 1000 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3063 1432 gene locus_tag LOCUS_41070 gene pgi 3063 1432 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141691.1 protein_id gnl|my_center|LOCUS_41070 4166 3081 gene locus_tag LOCUS_41080 gene tal 4166 3081 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_41080 >Feature sequence336 606 109 gene locus_tag LOCUS_41090 606 109 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209677908.1 protein_id gnl|my_center|LOCUS_41090 845 1288 gene locus_tag LOCUS_41100 845 1288 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972923.1 protein_id gnl|my_center|LOCUS_41100 2447 1317 gene locus_tag LOCUS_41110 2447 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 3989 2676 gene locus_tag LOCUS_41120 3989 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 4339 4025 gene locus_tag LOCUS_41130 4339 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 >Feature sequence337 424 987 gene locus_tag LOCUS_41140 424 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 1032 1526 gene locus_tag LOCUS_41150 1032 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142078.1 protein_id gnl|my_center|LOCUS_41150 1801 3387 gene locus_tag LOCUS_41160 1801 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 >Feature sequence338 1160 465 gene locus_tag LOCUS_41170 1160 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 1609 1190 gene locus_tag LOCUS_41180 1609 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 1764 2423 gene locus_tag LOCUS_41190 1764 2423 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256517.1 protein_id gnl|my_center|LOCUS_41190 >Feature sequence339 1278 256 gene locus_tag LOCUS_41200 gene nirJ2 1278 256 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392759.1 protein_id gnl|my_center|LOCUS_41200 2300 1275 gene locus_tag LOCUS_41210 2300 1275 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408265.1 protein_id gnl|my_center|LOCUS_41210 3570 2839 gene locus_tag LOCUS_41220 3570 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 >Feature sequence340 2525 1488 gene locus_tag LOCUS_41230 2525 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053431.1 protein_id gnl|my_center|LOCUS_41230 2543 3499 gene locus_tag LOCUS_41240 gene add 2543 3499 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224867.1 protein_id gnl|my_center|LOCUS_41240 3501 4259 gene locus_tag LOCUS_41250 3501 4259 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207075.1 protein_id gnl|my_center|LOCUS_41250 >Feature sequence341 411 1601 gene locus_tag LOCUS_41260 411 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 1583 2419 gene locus_tag LOCUS_41270 1583 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 3395 2400 gene locus_tag LOCUS_41280 3395 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 3867 3409 gene locus_tag LOCUS_41290 3867 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41290 4323 3934 gene locus_tag LOCUS_41300 4323 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41300 >Feature sequence342 3135 1447 gene locus_tag LOCUS_41310 3135 1447 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_41310 3878 3240 gene locus_tag LOCUS_41320 3878 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 >Feature sequence343 594 25 gene locus_tag LOCUS_41330 gene rpoE 594 25 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658683.1 protein_id gnl|my_center|LOCUS_41330 3284 660 gene locus_tag LOCUS_41340 gene polA 3284 660 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_41340 3362 4114 gene locus_tag LOCUS_41350 3362 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41350 >Feature sequence344 481 2541 gene locus_tag LOCUS_41360 481 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 >Feature sequence345 1593 346 gene locus_tag LOCUS_41370 1593 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 1813 2643 gene locus_tag LOCUS_41380 1813 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 2680 3417 gene locus_tag LOCUS_41390 2680 3417 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_41390 >Feature sequence346 1421 945 gene locus_tag LOCUS_41400 1421 945 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486580.1 protein_id gnl|my_center|LOCUS_41400 2726 1530 gene locus_tag LOCUS_41410 2726 1530 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_41410 2882 3826 gene locus_tag LOCUS_41420 2882 3826 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066146.1 protein_id gnl|my_center|LOCUS_41420 >Feature sequence347 1140 361 gene locus_tag LOCUS_41430 1140 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583157.1 protein_id gnl|my_center|LOCUS_41430 1996 1166 gene locus_tag LOCUS_41440 1996 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 3561 1996 gene locus_tag LOCUS_41450 3561 1996 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908534.1 protein_id gnl|my_center|LOCUS_41450 3973 3545 gene locus_tag LOCUS_41460 3973 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 >Feature sequence348 1118 2356 gene locus_tag LOCUS_41470 1118 2356 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_41470 2499 2335 gene locus_tag LOCUS_41480 2499 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 3668 2502 gene locus_tag LOCUS_41490 3668 2502 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727819.1 protein_id gnl|my_center|LOCUS_41490 >Feature sequence349 344 1252 gene locus_tag LOCUS_41500 344 1252 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971214.1 protein_id gnl|my_center|LOCUS_41500 1402 1656 gene locus_tag LOCUS_41510 1402 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 1653 2009 gene locus_tag LOCUS_41520 1653 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 2361 2098 gene locus_tag LOCUS_41530 2361 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 3468 2371 gene locus_tag LOCUS_41540 gene chrA 3468 2371 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 protein_id gnl|my_center|LOCUS_41540 3670 4158 gene locus_tag LOCUS_41550 3670 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 >Feature sequence350 661 1437 gene locus_tag LOCUS_41560 661 1437 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142544.1 protein_id gnl|my_center|LOCUS_41560 1612 2316 gene locus_tag LOCUS_41570 1612 2316 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941996.1 protein_id gnl|my_center|LOCUS_41570 2330 2620 gene locus_tag LOCUS_41580 2330 2620 CDS product XapX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087031.1 protein_id gnl|my_center|LOCUS_41580 2617 3480 gene locus_tag LOCUS_41590 2617 3480 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192727398.1 protein_id gnl|my_center|LOCUS_41590 >Feature sequence351 1244 639 gene locus_tag LOCUS_41600 1244 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 2385 1636 gene locus_tag LOCUS_41610 2385 1636 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090604.1 protein_id gnl|my_center|LOCUS_41610 2513 2872 gene locus_tag LOCUS_41620 2513 2872 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312731.1 protein_id gnl|my_center|LOCUS_41620 2889 3077 gene locus_tag LOCUS_41630 2889 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 4047 3148 gene locus_tag LOCUS_41640 4047 3148 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067118245.1 protein_id gnl|my_center|LOCUS_41640 >Feature sequence352 2571 2308 gene locus_tag LOCUS_41650 2571 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 >Feature sequence353 <1 3032 gene locus_tag LOCUS_41660 <1 3032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742126.1:penicillin acylase family protein >Feature sequence354 964 401 gene locus_tag LOCUS_41670 gene rfbC 964 401 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159758.1 protein_id gnl|my_center|LOCUS_41670 1039 2061 gene locus_tag LOCUS_41680 1039 2061 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974174.1 protein_id gnl|my_center|LOCUS_41680 2070 2945 gene locus_tag LOCUS_41690 gene rfbD 2070 2945 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868299.1 protein_id gnl|my_center|LOCUS_41690 >Feature sequence355 519 1991 gene locus_tag LOCUS_41700 gene guaB 519 1991 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_41700 2016 3557 gene locus_tag LOCUS_41710 gene guaA 2016 3557 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_41710 >Feature sequence356 222 743 gene locus_tag LOCUS_41720 222 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 764 2200 gene locus_tag LOCUS_41730 764 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 2287 2451 gene locus_tag LOCUS_41740 2287 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 2860 2420 gene locus_tag LOCUS_41750 