>Feature sequence01 717 304 gene locus_tag LOCUS_00010 717 304 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438867.1 protein_id gnl|my_center|LOCUS_00010 2148 739 gene locus_tag LOCUS_00020 gene mtaB 2148 739 CDS product methanol--corrinoid protein co-methyltransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024271.1 protein_id gnl|my_center|LOCUS_00020 2812 2150 gene locus_tag LOCUS_00030 gene mtaC 2812 2150 CDS product methanol--corrinoid protein MtaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024270.1 protein_id gnl|my_center|LOCUS_00030 3118 4059 gene locus_tag LOCUS_00040 gene radA 3118 4059 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023460.1 protein_id gnl|my_center|LOCUS_00040 4064 5080 gene locus_tag LOCUS_00050 4064 5080 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020267.1 protein_id gnl|my_center|LOCUS_00050 6464 5064 gene locus_tag LOCUS_00060 6464 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6585 7358 gene locus_tag LOCUS_00070 6585 7358 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876722.1 protein_id gnl|my_center|LOCUS_00070 7355 8089 gene locus_tag LOCUS_00080 7355 8089 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023864.1 protein_id gnl|my_center|LOCUS_00080 8802 8212 gene locus_tag LOCUS_00090 gene pdxT 8802 8212 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878016.1 protein_id gnl|my_center|LOCUS_00090 9632 8847 gene locus_tag LOCUS_00100 9632 8847 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065769.1 protein_id gnl|my_center|LOCUS_00100 9745 10494 gene locus_tag LOCUS_00110 9745 10494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10796 10551 gene locus_tag LOCUS_00120 10796 10551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10872 11687 gene locus_tag LOCUS_00130 10872 11687 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_00130 12783 11674 gene locus_tag LOCUS_00140 12783 11674 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957761.1 protein_id gnl|my_center|LOCUS_00140 12892 14991 gene locus_tag LOCUS_00150 12892 14991 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878706.1 protein_id gnl|my_center|LOCUS_00150 14988 15971 gene locus_tag LOCUS_00160 14988 15971 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902666.1 protein_id gnl|my_center|LOCUS_00160 16266 15961 gene locus_tag LOCUS_00170 16266 15961 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966108.1 protein_id gnl|my_center|LOCUS_00170 16884 16435 gene locus_tag LOCUS_00180 16884 16435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17076 17699 gene locus_tag LOCUS_00190 17076 17699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18165 17776 gene locus_tag LOCUS_00200 gene gcvH 18165 17776 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461730.1 protein_id gnl|my_center|LOCUS_00200 18354 20432 gene locus_tag LOCUS_00210 gene hypF 18354 20432 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250947.1 protein_id gnl|my_center|LOCUS_00210 20874 20437 gene locus_tag LOCUS_00220 20874 20437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21177 22274 gene locus_tag LOCUS_00230 21177 22274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 22384 23490 gene locus_tag LOCUS_00240 22384 23490 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061048.1 protein_id gnl|my_center|LOCUS_00240 24108 23473 gene locus_tag LOCUS_00250 24108 23473 CDS product TIGR00454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870628.1 protein_id gnl|my_center|LOCUS_00250 24941 24105 gene locus_tag LOCUS_00260 gene cobS 24941 24105 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496830.1 protein_id gnl|my_center|LOCUS_00260 26061 24934 gene locus_tag LOCUS_00270 26061 24934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27068 26073 gene locus_tag LOCUS_00280 gene cbiB 27068 26073 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877021.1 protein_id gnl|my_center|LOCUS_00280 28263 27070 gene locus_tag LOCUS_00290 gene cobD 28263 27070 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020980.1 protein_id gnl|my_center|LOCUS_00290 28374 29453 gene locus_tag LOCUS_00300 gene carA 28374 29453 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878768.1 protein_id gnl|my_center|LOCUS_00300 29450 32662 gene locus_tag LOCUS_00310 gene carB 29450 32662 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022129.1 protein_id gnl|my_center|LOCUS_00310 33291 32947 gene locus_tag LOCUS_00320 33291 32947 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459853.1 protein_id gnl|my_center|LOCUS_00320 33815 33315 gene locus_tag LOCUS_00330 33815 33315 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878520.1 protein_id gnl|my_center|LOCUS_00330 34273 38343 gene locus_tag LOCUS_00340 34273 38343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 38657 39898 gene locus_tag LOCUS_00350 38657 39898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 42269 39885 gene locus_tag LOCUS_00360 gene rad50 42269 39885 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878532.1 protein_id gnl|my_center|LOCUS_00360 43435 42308 gene locus_tag LOCUS_00370 43435 42308 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870840.1 protein_id gnl|my_center|LOCUS_00370 44965 43445 gene locus_tag LOCUS_00380 44965 43445 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890055.1 protein_id gnl|my_center|LOCUS_00380 45390 45061 gene locus_tag LOCUS_00390 45390 45061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809368.1 protein_id gnl|my_center|LOCUS_00390 46410 45439 gene locus_tag LOCUS_00400 46410 45439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 46855 48474 gene locus_tag LOCUS_00410 gene atwA 46855 48474 CDS product methyl coenzyme M reductase system, component A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060951.1 protein_id gnl|my_center|LOCUS_00410 48471 49073 gene locus_tag LOCUS_00420 gene mcrC 48471 49073 CDS product methyl-coenzyme M reductase I operon protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876790.1 protein_id gnl|my_center|LOCUS_00420 49637 49074 gene locus_tag LOCUS_00430 49637 49074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 49762 51372 gene locus_tag LOCUS_00440 49762 51372 CDS product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061161.1 protein_id gnl|my_center|LOCUS_00440 51384 51809 gene locus_tag LOCUS_00450 51384 51809 CDS product methanogenesis marker 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065869.1 protein_id gnl|my_center|LOCUS_00450 51806 52246 gene locus_tag LOCUS_00460 51806 52246 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066559.1 protein_id gnl|my_center|LOCUS_00460 52236 53468 gene locus_tag LOCUS_00470 52236 53468 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877471.1 protein_id gnl|my_center|LOCUS_00470 53468 54022 gene locus_tag LOCUS_00480 53468 54022 CDS product methanogenesis marker 17 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023888.1 protein_id gnl|my_center|LOCUS_00480 54024 54953 gene locus_tag LOCUS_00490 54024 54953 CDS product methanogenesis marker 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496388.1 protein_id gnl|my_center|LOCUS_00490 55005 55562 gene locus_tag LOCUS_00500 55005 55562 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061181.1 protein_id gnl|my_center|LOCUS_00500 55562 56038 gene locus_tag LOCUS_00510 55562 56038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 56393 57991 gene locus_tag LOCUS_00520 56393 57991 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817128.1 protein_id gnl|my_center|LOCUS_00520 58453 58250 gene locus_tag LOCUS_00530 58453 58250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 58401 61673 gene locus_tag LOCUS_00540 58401 61673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 62677 61778 gene locus_tag LOCUS_00550 62677 61778 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_00550 65275 62849 gene locus_tag LOCUS_00560 65275 62849 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_00560 65455 65940 gene locus_tag LOCUS_00570 65455 65940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 66573 65911 gene locus_tag LOCUS_00580 66573 65911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 67971 66664 gene locus_tag LOCUS_00590 67971 66664 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_00590 68821 68045 gene locus_tag LOCUS_00600 68821 68045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 69489 69575 gene locus_tag LOCUS_t00010 69489 69575 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 69905 69750 gene locus_tag LOCUS_00610 69905 69750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 70194 71012 gene locus_tag LOCUS_00620 70194 71012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 71090 72130 gene locus_tag LOCUS_00630 71090 72130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 72959 72174 gene locus_tag LOCUS_00640 72959 72174 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_00640 74028 72964 gene locus_tag LOCUS_00650 74028 72964 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_00650 74289 74101 gene locus_tag LOCUS_00660 74289 74101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 75479 74307 gene locus_tag LOCUS_00670 75479 74307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 75686 76843 gene locus_tag LOCUS_00680 75686 76843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 77673 76837 gene locus_tag LOCUS_00690 77673 76837 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810480.1 protein_id gnl|my_center|LOCUS_00690 77965 79188 gene locus_tag LOCUS_00700 77965 79188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 80202 79240 gene locus_tag LOCUS_00710 80202 79240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 80481 81578 gene locus_tag LOCUS_00720 80481 81578 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_00720 81578 82651 gene locus_tag LOCUS_00730 81578 82651 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_00730 82656 86399 gene locus_tag LOCUS_00740 gene cobN 82656 86399 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932109.1 protein_id gnl|my_center|LOCUS_00740 87157 86402 gene locus_tag LOCUS_00750 87157 86402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 protein_id gnl|my_center|LOCUS_00750 88050 87151 gene locus_tag LOCUS_00760 88050 87151 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_00760 88310 89323 gene locus_tag LOCUS_00770 88310 89323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 89369 90544 gene locus_tag LOCUS_00780 89369 90544 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065759.1 protein_id gnl|my_center|LOCUS_00780 90541 91329 gene locus_tag LOCUS_00790 90541 91329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_00790 91354 92391 gene locus_tag LOCUS_00800 91354 92391 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461434.1 protein_id gnl|my_center|LOCUS_00800 92361 94256 gene locus_tag LOCUS_00810 92361 94256 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546102.1 protein_id gnl|my_center|LOCUS_00810 94274 98122 gene locus_tag LOCUS_00820 gene cobN 94274 98122 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020916.1 protein_id gnl|my_center|LOCUS_00820 98660 98178 gene locus_tag LOCUS_00830 98660 98178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 98943 98773 gene locus_tag LOCUS_00840 98943 98773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 98918 100426 gene locus_tag LOCUS_00850 98918 100426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 101478 100720 gene locus_tag LOCUS_00860 101478 100720 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_00860 102305 101499 gene locus_tag LOCUS_00870 102305 101499 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948093.1 protein_id gnl|my_center|LOCUS_00870 105135 102298 gene locus_tag LOCUS_00880 105135 102298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 106520 105132 gene locus_tag LOCUS_00890 106520 105132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 107486 108493 gene locus_tag LOCUS_00900 107486 108493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 108584 114607 gene locus_tag LOCUS_00910 108584 114607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 114619 117360 gene locus_tag LOCUS_00920 114619 117360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 117545 118684 gene locus_tag LOCUS_00930 117545 118684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 118737 119789 gene locus_tag LOCUS_00940 118737 119789 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545600.1 protein_id gnl|my_center|LOCUS_00940 119791 120627 gene locus_tag LOCUS_00950 119791 120627 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_00950 120891 123566 gene locus_tag LOCUS_00960 120891 123566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 123576 124532 gene locus_tag LOCUS_00970 123576 124532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 124543 125928 gene locus_tag LOCUS_00980 124543 125928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 125928 127862 gene locus_tag LOCUS_00990 125928 127862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 127863 129050 gene locus_tag LOCUS_01000 127863 129050 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969709.1 protein_id gnl|my_center|LOCUS_01000 129043 129840 gene locus_tag LOCUS_01010 129043 129840 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948093.1 protein_id gnl|my_center|LOCUS_01010 130051 130353 gene locus_tag LOCUS_01020 130051 130353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 130551 131096 gene locus_tag LOCUS_01030 130551 131096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 131954 132208 gene locus_tag LOCUS_01040 131954 132208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 132205 132795 gene locus_tag LOCUS_01050 132205 132795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 132872 135025 gene locus_tag LOCUS_01060 132872 135025 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200796636.1 protein_id gnl|my_center|LOCUS_01060 135015 136262 gene locus_tag LOCUS_01070 135015 136262 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022026.1 protein_id gnl|my_center|LOCUS_01070 136728 136306 gene locus_tag LOCUS_01080 136728 136306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 137098 137400 gene locus_tag LOCUS_01090 137098 137400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 138905 137550 gene locus_tag LOCUS_01100 138905 137550 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772424.1 protein_id gnl|my_center|LOCUS_01100 139698 138934 gene locus_tag LOCUS_01110 139698 138934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 141043 139643 gene locus_tag LOCUS_01120 141043 139643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 142049 141108 gene locus_tag LOCUS_01130 142049 141108 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_01130 142671 142087 gene locus_tag LOCUS_01140 142671 142087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 142819 143004 gene locus_tag LOCUS_01150 142819 143004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 143411 144853 gene locus_tag LOCUS_01160 gene pap 143411 144853 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065389.1 protein_id gnl|my_center|LOCUS_01160 146611 144854 gene locus_tag LOCUS_01170 146611 144854 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768314.1 protein_id gnl|my_center|LOCUS_01170 146882 149068 gene locus_tag LOCUS_01180 146882 149068 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104337.1 protein_id gnl|my_center|LOCUS_01180 149259 149831 gene locus_tag LOCUS_01190 gene rpoE 149259 149831 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878613.1 protein_id gnl|my_center|LOCUS_01190 149828 150013 gene locus_tag LOCUS_01200 149828 150013 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868804.1 protein_id gnl|my_center|LOCUS_01200 149979 150536 gene locus_tag LOCUS_01210 149979 150536 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023601.1 protein_id gnl|my_center|LOCUS_01210 150533 150850 gene locus_tag LOCUS_01220 150533 150850 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875906.1 protein_id gnl|my_center|LOCUS_01220 150862 151059 gene locus_tag LOCUS_01230 150862 151059 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878609.1 protein_id gnl|my_center|LOCUS_01230 151101 151832 gene locus_tag LOCUS_01240 gene proG 151101 151832 CDS product pyrroline-5-carboxylate reductase ProG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232626.1 protein_id gnl|my_center|LOCUS_01240 151877 151971 gene locus_tag LOCUS_t00020 151877 151971 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 152142 152741 gene locus_tag LOCUS_01250 152142 152741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 153027 153299 gene locus_tag LOCUS_01260 153027 153299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 153375 154355 gene locus_tag LOCUS_01270 153375 154355 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774964.1 protein_id gnl|my_center|LOCUS_01270 154615 155643 gene locus_tag LOCUS_01280 gene mtaA 154615 155643 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021625.1 protein_id gnl|my_center|LOCUS_01280 156213 155686 gene locus_tag LOCUS_01290 156213 155686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 156503 157789 gene locus_tag LOCUS_01300 156503 157789 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860380.1 protein_id gnl|my_center|LOCUS_01300 158311 157958 gene locus_tag LOCUS_01310 158311 157958 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901934.1 protein_id gnl|my_center|LOCUS_01310 158544 159200 gene locus_tag LOCUS_01320 158544 159200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 159507 159271 gene locus_tag LOCUS_01330 159507 159271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 159593 160144 gene locus_tag LOCUS_01340 159593 160144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 160628 160182 gene locus_tag LOCUS_01350 160628 160182 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_01350 160712 162121 gene locus_tag LOCUS_01360 160712 162121 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_01360 162831 162130 gene locus_tag LOCUS_01370 162831 162130 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223578.1 protein_id gnl|my_center|LOCUS_01370 163223 162855 gene locus_tag LOCUS_01380 163223 162855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 163369 164526 gene locus_tag LOCUS_01390 163369 164526 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877033.1 protein_id gnl|my_center|LOCUS_01390 164523 165296 gene locus_tag LOCUS_01400 164523 165296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 166631 165348 gene locus_tag LOCUS_01410 166631 165348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 166853 168502 gene locus_tag LOCUS_01420 166853 168502 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437634.1 protein_id gnl|my_center|LOCUS_01420 168688 169005 gene locus_tag LOCUS_01430 168688 169005 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004612621.1 protein_id gnl|my_center|LOCUS_01430 171824 169206 gene locus_tag LOCUS_01440 gene acnA 171824 169206 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 protein_id gnl|my_center|LOCUS_01440 173040 171961 gene locus_tag LOCUS_01450 173040 171961 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902193.1 protein_id gnl|my_center|LOCUS_01450 173829 173128 gene locus_tag LOCUS_01460 173829 173128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 174235 175266 gene locus_tag LOCUS_01470 174235 175266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 175305 176243 gene locus_tag LOCUS_01480 175305 176243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 176339 176992 gene locus_tag LOCUS_01490 gene rpe 176339 176992 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_01490 177051 178010 gene locus_tag LOCUS_01500 gene menA 177051 178010 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_01500 178120 178368 gene locus_tag LOCUS_01510 178120 178368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 178379 179287 gene locus_tag LOCUS_01520 gene rnz 178379 179287 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_01520 179371 179955 gene locus_tag LOCUS_01530 179371 179955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 181741 180128 gene locus_tag LOCUS_01540 181741 180128 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546886.1 protein_id gnl|my_center|LOCUS_01540 182127 182417 gene locus_tag LOCUS_01550 182127 182417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 182509 184032 gene locus_tag LOCUS_01560 182509 184032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 184082 185863 gene locus_tag LOCUS_01570 184082 185863 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_01570 186005 186526 gene locus_tag LOCUS_01580 186005 186526 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066175.1 protein_id gnl|my_center|LOCUS_01580 186540 187184 gene locus_tag LOCUS_01590 186540 187184 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250456.1 protein_id gnl|my_center|LOCUS_01590 187187 187570 gene locus_tag LOCUS_01600 187187 187570 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879772.1 protein_id gnl|my_center|LOCUS_01600 187682 188422 gene locus_tag LOCUS_01610 187682 188422 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875678.1 protein_id gnl|my_center|LOCUS_01610 188508 188852 gene locus_tag LOCUS_01620 188508 188852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 189271 188858 gene locus_tag LOCUS_01630 189271 188858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 190731 189277 gene locus_tag LOCUS_01640 190731 189277 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_01640 191862 190744 gene locus_tag LOCUS_01650 191862 190744 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869494.1 protein_id gnl|my_center|LOCUS_01650 192793 191999 gene locus_tag LOCUS_01660 192793 191999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 193022 193393 gene locus_tag LOCUS_01670 193022 193393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 193662 193438 gene locus_tag LOCUS_01680 193662 193438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 195488 194040 gene locus_tag LOCUS_01690 gene argH 195488 194040 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_01690 196833 195544 gene locus_tag LOCUS_01700 196833 195544 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869501.1 protein_id gnl|my_center|LOCUS_01700 197041 198060 gene locus_tag LOCUS_01710 gene argC 197041 198060 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876479.1 protein_id gnl|my_center|LOCUS_01710 198063 199289 gene locus_tag LOCUS_01720 gene argJ 198063 199289 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_01720 199300 200094 gene locus_tag LOCUS_01730 gene argB 199300 200094 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459300.1 protein_id gnl|my_center|LOCUS_01730 200097 201251 gene locus_tag LOCUS_01740 200097 201251 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876950.1 protein_id gnl|my_center|LOCUS_01740 201291 201944 gene locus_tag LOCUS_01750 201291 201944 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970077.1 protein_id gnl|my_center|LOCUS_01750 202017 202418 gene locus_tag LOCUS_01760 202017 202418 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393003.1 protein_id gnl|my_center|LOCUS_01760 202607 203290 gene locus_tag LOCUS_01770 202607 203290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 203287 203634 gene locus_tag LOCUS_01780 203287 203634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 204760 203816 gene locus_tag LOCUS_01790 204760 203816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 205683 204895 gene locus_tag LOCUS_01800 205683 204895 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020389.1 protein_id gnl|my_center|LOCUS_01800 205965 206216 gene locus_tag LOCUS_01810 205965 206216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 206240 206782 gene locus_tag LOCUS_01820 206240 206782 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462102.1 protein_id gnl|my_center|LOCUS_01820 206944 206868 gene locus_tag LOCUS_t00030 206944 206868 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 207153 207923 gene locus_tag LOCUS_01830 207153 207923 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022767.1 protein_id gnl|my_center|LOCUS_01830 207954 208031 gene locus_tag LOCUS_t00040 207954 208031 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 209124 208252 gene locus_tag LOCUS_01840 209124 208252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 209760 209239 gene locus_tag LOCUS_01850 209760 209239 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867433.1 protein_id gnl|my_center|LOCUS_01850 209847 211091 gene locus_tag LOCUS_01860 gene metK 209847 211091 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_01860 213009 211327 gene locus_tag LOCUS_01870 213009 211327 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249982.1 protein_id gnl|my_center|LOCUS_01870 213817 213161 gene locus_tag LOCUS_01880 213817 213161 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048417.1 protein_id gnl|my_center|LOCUS_01880 216024 213814 gene locus_tag LOCUS_01890 gene metG 216024 213814 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876226.1 protein_id gnl|my_center|LOCUS_01890 216135 216890 gene locus_tag LOCUS_01900 216135 216890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 217233 216880 gene locus_tag LOCUS_01910 217233 216880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 217618 217448 gene locus_tag LOCUS_01920 217618 217448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 217660 218898 gene locus_tag LOCUS_01930 gene ftsZ 217660 218898 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064630.1 protein_id gnl|my_center|LOCUS_01930 220769 218967 gene locus_tag LOCUS_01940 220769 218967 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250266.1 protein_id gnl|my_center|LOCUS_01940 221024 222223 gene locus_tag LOCUS_01950 221024 222223 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867946.1 protein_id gnl|my_center|LOCUS_01950 222325 223272 gene locus_tag LOCUS_01960 222325 223272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 223747 223334 gene locus_tag LOCUS_01970 gene ribH 223747 223334 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496458.1 protein_id gnl|my_center|LOCUS_01970 224214 223747 gene locus_tag LOCUS_01980 gene ribC 224214 223747 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870697.1 protein_id gnl|my_center|LOCUS_01980 224675 224211 gene locus_tag LOCUS_01990 224675 224211 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876477.1 protein_id gnl|my_center|LOCUS_01990 225348 224647 gene locus_tag LOCUS_02000 gene ribB 225348 224647 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869547.1 protein_id gnl|my_center|LOCUS_02000 225676 226719 gene locus_tag LOCUS_02010 225676 226719 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_02010 226797 228125 gene locus_tag LOCUS_02020 226797 228125 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867639.1 protein_id gnl|my_center|LOCUS_02020 229055 228141 gene locus_tag LOCUS_02030 229055 228141 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021969.1 protein_id gnl|my_center|LOCUS_02030 229549 229115 gene locus_tag LOCUS_02040 229549 229115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 230083 229616 gene locus_tag LOCUS_02050 230083 229616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 230555 230163 gene locus_tag LOCUS_02060 230555 230163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 231019 230639 gene locus_tag LOCUS_02070 231019 230639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 231307 232161 gene locus_tag LOCUS_02080 231307 232161 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_02080 232406 232197 gene locus_tag LOCUS_02090 232406 232197 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860795.1 protein_id gnl|my_center|LOCUS_02090 232727 232410 gene locus_tag LOCUS_02100 232727 232410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 233001 233150 gene locus_tag LOCUS_02110 233001 233150 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065861.1 protein_id gnl|my_center|LOCUS_02110 233305 234582 gene locus_tag LOCUS_02120 gene eno 233305 234582 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496902.1 protein_id gnl|my_center|LOCUS_02120 234744 235934 gene locus_tag LOCUS_02130 234744 235934 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868844.1 protein_id gnl|my_center|LOCUS_02130 235931 236356 gene locus_tag LOCUS_02140 235931 236356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 237310 236507 gene locus_tag LOCUS_02150 237310 236507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 238254 237310 gene locus_tag LOCUS_02160 238254 237310 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655975.1 protein_id gnl|my_center|LOCUS_02160 239279 238251 gene locus_tag LOCUS_02170 239279 238251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 239811 240011 gene locus_tag LOCUS_02180 239811 240011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 240059 240658 gene locus_tag LOCUS_02190 240059 240658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 240658 241074 gene locus_tag LOCUS_02200 240658 241074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 243452 241062 gene locus_tag LOCUS_02210 243452 241062 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010916276.1 protein_id gnl|my_center|LOCUS_02210 244046 243588 gene locus_tag LOCUS_02220 gene nikR 244046 243588 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_02220 244371 246302 gene locus_tag LOCUS_02230 244371 246302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 246286 247122 gene locus_tag LOCUS_02240 246286 247122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 247160 248431 gene locus_tag LOCUS_02250 247160 248431 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544919.1 protein_id gnl|my_center|LOCUS_02250 248409 249065 gene locus_tag LOCUS_02260 248409 249065 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485759.1 protein_id gnl|my_center|LOCUS_02260 249072 253052 gene locus_tag LOCUS_02270 249072 253052 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147213.1 protein_id gnl|my_center|LOCUS_02270 253394 255178 gene locus_tag LOCUS_02280 253394 255178 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392612.1 protein_id gnl|my_center|LOCUS_02280 255175 255990 gene locus_tag LOCUS_02290 255175 255990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 256610 255993 gene locus_tag LOCUS_02300 256610 255993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 256794 257510 gene locus_tag LOCUS_02310 256794 257510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146593.1 protein_id gnl|my_center|LOCUS_02310 257507 258802 gene locus_tag LOCUS_02320 257507 258802 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081357.1 protein_id gnl|my_center|LOCUS_02320 259469 259801 gene locus_tag LOCUS_02330 259469 259801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 261559 260150 gene locus_tag LOCUS_02340 261559 260150 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272339.1 protein_id gnl|my_center|LOCUS_02340 262267 261644 gene locus_tag LOCUS_02350 262267 261644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 263070 262618 gene locus_tag LOCUS_02360 263070 262618 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582438.1 protein_id gnl|my_center|LOCUS_02360 263184 263450 gene locus_tag LOCUS_02370 263184 263450 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722106.1 protein_id gnl|my_center|LOCUS_02370 264730 263657 gene locus_tag LOCUS_02380 gene hypD 264730 263657 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876696.1 protein_id gnl|my_center|LOCUS_02380 265097 264723 gene locus_tag LOCUS_02390 gene hypA 265097 264723 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021162.1 protein_id gnl|my_center|LOCUS_02390 266794 265163 gene locus_tag LOCUS_02400 266794 265163 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762692.1 protein_id gnl|my_center|LOCUS_02400 267375 266791 gene locus_tag LOCUS_02410 267375 266791 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022863.1 protein_id gnl|my_center|LOCUS_02410 267502 268155 gene locus_tag LOCUS_02420 267502 268155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_02420 268179 268388 gene locus_tag LOCUS_02430 268179 268388 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_02430 268390 269451 gene locus_tag LOCUS_02440 268390 269451 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_02440 269452 270207 gene locus_tag LOCUS_02450 269452 270207 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_02450 270200 270736 gene locus_tag LOCUS_02460 270200 270736 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 protein_id gnl|my_center|LOCUS_02460 271910 270759 gene locus_tag LOCUS_02470 gene hmgA 271910 270759 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065600.1 protein_id gnl|my_center|LOCUS_02470 272084 272506 gene locus_tag LOCUS_02480 272084 272506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 272652 272727 gene locus_tag LOCUS_t00050 272652 272727 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 273221 272745 gene locus_tag LOCUS_02490 273221 272745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 273348 273734 gene locus_tag LOCUS_02500 273348 273734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 275246 273795 gene locus_tag LOCUS_02510 275246 273795 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065911.1 protein_id gnl|my_center|LOCUS_02510 276488 275370 gene locus_tag LOCUS_02520 276488 275370 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_02520 277460 276627 gene locus_tag LOCUS_02530 277460 276627 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_02530 278744 277524 gene locus_tag LOCUS_02540 278744 277524 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824500.1 protein_id gnl|my_center|LOCUS_02540 278821 279996 gene locus_tag LOCUS_02550 gene nifS 278821 279996 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_02550 279980 280351 gene locus_tag LOCUS_02560 gene nifU 279980 280351 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_02560 280429 281301 gene locus_tag LOCUS_02570 280429 281301 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146595.1 protein_id gnl|my_center|LOCUS_02570 281294 282061 gene locus_tag LOCUS_02580 281294 282061 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870966.1 protein_id gnl|my_center|LOCUS_02580 282279 282118 gene locus_tag LOCUS_02590 282279 282118 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_02590 282734 282306 gene locus_tag LOCUS_02600 282734 282306 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879168.1 protein_id gnl|my_center|LOCUS_02600 284036 282735 gene locus_tag LOCUS_02610 284036 282735 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023751.1 protein_id gnl|my_center|LOCUS_02610 285070 284174 gene locus_tag LOCUS_02620 285070 284174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 285606 285812 gene locus_tag LOCUS_02630 285606 285812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 285809 286282 gene locus_tag LOCUS_02640 285809 286282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 287102 286242 gene locus_tag LOCUS_02650 287102 286242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 287156 287740 gene locus_tag LOCUS_02660 287156 287740 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 protein_id gnl|my_center|LOCUS_02660 287908 288267 gene locus_tag LOCUS_02670 287908 288267 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_02670 288282 288500 gene locus_tag LOCUS_02680 288282 288500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02680 288507 290414 gene locus_tag LOCUS_02690 288507 290414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02690 290692 291339 gene locus_tag LOCUS_02700 gene cysE 290692 291339 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_02700 291369 292763 gene locus_tag LOCUS_02710 gene cysS 291369 292763 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_02710 292748 293782 gene locus_tag LOCUS_02720 292748 293782 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066092.1 protein_id gnl|my_center|LOCUS_02720 293821 294483 gene locus_tag LOCUS_02730 293821 294483 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065966.1 protein_id gnl|my_center|LOCUS_02730 294484 296400 gene locus_tag LOCUS_02740 gene feoB 294484 296400 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024217.1 protein_id gnl|my_center|LOCUS_02740 296832 296383 gene locus_tag LOCUS_02750 296832 296383 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755897.1 protein_id gnl|my_center|LOCUS_02750 296947 296861 gene locus_tag LOCUS_t00060 296947 296861 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 297684 297145 gene locus_tag LOCUS_02760 297684 297145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 298148 297966 gene locus_tag LOCUS_02770 298148 297966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 298658 304300 gene locus_tag LOCUS_02780 298658 304300 CDS product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203358.1 protein_id gnl|my_center|LOCUS_02780 304310 304990 gene locus_tag LOCUS_02790 304310 304990 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948716.1 protein_id gnl|my_center|LOCUS_02790 304994 305914 gene locus_tag LOCUS_02800 304994 305914 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_02800 306347 306000 gene locus_tag LOCUS_02810 306347 306000 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390711.1 protein_id gnl|my_center|LOCUS_02810 307620 306388 gene locus_tag LOCUS_02820 307620 306388 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021729.1 protein_id gnl|my_center|LOCUS_02820 308228 307653 gene locus_tag LOCUS_02830 308228 307653 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392451.1 protein_id gnl|my_center|LOCUS_02830 309997 308228 gene locus_tag LOCUS_02840 gene iorA 309997 308228 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021731.1 protein_id gnl|my_center|LOCUS_02840 310107 310763 gene locus_tag LOCUS_02850 310107 310763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 312400 311009 gene locus_tag LOCUS_02860 gene mtmB 312400 311009 CDS product monomethylamine methyltransferase MtmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P58866 transl_except (pos:complement(311795..311797),aa:Pyl) note codon on position 202 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_02860 313062 312406 gene locus_tag LOCUS_02870 313062 312406 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020578.1 protein_id gnl|my_center|LOCUS_02870 314784 313150 gene locus_tag LOCUS_02880 314784 313150 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020208.1 protein_id gnl|my_center|LOCUS_02880 315620 314781 gene locus_tag LOCUS_02890 gene pylD 315620 314781 CDS product 3-methylornithyl-N6-L-lysine dehydrogenase PylD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462267.1 protein_id gnl|my_center|LOCUS_02890 316801 315629 gene locus_tag LOCUS_02900 gene pylC 316801 315629 CDS product 3-methylornithine--L-lysine ligase PylC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462268.1 protein_id gnl|my_center|LOCUS_02900 317880 316798 gene locus_tag LOCUS_02910 gene pylB 317880 316798 CDS product methylornithine synthase PylB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945507.1 protein_id gnl|my_center|LOCUS_02910 318718 317891 gene locus_tag LOCUS_02920 gene pylSc 318718 317891 CDS product pyrrolysine--tRNA(Pyl) ligase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462270.1 protein_id gnl|my_center|LOCUS_02920 319260 319901 gene locus_tag LOCUS_02930 319260 319901 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020969.1 protein_id gnl|my_center|LOCUS_02930 319908 321275 gene locus_tag LOCUS_02940 gene mtmB 319908 321275 CDS product monomethylamine methyltransferase MtmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P58866 transl_except (pos:320508..320510,aa:Pyl) note codon on position 201 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_02940 321353 322684 gene locus_tag LOCUS_02950 321353 322684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 324249 322792 gene locus_tag LOCUS_02960 324249 322792 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065402.1 protein_id gnl|my_center|LOCUS_02960 324416 324267 gene locus_tag LOCUS_02970 324416 324267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 325888 324431 gene locus_tag LOCUS_02980 325888 324431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 326622 325972 gene locus_tag LOCUS_02990 326622 325972 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020578.1 protein_id gnl|my_center|LOCUS_02990 328125 326635 gene locus_tag LOCUS_03000 gene mttB 328125 326635 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P58973 transl_except (pos:complement(327124..327126),aa:Pyl) note codon on position 334 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_03000 329725 328316 gene locus_tag LOCUS_03010 gene mtbB 329725 328316 CDS product dimethylamine methyltransferase MtbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q8TN68 transl_except (pos:complement(328661..328663),aa:Pyl) note codon on position 355 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_03010 330379 329735 gene locus_tag LOCUS_03020 330379 329735 CDS product methyltransferase cognate corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065003.1 protein_id gnl|my_center|LOCUS_03020 330651 331829 gene locus_tag LOCUS_03030 330651 331829 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065790.1 protein_id gnl|my_center|LOCUS_03030 332181 334277 gene locus_tag LOCUS_03040 gene nrdD 332181 334277 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869385.1 protein_id gnl|my_center|LOCUS_03040 334519 334995 gene locus_tag LOCUS_03050 334519 334995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 335385 335026 gene locus_tag LOCUS_03060 335385 335026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 335816 335445 gene locus_tag LOCUS_03070 gene sugE 335816 335445 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118469.1 protein_id