2860 2420 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728874.1 protein_id gnl|my_center|LOCUS_41750 3230 2892 gene locus_tag LOCUS_41760 3230 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 3705 3621 gene locus_tag LOCUS_t00390 3705 3621 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence357 137 475 gene locus_tag LOCUS_41770 137 475 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_41770 1597 506 gene locus_tag LOCUS_41780 1597 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 2313 1594 gene locus_tag LOCUS_41790 2313 1594 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188389.1 protein_id gnl|my_center|LOCUS_41790 3362 2310 gene locus_tag LOCUS_41800 3362 2310 CDS product 2-aminoethylphosphonate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525538.1 protein_id gnl|my_center|LOCUS_41800 3919 3359 gene locus_tag LOCUS_41810 3919 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41810 >Feature sequence358 3138 1609 gene locus_tag LOCUS_41820 gene hutH 3138 1609 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681759.1 protein_id gnl|my_center|LOCUS_41820 3261 3878 gene locus_tag LOCUS_41830 3261 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042595818.1 protein_id gnl|my_center|LOCUS_41830 >Feature sequence359 1 384 gene locus_tag LOCUS_41840 1 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 411 1253 gene locus_tag LOCUS_41850 411 1253 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941223.1 protein_id gnl|my_center|LOCUS_41850 1501 1950 gene locus_tag LOCUS_41860 1501 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 1947 2261 gene locus_tag LOCUS_41870 1947 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 2770 2258 gene locus_tag LOCUS_41880 2770 2258 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173398.1 protein_id gnl|my_center|LOCUS_41880 3301 2783 gene locus_tag LOCUS_41890 3301 2783 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_41890 3809 3309 gene locus_tag LOCUS_41900 3809 3309 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528765.1 protein_id gnl|my_center|LOCUS_41900 >Feature sequence360 1936 3090 gene locus_tag LOCUS_41910 1936 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 >Feature sequence361 1572 679 gene locus_tag LOCUS_41920 1572 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 1781 1855 gene locus_tag LOCUS_t00400 1781 1855 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1873 1801 gene locus_tag LOCUS_t00410 1873 1801 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2480 1980 gene locus_tag LOCUS_41930 2480 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 2866 2489 gene locus_tag LOCUS_41940 2866 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 3410 2970 gene locus_tag LOCUS_41950 3410 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 4008 3667 gene locus_tag LOCUS_41960 4008 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 >Feature sequence362 806 279 gene locus_tag LOCUS_41970 806 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41970 1045 800 gene locus_tag LOCUS_41980 1045 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 1438 1617 gene locus_tag LOCUS_41990 1438 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 >Feature sequence363 447 827 gene locus_tag LOCUS_42000 447 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 817 1002 gene locus_tag LOCUS_42010 817 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 3789 1303 gene locus_tag LOCUS_42020 3789 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 >Feature sequence364 652 1173 gene locus_tag LOCUS_42030 652 1173 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_42030 1170 1670 gene locus_tag LOCUS_42040 1170 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 1721 2230 gene locus_tag LOCUS_42050 1721 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 3070 2273 gene locus_tag LOCUS_42060 3070 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 <3987 3149 gene locus_tag LOCUS_42070 <3987 3149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941314.1:16S rRNA (cytidine(1402)-2'-O)-methyltransferase >Feature sequence365 971 246 gene locus_tag LOCUS_42080 971 246 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 protein_id gnl|my_center|LOCUS_42080 2209 1028 gene locus_tag LOCUS_42090 2209 1028 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769934.1 protein_id gnl|my_center|LOCUS_42090 2254 3450 gene locus_tag LOCUS_42100 2254 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 3500 3877 gene locus_tag LOCUS_42110 3500 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 >Feature sequence366 393 133 gene locus_tag LOCUS_42120 393 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 532 873 gene locus_tag LOCUS_42130 532 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42130 999 3149 gene locus_tag LOCUS_42140 999 3149 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929205.1 protein_id gnl|my_center|LOCUS_42140 >Feature sequence367 762 2210 gene locus_tag LOCUS_42150 762 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 2392 3897 gene locus_tag LOCUS_42160 2392 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 >Feature sequence368 1 588 gene locus_tag LOCUS_42170 1 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 709 1653 gene locus_tag LOCUS_42180 709 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 1650 2456 gene locus_tag LOCUS_42190 1650 2456 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947778.1 protein_id gnl|my_center|LOCUS_42190 3621 2755 gene locus_tag LOCUS_42200 3621 2755 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921521.1 protein_id gnl|my_center|LOCUS_42200 >Feature sequence369 <1 748 gene locus_tag LOCUS_42210 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582847.1:glycoside hydrolase family 1 protein 1877 732 gene locus_tag LOCUS_42220 1877 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 2323 1859 gene locus_tag LOCUS_42230 2323 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 2556 3362 gene locus_tag LOCUS_42240 2556 3362 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460483.1 protein_id gnl|my_center|LOCUS_42240 >Feature sequence370 1 315 gene locus_tag LOCUS_42250 1 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 2035 320 gene locus_tag LOCUS_42260 2035 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 3069 2134 gene locus_tag LOCUS_42270 3069 2134 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940694.1 protein_id gnl|my_center|LOCUS_42270 3220 3507 gene locus_tag LOCUS_42280 3220 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 >Feature sequence371 1530 259 gene locus_tag LOCUS_42290 1530 259 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230479.1 protein_id gnl|my_center|LOCUS_42290 1874 1653 gene locus_tag LOCUS_42300 1874 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 1972 2310 gene locus_tag LOCUS_42310 1972 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 3405 2377 gene locus_tag LOCUS_42320 3405 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 >Feature sequence372 678 4 gene locus_tag LOCUS_42330 678 4 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839307.1 protein_id gnl|my_center|LOCUS_42330 1373 678 gene locus_tag LOCUS_42340 1373 678 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_42340 1780 1355 gene locus_tag LOCUS_42350 1780 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 2811 1786 gene locus_tag LOCUS_42360 gene nirJ2 2811 1786 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392759.1 protein_id gnl|my_center|LOCUS_42360 3146 2808 gene locus_tag LOCUS_42370 3146 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 >Feature sequence373 766 74 gene locus_tag LOCUS_42380 766 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 870 1532 gene locus_tag LOCUS_42390 870 1532 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973806.1 protein_id gnl|my_center|LOCUS_42390 1635 2573 gene locus_tag LOCUS_42400 1635 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 2470 3483 gene locus_tag LOCUS_42410 2470 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 >Feature sequence374 <3889 1355 gene locus_tag LOCUS_42420 <3889 1355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727662.1:mycofactocin biosynthesis glycosyltransferase MftF >Feature sequence375 >Feature sequence376 1913 315 gene locus_tag LOCUS_42430 gene rtcR 1913 315 CDS product DNA-binding transcriptional regulator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232919.1 protein_id gnl|my_center|LOCUS_42430 2302 2991 gene locus_tag LOCUS_42440 2302 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 >Feature sequence377 377 631 gene