gnl|my_center|LOCUS_03070 336164 335817 gene locus_tag LOCUS_03080 336164 335817 CDS product SugE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021723289.1 protein_id gnl|my_center|LOCUS_03080 336924 336292 gene locus_tag LOCUS_03090 336924 336292 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459560.1 protein_id gnl|my_center|LOCUS_03090 337781 336912 gene locus_tag LOCUS_03100 337781 336912 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897173.1 protein_id gnl|my_center|LOCUS_03100 338158 337781 gene locus_tag LOCUS_03110 338158 337781 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_03110 338270 338602 gene locus_tag LOCUS_03120 338270 338602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 338856 339221 gene locus_tag LOCUS_03130 338856 339221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 339265 339933 gene locus_tag LOCUS_03140 339265 339933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 340041 340745 gene locus_tag LOCUS_03150 340041 340745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 340750 342423 gene locus_tag LOCUS_03160 gene cas8a1 340750 342423 CDS product type I-B CRISPR-associated protein Cas8b1/Cst1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546150.1 protein_id gnl|my_center|LOCUS_03160 342410 343285 gene locus_tag LOCUS_03170 gene cas7i 342410 343285 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861770.1 protein_id gnl|my_center|LOCUS_03170 343278 344006 gene locus_tag LOCUS_03180 gene cas5b 343278 344006 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439785.1 protein_id gnl|my_center|LOCUS_03180 344018 346231 gene locus_tag LOCUS_03190 344018 346231 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861769.1 protein_id gnl|my_center|LOCUS_03190 346324 346728 gene locus_tag LOCUS_03200 gene cas4 346324 346728 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016964.1 protein_id gnl|my_center|LOCUS_03200 346756 347730 gene locus_tag LOCUS_03210 gene cas1b 346756 347730 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896423.1 protein_id gnl|my_center|LOCUS_03210 347724 348029 gene locus_tag LOCUS_03220 gene cas2 347724 348029 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903132.1 protein_id gnl|my_center|LOCUS_03220 348207 349923 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttagaaatccatctaaactagaatgtaaat 350063 350278 gene locus_tag LOCUS_03230 350063 350278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 351309 350488 gene locus_tag LOCUS_03240 351309 350488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 351571 351281 gene locus_tag LOCUS_03250 351571 351281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 352319 351678 gene locus_tag LOCUS_03260 352319 351678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 352713 354498 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttacattctagtttagatggatttctaac 354790 354494 gene locus_tag LOCUS_03270 354790 354494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 356237 356536 gene locus_tag LOCUS_03280 356237 356536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 356828 357799 gene locus_tag LOCUS_03290 356828 357799 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104632.1 protein_id gnl|my_center|LOCUS_03290 358240 357803 gene locus_tag LOCUS_03300 358240 357803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 360188 358377 gene locus_tag LOCUS_03310 360188 358377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 361228 360428 gene locus_tag LOCUS_03320 361228 360428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 361619 363121 gene locus_tag LOCUS_03330 gene arcD 361619 363121 CDS product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129471.1 protein_id gnl|my_center|LOCUS_03330 363137 364153 gene locus_tag LOCUS_03340 363137 364153 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583099.1 protein_id gnl|my_center|LOCUS_03340 364715 364179 gene locus_tag LOCUS_03350 364715 364179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 365902 365021 gene locus_tag LOCUS_03360 365902 365021 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_03360 366147 366722 gene locus_tag LOCUS_03370 366147 366722 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_03370 366724 367263 gene locus_tag LOCUS_03380 366724 367263 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434284.1 protein_id gnl|my_center|LOCUS_03380 368492 367950 gene locus_tag LOCUS_03390 368492 367950 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_03390 369051 368584 gene locus_tag LOCUS_03400 gene pth2 369051 368584 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877304.1 protein_id gnl|my_center|LOCUS_03400 370015 369137 gene locus_tag LOCUS_03410 370015 369137 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861326.1 protein_id gnl|my_center|LOCUS_03410 370154 370759 gene locus_tag LOCUS_03420 370154 370759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 371896 371420 gene locus_tag LOCUS_03430 371896 371420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 373007 372934 gene locus_tag LOCUS_t00070 373007 372934 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 373823 373074 gene locus_tag LOCUS_03440 373823 373074 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 protein_id gnl|my_center|LOCUS_03440 374701 373823 gene locus_tag LOCUS_03450 374701 373823 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_03450 375391 376422 gene locus_tag LOCUS_03460 375391 376422 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545241.1 protein_id gnl|my_center|LOCUS_03460 376404 378308 gene locus_tag LOCUS_03470 376404 378308 CDS product magnesium chelatase subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932111.1 protein_id gnl|my_center|LOCUS_03470 378352 379296 gene locus_tag LOCUS_03480 378352 379296 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948766.1 protein_id gnl|my_center|LOCUS_03480 381937 379325 gene locus_tag LOCUS_03490 gene valS 381937 379325 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870520.1 protein_id gnl|my_center|LOCUS_03490 382193 382017 gene locus_tag LOCUS_03500 382193 382017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 382531 382432 gene locus_tag LOCUS_r00010 382531 382432 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 383782 382580 gene locus_tag LOCUS_03510 383782 382580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 385593 383968 gene locus_tag LOCUS_03520 gene glyS 385593 383968 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869726.1 protein_id gnl|my_center|LOCUS_03520 386609 385764 gene locus_tag LOCUS_03530 386609 385764 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060939.1 protein_id gnl|my_center|LOCUS_03530 387057 386596 gene locus_tag LOCUS_03540 387057 386596 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_03540 388117 387059 gene locus_tag LOCUS_03550 388117 387059 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023987.1 protein_id gnl|my_center|LOCUS_03550 388231 388398 gene locus_tag LOCUS_03560 388231 388398 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024079.1 protein_id gnl|my_center|LOCUS_03560 388472 389014 gene locus_tag LOCUS_03570 gene thpR 388472 389014 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545374.1 protein_id gnl|my_center|LOCUS_03570 390144 389032 gene locus_tag LOCUS_03580 gene fbpC 390144 389032 CDS product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078833.1 protein_id gnl|my_center|LOCUS_03580 390935 390141 gene locus_tag LOCUS_03590 390935 390141 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028995.1 protein_id gnl|my_center|LOCUS_03590 391786 390932 gene locus_tag LOCUS_03600 391786 390932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 393435 391813 gene locus_tag LOCUS_03610 393435 391813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 393574 395064 gene locus_tag LOCUS_03620 393574 395064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 395061 396089 gene locus_tag LOCUS_03630 395061 396089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 396543 396109 gene locus_tag LOCUS_03640 396543 396109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 396786 397559 gene locus_tag LOCUS_03650 396786 397559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 398487 397549 gene locus_tag LOCUS_03660 398487 397549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 398817 398488 gene locus_tag LOCUS_03670 398817 398488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 399742 398822 gene locus_tag LOCUS_03680 399742 398822 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870653.1 protein_id gnl|my_center|LOCUS_03680 400008 400325 gene locus_tag LOCUS_03690 400008 400325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809368.1 protein_id gnl|my_center|LOCUS_03690 401041 400421 gene locus_tag LOCUS_03700 401041 400421 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_03700 402427 401156 gene locus_tag LOCUS_03710 402427 401156 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_03710 402646 403356 gene locus_tag LOCUS_03720 gene rluF 402646 403356 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963354.1 protein_id gnl|my_center|LOCUS_03720 408253 403460 gene locus_tag LOCUS_03730 408253 403460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 408570 409850 gene locus_tag LOCUS_03740 408570 409850 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861968.1 protein_id gnl|my_center|LOCUS_03740 409864 410775 gene locus_tag LOCUS_03750 409864 410775 CDS product 4Fe-4S-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430299.1 protein_id gnl|my_center|LOCUS_03750 411526 410891 gene locus_tag LOCUS_03760 411526 410891 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286616.1 protein_id gnl|my_center|LOCUS_03760 411672 412595 gene locus_tag LOCUS_03770 411672 412595 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015663.1 protein_id gnl|my_center|LOCUS_03770 412592 413287 gene locus_tag LOCUS_03780 gene menG 412592 413287 CDS product 2-heptaprenyl-1,4-naphthoquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187667.1 protein_id gnl|my_center|LOCUS_03780 413341 413553 gene locus_tag LOCUS_03790 413341 413553 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198960.1 protein_id gnl|my_center|LOCUS_03790 414292 413612 gene locus_tag LOCUS_03800 414292 413612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 414602 414324 gene locus_tag LOCUS_03810 414602 414324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 415118 415762 gene locus_tag LOCUS_03820 415118 415762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 415837 416391 gene locus_tag LOCUS_03830 415837 416391 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020390.1 protein_id gnl|my_center|LOCUS_03830 417284 416457 gene locus_tag LOCUS_03840 417284 416457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 418099 417284 gene locus_tag LOCUS_03850 418099 417284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 418403 418711 gene locus_tag LOCUS_03860 418403 418711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 420521 418863 gene locus_tag LOCUS_03870 gene thsB 420521 418863 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878948.1 protein_id gnl|my_center|LOCUS_03870 421386 420613 gene locus_tag LOCUS_03880 421386 420613 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541595.1 protein_id gnl|my_center|LOCUS_03880 422662 421379 gene locus_tag LOCUS_03890 422662 421379 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978992.1 protein_id gnl|my_center|LOCUS_03890 423626 422730 gene locus_tag LOCUS_03900 423626 422730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 425253 423628 gene locus_tag LOCUS_03910 gene polX 425253 423628 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551361.1 protein_id gnl|my_center|LOCUS_03910 426001 425243 gene locus_tag LOCUS_03920 gene larB 426001 425243 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061016.1 protein_id gnl|my_center|LOCUS_03920 426047 426832 gene locus_tag LOCUS_03930 gene larE 426047 426832 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584116.1 protein_id gnl|my_center|LOCUS_03930 428331 426835 gene locus_tag LOCUS_03940 428331 426835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 428493 428421 gene locus_tag LOCUS_t00080 428493 428421 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 429025 428549 gene locus_tag LOCUS_03950 429025 428549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 430347 429028 gene locus_tag LOCUS_03960 gene purB 430347 429028 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868368.1 protein_id gnl|my_center|LOCUS_03960 430494 430844 gene locus_tag LOCUS_03970 430494 430844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 431007 431879 gene locus_tag LOCUS_03980 431007 431879 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902245.1 protein_id gnl|my_center|LOCUS_03980 432208 433545 gene locus_tag LOCUS_03990 432208 433545 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024460.1 protein_id gnl|my_center|LOCUS_03990 433542 434132 gene locus_tag LOCUS_04000 gene trmY 433542 434132 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066221.1 protein_id gnl|my_center|LOCUS_04000 434184 434387 gene locus_tag LOCUS_04010 434184 434387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 434384 435349 gene locus_tag LOCUS_04020 434384 435349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 436284 435346 gene locus_tag LOCUS_04030 436284 435346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 436673 437827 gene locus_tag LOCUS_04040 436673 437827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 437866 438918 gene locus_tag LOCUS_04050 437866 438918 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024478.1 protein_id gnl|my_center|LOCUS_04050 438923 439705 gene locus_tag LOCUS_04060 438923 439705 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_04060 439813 439726 gene locus_tag LOCUS_t00090 439813 439726 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 441512 439857 gene locus_tag LOCUS_04070 gene pheT 441512 439857 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_04070 442299 441865 gene locus_tag LOCUS_04080 442299 441865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 444711 442951 gene locus_tag LOCUS_04090 444711 442951 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_04090 445120 444716 gene locus_tag LOCUS_04100 gene paaI 445120 444716 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228333.1 protein_id gnl|my_center|LOCUS_04100 445356 445135 gene locus_tag LOCUS_04110 445356 445135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 445483 447267 gene locus_tag LOCUS_04120 445483 447267 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263109.1 protein_id gnl|my_center|LOCUS_04120 447871 447272 gene locus_tag LOCUS_04130 447871 447272 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020584.1 protein_id gnl|my_center|LOCUS_04130 448377 447868 gene locus_tag LOCUS_04140 448377 447868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 449587 448337 gene locus_tag LOCUS_04150 gene hisD 449587 448337 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023136.1 protein_id gnl|my_center|LOCUS_04150 449739 450020 gene locus_tag LOCUS_04160 449739 450020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 450484 450113 gene locus_tag LOCUS_04170 450484 450113 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764611.1 protein_id gnl|my_center|LOCUS_04170 450634 450918 gene locus_tag LOCUS_04180 450634 450918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 451524 450919 gene locus_tag LOCUS_04190 451524 450919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 451617 451907 gene locus_tag LOCUS_04200 451617 451907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 451925 452206 gene locus_tag LOCUS_04210 451925 452206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 453563 452562 gene locus_tag LOCUS_04220 453563 452562 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024078.1 protein_id gnl|my_center|LOCUS_04220 454243 453656 gene locus_tag LOCUS_04230 454243 453656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022949.1 protein_id gnl|my_center|LOCUS_04230 454408 455244 gene locus_tag LOCUS_04240 454408 455244 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496386.1 protein_id gnl|my_center|LOCUS_04240 455596 455964 gene locus_tag LOCUS_04250 455596 455964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 456033 456770 gene locus_tag LOCUS_04260 456033 456770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 456953 458047 gene locus_tag LOCUS_04270 456953 458047 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 protein_id gnl|my_center|LOCUS_04270 458140 459045 gene locus_tag LOCUS_04280 gene cysK 458140 459045 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948015.1 protein_id gnl|my_center|LOCUS_04280 459076 460359 gene locus_tag LOCUS_04290 459076 460359 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_04290 460372 461289 gene locus_tag LOCUS_04300 gene metA 460372 461289 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_04300 >Feature sequence02 2177 339 gene locus_tag LOCUS_04310 2177 339 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763439.1 protein_id gnl|my_center|LOCUS_04310 2339 3292 gene locus_tag LOCUS_04320 2339 3292 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_04320 3289 4320 gene locus_tag LOCUS_04330 3289 4320 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583087.1 protein_id gnl|my_center|LOCUS_04330 5735 4659 gene locus_tag LOCUS_04340 5735 4659 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868366.1 protein_id gnl|my_center|LOCUS_04340 6204 5716 gene locus_tag LOCUS_04350 6204 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 7481 6315 gene locus_tag LOCUS_04360 7481 6315 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583323.1 protein_id gnl|my_center|LOCUS_04360 8351 7539 gene locus_tag LOCUS_04370 8351 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 8705 8632 gene locus_tag LOCUS_t00100 8705 8632 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9011 9337 gene locus_tag LOCUS_04380 gene eif1A 9011 9337 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064286.1 protein_id gnl|my_center|LOCUS_04380 9349 10125 gene locus_tag LOCUS_04390 gene rio1 9349 10125 CDS product serine/threonine-protein kinase Rio1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289466.1 protein_id gnl|my_center|LOCUS_04390 10122 10661 gene locus_tag LOCUS_04400 10122 10661 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867717.1 protein_id gnl|my_center|LOCUS_04400 10674 11909 gene locus_tag LOCUS_04410 10674 11909 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_04410 11912 12205 gene locus_tag LOCUS_04420 11912 12205 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869531.1 protein_id gnl|my_center|LOCUS_04420 12216 12536 gene locus_tag LOCUS_04430 12216 12536 CDS product RNA polymerase Rpb4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064405.1 protein_id gnl|my_center|LOCUS_04430 12560 13108 gene locus_tag LOCUS_04440 12560 13108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 13192 13908 gene locus_tag LOCUS_04450 gene rsmA 13192 13908 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990848.1 protein_id gnl|my_center|LOCUS_04450 13944 15134 gene locus_tag LOCUS_04460 13944 15134 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496963.1 protein_id gnl|my_center|LOCUS_04460 15139 17547 gene locus_tag LOCUS_04470 15139 17547 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868838.1 protein_id gnl|my_center|LOCUS_04470 17610 17954 gene locus_tag LOCUS_04480 17610 17954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 18441 17971 gene locus_tag LOCUS_04490 18441 17971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 18551 19051 gene locus_tag LOCUS_04500 18551 19051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 19863 19066 gene locus_tag LOCUS_04510 19863 19066 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812722.1 protein_id gnl|my_center|LOCUS_04510 20837 19917 gene locus_tag LOCUS_04520 20837 19917 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_04520 21027 21752 gene locus_tag LOCUS_04530 21027 21752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 22468 21749 gene locus_tag LOCUS_04540 22468 21749 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251067.1 protein_id gnl|my_center|LOCUS_04540 23024 22500 gene locus_tag LOCUS_04550 23024 22500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 23170 24000 gene locus_tag LOCUS_04560 23170 24000 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024128.1 protein_id gnl|my_center|LOCUS_04560 24088 24435 gene locus_tag LOCUS_04570 24088 24435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 25334 24399 gene locus_tag LOCUS_04580 25334 24399 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_04580 25488 25685 gene locus_tag LOCUS_04590 25488 25685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 25759 27213 gene locus_tag LOCUS_04600 25759 27213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 27256 27573 gene locus_tag LOCUS_04610 27256 