locus_tag LOCUS_42450 377 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 665 1255 gene locus_tag LOCUS_42460 665 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 1326 1592 gene locus_tag LOCUS_42470 1326 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 1589 2002 gene locus_tag LOCUS_42480 1589 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 3564 1993 gene locus_tag LOCUS_42490 3564 1993 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_42490 3820 3662 gene locus_tag LOCUS_42500 3820 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 >Feature sequence378 2306 1491 gene locus_tag LOCUS_42510 2306 1491 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529940.1 protein_id gnl|my_center|LOCUS_42510 3148 2303 gene locus_tag LOCUS_42520 3148 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 3369 3145 gene locus_tag LOCUS_42530 3369 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 >Feature sequence379 <1 523 gene locus_tag LOCUS_42540 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392284.1:Uma2 family endonuclease 595 1926 gene locus_tag LOCUS_42550 595 1926 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192100.1 protein_id gnl|my_center|LOCUS_42550 1931 3352 gene locus_tag LOCUS_42560 1931 3352 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_42560 3714 3349 gene locus_tag LOCUS_42570 3714 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 >Feature sequence380 <1 734 gene locus_tag LOCUS_42580 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928427.1:ATP-binding protein 2217 742 gene locus_tag LOCUS_42590 2217 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 >Feature sequence381 2387 378 gene locus_tag LOCUS_42600 2387 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 2471 2533 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2552 2803 gene locus_tag LOCUS_42610 2552 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 >Feature sequence382 <1 1021 gene locus_tag LOCUS_42620 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112868.1:YfaP family protein 1129 1473 gene locus_tag LOCUS_42630 1129 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 1476 1727 gene locus_tag LOCUS_42640 1476 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 1724 3061 gene locus_tag LOCUS_42650 1724 3061 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931342.1 protein_id gnl|my_center|LOCUS_42650 >Feature sequence383 353 1669 gene locus_tag LOCUS_42660 353 1669 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_42660 1666 2694 gene locus_tag LOCUS_42670 gene lpxK 1666 2694 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091159.1 protein_id gnl|my_center|LOCUS_42670 2941 2759 gene locus_tag LOCUS_42680 2941 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 3361 3005 gene locus_tag LOCUS_42690 3361 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 3702 3406 gene locus_tag LOCUS_42700 3702 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 >Feature sequence384 142 669 gene locus_tag LOCUS_42710 142 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 1960 671 gene locus_tag LOCUS_42720 1960 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 2136 3545 gene locus_tag LOCUS_42730 2136 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 >Feature sequence385 273 1274 gene locus_tag LOCUS_42740 273 1274 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967849.1 protein_id gnl|my_center|LOCUS_42740 2054 1263 gene locus_tag LOCUS_42750 2054 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 >Feature sequence386 2876 3298 gene locus_tag LOCUS_42760 2876 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 >Feature sequence387 791 1888 gene locus_tag LOCUS_42770 791 1888 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_42770 2289 3542 gene locus_tag LOCUS_42780 2289 3542 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126863657.1 protein_id gnl|my_center|LOCUS_42780 >Feature sequence388 >Feature sequence389 <1 885 gene locus_tag LOCUS_42790 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225134.1:sialidase family protein 1067 897 gene locus_tag LOCUS_42800 1067 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 1768 1241 gene locus_tag LOCUS_42810 1768 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 3303 1819 gene locus_tag LOCUS_42820 3303 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 >Feature sequence390 270 1025 gene locus_tag LOCUS_42830 270 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 <3713 1275 gene locus_tag LOCUS_42840 <3713 1275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001211849.1:di-heme enzyme >Feature sequence391 190 1029 gene locus_tag LOCUS_42850 190 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 1323 1012 gene locus_tag LOCUS_42860 1323 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 3653 1299 gene locus_tag LOCUS_42870 3653 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 >Feature sequence392 815 192 gene locus_tag LOCUS_42880 815 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 1696 815 gene locus_tag LOCUS_42890 1696 815 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078040.1 protein_id gnl|my_center|LOCUS_42890 2492 1788 gene locus_tag LOCUS_42900 2492 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 2902 2681 gene locus_tag LOCUS_42910 2902 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 3425 2982 gene locus_tag LOCUS_42920 3425 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 >Feature sequence393 2463 448 gene locus_tag LOCUS_42930 2463 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 3512 2460 gene locus_tag LOCUS_42940 gene cheB 3512 2460 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 protein_id gnl|my_center|LOCUS_42940 >Feature sequence394 2903 3100 gene locus_tag LOCUS_42950 2903 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 3172 3402 gene locus_tag LOCUS_42960 3172 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 >Feature sequence395 564 1793 gene locus_tag LOCUS_42970 564 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 2953 1796 gene locus_tag LOCUS_42980 2953 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 >Feature sequence396 <1 943 gene locus_tag LOCUS_42990 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920652.1:ABC transporter ATP-binding protein/permease 1392 952 gene locus_tag LOCUS_43000 1392 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 1625 1419 gene locus_tag LOCUS_43010 1625 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 1815 1645 gene locus_tag LOCUS_43020 1815 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 >Feature sequence397 434 165 gene locus_tag LOCUS_43030 434 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 1422 961 gene locus_tag LOCUS_43040 1422 961 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727472.1 protein_id gnl|my_center|LOCUS_43040 1482 1841 gene locus_tag LOCUS_43050 1482 1841 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031215.1 protein_id gnl|my_center|LOCUS_43050 1838 2836 gene locus_tag LOCUS_43060 1838 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 3551 3186 gene locus_tag LOCUS_43070 3551 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 >Feature sequence398 <1 3295 gene locus_tag LOCUS_43080 <1 3295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339463.1:glucoamylase family protein 3344 3544 gene locus_tag LOCUS_43090 3344 3544 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_43090 >Feature sequence399 1055 885 gene locus_tag LOCUS_43100 1055 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 1547 1173 gene locus_tag LOCUS_43110 1547 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 >Feature sequence400 932 183 gene locus_tag LOCUS_43120 gene fabG 932 183 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_43120 1933 929 gene locus_tag LOCUS_43130 1933 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 3075 1933 gene locus_tag LOCUS_43140 gene fabF 3075 1933 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957615.1 protein_id gnl|my_center|LOCUS_43140 >Feature sequence401 <1 1383 gene locus_tag LOCUS_43150 <1 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071802696.1:multicopper oxidase family protein 1406 1891 gene locus_tag LOCUS_43160 1406 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 1922 2839 gene locus_tag LOCUS_43170 1922 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 >Feature sequence402 2353 2081 gene locus_tag LOCUS_43180 2353 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 2363 2596 gene locus_tag LOCUS_43190 2363 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 2593 2997 gene locus_tag LOCUS_43200 2593 2997 