27573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 28366 27578 gene locus_tag LOCUS_04620 28366 27578 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772043.1 protein_id gnl|my_center|LOCUS_04620 29182 28808 gene locus_tag LOCUS_04630 29182 28808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 29383 29865 gene locus_tag LOCUS_04640 29383 29865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 30517 29963 gene locus_tag LOCUS_04650 30517 29963 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_04650 33906 30556 gene locus_tag LOCUS_04660 33906 30556 CDS product DNA-directed DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496881.1 protein_id gnl|my_center|LOCUS_04660 34877 33915 gene locus_tag LOCUS_04670 34877 33915 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589523.1 protein_id gnl|my_center|LOCUS_04670 34996 35568 gene locus_tag LOCUS_04680 34996 35568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 36001 35621 gene locus_tag LOCUS_04690 36001 35621 CDS product HTH-type transcriptional regulator Ptr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496594.1 protein_id gnl|my_center|LOCUS_04690 36185 37126 gene locus_tag LOCUS_04700 36185 37126 CDS product EF-Tu/IF-2/RF-3 family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869822.1 protein_id gnl|my_center|LOCUS_04700 37206 37676 gene locus_tag LOCUS_04710 37206 37676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 38176 39765 gene locus_tag LOCUS_04720 38176 39765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 40124 39762 gene locus_tag LOCUS_04730 40124 39762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 40407 40931 gene locus_tag LOCUS_04740 40407 40931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 40931 41569 gene locus_tag LOCUS_04750 40931 41569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 41562 42452 gene locus_tag LOCUS_04760 gene map 41562 42452 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879334.1 protein_id gnl|my_center|LOCUS_04760 43627 43001 gene locus_tag LOCUS_04770 43627 43001 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065091.1 protein_id gnl|my_center|LOCUS_04770 43746 45047 gene locus_tag LOCUS_04780 43746 45047 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860380.1 protein_id gnl|my_center|LOCUS_04780 45404 45042 gene locus_tag LOCUS_04790 45404 45042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 45812 46459 gene locus_tag LOCUS_04800 45812 46459 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722009.1 protein_id gnl|my_center|LOCUS_04800 46604 46777 gene locus_tag LOCUS_04810 46604 46777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 47539 47207 gene locus_tag LOCUS_04820 47539 47207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020960.1 protein_id gnl|my_center|LOCUS_04820 47748 48113 gene locus_tag LOCUS_04830 47748 48113 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948189.1 protein_id gnl|my_center|LOCUS_04830 49310 48114 gene locus_tag LOCUS_04840 gene hisS 49310 48114 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061190.1 protein_id gnl|my_center|LOCUS_04840 50504 49389 gene locus_tag LOCUS_04850 50504 49389 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496792.1 protein_id gnl|my_center|LOCUS_04850 50756 51784 gene locus_tag LOCUS_04860 50756 51784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 51842 53842 gene locus_tag LOCUS_04870 51842 53842 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_04870 53832 54932 gene locus_tag LOCUS_04880 53832 54932 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878440.1 protein_id gnl|my_center|LOCUS_04880 55530 54973 gene locus_tag LOCUS_04890 55530 54973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 55761 56681 gene locus_tag LOCUS_04900 55761 56681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 57462 56668 gene locus_tag LOCUS_04910 gene dph5 57462 56668 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249061.1 protein_id gnl|my_center|LOCUS_04910 57472 58503 gene locus_tag LOCUS_04920 gene trm5b 57472 58503 CDS product tRNA (guanine(37)-N1)-methyltransferase Trm5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867861.1 protein_id gnl|my_center|LOCUS_04920 58974 58480 gene locus_tag LOCUS_04930 gene dcd 58974 58480 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250365.1 protein_id gnl|my_center|LOCUS_04930 59030 60130 gene locus_tag LOCUS_04940 59030 60130 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_04940 60160 61212 gene locus_tag LOCUS_04950 60160 61212 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869669.1 protein_id gnl|my_center|LOCUS_04950 62237 61215 gene locus_tag LOCUS_04960 62237 61215 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021397.1 protein_id gnl|my_center|LOCUS_04960 62434 63378 gene locus_tag LOCUS_04970 62434 63378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 63368 64276 gene locus_tag LOCUS_04980 gene pstC 63368 64276 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_04980 64273 65136 gene locus_tag LOCUS_04990 gene pstA 64273 65136 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788578.1 protein_id gnl|my_center|LOCUS_04990 65117 65947 gene locus_tag LOCUS_05000 gene pstB 65117 65947 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_05000 65947 66600 gene locus_tag LOCUS_05010 gene phoU 65947 66600 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986850.1 protein_id gnl|my_center|LOCUS_05010 66792 66616 gene locus_tag LOCUS_05020 66792 66616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 66987 67781 gene locus_tag LOCUS_05030 66987 67781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 67871 68662 gene locus_tag LOCUS_05040 67871 68662 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 protein_id gnl|my_center|LOCUS_05040 68669 69697 gene locus_tag LOCUS_05050 68669 69697 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870761.1 protein_id gnl|my_center|LOCUS_05050 69697 71118 gene locus_tag LOCUS_05060 gene aroE 69697 71118 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_05060 71115 71969 gene locus_tag LOCUS_05070 71115 71969 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870958.1 protein_id gnl|my_center|LOCUS_05070 71953 73209 gene locus_tag LOCUS_05080 gene aroA 71953 73209 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496517.1 protein_id gnl|my_center|LOCUS_05080 73206 74285 gene locus_tag LOCUS_05090 gene aroC 73206 74285 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878173.1 protein_id gnl|my_center|LOCUS_05090 74278 75345 gene locus_tag LOCUS_05100 gene tyrA 74278 75345 CDS product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257629.1 protein_id gnl|my_center|LOCUS_05100 75346 76407 gene locus_tag LOCUS_05110 gene asd 75346 76407 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_05110 76418 77587 gene locus_tag LOCUS_05120 76418 77587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 77587 77991 gene locus_tag LOCUS_05130 77587 77991 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876487.1 protein_id gnl|my_center|LOCUS_05130 77988 78701 gene locus_tag LOCUS_05140 77988 78701 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021719.1 protein_id gnl|my_center|LOCUS_05140 78740 80230 gene locus_tag LOCUS_05150 78740 80230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 80316 81221 gene locus_tag LOCUS_05160 gene hisG 80316 81221 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870716.1 protein_id gnl|my_center|LOCUS_05160 81221 82264 gene locus_tag LOCUS_05170 gene hisC 81221 82264 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496679.1 protein_id gnl|my_center|LOCUS_05170 82258 82923 gene locus_tag LOCUS_05180 gene hisH 82258 82923 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496519.1 protein_id gnl|my_center|LOCUS_05180 82920 83627 gene locus_tag LOCUS_05190 gene hisA 82920 83627 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871056.1 protein_id gnl|my_center|LOCUS_05190 83624 84172 gene locus_tag LOCUS_05200 gene hisB 83624 84172 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774805.1 protein_id gnl|my_center|LOCUS_05200 84173 84925 gene locus_tag LOCUS_05210 gene hisF 84173 84925 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_05210 84922 85533 gene locus_tag LOCUS_05220 gene hisIE 84922 85533 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131119.1 protein_id gnl|my_center|LOCUS_05220 85530 86183 gene locus_tag LOCUS_05230 85530 86183 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065077.1 protein_id gnl|my_center|LOCUS_05230 86180 86992 gene locus_tag LOCUS_05240 gene pheA 86180 86992 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_05240 87029 87577 gene locus_tag LOCUS_05250 87029 87577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 87807 88553 gene locus_tag LOCUS_05260 87807 88553 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_05260 91661 88775 gene locus_tag LOCUS_r00020 91661 88775 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 92155 92229 gene locus_tag LOCUS_t00110 92155 92229 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 92388 93566 gene locus_tag LOCUS_05270 92388 93566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 94664 94008 gene locus_tag LOCUS_05280 94664 94008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 95032 95991 gene locus_tag LOCUS_05290 gene xerC 95032 95991 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079116.1 protein_id gnl|my_center|LOCUS_05290 97976 96537 gene locus_tag LOCUS_05300 97976 96537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 98460 97963 gene locus_tag LOCUS_05310 98460 97963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 100111 98465 gene locus_tag LOCUS_05320 gene ilvD 100111 98465 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023301.1 protein_id gnl|my_center|LOCUS_05320 100535 100224 gene locus_tag LOCUS_05330 gene rpsJ 100535 100224 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878438.1 protein_id gnl|my_center|LOCUS_05330 101838 100573 gene locus_tag LOCUS_05340 gene tuf 101838 100573 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878437.1 protein_id gnl|my_center|LOCUS_05340 104114 101916 gene locus_tag LOCUS_05350 104114 101916 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060960.1 protein_id gnl|my_center|LOCUS_05350 104726 104130 gene locus_tag LOCUS_05360 gene rpsG 104726 104130 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879386.1 protein_id gnl|my_center|LOCUS_05360 105151 104723 gene locus_tag LOCUS_05370 105151 104723 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064744.1 protein_id gnl|my_center|LOCUS_05370 105874 105545 gene locus_tag LOCUS_05380 gene pth2 105874 105545 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146590.1 protein_id gnl|my_center|LOCUS_05380 105994 107952 gene locus_tag LOCUS_05390 gene tgtA 105994 107952 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060763.1 protein_id gnl|my_center|LOCUS_05390 108205 107972 gene locus_tag LOCUS_05400 108205 107972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 109418 108297 gene locus_tag LOCUS_05410 109418 108297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 109791 111122 gene locus_tag LOCUS_05420 gene cca 109791 111122 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876223.1 protein_id gnl|my_center|LOCUS_05420 111475 111119 gene locus_tag LOCUS_05430 111475 111119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 111691 111619 gene locus_tag LOCUS_t00120 111691 111619 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 111802 112830 gene locus_tag LOCUS_05440 gene bmpA 111802 112830 CDS product nucleoside ABC transporter substrate-binding protein BmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656850.1 protein_id gnl|my_center|LOCUS_05440 114024 112825 gene locus_tag LOCUS_05450 114024 112825 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868848.1 protein_id gnl|my_center|LOCUS_05450 115718 114081 gene locus_tag LOCUS_05460 gene pyrG 115718 114081 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023212.1 protein_id gnl|my_center|LOCUS_05460 117358 115898 gene locus_tag LOCUS_r00030 117358 115898 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 117530 117772 gene locus_tag LOCUS_05470 117530 117772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 118000 118084 gene locus_tag LOCUS_t00130 118000 118084 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 118138 118929 gene locus_tag LOCUS_05480 118138 118929 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023442.1 protein_id gnl|my_center|LOCUS_05480 119056 119129 gene locus_tag LOCUS_t00140 119056 119129 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 120296 119217 gene locus_tag LOCUS_05490 120296 119217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 121250 120315 gene locus_tag LOCUS_05500 121250 120315 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319540.1 protein_id gnl|my_center|LOCUS_05500 121736 121308 gene locus_tag LOCUS_05510 121736 121308 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867748.1 protein_id gnl|my_center|LOCUS_05510 121785 122597 gene locus_tag LOCUS_05520 121785 122597 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_05520 123036 122653 gene locus_tag LOCUS_05530 123036 122653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 123144 124244 gene locus_tag LOCUS_05540 123144 124244 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966073.1 protein_id gnl|my_center|LOCUS_05540 124708 124241 gene locus_tag LOCUS_05550 124708 124241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 125081 124710 gene locus_tag LOCUS_05560 125081 124710 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393092.1 protein_id gnl|my_center|LOCUS_05560 127266 125122 gene locus_tag LOCUS_05570 127266 125122 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_05570 128088 127348 gene locus_tag LOCUS_05580 128088 127348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 128157 128567 gene locus_tag LOCUS_05590 128157 128567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 129040 128594 gene locus_tag LOCUS_05600 129040 128594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 129675 129091 gene locus_tag LOCUS_05610 129675 129091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 129807 130649 gene locus_tag LOCUS_05620 129807 130649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 130741 132102 gene locus_tag LOCUS_05630 gene trkA 130741 132102 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021496.1 protein_id gnl|my_center|LOCUS_05630 132113 133696 gene locus_tag LOCUS_05640 132113 133696 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_05640 133746 134597 gene locus_tag LOCUS_05650 133746 134597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 134980 134594 gene locus_tag LOCUS_05660 gene nikR 134980 134594 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870053.1 protein_id gnl|my_center|LOCUS_05660 135551 134994 gene locus_tag LOCUS_05670 135551 134994 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020390.1 protein_id gnl|my_center|LOCUS_05670 135670 136734 gene locus_tag LOCUS_05680 135670 136734 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876249.1 protein_id gnl|my_center|LOCUS_05680 136744 137169 gene locus_tag LOCUS_05690 136744 137169 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871151.1 protein_id gnl|my_center|LOCUS_05690 138086 137181 gene locus_tag LOCUS_05700 gene purC 138086 137181 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582681.1 protein_id gnl|my_center|LOCUS_05700 138321 139364 gene locus_tag LOCUS_05710 138321 139364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 140020 139361 gene locus_tag LOCUS_05720 140020 139361 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250715.1 protein_id gnl|my_center|LOCUS_05720 140139 141134 gene locus_tag LOCUS_05730 140139 141134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 142055 141135 gene locus_tag LOCUS_05740 142055 141135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 142813 142055 gene locus_tag LOCUS_05750 142813 142055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 143729 142794 gene locus_tag LOCUS_05760 143729 142794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 144814 143729 gene locus_tag LOCUS_05770 144814 143729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 145989 144811 gene locus_tag LOCUS_05780 145989 144811 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030721.1 protein_id gnl|my_center|LOCUS_05780 147508 145991 gene locus_tag LOCUS_05790 147508 145991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 147866 148702 gene locus_tag LOCUS_05800 147866 148702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 148707 149879 gene locus_tag LOCUS_05810 148707 149879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 149876 151291 gene locus_tag LOCUS_05820 149876 151291 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_05820 151300 152469 gene locus_tag LOCUS_05830 151300 152469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 152466 153860 gene locus_tag LOCUS_05840 152466 153860 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_05840 153850 154959 gene locus_tag LOCUS_05850 153850 154959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 155423 154956 gene locus_tag LOCUS_05860 155423 154956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 155866 155420 gene locus_tag LOCUS_05870 155866 155420 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870045.1 protein_id gnl|my_center|LOCUS_05870 157975 155996 gene locus_tag LOCUS_05880 gene lonB 157975 155996 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877871.1 protein_id gnl|my_center|LOCUS_05880 158145 160340 gene locus_tag LOCUS_05890 158145 160340 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_05890 161539 160337 gene locus_tag LOCUS_05900 gene thrC 161539 160337 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_05900 162473 161541 gene locus_tag LOCUS_05910 162473 161541 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903313.1 protein_id gnl|my_center|LOCUS_05910 162631 163101 gene locus_tag LOCUS_05920 162631 163101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 163499 164452 gene locus_tag LOCUS_05930 163499 164452 CDS product DUF2776 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107457.1 protein_id gnl|my_center|LOCUS_05930 164917 164513 gene locus_tag LOCUS_05940 164917 164513 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496977.1 protein_id gnl|my_center|LOCUS_05940 166086 164917 gene locus_tag LOCUS_05950 166086 164917 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_05950 167141 166083 gene locus_tag LOCUS_05960 167141 166083 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871070.1 protein_id gnl|my_center|LOCUS_05960 167839 167156 gene locus_tag LOCUS_05970 167839 167156 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867812.1 protein_id gnl|my_center|LOCUS_05970 167961 168036 gene locus_tag LOCUS_t00150 167961 168036 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 168372 168154 gene locus_tag LOCUS_05980 168372 168154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 168442 168645 gene locus_tag LOCUS_05990 168442 168645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 169698 169285 gene locus_tag LOCUS_06000 169698 169285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 170809 169952 gene locus_tag LOCUS_06010 170809 169952 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065770.1 protein_id gnl|my_center|LOCUS_06010 171493 170822 gene locus_tag LOCUS_06020 171493 170822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 172412 171627 gene locus_tag LOCUS_06030 172412 171627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 173188 172409 gene locus_tag LOCUS_06040 173188 172409 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795042.1 protein_id gnl|my_center|LOCUS_06040 174184 173294 gene locus_tag LOCUS_06050 174184 173294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 174299 175372 gene locus_tag LOCUS_06060 174299 175372 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272563.1 protein_id gnl|my_center|LOCUS_06060 176683 175457 gene locus_tag LOCUS_06070 176683 175457 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024286.1 protein_id gnl|my_center|LOCUS_06070 177405 176659 gene locus_tag LOCUS_06080 177405 176659 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024285.1 protein_id gnl|my_center|LOCUS_06080 177640 178344 gene locus_tag LOCUS_06090 177640 178344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 179690 178320 gene locus_tag LOCUS_06100 179690 178320 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584110.1 protein_id gnl|my_center|LOCUS_06100 180252 179794 gene locus_tag LOCUS_06110 180252 179794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 180339 180692 gene locus_tag LOCUS_06120 180339 180692 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024126.1 protein_id gnl|my_center|LOCUS_06120 181283 180708 gene locus_tag LOCUS_06130 181283 180708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 181688 181317 gene locus_tag LOCUS_06140 181688 181317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 181630 181827 gene locus_tag LOCUS_06150 181630 181827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 181907 183298 gene locus_tag LOCUS_06160 181907 183298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 183295 184005 gene locus_tag LOCUS_06170 183295 184005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 184487 184666 gene locus_tag LOCUS_06180 184487 184666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 184740 185123 gene locus_tag LOCUS_06190 184740 185123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 185767 185492 gene locus_tag LOCUS_06200 185767 185492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 187434 185779 gene locus_tag LOCUS_06210 gene mcrA 187434 185779 CDS product coenzyme-B sulfoethylthiotransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870360.1 protein_id gnl|my_center|LOCUS_06210 188210 187437 gene locus_tag LOCUS_06220 gene mcrG 188210 187437 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870359.1 protein_id gnl|my_center|LOCUS_06220 188651 188223 gene locus_tag LOCUS_06230 188651 188223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 189978 188656 gene locus_tag LOCUS_06240 gene mcrB 189978 188656 CDS product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061283.1 protein_id gnl|my_center|LOCUS_06240 190861 190232 gene locus_tag LOCUS_06250 190861 190232 CDS product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 protein_id gnl|my_center|LOCUS_06250 192057 190858 gene locus_tag LOCUS_06260 192057 190858 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876618.1 protein_id gnl|my_center|LOCUS_06260 192096 192989 gene locus_tag LOCUS_06270 192096 192989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 193133 193744 gene locus_tag LOCUS_06280 193133 193744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 194305 193841 gene locus_tag LOCUS_06290 194305 193841 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794261.1 protein_id gnl|my_center|LOCUS_06290 194903 194643 gene locus_tag LOCUS_06300 194903 194643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 195007 195315 gene locus_tag LOCUS_06310 195007 195315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 197137 195500 gene locus_tag LOCUS_06320 197137 195500 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020208.1 protein_id gnl|my_center|LOCUS_06320 198242 197244 gene locus_tag LOCUS_06330 gene mtaA 198242 197244 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021625.1 protein_id gnl|my_center|LOCUS_06330 199071 198427 gene locus_tag LOCUS_06340 199071 198427 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_06340 200100 199375 gene locus_tag LOCUS_06350 200100 199375 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867960.1 protein_id gnl|my_center|LOCUS_06350 200185 200949 gene locus_tag LOCUS_06360 200185 200949 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545335.1 protein_id gnl|my_center|LOCUS_06360 200946 202424 gene locus_tag LOCUS_06370 200946 202424 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_06370 203322 202411 gene locus_tag LOCUS_06380 gene argF 203322 202411 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_06380 203494 204039 gene locus_tag LOCUS_06390 203494 204039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 205557 204274 gene locus_tag LOCUS_06400 205557 204274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 206909 205638 gene locus_tag LOCUS_06410 206909 205638 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173522.1 protein_id gnl|my_center|LOCUS_06410 207888 207046 gene locus_tag LOCUS_06420 207888 207046 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869263.1 protein_id gnl|my_center|LOCUS_06420 208235 207987 gene locus_tag LOCUS_06430 208235 207987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 210536 208887 gene locus_tag LOCUS_06440 210536 208887 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940324.1 protein_id gnl|my_center|LOCUS_06440 211112 210549 gene locus_tag LOCUS_06450 211112 210549 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940325.1 protein_id gnl|my_center|LOCUS_06450 211288 211854 gene locus_tag LOCUS_06460 211288 211854 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023860.1 protein_id gnl|my_center|LOCUS_06460 211847 212311 gene locus_tag LOCUS_06470 gene bcp 211847 212311 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_06470 212808 212326 gene locus_tag LOCUS_06480 212808 212326 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890655.1 protein_id gnl|my_center|LOCUS_06480 213048 213698 gene locus_tag LOCUS_06490 213048 213698 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870497.1 protein_id gnl|my_center|LOCUS_06490 213940 216048 gene locus_tag LOCUS_06500 213940 216048 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200796636.1 protein_id gnl|my_center|LOCUS_06500 216045 217355 gene locus_tag LOCUS_06510 216045 217355 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812417.1 protein_id gnl|my_center|LOCUS_06510 218157 217378 gene locus_tag LOCUS_06520 218157 217378 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_06520 219304 218162 gene locus_tag LOCUS_06530 219304 218162 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_06530 220653 219343 gene locus_tag LOCUS_06540 220653 219343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 222055 221198 gene locus_tag LOCUS_06550 222055 221198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 222133 222960 gene locus_tag LOCUS_06560 222133 222960 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541103.1 protein_id gnl|my_center|LOCUS_06560 222960 223298 gene locus_tag LOCUS_06570 222960 223298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 223409 224620 gene locus_tag LOCUS_06580 223409 224620 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_06580 224756 226708 gene locus_tag LOCUS_06590 224756 226708 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271940.1 protein_id gnl|my_center|LOCUS_06590 227515 227679 gene locus_tag LOCUS_06600 227515 227679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 228249 228431 gene locus_tag LOCUS_06610 228249 228431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 228530 228754 gene locus_tag LOCUS_06620 228530 228754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 228821 229303 gene locus_tag LOCUS_06630 228821 229303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06630 229856 230362 gene locus_tag LOCUS_06640 229856 230362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 232006 230573 gene locus_tag LOCUS_06650 232006 230573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 244118 232023 gene locus_tag LOCUS_06660 244118 232023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 <245594 244207 gene locus_tag LOCUS_06670 <245594 244207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015942796.1:InlB B-repeat-containing protein >Feature sequence03 429 1493 gene locus_tag LOCUS_06680 429 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 1490 2416 gene locus_tag LOCUS_06690 1490 2416 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876982.1 protein_id gnl|my_center|LOCUS_06690 2409 3182 gene locus_tag LOCUS_06700 2409 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 3285 3512 gene locus_tag LOCUS_06710 3285 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 4498 3608 gene locus_tag LOCUS_06720 4498 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 5139 4495 gene locus_tag LOCUS_06730 gene ureG 5139 4495 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261400.1 protein_id gnl|my_center|LOCUS_06730 5812 5150 gene locus_tag LOCUS_06740 5812 5150 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357404.1 protein_id gnl|my_center|LOCUS_06740 6251 5796 gene locus_tag LOCUS_06750 6251 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 8014 6299 gene locus_tag LOCUS_06760 gene ureC 8014 6299 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269033.1 protein_id gnl|my_center|LOCUS_06760 8454 8017 gene locus_tag LOCUS_06770 8454 8017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06770 8774 8451 gene locus_tag LOCUS_06780 8774 8451 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862556.1 protein_id gnl|my_center|LOCUS_06780 9271 8891 gene locus_tag LOCUS_06790 gene crcB 9271 8891 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172954.1 protein_id gnl|my_center|LOCUS_06790 9663 9268 gene locus_tag LOCUS_06800 gene crcB 9663 9268 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212238.1 protein_id gnl|my_center|LOCUS_06800 9894 12446 gene locus_tag LOCUS_06810 9894 12446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618669.1 protein_id gnl|my_center|LOCUS_06810 13743 12562 gene locus_tag LOCUS_06820 13743 12562 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762413.1 protein_id gnl|my_center|LOCUS_06820 16291 13763 gene locus_tag LOCUS_06830 gene gyrA 16291 13763 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947899.1 protein_id gnl|my_center|LOCUS_06830 18205 16304 gene locus_tag LOCUS_06840 gene gyrB 18205 16304 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021594.1 protein_id gnl|my_center|LOCUS_06840 18431 19705 gene locus_tag LOCUS_06850 gene thiC 18431 19705 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_06850 20068 19688 gene locus_tag LOCUS_06860 gene crcB 20068 19688 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212237.1 protein_id gnl|my_center|LOCUS_06860 20451 20065 gene locus_tag LOCUS_06870 gene crcB 20451 20065 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964895.1 protein_id gnl|my_center|LOCUS_06870 21681 20866 gene locus_tag LOCUS_06880 21681 20866 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_06880 22597 21911 gene locus_tag LOCUS_06890 22597 21911 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964066.1 protein_id gnl|my_center|LOCUS_06890 22818 23609 gene locus_tag LOCUS_06900 22818 23609 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_06900 23992 23606 gene locus_tag LOCUS_06910 23992 23606 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933225.1 protein_id gnl|my_center|LOCUS_06910 29418 24043 gene locus_tag LOCUS_06920 29418 24043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 29816 30655 gene locus_tag LOCUS_06930 29816 30655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 31427 30639 gene locus_tag LOCUS_06940 31427 30639 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250562.1 protein_id gnl|my_center|LOCUS_06940 32023 31475 gene locus_tag LOCUS_06950 32023 31475 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903666.1 protein_id gnl|my_center|LOCUS_06950 32260 32571 gene locus_tag LOCUS_06960 32260 32571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 33293 32577 gene locus_tag LOCUS_06970 33293 32577 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064947.1 protein_id gnl|my_center|LOCUS_06970 33383 34135 gene locus_tag LOCUS_06980 gene truA 33383 34135 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249878.1 protein_id gnl|my_center|LOCUS_06980 34152 34679 gene locus_tag LOCUS_06990 34152 34679 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879493.1 protein_id gnl|my_center|LOCUS_06990 34670 35308 gene locus_tag LOCUS_07000 34670 35308 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020322.1 protein_id gnl|my_center|LOCUS_07000 36341 35283 gene locus_tag LOCUS_07010 gene priL 36341 35283 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_07010 36933 36406 gene locus_tag LOCUS_07020 36933 36406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 37561 37055 gene locus_tag LOCUS_07030 37561 37055 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434976.1 protein_id gnl|my_center|LOCUS_07030 37652 39385 gene locus_tag LOCUS_07040 37652 39385 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544976.1 protein_id gnl|my_center|LOCUS_07040 39549 40451 gene locus_tag LOCUS_07050 39549 40451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006607.1 protein_id gnl|my_center|LOCUS_07050 40454 41206 gene locus_tag LOCUS_07060 40454 41206 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_07060 41348 42052 gene locus_tag LOCUS_07070 41348 42052 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703462.1 protein_id gnl|my_center|LOCUS_07070 43379 42057 gene locus_tag LOCUS_07080 gene acsC 43379 42057 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545537.1 protein_id gnl|my_center|LOCUS_07080 44278 43382 gene locus_tag LOCUS_07090 44278 43382 CDS product acetyl-CoA decarbonylase/synthase complex subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944232.1 protein_id gnl|my_center|LOCUS_07090 46432 44297 gene locus_tag LOCUS_07100 gene acsB 46432 44297 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392716.1 protein_id gnl|my_center|LOCUS_07100 47453 46527 gene locus_tag LOCUS_07110 47453 46527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 48253 47585 gene locus_tag LOCUS_07120 48253 47585 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_07120 48757 48320 gene locus_tag LOCUS_07130 48757 48320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 49584 49132 gene locus_tag LOCUS_07140 gene ndk 49584 49132 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056122.1 protein_id gnl|my_center|LOCUS_07140 50006 49590 gene locus_tag LOCUS_07150 50006 49590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 50235 50017 gene locus_tag LOCUS_07160 50235 50017 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878268.1 protein_id gnl|my_center|LOCUS_07160 50620 50249 gene locus_tag LOCUS_07170 gene rpl7ae 50620 50249 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053845.1 protein_id gnl|my_center|LOCUS_07170 50840 51001 gene locus_tag LOCUS_07180 50840 51001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 51013 51555 gene locus_tag LOCUS_07190 51013 51555 CDS product DUF531 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868567.1 protein_id gnl|my_center|LOCUS_07190 52592 51564 gene locus_tag LOCUS_07200 gene purM 52592 51564 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879189.1 protein_id gnl|my_center|LOCUS_07200 52703 53569 gene locus_tag LOCUS_07210 52703 53569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 54152 53571 gene locus_tag LOCUS_07220 54152 53571 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240327.1 protein_id gnl|my_center|LOCUS_07220 54934 54149 gene locus_tag LOCUS_07230 54934 54149 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870811.1 protein_id gnl|my_center|LOCUS_07230 55119 55847 gene locus_tag LOCUS_07240 55119 55847 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868711.1 protein_id gnl|my_center|LOCUS_07240 56862 55834 gene locus_tag LOCUS_07250 56862 55834 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296895.1 protein_id gnl|my_center|LOCUS_07250 57273 56980 gene locus_tag LOCUS_07260 57273 56980 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868107.1 protein_id gnl|my_center|LOCUS_07260 60455 57282 gene locus_tag LOCUS_07270 60455 57282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 61035 60511 gene locus_tag LOCUS_07280 61035 60511 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_07280 61185 62417 gene locus_tag LOCUS_07290 61185 62417 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878404.1 protein_id gnl|my_center|LOCUS_07290 63970 62414 gene locus_tag LOCUS_07300 63970 62414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 64393 63974 gene locus_tag LOCUS_07310 gene pfdA 64393 63974 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249956.1 protein_id gnl|my_center|LOCUS_07310 64623 64390 gene locus_tag LOCUS_07320 64623 64390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 64877 65566 gene locus_tag LOCUS_07330 64877 65566 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436928.1 protein_id gnl|my_center|LOCUS_07330 66538 65558 gene locus_tag LOCUS_07340 gene priS 66538 65558 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020695.1 protein_id gnl|my_center|LOCUS_07340 67862 66813 gene locus_tag LOCUS_07350 67862 66813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 68025 68903 gene locus_tag LOCUS_07360 gene htpX 68025 68903 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360263.1 protein_id gnl|my_center|LOCUS_07360 70212 68950 gene locus_tag LOCUS_07370 70212 68950 CDS product bifunctional hexulose-6-phosphate synthase/ribonuclease regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878362.1 protein_id gnl|my_center|LOCUS_07370 70405 70629 gene locus_tag LOCUS_07380 70405 70629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 71978 70800 gene locus_tag LOCUS_07390 71978 70800 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_07390 73438 72146 gene locus_tag LOCUS_07400 73438 72146 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496722.1 protein_id gnl|my_center|LOCUS_07400 73466 74092 gene locus_tag LOCUS_07410 73466 74092 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061290.1 protein_id gnl|my_center|LOCUS_07410 74410 74087 gene locus_tag LOCUS_07420 74410 74087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 76323 74464 gene locus_tag LOCUS_07430 gene gatE 76323 74464 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249862.1 protein_id gnl|my_center|LOCUS_07430 77638 76316 gene locus_tag LOCUS_07440 gene gatD 77638 76316 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 protein_id gnl|my_center|LOCUS_07440 77706 79028 gene locus_tag LOCUS_07450 gene purD 77706 79028 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868755.1 protein_id gnl|my_center|LOCUS_07450 79142 79762 gene locus_tag LOCUS_07460 79142 79762 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020150.1 protein_id gnl|my_center|LOCUS_07460 80082 79759 gene locus_tag LOCUS_07470 gene trxA 80082 79759 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_07470 80918 80172 gene locus_tag LOCUS_07480 80918 80172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 86974 80933 gene locus_tag LOCUS_07490 86974 80933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 88045 87398 gene locus_tag LOCUS_07500 gene pyrF 88045 87398 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065013.1 protein_id gnl|my_center|LOCUS_07500 88134 89189 gene locus_tag LOCUS_07510 88134 89189 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023617.1 protein_id gnl|my_center|LOCUS_07510 89604 89176 gene locus_tag LOCUS_07520 89604 89176 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978223.1 protein_id gnl|my_center|LOCUS_07520 89889 89611 gene locus_tag LOCUS_07530 89889 89611 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870557.1 protein_id gnl|my_center|LOCUS_07530 91337 89886 gene locus_tag LOCUS_07540 gene rpoA2 91337 89886 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066196.1 protein_id gnl|my_center|LOCUS_07540 94132 91337 gene locus_tag LOCUS_07550 gene rpoA1 94132 91337 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876677.1 protein_id gnl|my_center|LOCUS_07550 97728 94129 gene locus_tag LOCUS_07560 97728 94129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 98004 97735 gene locus_tag LOCUS_07570 98004 97735 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876674.1 protein_id gnl|my_center|LOCUS_07570 98756 99022 gene locus_tag LOCUS_07580 98756 99022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 99358 99068 gene locus_tag LOCUS_07590 99358 99068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 100920 99577 gene locus_tag LOCUS_07600 100920 99577 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064444.1 protein_id gnl|my_center|LOCUS_07600 101062 102660 gene locus_tag LOCUS_07610 101062 102660 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867223.1 protein_id gnl|my_center|LOCUS_07610 103241 104482 gene locus_tag LOCUS_07620 103241 104482 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064787.1 protein_id gnl|my_center|LOCUS_07620 105279 104479 gene locus_tag LOCUS_07630 105279 104479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 105419 105841 gene locus_tag LOCUS_07640 105419 105841 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421374.1 protein_id gnl|my_center|LOCUS_07640 106053 106397 gene locus_tag LOCUS_07650 106053 106397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 106372 108411 gene locus_tag LOCUS_07660 106372 108411 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589509.1 protein_id gnl|my_center|LOCUS_07660 108414 108635 gene locus_tag LOCUS_07670 108414 108635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 108650 109207 gene locus_tag LOCUS_07680 108650 109207 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024043.1 protein_id gnl|my_center|LOCUS_07680 109225 110292 gene locus_tag LOCUS_07690 109225 110292 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024044.1 protein_id gnl|my_center|LOCUS_07690 110292 110597 gene locus_tag LOCUS_07700 110292 110597 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024045.1 protein_id gnl|my_center|LOCUS_07700 110599 112338 gene locus_tag LOCUS_07710 110599 112338 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024046.1 