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066227.1 protein_id gnl|my_center|LOCUS_43200 >Feature sequence403 1220 348 gene locus_tag LOCUS_43210 1220 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 2646 1615 gene locus_tag LOCUS_43220 2646 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 >Feature sequence404 2435 1437 gene locus_tag LOCUS_43230 2435 1437 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_43230 2490 3392 gene locus_tag LOCUS_43240 2490 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 >Feature sequence405 1930 212 gene locus_tag LOCUS_43250 1930 212 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173645.1 protein_id gnl|my_center|LOCUS_43250 2127 3239 gene locus_tag LOCUS_43260 2127 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 >Feature sequence406 422 715 gene locus_tag LOCUS_43270 422 715 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045874275.1 protein_id gnl|my_center|LOCUS_43270 712 1092 gene locus_tag LOCUS_43280 712 1092 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530563.1 protein_id gnl|my_center|LOCUS_43280 1917 1135 gene locus_tag LOCUS_43290 1917 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 3005 1917 gene locus_tag LOCUS_43300 3005 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 >Feature sequence407 1660 1424 gene locus_tag LOCUS_43310 1660 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 2154 1678 gene locus_tag LOCUS_43320 2154 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 3223 2786 gene locus_tag LOCUS_43330 3223 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 >Feature sequence408 >Feature sequence409 998 1255 gene locus_tag LOCUS_43340 998 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 1252 2409 gene locus_tag LOCUS_43350 1252 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 >Feature sequence410 >Feature sequence411 608 219 gene locus_tag LOCUS_43360 608 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 2441 942 gene locus_tag LOCUS_43370 2441 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 >Feature sequence412 1503 898 gene locus_tag LOCUS_43380 1503 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 2768 1620 gene locus_tag LOCUS_43390 2768 1620 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_43390 3217 2954 gene locus_tag LOCUS_43400 3217 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 >Feature sequence413 3196 1115 gene locus_tag LOCUS_43410 3196 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 >Feature sequence414 1830 832 gene locus_tag LOCUS_43420 1830 832 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533118.1 protein_id gnl|my_center|LOCUS_43420 2039 2227 gene locus_tag LOCUS_43430 2039 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 2612 2349 gene locus_tag LOCUS_43440 2612 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 >Feature sequence415 671 237 gene locus_tag LOCUS_43450 671 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 940 620 gene locus_tag LOCUS_43460 940 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 >Feature sequence416 50 280 gene locus_tag LOCUS_43470 50 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 445 705 gene locus_tag LOCUS_43480 445 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 1131 763 gene locus_tag LOCUS_43490 1131 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 2387 1140 gene locus_tag LOCUS_43500 gene ccrA 2387 1140 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078168.1 protein_id gnl|my_center|LOCUS_43500 3075 2392 gene locus_tag LOCUS_43510 3075 2392 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226852.1 protein_id gnl|my_center|LOCUS_43510 >Feature sequence417 1110 1580 gene locus_tag LOCUS_43520 1110 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 1559 1885 gene locus_tag LOCUS_43530 1559 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 2454 1894 gene locus_tag LOCUS_43540 2454 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 <3363 2607 gene locus_tag LOCUS_43550 <3363 2607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046694565.1:TolC family protein >Feature sequence418 167 1510 gene locus_tag LOCUS_43560 167 1510 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791400.1 protein_id gnl|my_center|LOCUS_43560 1616 2356 gene locus_tag LOCUS_43570 1616 2356 CDS product DUF1571 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_43570 2591 2370 gene locus_tag LOCUS_43580 2591 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 2712 2933 gene locus_tag LOCUS_43590 2712 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 2938 3333 gene locus_tag LOCUS_43600 2938 3333 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_43600 >Feature sequence419 925 596 gene locus_tag LOCUS_43610 gene trxA 925 596 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943892.1 protein_id gnl|my_center|LOCUS_43610 1653 982 gene locus_tag LOCUS_43620 1653 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 2003 1650 gene locus_tag LOCUS_43630 2003 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 2295 2014 gene locus_tag LOCUS_43640 2295 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 2422 2697 gene locus_tag LOCUS_43650 2422 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 2759 3133 gene locus_tag LOCUS_43660 2759 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 3233 3149 gene locus_tag LOCUS_t00420 3233 3149 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence420 <1 1182 gene locus_tag LOCUS_43670 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023751.1:phenylacetate--CoA ligase family protein 1205 2374 gene locus_tag LOCUS_43680 gene hydG 1205 2374 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868901.1 protein_id gnl|my_center|LOCUS_43680 >Feature sequence421 >Feature sequence422 308 1378 gene locus_tag LOCUS_43690 308 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 1332 1724 gene locus_tag LOCUS_43700 1332 1724 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393003.1 protein_id gnl|my_center|LOCUS_43700 2367 1951 gene locus_tag LOCUS_43710 2367 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 <3314 2539 gene locus_tag LOCUS_43720 <3314 2539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055994.1:tetracycline resistance MFS efflux pump >Feature sequence423 <1 741 gene locus_tag LOCUS_43730 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899248.1:alpha/beta hydrolase 738 1532 gene locus_tag LOCUS_43740 738 1532 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064400.1 protein_id gnl|my_center|LOCUS_43740 1540 2385 gene locus_tag LOCUS_43750 1540 2385 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039795.1 protein_id gnl|my_center|LOCUS_43750 3144 2389 gene locus_tag LOCUS_43760 3144 2389 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967135.1 protein_id gnl|my_center|LOCUS_43760 >Feature sequence424 1553 618 gene locus_tag LOCUS_43770 1553 618 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_43770 1628 1903 gene locus_tag LOCUS_43780 1628 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 1921 2145 gene locus_tag LOCUS_43790 1921 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 2163 3023 gene locus_tag LOCUS_43800 2163 3023 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_43800 >Feature sequence425 1635 364 gene locus_tag LOCUS_43810 1635 364 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064316.1 protein_id gnl|my_center|LOCUS_43810 1727 2911 gene locus_tag LOCUS_43820 1727 2911 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459196.1 protein_id gnl|my_center|LOCUS_43820 >Feature sequence426 1132 2676 gene locus_tag LOCUS_43830 1132 2676 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222576.1 protein_id gnl|my_center|LOCUS_43830 2895 2683 gene locus_tag LOCUS_43840 2895 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 >Feature sequence427 750 253 gene locus_tag LOCUS_43850 750 253 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_43850 <3278 886 gene locus_tag LOCUS_43860 <3278 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888815.1:carbon-nitrogen hydrolase family protein >Feature sequence428 638 102 gene locus_tag LOCUS_43870 638 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 834 2609 gene locus_tag LOCUS_43880 834 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 2612 3034 gene locus_tag LOCUS_43890 2612 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 >Feature sequence429 43 474 gene locus_tag LOCUS_43900 43 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 1283 816 gene locus_tag LOCUS_43910 1283 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43910 1314 1586 gene locus_tag LOCUS_43920 