protein_id gnl|my_center|LOCUS_07710 112335 113726 gene locus_tag LOCUS_07720 112335 113726 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024047.1 protein_id gnl|my_center|LOCUS_07720 113729 114364 gene locus_tag LOCUS_07730 113729 114364 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024048.1 protein_id gnl|my_center|LOCUS_07730 114591 115841 gene locus_tag LOCUS_07740 114591 115841 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289743.1 protein_id gnl|my_center|LOCUS_07740 116002 116640 gene locus_tag LOCUS_07750 116002 116640 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024156.1 protein_id gnl|my_center|LOCUS_07750 116651 117649 gene locus_tag LOCUS_07760 116651 117649 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250367.1 protein_id gnl|my_center|LOCUS_07760 117670 117978 gene locus_tag LOCUS_07770 gene rpl12p 117670 117978 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868901.1 protein_id gnl|my_center|LOCUS_07770 119303 118080 gene locus_tag LOCUS_07780 119303 118080 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_07780 119614 119456 gene locus_tag LOCUS_07790 119614 119456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 121743 119611 gene locus_tag LOCUS_07800 gene feoB 121743 119611 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_07800 122014 121793 gene locus_tag LOCUS_07810 122014 121793 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360987.1 protein_id gnl|my_center|LOCUS_07810 122244 122011 gene locus_tag LOCUS_07820 122244 122011 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_07820 122454 123086 gene locus_tag LOCUS_07830 122454 123086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 123083 123697 gene locus_tag LOCUS_07840 123083 123697 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020634.1 protein_id gnl|my_center|LOCUS_07840 124158 125159 gene locus_tag LOCUS_07850 124158 125159 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693372.1 protein_id gnl|my_center|LOCUS_07850 127990 125258 gene locus_tag LOCUS_07860 127990 125258 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 protein_id gnl|my_center|LOCUS_07860 129964 128060 gene locus_tag LOCUS_07870 129964 128060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 130533 129973 gene locus_tag LOCUS_07880 130533 129973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 133904 130530 gene locus_tag LOCUS_07890 133904 130530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 134298 134041 gene locus_tag LOCUS_07900 134298 134041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 136100 134454 gene locus_tag LOCUS_07910 136100 134454 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894984.1 protein_id gnl|my_center|LOCUS_07910 136549 136184 gene locus_tag LOCUS_07920 136549 136184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 136814 138463 gene locus_tag LOCUS_07930 136814 138463 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_07930 139253 138447 gene locus_tag LOCUS_07940 139253 138447 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064968.1 protein_id gnl|my_center|LOCUS_07940 139332 140333 gene locus_tag LOCUS_07950 139332 140333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 140330 141409 gene locus_tag LOCUS_07960 140330 141409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07960 141402 141794 gene locus_tag LOCUS_07970 141402 141794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07970 141791 142492 gene locus_tag LOCUS_07980 141791 142492 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_07980 142489 143385 gene locus_tag LOCUS_07990 142489 143385 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_07990 144158 143382 gene locus_tag LOCUS_08000 144158 143382 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944231.1 protein_id gnl|my_center|LOCUS_08000 144378 144677 gene locus_tag LOCUS_08010 144378 144677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 145908 144700 gene locus_tag LOCUS_08020 145908 144700 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_08020 146075 146644 gene locus_tag LOCUS_08030 146075 146644 CDS product DUF6434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247875.1 protein_id gnl|my_center|LOCUS_08030 147544 146984 gene locus_tag LOCUS_08040 gene satP 147544 146984 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209246.1 protein_id gnl|my_center|LOCUS_08040 147797 149353 gene locus_tag LOCUS_08050 gene purH 147797 149353 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745439.1 protein_id gnl|my_center|LOCUS_08050 149401 150282 gene locus_tag LOCUS_08060 149401 150282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 150506 151879 gene locus_tag LOCUS_08070 gene ppcA 150506 151879 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060929.1 protein_id gnl|my_center|LOCUS_08070 151955 152992 gene locus_tag LOCUS_08080 151955 152992 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485794.1 protein_id gnl|my_center|LOCUS_08080 153443 153147 gene locus_tag LOCUS_08090 153443 153147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 154318 153407 gene locus_tag LOCUS_08100 154318 153407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 155436 154684 gene locus_tag LOCUS_08110 155436 154684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 156335 159013 gene locus_tag LOCUS_08120 156335 159013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 160103 159036 gene locus_tag LOCUS_08130 160103 159036 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023661.1 protein_id gnl|my_center|LOCUS_08130 160249 161358 gene locus_tag LOCUS_08140 160249 161358 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763226.1 protein_id gnl|my_center|LOCUS_08140 161398 162330 gene locus_tag LOCUS_08150 161398 162330 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791450.1 protein_id gnl|my_center|LOCUS_08150 162372 162872 gene locus_tag LOCUS_08160 162372 162872 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545398.1 protein_id gnl|my_center|LOCUS_08160 163271 164488 gene locus_tag LOCUS_08170 163271 164488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 164553 165167 gene locus_tag LOCUS_08180 164553 165167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 165169 165813 gene locus_tag LOCUS_08190 165169 165813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence04 67 201 gene locus_tag LOCUS_08200 67 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 198 440 gene locus_tag LOCUS_08210 198 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 427 579 gene locus_tag LOCUS_08220 427 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 1355 11758 gene locus_tag LOCUS_08230 1355 11758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 11821 11896 gene locus_tag LOCUS_t00160 11821 11896 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11975 13435 gene locus_tag LOCUS_08240 gene glpA 11975 13435 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098019.1 protein_id gnl|my_center|LOCUS_08240 13438 14439 gene locus_tag LOCUS_08250 13438 14439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 14436 15413 gene locus_tag LOCUS_08260 14436 15413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 15829 15978 gene locus_tag LOCUS_08270 15829 15978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 16074 17240 gene locus_tag LOCUS_08280 16074 17240 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022961.1 protein_id gnl|my_center|LOCUS_08280 17240 19033 gene locus_tag LOCUS_08290 gene glmS 17240 19033 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_08290 19836 19030 gene locus_tag LOCUS_08300 19836 19030 CDS product C15orf41 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065051.1 protein_id gnl|my_center|LOCUS_08300 20059 20547 gene locus_tag LOCUS_08310 20059 20547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 20563 20853 gene locus_tag LOCUS_08320 20563 20853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816325.1 protein_id gnl|my_center|LOCUS_08320 22005 20956 gene locus_tag LOCUS_08330 22005 20956 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846716.1 protein_id gnl|my_center|LOCUS_08330 22550 22239 gene locus_tag LOCUS_08340 22550 22239 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396712.1 protein_id gnl|my_center|LOCUS_08340 22818 22531 gene locus_tag LOCUS_08350 22818 22531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 25012 22766 gene locus_tag LOCUS_08360 25012 22766 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_08360 25628 25347 gene locus_tag LOCUS_08370 25628 25347 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868081.1 protein_id gnl|my_center|LOCUS_08370 26978 25629 gene locus_tag LOCUS_08380 26978 25629 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496570.1 protein_id gnl|my_center|LOCUS_08380 27143 28078 gene locus_tag LOCUS_08390 27143 28078 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066004.1 protein_id gnl|my_center|LOCUS_08390 28071 28316 gene locus_tag LOCUS_08400 28071 28316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 28937 28335 gene locus_tag LOCUS_08410 28937 28335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 29152 29472 gene locus_tag LOCUS_08420 29152 29472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 29761 30759 gene locus_tag LOCUS_08430 gene rpl3p 29761 30759 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879418.1 protein_id gnl|my_center|LOCUS_08430 30765 31529 gene locus_tag LOCUS_08440 gene rpl4p 30765 31529 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021102.1 protein_id gnl|my_center|LOCUS_08440 31532 31813 gene locus_tag LOCUS_08450 31532 31813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 31822 32520 gene locus_tag LOCUS_08460 31822 32520 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875647.1 protein_id gnl|my_center|LOCUS_08460 32525 32989 gene locus_tag LOCUS_08470 gene rpsS 32525 32989 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869675.1 protein_id gnl|my_center|LOCUS_08470 33000 33446 gene locus_tag LOCUS_08480 gene rplV 33000 33446 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250488.1 protein_id gnl|my_center|LOCUS_08480 33443 34240 gene locus_tag LOCUS_08490 33443 34240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 34240 34443 gene locus_tag LOCUS_08500 gene rpmC 34240 34443 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903241.1 protein_id gnl|my_center|LOCUS_08500 34443 34742 gene locus_tag LOCUS_08510 gene yciH 34443 34742 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875652.1 protein_id gnl|my_center|LOCUS_08510 34739 34999 gene locus_tag LOCUS_08520 34739 34999 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875653.1 protein_id gnl|my_center|LOCUS_08520 35005 35334 gene locus_tag LOCUS_08530 35005 35334 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011696863.1 protein_id gnl|my_center|LOCUS_08530 35340 35738 gene locus_tag LOCUS_08540 gene rpl14p 35340 35738 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021111.1 protein_id gnl|my_center|LOCUS_08540 35748 36122 gene locus_tag LOCUS_08550 35748 36122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 36119 36829 gene locus_tag LOCUS_08560 36119 36829 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875657.1 protein_id gnl|my_center|LOCUS_08560 36826 37341 gene locus_tag LOCUS_08570 36826 37341 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013673.1 protein_id gnl|my_center|LOCUS_08570 37338 37484 gene locus_tag LOCUS_08580 37338 37484 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879404.1 protein_id gnl|my_center|LOCUS_08580 37495 37884 gene locus_tag LOCUS_08590 37495 37884 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869971.1 protein_id gnl|my_center|LOCUS_08590 37894 38448 gene locus_tag LOCUS_08600 37894 38448 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869972.1 protein_id gnl|my_center|LOCUS_08600 38445 38927 gene locus_tag LOCUS_08610 38445 38927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 38930 39388 gene locus_tag LOCUS_08620 38930 39388 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021119.1 protein_id gnl|my_center|LOCUS_08620 39389 39889 gene locus_tag LOCUS_08630 39389 39889 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869975.1 protein_id gnl|my_center|LOCUS_08630 39891 40580 gene locus_tag LOCUS_08640 gene rpsE 39891 40580 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879398.1 protein_id gnl|my_center|LOCUS_08640 40586 41050 gene locus_tag LOCUS_08650 gene rpmD 40586 41050 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875666.1 protein_id gnl|my_center|LOCUS_08650 41061 41489 gene locus_tag LOCUS_08660 41061 41489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 41743 43083 gene locus_tag LOCUS_08670 gene secY 41743 43083 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021124.1 protein_id gnl|my_center|LOCUS_08670 43080 43790 gene locus_tag LOCUS_08680 43080 43790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 43787 44311 gene locus_tag LOCUS_08690 43787 44311 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021132.1 protein_id gnl|my_center|LOCUS_08690 44314 45270 gene locus_tag LOCUS_08700 44314 45270 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869643.1 protein_id gnl|my_center|LOCUS_08700 45671 46300 gene locus_tag LOCUS_08710 45671 46300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 46302 47387 gene locus_tag LOCUS_08720 46302 47387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 47437 47751 gene locus_tag LOCUS_08730 47437 47751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 47759 49768 gene locus_tag LOCUS_08740 47759 49768 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271940.1 protein_id gnl|my_center|LOCUS_08740 50176 49844 gene locus_tag LOCUS_08750 50176 49844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 51381 50218 gene locus_tag LOCUS_08760 51381 50218 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388134.1 protein_id gnl|my_center|LOCUS_08760 51811 51455 gene locus_tag LOCUS_08770 51811 51455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 51854 52447 gene locus_tag LOCUS_08780 gene hpt 51854 52447 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061024.1 protein_id gnl|my_center|LOCUS_08780 52447 52956 gene locus_tag LOCUS_08790 52447 52956 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963592.1 protein_id gnl|my_center|LOCUS_08790 52992 53984 gene locus_tag LOCUS_08800 52992 53984 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879847.1 protein_id gnl|my_center|LOCUS_08800 54644 53985 gene locus_tag LOCUS_08810 54644 53985 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867371.1 protein_id gnl|my_center|LOCUS_08810 55645 54677 gene locus_tag LOCUS_08820 55645 54677 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023750.1 protein_id gnl|my_center|LOCUS_08820 56091 55726 gene locus_tag LOCUS_08830 56091 55726 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878647.1 protein_id gnl|my_center|LOCUS_08830 56326 56093 gene locus_tag LOCUS_08840 56326 56093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 56760 56470 gene locus_tag LOCUS_08850 56760 56470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 57536 56766 gene locus_tag LOCUS_08860 gene rrp42 57536 56766 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250584.1 protein_id gnl|my_center|LOCUS_08860 58324 57536 gene locus_tag LOCUS_08870 gene rrp41 58324 57536 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250585.1 protein_id gnl|my_center|LOCUS_08870 59032 58334 gene locus_tag LOCUS_08880 gene rrp4 59032 58334 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021780.1 protein_id gnl|my_center|LOCUS_08880 59787 59083 gene locus_tag LOCUS_08890 59787 59083 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876324.1 protein_id gnl|my_center|LOCUS_08890 60522 59800 gene locus_tag LOCUS_08900 gene psmA 60522 59800 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_08900 60864 60607 gene locus_tag LOCUS_08910 60864 60607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 60863 61129 gene locus_tag LOCUS_08920 60863 61129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 61461 64484 gene locus_tag LOCUS_08930 61461 64484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 64487 64963 gene locus_tag LOCUS_08940 64487 64963 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876760.1 protein_id gnl|my_center|LOCUS_08940 64981 65991 gene locus_tag LOCUS_08950 64981 65991 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_08950 65988 67502 gene locus_tag LOCUS_08960 65988 67502 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_08960 68423 67629 gene locus_tag LOCUS_08970 68423 67629 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 protein_id gnl|my_center|LOCUS_08970 69883 68471 gene locus_tag LOCUS_08980 69883 68471 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878354.1 protein_id gnl|my_center|LOCUS_08980 70100 70384 gene locus_tag LOCUS_08990 70100 70384 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869817.1 protein_id gnl|my_center|LOCUS_08990 70415 71005 gene locus_tag LOCUS_09000 70415 71005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 71191 71832 gene locus_tag LOCUS_09010 71191 71832 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_09010 71925 73436 gene locus_tag LOCUS_09020 71925 73436 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_09020 74239 73508 gene locus_tag LOCUS_09030 74239 73508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 74366 74749 gene locus_tag LOCUS_09040 74366 74749 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870178.1 protein_id gnl|my_center|LOCUS_09040 74830 75123 gene locus_tag LOCUS_09050 74830 75123 CDS product signal recognition particle subunit SRP19/SEC65 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875804.1 protein_id gnl|my_center|LOCUS_09050 75539 75895 gene locus_tag LOCUS_09060 75539 75895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 76407 76015 gene locus_tag LOCUS_09070 76407 76015 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814175.1 protein_id gnl|my_center|LOCUS_09070 77277 76531 gene locus_tag LOCUS_09080 77277 76531 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_09080 77756 77274 gene locus_tag LOCUS_09090 77756 77274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 77912 78682 gene locus_tag LOCUS_09100 77912 78682 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027793.1 protein_id gnl|my_center|LOCUS_09100 78712 78796 gene locus_tag LOCUS_t00170 78712 78796 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 78874 79368 gene locus_tag LOCUS_09110 78874 79368 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065441.1 protein_id gnl|my_center|LOCUS_09110 79365 80363 gene locus_tag LOCUS_09120 79365 80363 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878435.1 protein_id gnl|my_center|LOCUS_09120 80377 81945 gene locus_tag LOCUS_09130 gene cimA 80377 81945 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880180.1 protein_id gnl|my_center|LOCUS_09130 82200 82012 gene locus_tag LOCUS_09140 82200 82012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 82485 82255 gene locus_tag LOCUS_09150 82485 82255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 82397 83473 gene locus_tag LOCUS_09160 82397 83473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 83579 84382 gene locus_tag LOCUS_09170 83579 84382 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061092.1 protein_id gnl|my_center|LOCUS_09170 84661 85287 gene locus_tag LOCUS_09180 84661 85287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 85308 85718 gene locus_tag LOCUS_09190 85308 85718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 86013 87080 gene locus_tag LOCUS_09200 86013 87080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 87090 87536 gene locus_tag LOCUS_09210 87090 87536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 87616 88986 gene locus_tag LOCUS_09220 87616 88986 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065079778.1 protein_id gnl|my_center|LOCUS_09220 89306 89001 gene locus_tag LOCUS_09230 89306 89001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 89460 90083 gene locus_tag LOCUS_09240 89460 90083 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390042.1 protein_id gnl|my_center|LOCUS_09240 90209 93511 gene locus_tag LOCUS_09250 90209 93511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 93555 95015 gene locus_tag LOCUS_09260 93555 95015 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546536.1 protein_id gnl|my_center|LOCUS_09260 95109 95546 gene locus_tag LOCUS_09270 95109 95546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 95895 95527 gene locus_tag LOCUS_09280 95895 95527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 96398 96012 gene locus_tag LOCUS_09290 96398 96012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 97588 96380 gene locus_tag LOCUS_09300 97588 96380 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_09300 98027 97710 gene locus_tag LOCUS_09310 98027 97710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 98179 98520 gene locus_tag LOCUS_09320 98179 98520 