1314 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 1731 1967 gene locus_tag LOCUS_43930 1731 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 2042 2317 gene locus_tag LOCUS_43940 2042 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 <3273 2431 gene locus_tag LOCUS_43950 <3273 2431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810239.1:GNAT family N-acetyltransferase >Feature sequence430 216 572 gene locus_tag LOCUS_43960 216 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 602 2356 gene locus_tag LOCUS_43970 602 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 2457 2825 gene locus_tag LOCUS_43980 2457 2825 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388781.1 protein_id gnl|my_center|LOCUS_43980 2822 3235 gene locus_tag LOCUS_43990 2822 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 >Feature sequence431 90 302 gene locus_tag LOCUS_44000 90 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 634 2193 gene locus_tag LOCUS_44010 634 2193 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525109.1 protein_id gnl|my_center|LOCUS_44010 2202 2558 gene locus_tag LOCUS_44020 2202 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 >Feature sequence432 2992 2432 gene locus_tag LOCUS_44030 2992 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 >Feature sequence433 1745 774 gene locus_tag LOCUS_44040 1745 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 >Feature sequence434 1371 379 gene locus_tag LOCUS_44050 1371 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 >Feature sequence435 1607 468 gene locus_tag LOCUS_44060 1607 468 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404932.1 protein_id gnl|my_center|LOCUS_44060 1689 2843 gene locus_tag LOCUS_44070 1689 2843 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036619.1 protein_id gnl|my_center|LOCUS_44070 >Feature sequence436 1758 256 gene locus_tag LOCUS_44080 1758 256 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017586463.1 protein_id gnl|my_center|LOCUS_44080 1700 2737 gene locus_tag LOCUS_44090 1700 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 3067 2756 gene locus_tag LOCUS_44100 3067 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 >Feature sequence437 >Feature sequence438 862 1476 gene locus_tag LOCUS_44110 862 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 1487 1765 gene locus_tag LOCUS_44120 1487 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 1762 2187 gene locus_tag LOCUS_44130 1762 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 2281 2466 gene locus_tag LOCUS_44140 2281 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 <3184 2496 gene locus_tag LOCUS_44150 <3184 2496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389556.1:undecaprenyl-diphosphate phosphatase >Feature sequence439 2034 322 gene locus_tag LOCUS_44160 2034 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 >Feature sequence440 695 1675 gene locus_tag LOCUS_44170 695 1675 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_44170 2615 1683 gene locus_tag LOCUS_44180 2615 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 >Feature sequence441 <1 724 gene locus_tag LOCUS_44190 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021200.1:ABC transporter permease 881 2017 gene locus_tag LOCUS_44200 881 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 2617 2862 gene locus_tag LOCUS_44210 2617 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 >Feature sequence442 1677 1243 gene locus_tag LOCUS_44220 1677 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 1950 1696 gene locus_tag LOCUS_44230 1950 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 >Feature sequence443 1238 291 gene locus_tag LOCUS_44240 1238 291 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095780.1 protein_id gnl|my_center|LOCUS_44240 2814 1360 gene locus_tag LOCUS_44250 2814 1360 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_44250 >Feature sequence444 1158 2849 gene locus_tag LOCUS_44260 1158 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 >Feature sequence445 86 1228 gene locus_tag LOCUS_44270 86 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 1222 1764 gene locus_tag LOCUS_44280 1222 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 2215 2018 gene locus_tag LOCUS_44290 2215 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 2857 2429 gene locus_tag LOCUS_44300 2857 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 3105 2854 gene locus_tag LOCUS_44310 3105 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 >Feature sequence446 893 282 gene locus_tag LOCUS_44320 893 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 2657 900 gene locus_tag LOCUS_44330 2657 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44330 >Feature sequence447 442 155 gene locus_tag LOCUS_44340 442 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 1094 534 gene locus_tag LOCUS_44350 1094 534 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317037.1 protein_id gnl|my_center|LOCUS_44350 1236 1081 gene locus_tag LOCUS_44360 1236 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 1947 1288 gene locus_tag LOCUS_44370 1947 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 2223 3065 gene locus_tag LOCUS_44380 gene coxB 2223 3065 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227850.1 protein_id gnl|my_center|LOCUS_44380 >Feature sequence448 >Feature sequence449 343 672 gene locus_tag LOCUS_44390 343 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 1122 685 gene locus_tag LOCUS_44400 1122 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 1141 2259 gene locus_tag LOCUS_44410 1141 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 2269 2694 gene locus_tag LOCUS_44420 2269 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 >Feature sequence450 1070 51 gene locus_tag LOCUS_44430 1070 51 CDS product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035906.1 protein_id gnl|my_center|LOCUS_44430 1872 1102 gene locus_tag LOCUS_44440 1872 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 2281 1865 gene locus_tag LOCUS_44450 2281 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 2736 2278 gene locus_tag LOCUS_44460 2736 2278 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533579.1 protein_id gnl|my_center|LOCUS_44460 >Feature sequence451 <1 584 gene locus_tag LOCUS_44470 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947815.1:sterol desaturase family protein >Feature sequence452 1060 53 gene locus_tag LOCUS_44480 1060 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 1928 1047 gene locus_tag LOCUS_44490 1928 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 2832 1975 gene locus_tag LOCUS_44500 2832 1975 CDS product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521521.1 protein_id gnl|my_center|LOCUS_44500 >Feature sequence453 400 107 gene locus_tag LOCUS_44510 400 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 1109 411 gene locus_tag LOCUS_44520 1109 411 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_44520 2548 1115 gene locus_tag LOCUS_44530 2548 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 2748 2566 gene locus_tag LOCUS_44540 2748 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 >Feature sequence454 38 415 gene locus_tag LOCUS_44550 38 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 412 819 gene locus_tag LOCUS_44560 412 819 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_44560 952 1485 gene locus_tag LOCUS_44570 952 1485 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868267.1 protein_id gnl|my_center|LOCUS_44570 >Feature sequence455 271 1407 gene locus_tag LOCUS_44580 271 1407 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695173.1 protein_id gnl|my_center|LOCUS_44580 >Feature sequence456 >Feature sequence457 1437 451 gene locus_tag LOCUS_44590 1437 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 1916 1464 gene locus_tag LOCUS_44600 1916 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 2182 1913 gene locus_tag LOCUS_44610 2182 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 2608 2219 gene locus_tag LOCUS_44620 2608 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 >Feature sequence458 262 1113 gene locus_tag LOCUS_44630 262 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 1116 1535 gene locus_tag LOCUS_44640 1116 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 >Feature sequence459 1050 253 gene locus_tag LOCUS_44650 gene istB 1050 253 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_44650 2519 1047 gene locus_tag LOCUS_44660 gene istA 2519 1047 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974233.1 protein_id