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148208718.1 protein_id gnl|my_center|LOCUS_09320 99605 98511 gene locus_tag LOCUS_09330 99605 98511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 100077 99691 gene locus_tag LOCUS_09340 100077 99691 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048271.1 protein_id gnl|my_center|LOCUS_09340 100672 100082 gene locus_tag LOCUS_09350 100672 100082 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496605.1 protein_id gnl|my_center|LOCUS_09350 101666 100716 gene locus_tag LOCUS_09360 101666 100716 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765594.1 protein_id gnl|my_center|LOCUS_09360 101769 103220 gene locus_tag LOCUS_09370 101769 103220 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979012.1 protein_id gnl|my_center|LOCUS_09370 103251 103832 gene locus_tag LOCUS_09380 103251 103832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 104293 103829 gene locus_tag LOCUS_09390 104293 103829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 104592 104912 gene locus_tag LOCUS_09400 104592 104912 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812671.1 protein_id gnl|my_center|LOCUS_09400 105055 106629 gene locus_tag LOCUS_09410 105055 106629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 106786 108543 gene locus_tag LOCUS_09420 106786 108543 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762861.1 protein_id gnl|my_center|LOCUS_09420 108596 108871 gene locus_tag LOCUS_09430 108596 108871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 108872 110176 gene locus_tag LOCUS_09440 gene truD 108872 110176 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_09440 114619 110180 gene locus_tag LOCUS_09450 114619 110180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 115340 115413 gene locus_tag LOCUS_t00180 115340 115413 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 116549 115434 gene locus_tag LOCUS_09460 116549 115434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 116807 117127 gene locus_tag LOCUS_09470 116807 117127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 117540 117136 gene locus_tag LOCUS_09480 117540 117136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 117963 118943 gene locus_tag LOCUS_09490 117963 118943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 119108 119031 gene locus_tag LOCUS_t00190 119108 119031 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 120085 119153 gene locus_tag LOCUS_09500 120085 119153 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_09500 120708 120151 gene locus_tag LOCUS_09510 120708 120151 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251061.1 protein_id gnl|my_center|LOCUS_09510 121268 120705 gene locus_tag LOCUS_09520 121268 120705 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249630.1 protein_id gnl|my_center|LOCUS_09520 121363 122067 gene locus_tag LOCUS_09530 gene radB 121363 122067 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320585.1 protein_id gnl|my_center|LOCUS_09530 123053 122064 gene locus_tag LOCUS_09540 123053 122064 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496935.1 protein_id gnl|my_center|LOCUS_09540 124114 123056 gene locus_tag LOCUS_09550 gene fni 124114 123056 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904022.1 protein_id gnl|my_center|LOCUS_09550 124877 124101 gene locus_tag LOCUS_09560 124877 124101 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875687.1 protein_id gnl|my_center|LOCUS_09560 125062 124964 gene locus_tag LOCUS_r00040 125062 124964 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 125751 125068 gene locus_tag LOCUS_09570 125751 125068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 126131 125841 gene locus_tag LOCUS_09580 126131 125841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 126657 126124 gene locus_tag LOCUS_09590 126657 126124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 127112 126657 gene locus_tag LOCUS_09600 gene pyrI 127112 126657 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060913.1 protein_id gnl|my_center|LOCUS_09600 128047 127109 gene locus_tag LOCUS_09610 gene pyrB 128047 127109 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_09610 128177 129787 gene locus_tag LOCUS_09620 gene arcS 128177 129787 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024500.1 protein_id gnl|my_center|LOCUS_09620 129989 130468 gene locus_tag LOCUS_09630 129989 130468 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_09630 131146 130469 gene locus_tag LOCUS_09640 131146 130469 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876071.1 protein_id gnl|my_center|LOCUS_09640 131394 132104 gene locus_tag LOCUS_09650 131394 132104 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942367.1 protein_id gnl|my_center|LOCUS_09650 132097 132774 gene locus_tag LOCUS_09660 gene rpiA 132097 132774 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364539.1 protein_id gnl|my_center|LOCUS_09660 133139 132768 gene locus_tag LOCUS_09670 133139 132768 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064265.1 protein_id gnl|my_center|LOCUS_09670 134001 134279 gene locus_tag LOCUS_09680 134001 134279 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868833.1 protein_id gnl|my_center|LOCUS_09680 134285 134464 gene locus_tag LOCUS_09690 134285 134464 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147173.1 protein_id gnl|my_center|LOCUS_09690 134467 135252 gene locus_tag LOCUS_09700 134467 135252 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061020.1 protein_id gnl|my_center|LOCUS_09700 135430 136197 gene locus_tag LOCUS_09710 135430 136197 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 protein_id gnl|my_center|LOCUS_09710 137032 136250 gene locus_tag LOCUS_09720 137032 136250 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065416.1 protein_id gnl|my_center|LOCUS_09720 137840 137025 gene locus_tag LOCUS_09730 137840 137025 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065008.1 protein_id gnl|my_center|LOCUS_09730 138952 137837 gene locus_tag LOCUS_09740 138952 137837 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020989.1 protein_id gnl|my_center|LOCUS_09740 140291 139002 gene locus_tag LOCUS_09750 140291 139002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 140657 142096 gene locus_tag LOCUS_09760 gene cls 140657 142096 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457116.1 protein_id gnl|my_center|LOCUS_09760 142980 142105 gene locus_tag LOCUS_09770 142980 142105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 143171 143749 gene locus_tag LOCUS_09780 143171 143749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 144253 143807 gene locus_tag LOCUS_09790 144253 143807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 145908 144346 gene locus_tag LOCUS_09800 145908 144346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 146140 147489 gene locus_tag LOCUS_09810 146140 147489 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015873.1 protein_id gnl|my_center|LOCUS_09810 147517 149397 gene locus_tag LOCUS_09820 147517 149397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 149435 149752 gene locus_tag LOCUS_09830 149435 149752 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939281.1 protein_id gnl|my_center|LOCUS_09830 149754 151178 gene locus_tag LOCUS_09840 149754 151178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 151184 152350 gene locus_tag LOCUS_09850 151184 152350 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222163.1 protein_id gnl|my_center|LOCUS_09850 152355 154805 gene locus_tag LOCUS_09860 152355 154805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 154810 156531 gene locus_tag LOCUS_09870 154810 156531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 157602 157150 gene locus_tag LOCUS_09880 157602 157150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 159031 157742 gene locus_tag LOCUS_09890 159031 157742 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_09890 159244 160110 gene locus_tag LOCUS_09900 159244 160110 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868837.1 protein_id gnl|my_center|LOCUS_09900 160221 160814 gene locus_tag LOCUS_09910 160221 160814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 160814 161233 gene locus_tag LOCUS_09920 160814 161233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 161235 162869 gene locus_tag LOCUS_09930 161235 162869 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020208.1 protein_id gnl|my_center|LOCUS_09930 162919 163254 gene locus_tag LOCUS_09940 162919 163254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 163310 163690 gene locus_tag LOCUS_09950 163310 163690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence05 145 1344 gene locus_tag LOCUS_09960 gene coaBC 145 1344 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867837.1 protein_id gnl|my_center|LOCUS_09960 1341 2195 gene locus_tag LOCUS_09970 1341 2195 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066198.1 protein_id gnl|my_center|LOCUS_09970 2469 2179 gene locus_tag LOCUS_09980 2469 2179 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868148.1 protein_id gnl|my_center|LOCUS_09980 3934 2453 gene locus_tag LOCUS_09990 3934 2453 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878560.1 protein_id gnl|my_center|LOCUS_09990 4053 4904 gene locus_tag LOCUS_10000 4053 4904 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868818.1 protein_id gnl|my_center|LOCUS_10000 4907 6313 gene locus_tag LOCUS_10010 gene proS 4907 6313 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249505.1 protein_id gnl|my_center|LOCUS_10010 6361 7350 gene locus_tag LOCUS_10020 6361 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 7739 7524 gene locus_tag LOCUS_10030 7739 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 7914 8726 gene locus_tag LOCUS_10040 7914 8726 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250279.1 protein_id gnl|my_center|LOCUS_10040 8773 9012 gene locus_tag LOCUS_10050 gene purS 8773 9012 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879434.1 protein_id gnl|my_center|LOCUS_10050 9021 11333 gene locus_tag LOCUS_10060 gene purL 9021 11333 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879433.1 protein_id gnl|my_center|LOCUS_10060 11339 12175 gene locus_tag LOCUS_10070 gene purQ 11339 12175 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878755.1 protein_id gnl|my_center|LOCUS_10070 12841 12182 gene locus_tag LOCUS_10080 12841 12182 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169713.1 protein_id gnl|my_center|LOCUS_10080 13721 12963 gene locus_tag LOCUS_10090 13721 12963 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 protein_id gnl|my_center|LOCUS_10090 13850 14017 gene locus_tag LOCUS_10100 13850 14017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 14088 14303 gene locus_tag LOCUS_10110 14088 14303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 15697 15284 gene locus_tag LOCUS_10120 15697 15284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 16038 15697 gene locus_tag LOCUS_10130 16038 15697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 16406 16657 gene locus_tag LOCUS_10140 16406 16657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 16864 17142 gene locus_tag LOCUS_10150 16864 17142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 17591 17307 gene locus_tag LOCUS_10160 17591 17307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 17820 17581 gene locus_tag LOCUS_10170 17820 17581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 19228 18233 gene locus_tag LOCUS_10180 19228 18233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 19687 19502 gene locus_tag LOCUS_10190 19687 19502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 19870 20232 gene locus_tag LOCUS_10200 19870 20232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 20365 20964 gene locus_tag LOCUS_10210 20365 20964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 22197 20998 gene locus_tag LOCUS_10220 22197 20998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 22672 22316 gene locus_tag LOCUS_10230 22672 22316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 23331 22669 gene locus_tag LOCUS_10240 23331 22669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 24028 23324 gene locus_tag LOCUS_10250 24028 23324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 25990 24119 gene locus_tag LOCUS_10260 25990 24119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 27942 25987 gene locus_tag LOCUS_10270 27942 25987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 29317 27935 gene locus_tag LOCUS_10280 29317 27935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 29639 29328 gene locus_tag LOCUS_10290 29639 29328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 29965 29890 gene locus_tag LOCUS_t00200 29965 29890 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 29975 30880 gene locus_tag LOCUS_10300 29975 30880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 31669 30875 gene locus_tag LOCUS_10310 31669 30875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 31810 32205 gene locus_tag LOCUS_10320 31810 32205 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021540.1 protein_id gnl|my_center|LOCUS_10320 32202 33428 gene locus_tag LOCUS_10330 gene eif2g 32202 33428 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875900.1 protein_id gnl|my_center|LOCUS_10330 33436 33786 gene locus_tag LOCUS_10340 33436 33786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 35012 33804 gene locus_tag LOCUS_10350 gene pan 35012 33804 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879468.1 protein_id gnl|my_center|LOCUS_10350 35239 35751 gene locus_tag LOCUS_10360 35239 35751 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496550.1 protein_id gnl|my_center|LOCUS_10360 36224 35754 gene locus_tag LOCUS_10370 36224 35754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 36460 38097 gene locus_tag LOCUS_10380 gene thsB 36460 38097 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879727.1 protein_id gnl|my_center|LOCUS_10380 38015 38701 gene locus_tag LOCUS_10390 38015 38701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 38694 40574 gene locus_tag LOCUS_10400 gene dnaK 38694 40574 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_10400 40589 41740 gene locus_tag LOCUS_10410 gene dnaJ 40589 41740 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816474.1 protein_id gnl|my_center|LOCUS_10410 41910 43100 gene locus_tag LOCUS_10420 41910 43100 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023232.1 protein_id gnl|my_center|LOCUS_10420 43626 43069 gene locus_tag LOCUS_10430 gene comE 43626 43069 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496438.1 protein_id gnl|my_center|LOCUS_10430 44123 43623 gene locus_tag LOCUS_10440 gene comD 44123 43623 CDS product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876830.1 protein_id gnl|my_center|LOCUS_10440 44746 44123 gene locus_tag LOCUS_10450 44746 44123 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877278.1 protein_id gnl|my_center|LOCUS_10450 45398 44748 gene locus_tag LOCUS_10460 45398 44748 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869613.1 protein_id gnl|my_center|LOCUS_10460 46207 45443 gene locus_tag LOCUS_10470 46207 45443 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869614.1 protein_id gnl|my_center|LOCUS_10470 47411 46200 gene locus_tag LOCUS_10480 47411 46200 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_10480 48969 47515 gene locus_tag LOCUS_10490 48969 47515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 49023 49400 gene locus_tag LOCUS_10500 49023 49400 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871088.1 protein_id gnl|my_center|LOCUS_10500 49397 50149 gene locus_tag LOCUS_10510 49397 50149 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496786.1 protein_id gnl|my_center|LOCUS_10510 51221 50139 gene locus_tag LOCUS_10520 51221 50139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 51428 52000 gene locus_tag LOCUS_10530 gene cyaB 51428 52000 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869738.1 protein_id gnl|my_center|LOCUS_10530 52241 51987 gene locus_tag LOCUS_10540 52241 51987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 52552 53625 gene locus_tag LOCUS_10550 gene argE 52552 53625 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005050468.1 protein_id gnl|my_center|LOCUS_10550 54699 53998 gene locus_tag LOCUS_10560 54699 53998 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_10560 54973 54704 gene locus_tag LOCUS_10570 54973 54704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 56031 55822 gene locus_tag LOCUS_10580 56031 55822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 56063 56521 gene locus_tag LOCUS_10590 56063 56521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 58504 57704 gene locus_tag LOCUS_10600 gene nadC 58504 57704 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867134.1 protein_id gnl|my_center|LOCUS_10600 59754 58504 gene locus_tag LOCUS_10610 59754 58504 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878039.1 protein_id gnl|my_center|LOCUS_10610 60163 60474 gene locus_tag LOCUS_10620 60163 60474 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870659.1 protein_id gnl|my_center|LOCUS_10620 60506 61258 gene locus_tag LOCUS_10630 60506 61258 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020169.1 protein_id gnl|my_center|LOCUS_10630 61360 62196 gene locus_tag LOCUS_10640 61360 62196 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904393.1 protein_id gnl|my_center|LOCUS_10640 62193 63140 gene locus_tag LOCUS_10650 62193 63140 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_10650 63137 63826 gene locus_tag LOCUS_10660 gene fsa 63137 63826 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_10660 63896 65065 gene locus_tag LOCUS_10670 63896 65065 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_10670 65105 66127 gene locus_tag LOCUS_10680 65105 66127 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249026.1 protein_id gnl|my_center|LOCUS_10680 67643 66111 gene locus_tag LOCUS_10690 67643 66111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 68374 67733 gene locus_tag LOCUS_10700 68374 67733 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096121.1 protein_id gnl|my_center|LOCUS_10700 68478 69401 gene locus_tag LOCUS_10710 68478 69401 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496898.1 protein_id gnl|my_center|LOCUS_10710 69404 70648 gene locus_tag LOCUS_10720 gene rbcL 69404 70648 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870747.1 protein_id gnl|my_center|LOCUS_10720 70645 72204 gene locus_tag LOCUS_10730 70645 72204 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878838.1 protein_id gnl|my_center|LOCUS_10730 73844 72201 gene locus_tag LOCUS_10740 73844 72201 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065280.1 protein_id gnl|my_center|LOCUS_10740 74629 73841 gene locus_tag LOCUS_10750 74629 73841 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262657.1 protein_id gnl|my_center|LOCUS_10750 75765 74626 gene locus_tag LOCUS_10760 75765 74626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 75941 77374 gene locus_tag LOCUS_10770 gene thsB 75941 77374 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878948.1 protein_id gnl|my_center|LOCUS_10770 78234 77371 gene locus_tag LOCUS_10780 78234 77371 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878600.1 protein_id gnl|my_center|LOCUS_10780 78385 79680 gene locus_tag LOCUS_10790 78385 79680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 79702 81909 gene locus_tag LOCUS_10800 79702 81909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 81979 82218 gene locus_tag LOCUS_10810 81979 82218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 83778 82243 gene locus_tag LOCUS_10820 83778 82243 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496733.1 protein_id gnl|my_center|LOCUS_10820 84254 83793 gene locus_tag LOCUS_10830 84254 83793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 84465 85604 gene locus_tag LOCUS_10840 84465 85604 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064263.1 protein_id gnl|my_center|LOCUS_10840 85801 86622 gene locus_tag LOCUS_10850 85801 86622 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496487.1 protein_id gnl|my_center|LOCUS_10850 86604 87377 gene locus_tag LOCUS_10860 86604 87377 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_10860 87895 87374 gene locus_tag LOCUS_10870 87895 87374 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020126.1 protein_id gnl|my_center|LOCUS_10870 88783 87899 gene locus_tag LOCUS_10880 gene trxB 88783 87899 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251050.1 protein_id gnl|my_center|LOCUS_10880 89234 88842 gene locus_tag LOCUS_10890 gene trxA 89234 88842 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846557.1 protein_id gnl|my_center|LOCUS_10890 89312 89590 gene locus_tag LOCUS_10900 89312 89590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 90129 89596 gene locus_tag LOCUS_10910 90129 89596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 