gnl|my_center|LOCUS_44660 2768 2592 gene locus_tag LOCUS_44670 2768 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 >Feature sequence460 311 1504 gene locus_tag LOCUS_44680 311 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 1869 1693 gene locus_tag LOCUS_44690 1869 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 2052 2318 gene locus_tag LOCUS_44700 2052 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 2319 2852 gene locus_tag LOCUS_44710 2319 2852 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807613.1 protein_id gnl|my_center|LOCUS_44710 >Feature sequence461 <1 1512 gene locus_tag LOCUS_44720 <1 1512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000050481.1:IS91-like element ISCR1 family transposase 1787 2650 gene locus_tag LOCUS_44730 1787 2650 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514171.1 protein_id gnl|my_center|LOCUS_44730 >Feature sequence462 <1 918 gene locus_tag LOCUS_44740 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388784.1:AraC family transcriptional regulator 1255 1016 gene locus_tag LOCUS_44750 1255 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 >Feature sequence463 <1 650 gene locus_tag LOCUS_44760 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243731.1:sugar porter family MFS transporter 647 1981 gene locus_tag LOCUS_44770 647 1981 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704121.1 protein_id gnl|my_center|LOCUS_44770 1987 2307 gene locus_tag LOCUS_44780 1987 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 >Feature sequence464 1765 113 gene locus_tag LOCUS_44790 1765 113 CDS product DUF3556 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112485.1 protein_id gnl|my_center|LOCUS_44790 1964 1770 gene locus_tag LOCUS_44800 1964 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 1963 2553 gene locus_tag LOCUS_44810 1963 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 2553 2747 gene locus_tag LOCUS_44820 2553 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 >Feature sequence465 504 815 gene locus_tag LOCUS_44830 504 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 951 2522 gene locus_tag LOCUS_44840 951 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 >Feature sequence466 >Feature sequence467 480 740 gene locus_tag LOCUS_44850 480 740 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940916.1 protein_id gnl|my_center|LOCUS_44850 813 1976 gene locus_tag LOCUS_44860 813 1976 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941128.1 protein_id gnl|my_center|LOCUS_44860 >Feature sequence468 <2855 385 gene locus_tag LOCUS_44870 <2855 385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742126.1:penicillin acylase family protein >Feature sequence469 1513 554 gene locus_tag LOCUS_44880 1513 554 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965631.1 protein_id gnl|my_center|LOCUS_44880 2240 1539 gene locus_tag LOCUS_44890 2240 1539 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533115.1 protein_id gnl|my_center|LOCUS_44890 <2831 2262 gene locus_tag LOCUS_44900 <2831 2262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392272.1:NAD-dependent 4,6-dehydratase LegB >Feature sequence470 1 399 gene locus_tag LOCUS_44910 1 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 861 406 gene locus_tag LOCUS_44920 861 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 965 1588 gene locus_tag LOCUS_44930 965 1588 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615057.1 protein_id gnl|my_center|LOCUS_44930 >Feature sequence471 135 401 gene locus_tag LOCUS_44940 135 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 398 1123 gene locus_tag LOCUS_44950 398 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 1466 2623 gene locus_tag LOCUS_44960 1466 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 >Feature sequence472 2132 1797 gene locus_tag LOCUS_44970 2132 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 >Feature sequence473 335 156 gene locus_tag LOCUS_44980 335 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 1095 358 gene locus_tag LOCUS_44990 1095 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 1182 2480 gene locus_tag LOCUS_45000 1182 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 >Feature sequence474 1994 2226 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acgacgaccaccgtcacgtc >Feature sequence475 419 598 gene locus_tag LOCUS_45010 419 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 1018 662 gene locus_tag LOCUS_45020 1018 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 2042 1233 gene locus_tag LOCUS_45030 2042 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 2499 2230 gene locus_tag LOCUS_45040 2499 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 2677 2525 gene locus_tag LOCUS_45050 2677 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 >Feature sequence476 2082 925 gene locus_tag LOCUS_45060 2082 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 2286 2477 gene locus_tag LOCUS_45070 2286 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 >Feature sequence477 838 2043 gene locus_tag LOCUS_45080 838 2043 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024396.1 protein_id gnl|my_center|LOCUS_45080 >Feature sequence478 1011 850 gene locus_tag LOCUS_45090 1011 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 >Feature sequence479 42 797 gene locus_tag LOCUS_45100 42 797 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_45100 1177 2502 gene locus_tag LOCUS_45110 1177 2502 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090734.1 protein_id gnl|my_center|LOCUS_45110 >Feature sequence480 2129 750 gene locus_tag LOCUS_45120 2129 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 2174 2530 gene locus_tag LOCUS_45130 2174 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 >Feature sequence481 1341 409 gene locus_tag LOCUS_45140 1341 409 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_45140 2116 1334 gene locus_tag LOCUS_45150 2116 1334 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_45150 <2771 2120 gene locus_tag LOCUS_45160 <2771 2120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403123.1:ABC transporter permease >Feature sequence482 >Feature sequence483 1824 226 gene locus_tag LOCUS_45170 gene bgaS 1824 226 CDS product beta-galactosidase BgaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868057.1 protein_id gnl|my_center|LOCUS_45170 <2749 1905 gene locus_tag LOCUS_45180 <2749 1905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227510.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence484 818 42 gene locus_tag LOCUS_45190 818 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 1045 1356 gene locus_tag LOCUS_45200 1045 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 1459 1806 gene locus_tag LOCUS_45210 1459 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 >Feature sequence485 <1 1102 gene locus_tag LOCUS_45220 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_093950374.1:PD40 domain-containing protein 1585 1103 gene locus_tag LOCUS_45230 1585 1103 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727858.1 protein_id gnl|my_center|LOCUS_45230 2343 1582 gene locus_tag LOCUS_45240 2343 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 >Feature sequence486 1037 1444 gene locus_tag LOCUS_45250 1037 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 2043 1468 gene locus_tag LOCUS_45260 2043 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 2443 2691 gene locus_tag LOCUS_45270 2443 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 >Feature sequence487 <1 554 gene locus_tag LOCUS_45280 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005111467.1:lipid-transfer protein 796 569 gene locus_tag LOCUS_45290 796 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 749 1495 gene locus_tag LOCUS_45300 749 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 2506 1403 gene locus_tag LOCUS_45310 2506 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 2481 2663 gene locus_tag LOCUS_45320 2481 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 >Feature sequence488 1758 973 gene locus_tag LOCUS_45330 1758 973 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_45330 <2712 1778 gene locus_tag LOCUS_45340 <2712 1778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529682.1:glutamine synthetase family protein >Feature sequence489 <2700 694 gene locus_tag LOCUS_45350 <2700 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922188.1:ATP-binding protein >Feature sequence490 204 383 gene locus_tag LOCUS_45360 204 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 380 739 gene locus_tag LOCUS_45370 380 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 1204 803 gene locus_tag LOCUS_45380 1204 803 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037032.1 protein_id gnl|my_center|LOCUS_45380 1458 1201 gene locus_tag LOCUS_45390 1458 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 1640 2215 gene locus_tag LOCUS_45400 1640 2215 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_45400 2328 2633 gene locus_tag LOCUS_45410 2328 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 >Feature sequence491 757 551 gene locus_tag LOCUS_45420 757 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 1469 741 gene locus_tag LOCUS_45430 1469 741 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975106.1 protein_id gnl|my_center|LOCUS_45430 1572 2501 gene locus_tag LOCUS_45440 1572 2501 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072010.1 protein_id gnl|my_center|LOCUS_45440 >Feature sequence492 >Feature sequence493 >Feature sequence494 636 1163 gene locus_tag LOCUS_45450 636 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 1217 2620 gene locus_tag LOCUS_45460 1217 2620 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965648.1 protein_id gnl|my_center|LOCUS_45460 >Feature sequence495 1205 393 gene locus_tag LOCUS_45470 1205 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 1648 2244 gene locus_tag LOCUS_45480 1648 2244 CDS product DUF2652 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950737.1 protein_id gnl|my_center|LOCUS_45480 >Feature sequence496 1296 1138 gene locus_tag LOCUS_45490 1296 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 1987 1481 gene locus_tag LOCUS_45500 1987 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 >Feature sequence497 919 1824 gene locus_tag LOCUS_45510 919 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 1979 1806 gene locus_tag LOCUS_45520 1979 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 >Feature sequence498 753 2369 gene locus_tag LOCUS_45530 753 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 >Feature sequence499 1465 1908 gene locus_tag LOCUS_45540 1465 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 >Feature sequence500 >Feature sequence501 2435 1521 gene locus_tag LOCUS_45550 2435 1521 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689435.1 protein_id gnl|my_center|LOCUS_45550 >Feature sequence502 80 1489 gene locus_tag LOCUS_45560 80 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 1486 2382 gene locus_tag LOCUS_45570 1486 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 >Feature sequence503 1894 1091 gene locus_tag LOCUS_45580 1894 1091 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967853.1 protein_id gnl|my_center|LOCUS_45580 2220 1894 gene locus_tag LOCUS_45590 2220 1894 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388091.1 protein_id gnl|my_center|LOCUS_45590 >Feature sequence504 1540 860 gene locus_tag LOCUS_45600 1540 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 1998 1654 gene locus_tag LOCUS_45610 1998 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 >Feature sequence505 259 1335 gene locus_tag LOCUS_45620 259 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 1341 2171 gene locus_tag LOCUS_45630 1341 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 >Feature sequence506 415 2226 gene locus_tag LOCUS_45640 415 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 >Feature sequence507 2264 444 gene locus_tag LOCUS_45650 2264 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 2443 2518 gene locus_tag LOCUS_t00430 2443 2518 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence508 1002 1178 gene locus_tag LOCUS_45660 1002 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 1175 1591 gene locus_tag LOCUS_45670 1175 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 2450 1620 gene locus_tag LOCUS_45680 2450 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 >Feature sequence509 1880 390 gene locus_tag LOCUS_45690 1880 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45690 >Feature sequence510 1630 728 gene locus_tag LOCUS_45700 1630 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 2379 1627 gene locus_tag LOCUS_45710 2379 1627 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090604.1 protein_id gnl|my_center|LOCUS_45710 >Feature sequence511 106 675 gene locus_tag LOCUS_45720 106 675 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272666.1 protein_id gnl|my_center|LOCUS_45720 1154 687 gene locus_tag LOCUS_45730 1154 687 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065587.1 protein_id gnl|my_center|LOCUS_45730 1258 1470 gene locus_tag LOCUS_45740 1258 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 1547 2299 gene locus_tag LOCUS_45750 1547 2299 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259194.1 protein_id gnl|my_center|LOCUS_45750 >Feature sequence512 1928 2104 gene locus_tag LOCUS_45760 1928 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 >Feature sequence513 1490 1696 gene locus_tag LOCUS_45770 1490 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 1705 2010 gene locus_tag LOCUS_45780 1705 2010 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259549.1 protein_id gnl|my_center|LOCUS_45780 >Feature sequence514 1259 2428 gene locus_tag LOCUS_45790 1259 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 >Feature sequence515 582 208 gene locus_tag LOCUS_45800 582 208 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567661.1 protein_id gnl|my_center|LOCUS_45800 833 558 gene locus_tag LOCUS_45810 833 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 1811 978 gene locus_tag LOCUS_45820 1811 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 >Feature sequence516 2401 323 gene locus_tag LOCUS_45830 2401 323 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188722822.1 protein_id gnl|my_center|LOCUS_45830 >Feature sequence517 >Feature sequence518 614 2014 gene locus_tag LOCUS_45840 614 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 >Feature sequence519 337 588 gene locus_tag LOCUS_45850 337 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 1769 654 gene locus_tag LOCUS_45860 1769 654 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_45860 >Feature sequence520 293 1168 gene locus_tag LOCUS_45870 293 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45870 1129 1437 gene locus_tag LOCUS_45880 1129 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45880 1466 2470 gene locus_tag LOCUS_45890 1466 2470 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970089.1 protein_id gnl|my_center|LOCUS_45890 >Feature sequence521 709 1509 gene locus_tag LOCUS_45900 709 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 1785 1492 gene locus_tag LOCUS_45910 1785 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 2381 1788 gene locus_tag LOCUS_45920 2381 1788 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_45920 >Feature sequence522 1493 312 gene locus_tag LOCUS_45930 1493 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 >Feature sequence523 <1 837 gene locus_tag LOCUS_45940 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813277.1:Ku protein 838 1686 gene locus_tag LOCUS_45950 838 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 >Feature sequence524 264 97 gene locus_tag LOCUS_45960 264 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 300 1856 gene locus_tag LOCUS_45970 300 1856 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675527.1 protein_id gnl|my_center|LOCUS_45970 2279 1947 gene locus_tag LOCUS_45980 2279 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 >Feature sequence525 799 1119 gene locus_tag LOCUS_45990 799 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 >Feature sequence526 <1 950 gene locus_tag LOCUS_46000 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942127.1:HlyD family secretion protein >Feature sequence527 >Feature sequence528 103 1311 gene locus_tag LOCUS_46010 103 1311 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_46010 1308 1940 gene locus_tag LOCUS_46020 gene wlbG 1308 1940 CDS product O-antigen biosynthesis protein WlbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038693.1 protein_id gnl|my_center|LOCUS_46020 >Feature sequence529 >Feature sequence530 213 2054 gene locus_tag LOCUS_46030 213 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 >Feature sequence531 1115 1867 gene locus_tag LOCUS_46040 1115 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 1846 2289 gene locus_tag LOCUS_46050 1846 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 >Feature sequence532 >Feature sequence533 <1 539 gene locus_tag LOCUS_46060 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582541.1:cysteine hydrolase >Feature sequence534 1110 391 gene locus_tag LOCUS_46070 1110 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 1505 1149 gene locus_tag LOCUS_46080 1505 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 <2310 1641 gene locus_tag LOCUS_46090 <2310 1641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937466.1:alkaline phosphatase family protein >Feature sequence535 1339 203 gene locus_tag LOCUS_46100 1339 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 1654 1391 gene locus_tag LOCUS_46110 1654 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 1960 1715 gene locus_tag LOCUS_46120 1960 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 >Feature sequence536 1549 890 gene locus_tag LOCUS_46130 1549 890 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401656.1 protein_id gnl|my_center|LOCUS_46130 1685 1927 gene locus_tag LOCUS_46140 1685 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 >Feature sequence537 <1 1482 gene locus_tag LOCUS_46150 <1 1482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031049.1:DUF2075 domain-containing protein >Feature sequence538 >Feature sequence539 <1 725 gene locus_tag LOCUS_46160 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_019565706.1:N-acyl homoserine lactonase family protein >Feature sequence540 1235 393 gene locus_tag LOCUS_46170 1235 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 >Feature sequence541 >Feature sequence542 >Feature sequence543 879 109 gene locus_tag LOCUS_46180 879 109 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730379.1 protein_id gnl|my_center|LOCUS_46180 966 1895 gene locus_tag LOCUS_46190 966 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 >Feature sequence544 128 322 gene locus_tag LOCUS_46200 128 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 412 948 gene locus_tag LOCUS_46210 412 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 1550 1206 gene locus_tag LOCUS_46220 1550 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 >Feature sequence545 1758 109 gene locus_tag LOCUS_46230 1758 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 >Feature sequence546 225 1382 gene locus_tag LOCUS_46240 225 1382 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_46240 >Feature sequence547 1 159 gene locus_tag LOCUS_46250 1 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 1511 372 gene locus_tag LOCUS_46260 1511 372 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 protein_id gnl|my_center|LOCUS_46260 <2168 1548 gene locus_tag LOCUS_46270 <2168 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391565.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence548 >Feature sequence549 <2150 1455 gene locus_tag LOCUS_46280 <2150 1455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257107.1:lysophospholipid acyltransferase family protein >Feature sequence550 <1 1710 gene locus_tag LOCUS_46290 <1 1710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223771.1:discoidin domain-containing protein >Feature sequence551 >Feature sequence552 >Feature sequence553 1013 210 gene locus_tag LOCUS_46300 1013 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 1711 1010 gene locus_tag LOCUS_46310 1711 1010 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918530.1 protein_id gnl|my_center|LOCUS_46310 >Feature sequence554 1528 641 gene locus_tag LOCUS_46320 1528 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 >Feature sequence555 >Feature sequence556 >Feature sequence557 <1 618 gene locus_tag LOCUS_46330 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790215.1:MATE family efflux transporter 1355 1448 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence558 501 1532 gene locus_tag LOCUS_46340 gene pstS 501 1532 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140448.1 protein_id gnl|my_center|LOCUS_46340 >Feature sequence559 <1 511 gene locus_tag LOCUS_46350 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940917.1:lysophospholipid acyltransferase family protein 1830 469 gene locus_tag LOCUS_46360 1830 469 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_46360 >Feature sequence560 >Feature sequence561 >Feature sequence562 780 1022 gene locus_tag LOCUS_46370 780 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 1749 1180 gene locus_tag LOCUS_46380 1749 1180 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_46380 >Feature sequence563 <1 747 gene locus_tag LOCUS_46390 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259484.1:glycosyltransferase family 2 protein 874 1863 gene locus_tag LOCUS_46400 874 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 >Feature sequence564 >Feature sequence565 >Feature sequence566 323 799 gene locus_tag LOCUS_46410 323 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 802 963 gene locus_tag LOCUS_46420 802 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 1159 1458 gene locus_tag LOCUS_46430 1159 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 1718 1467 gene locus_tag LOCUS_46440 1718 1467 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058449.1 protein_id gnl|my_center|LOCUS_46440 >Feature sequence567 382 753 gene locus_tag LOCUS_46450 382 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 1531 1187 gene locus_tag LOCUS_46460 1531 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 >Feature sequence568 119 325 gene locus_tag LOCUS_46470 119 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 367 1632 gene locus_tag LOCUS_46480 367 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 >Feature sequence569 216 1556 gene locus_tag LOCUS_46490 216 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 >Feature sequence570 >Feature sequence571 <1749 933 gene locus_tag LOCUS_46500 <1749 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023662.1:glycosyltransferase family 2 protein >Feature sequence572 1060 1446 gene locus_tag LOCUS_46510 1060 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 >Feature sequence573 615 839 gene locus_tag LOCUS_46520 615 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 839 1357 gene locus_tag LOCUS_46530 839 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 >Feature sequence574 <1679 287 gene locus_tag LOCUS_46540 <1679 287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002121180.1:phosphomethylpyrimidine synthase ThiC >Feature sequence575 1001 222 gene locus_tag LOCUS_46550 1001 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 >Feature sequence576 1108 341 gene locus_tag LOCUS_46560 1108 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 >Feature sequence577 <1 652 gene locus_tag LOCUS_46570 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940636.1:sigma 54-interacting transcriptional regulator 881 1360 gene locus_tag LOCUS_46580 881 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 1357 1656 gene locus_tag LOCUS_46590 1357 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 >Feature sequence578 <1659 259 gene locus_tag LOCUS_46600 <1659 259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056851.1:ferredoxin PetF1 >Feature sequence579 >Feature sequence580 >Feature sequence581 559 107 gene locus_tag LOCUS_46610 559 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 777 556 gene locus_tag LOCUS_46620 777 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 1108 902 gene locus_tag LOCUS_46630 1108 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 >Feature sequence582 >Feature sequence583 25 852 gene locus_tag LOCUS_46640 25 852 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_46640 >Feature sequence584 >Feature sequence585 >Feature sequence586 >Feature sequence587 900 583 gene locus_tag LOCUS_46650 900 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 >Feature sequence588 >Feature sequence589 >Feature sequence590 >Feature sequence591 >Feature sequence592 >Feature sequence593 635 465 gene locus_tag LOCUS_46660 635 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 >Feature sequence594 >Feature sequence595 >Feature sequence596 >Feature sequence597 >Feature sequence598 >Feature sequence599 >Feature sequence600 >Feature sequence601 >Feature sequence602 >Feature sequence603 >Feature sequence604 >Feature sequence605 >Feature sequence606 >Feature sequence607 >Feature sequence608 >Feature sequence609 >Feature sequence610 >Feature sequence611 >Feature sequence612 >Feature sequence613 >Feature sequence614 341 72 gene locus_tag LOCUS_46670 341 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 >Feature sequence615 >Feature sequence616 >Feature sequence617 >Feature sequence618 >Feature sequence619 >Feature sequence620 >Feature sequence621 >Feature sequence622 >Feature sequence623 >Feature sequence624 >Feature sequence625