90634 90107 gene locus_tag LOCUS_10920 90634 90107 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053622.1 protein_id gnl|my_center|LOCUS_10920 91140 90643 gene locus_tag LOCUS_10930 91140 90643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 91374 91568 gene locus_tag LOCUS_10940 91374 91568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 91740 92054 gene locus_tag LOCUS_10950 91740 92054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289276.1 protein_id gnl|my_center|LOCUS_10950 92238 92312 gene locus_tag LOCUS_t00210 92238 92312 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 92532 92660 gene locus_tag LOCUS_10960 92532 92660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 92657 92824 gene locus_tag LOCUS_10970 92657 92824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 94160 93468 gene locus_tag LOCUS_10980 94160 93468 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_10980 94792 94157 gene locus_tag LOCUS_10990 gene thiE 94792 94157 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_10990 95624 94779 gene locus_tag LOCUS_11000 gene thiM 95624 94779 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_11000 96104 97246 gene locus_tag LOCUS_11010 gene ftsZ 96104 97246 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064630.1 protein_id gnl|my_center|LOCUS_11010 97420 98547 gene locus_tag LOCUS_11020 gene ftsZ 97420 98547 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024152.1 protein_id gnl|my_center|LOCUS_11020 98719 98940 gene locus_tag LOCUS_11030 98719 98940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 98957 99829 gene locus_tag LOCUS_11040 98957 99829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 99834 100310 gene locus_tag LOCUS_11050 99834 100310 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867125.1 protein_id gnl|my_center|LOCUS_11050 100377 100886 gene locus_tag LOCUS_11060 100377 100886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 100888 102603 gene locus_tag LOCUS_11070 100888 102603 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_11070 102647 102733 gene locus_tag LOCUS_t00220 102647 102733 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 103324 103776 gene locus_tag LOCUS_11080 103324 103776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 104134 105993 gene locus_tag LOCUS_11090 104134 105993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 106055 106927 gene locus_tag LOCUS_11100 gene hemB 106055 106927 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020627.1 protein_id gnl|my_center|LOCUS_11100 106917 108194 gene locus_tag LOCUS_11110 gene hemL 106917 108194 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878736.1 protein_id gnl|my_center|LOCUS_11110 108191 109033 gene locus_tag LOCUS_11120 gene hemC 108191 109033 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878737.1 protein_id gnl|my_center|LOCUS_11120 109035 109778 gene locus_tag LOCUS_11130 gene cobA 109035 109778 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022972.1 protein_id gnl|my_center|LOCUS_11130 109775 110557 gene locus_tag LOCUS_11140 109775 110557 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022973.1 protein_id gnl|my_center|LOCUS_11140 110671 111057 gene locus_tag LOCUS_11150 gene cfbA 110671 111057 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023539.1 protein_id gnl|my_center|LOCUS_11150 111058 112347 gene locus_tag LOCUS_11160 gene cfbE 111058 112347 CDS product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485764.1 protein_id gnl|my_center|LOCUS_11160 112389 113429 gene locus_tag LOCUS_11170 gene cfbD 112389 113429 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877132.1 protein_id gnl|my_center|LOCUS_11170 113426 114205 gene locus_tag LOCUS_11180 gene cfbC 113426 114205 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase ATP-dependent reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023535.1 protein_id gnl|my_center|LOCUS_11180 114202 115554 gene locus_tag LOCUS_11190 gene cfbB 114202 115554 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877070.1 protein_id gnl|my_center|LOCUS_11190 117347 115491 gene locus_tag LOCUS_11200 117347 115491 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038616.1 protein_id gnl|my_center|LOCUS_11200 118251 117442 gene locus_tag LOCUS_11210 118251 117442 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979837.1 protein_id gnl|my_center|LOCUS_11210 119254 118253 gene locus_tag LOCUS_11220 119254 118253 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 protein_id gnl|my_center|LOCUS_11220 119490 119708 gene locus_tag LOCUS_11230 119490 119708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 119748 120221 gene locus_tag LOCUS_11240 119748 120221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11240 120342 120269 gene locus_tag LOCUS_t00230 120342 120269 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 121442 120390 gene locus_tag LOCUS_11250 gene endA 121442 120390 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023532.1 protein_id gnl|my_center|LOCUS_11250 121569 122174 gene locus_tag LOCUS_11260 gene surR 121569 122174 CDS product transcriptional regulator SurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250037.1 protein_id gnl|my_center|LOCUS_11260 122858 122175 gene locus_tag LOCUS_11270 122858 122175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 123828 122839 gene locus_tag LOCUS_11280 123828 122839 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023440.1 protein_id gnl|my_center|LOCUS_11280 124430 123924 gene locus_tag LOCUS_11290 124430 123924 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878792.1 protein_id gnl|my_center|LOCUS_11290 126616 124436 gene locus_tag LOCUS_11300 126616 124436 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_11300 126899 128476 gene locus_tag LOCUS_11310 126899 128476 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898989.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence06 1760 303 gene locus_tag LOCUS_11320 gene mtaB 1760 303 CDS product methanol--corrinoid protein co-methyltransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021626.1 protein_id gnl|my_center|LOCUS_11320 2505 1798 gene locus_tag LOCUS_11330 gene mtaC 2505 1798 CDS product methanol--corrinoid protein MtaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020507.1 protein_id gnl|my_center|LOCUS_11330 3782 2748 gene locus_tag LOCUS_11340 3782 2748 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_11340 4683 3787 gene locus_tag LOCUS_11350 4683 3787 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 protein_id gnl|my_center|LOCUS_11350 5146 5073 gene locus_tag LOCUS_t00240 5146 5073 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5278 5511 gene locus_tag LOCUS_11360 5278 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 5518 6498 gene locus_tag LOCUS_11370 5518 6498 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251076.1 protein_id gnl|my_center|LOCUS_11370 7855 6485 gene locus_tag LOCUS_11380 7855 6485 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023357.1 protein_id gnl|my_center|LOCUS_11380 8316 7861 gene locus_tag LOCUS_11390 8316 7861 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869527.1 protein_id gnl|my_center|LOCUS_11390 8788 8441 gene locus_tag LOCUS_11400 8788 8441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 9441 8785 gene locus_tag LOCUS_11410 9441 8785 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876839.1 protein_id gnl|my_center|LOCUS_11410 9783 9475 gene locus_tag LOCUS_11420 9783 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 9862 10638 gene locus_tag LOCUS_11430 9862 10638 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876504.1 protein_id gnl|my_center|LOCUS_11430 10635 11441 gene locus_tag LOCUS_11440 10635 11441 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251074.1 protein_id gnl|my_center|LOCUS_11440 11438 11821 gene locus_tag LOCUS_11450 11438 11821 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879687.1 protein_id gnl|my_center|LOCUS_11450 13049 11823 gene locus_tag LOCUS_11460 13049 11823 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877197.1 protein_id gnl|my_center|LOCUS_11460 14308 13046 gene locus_tag LOCUS_11470 gene glmM 14308 13046 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065583.1 protein_id gnl|my_center|LOCUS_11470 14697 14918 gene locus_tag LOCUS_11480 14697 14918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 14996 15745 gene locus_tag LOCUS_11490 14996 15745 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496422.1 protein_id gnl|my_center|LOCUS_11490 15794 17032 gene locus_tag LOCUS_11500 gene ahcY 15794 17032 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870905.1 protein_id gnl|my_center|LOCUS_11500 17029 17949 gene locus_tag LOCUS_11510 17029 17949 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496485.1 protein_id gnl|my_center|LOCUS_11510 18044 18277 gene locus_tag LOCUS_11520 18044 18277 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878901.1 protein_id gnl|my_center|LOCUS_11520 18294 18590 gene locus_tag LOCUS_11530 18294 18590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 18646 19125 gene locus_tag LOCUS_11540 gene purE 18646 19125 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870121.1 protein_id gnl|my_center|LOCUS_11540 19112 20059 gene locus_tag LOCUS_11550 gene guaA 19112 20059 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249148.1 protein_id gnl|my_center|LOCUS_11550 20073 21362 gene locus_tag LOCUS_11560 gene guaA 20073 21362 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764094.1 protein_id gnl|my_center|LOCUS_11560 21628 22200 gene locus_tag LOCUS_11570 21628 22200 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249145.1 protein_id gnl|my_center|LOCUS_11570 22387 23403 gene locus_tag LOCUS_11580 22387 23403 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_11580 23413 24516 gene locus_tag LOCUS_11590 gene trpD 23413 24516 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 protein_id gnl|my_center|LOCUS_11590 24919 24539 gene locus_tag LOCUS_11600 24919 24539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 26224 24971 gene locus_tag LOCUS_11610 26224 24971 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_11610 26655 26221 gene locus_tag LOCUS_11620 26655 26221 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064659.1 protein_id gnl|my_center|LOCUS_11620 26911 27108 gene locus_tag LOCUS_11630 26911 27108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 29734 27161 gene locus_tag LOCUS_11640 29734 27161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 30774 29947 gene locus_tag LOCUS_11650 gene folP 30774 29947 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_11650 31949 30846 gene locus_tag LOCUS_11660 31949 30846 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878013.1 protein_id gnl|my_center|LOCUS_11660 33193 31952 gene locus_tag LOCUS_11670 gene larA 33193 31952 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_11670 33409 34371 gene locus_tag LOCUS_11680 gene thiL 33409 34371 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877008.1 protein_id gnl|my_center|LOCUS_11680 34475 34768 gene locus_tag LOCUS_11690 34475 34768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11690 34773 35396 gene locus_tag LOCUS_11700 34773 35396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11700 35409 35900 gene locus_tag LOCUS_11710 35409 35900 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 protein_id gnl|my_center|LOCUS_11710 35879 36850 gene locus_tag LOCUS_11720 35879 36850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 36847 37740 gene locus_tag LOCUS_11730 36847 37740 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258713.1 protein_id gnl|my_center|LOCUS_11730 37867 38289 gene locus_tag LOCUS_11740 37867 38289 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903327.1 protein_id gnl|my_center|LOCUS_11740 38291 39163 gene locus_tag LOCUS_11750 gene dapA 38291 39163 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939154.1 protein_id gnl|my_center|LOCUS_11750 39173 39952 gene locus_tag LOCUS_11760 gene dapB 39173 39952 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496490.1 protein_id gnl|my_center|LOCUS_11760 39949 41316 gene locus_tag LOCUS_11770 39949 41316 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870075.1 protein_id gnl|my_center|LOCUS_11770 41303 42559 gene locus_tag LOCUS_11780 gene lysA 41303 42559 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_11780 42556 43386 gene locus_tag LOCUS_11790 gene dapF 42556 43386 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_11790 43391 44539 gene locus_tag LOCUS_11800 43391 44539 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880128.1 protein_id gnl|my_center|LOCUS_11800 45462 44638 gene locus_tag LOCUS_11810 gene mutM 45462 44638 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_11810 46363 45455 gene locus_tag LOCUS_11820 46363 45455 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_11820 47673 46462 gene locus_tag LOCUS_11830 47673 46462 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496567.1 protein_id gnl|my_center|LOCUS_11830 47782 48447 gene locus_tag LOCUS_11840 47782 48447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 48547 49482 gene locus_tag LOCUS_11850 48547 49482 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256178.1 protein_id gnl|my_center|LOCUS_11850 50649 49660 gene locus_tag LOCUS_11860 gene ilvC 50649 49660 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496863.1 protein_id gnl|my_center|LOCUS_11860 51500 50661 gene locus_tag LOCUS_11870 51500 50661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11870 51840 52856 gene locus_tag LOCUS_11880 51840 52856 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023275.1 protein_id gnl|my_center|LOCUS_11880 53019 53642 gene locus_tag LOCUS_11890 53019 53642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 53655 54728 gene locus_tag LOCUS_11900 53655 54728 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272563.1 protein_id gnl|my_center|LOCUS_11900 54839 55285 gene locus_tag LOCUS_11910 54839 55285 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_11910 56088 55282 gene locus_tag LOCUS_11920 56088 55282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582453.1 protein_id gnl|my_center|LOCUS_11920 57593 56085 gene locus_tag LOCUS_11930 57593 56085 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392806.1 protein_id gnl|my_center|LOCUS_11930 58824 57586 gene locus_tag LOCUS_11940 58824 57586 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392807.1 protein_id gnl|my_center|LOCUS_11940 59075 59704 gene locus_tag LOCUS_11950 59075 59704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 59701 60303 gene locus_tag LOCUS_11960 59701 60303 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020764.1 protein_id gnl|my_center|LOCUS_11960 60328 60882 gene locus_tag LOCUS_11970 60328 60882 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250120.1 protein_id gnl|my_center|LOCUS_11970 60896 61522 gene locus_tag LOCUS_11980 60896 61522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 61844 61560 gene locus_tag LOCUS_11990 61844 61560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 61920 62387 gene locus_tag LOCUS_12000 61920 62387 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147315.1 protein_id gnl|my_center|LOCUS_12000 63458 62373 gene locus_tag LOCUS_12010 63458 62373 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023790.1 protein_id gnl|my_center|LOCUS_12010 64424 63462 gene locus_tag LOCUS_12020 64424 63462 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392766.1 protein_id gnl|my_center|LOCUS_12020 64567 65031 gene locus_tag LOCUS_12030 64567 65031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 66499 65000 gene locus_tag LOCUS_12040 gene fpoN 66499 65000 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_12040 68066 66501 gene locus_tag LOCUS_12050 gene fpoM 68066 66501 CDS product F(420)H(2) dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021519.1 protein_id gnl|my_center|LOCUS_12050 70030 68066 gene locus_tag LOCUS_12060 gene nuoL 70030 68066 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568230.1 protein_id gnl|my_center|LOCUS_12060 70334 70032 gene locus_tag LOCUS_12070 gene fpoK 70334 70032 CDS product F420H2 dehydrogenase subunit FpoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589525.1 protein_id gnl|my_center|LOCUS_12070 70582 70331 gene locus_tag LOCUS_12080 70582 70331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 70868 70575 gene locus_tag LOCUS_12090 70868 70575 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048140880.1 protein_id gnl|my_center|LOCUS_12090 71626 70868 gene locus_tag LOCUS_12100 71626 70868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 72725 71628 gene locus_tag LOCUS_12110 gene nuoH 72725 71628 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573431.1 protein_id gnl|my_center|LOCUS_12110 73813 72731 gene locus_tag LOCUS_12120 gene nuoD 73813 72731 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_12120 74276 73815 gene locus_tag LOCUS_12130 gene fpoC 74276 73815 CDS product F420H2 dehydrogenase subunit FpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021511.1 protein_id gnl|my_center|LOCUS_12130 74851 74288 gene locus_tag LOCUS_12140 74851 74288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 75138 74842 gene locus_tag LOCUS_12150 gene ndhC 75138 74842 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_12150 75416 76225 gene locus_tag LOCUS_12160 gene proC 75416 76225 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_12160 77951 76230 gene locus_tag LOCUS_12170 77951 76230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 79072 78290 gene locus_tag LOCUS_12180 gene uppS 79072 78290 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250124.1 protein_id gnl|my_center|LOCUS_12180 80043 79099 gene locus_tag LOCUS_12190 80043 79099 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870435.1 protein_id gnl|my_center|LOCUS_12190 80644 80117 gene locus_tag LOCUS_12200 80644 80117 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583745.1 protein_id gnl|my_center|LOCUS_12200 81180 80641 gene locus_tag LOCUS_12210 gene pyrE 81180 80641 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023240.1 protein_id gnl|my_center|LOCUS_12210 81746 81174 gene locus_tag LOCUS_12220 81746 81174 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879236.1 protein_id gnl|my_center|LOCUS_12220 83672 81786 gene locus_tag LOCUS_12230 83672 81786 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868460.1 protein_id gnl|my_center|LOCUS_12230 84128 83700 gene locus_tag LOCUS_12240 84128 83700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 85538 84342 gene locus_tag LOCUS_12250 85538 84342 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002037401.1 protein_id gnl|my_center|LOCUS_12250 87259 85649 gene locus_tag LOCUS_12260 gene serA 87259 85649 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_12260 88320 87256 gene locus_tag LOCUS_12270 88320 87256 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888750.1 protein_id gnl|my_center|LOCUS_12270 89034 88702 gene locus_tag LOCUS_12280 89034 88702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 89408 89070 gene locus_tag LOCUS_12290 89408 89070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 91049 89436 gene locus_tag LOCUS_12300 91049 89436 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021335.1 protein_id gnl|my_center|LOCUS_12300 93349 91343 gene locus_tag LOCUS_12310 93349 91343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 94397 93354 gene locus_tag LOCUS_12320 gene cbiG 94397 93354 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681802.1 protein_id gnl|my_center|LOCUS_12320 95542 94394 gene locus_tag LOCUS_12330 gene cbiD 95542 94394 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168467.1 protein_id gnl|my_center|LOCUS_12330 95703 96401 gene locus_tag LOCUS_12340 gene cobI 95703 96401 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 protein_id gnl|my_center|LOCUS_12340 96411 97166 gene locus_tag LOCUS_12350 gene cobM 96411 97166 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016784.1 protein_id gnl|my_center|LOCUS_12350 97168 97899 gene locus_tag LOCUS_12360 gene cobJ 97168 97899 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931509.1 protein_id gnl|my_center|LOCUS_12360 97910 98533 gene locus_tag LOCUS_12370 97910 98533 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_12370 98965 98534 gene locus_tag LOCUS_12380 98965 98534 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_12380 100269 98965 gene locus_tag LOCUS_12390 100269 98965 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023751.1 protein_id gnl|my_center|LOCUS_12390 100581 100853 gene locus_tag LOCUS_12400 100581 100853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 100895 101551 gene locus_tag LOCUS_12410 gene hypB 100895 101551 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876419.1 protein_id gnl|my_center|LOCUS_12410 102714 101554 gene locus_tag LOCUS_12420 102714 101554 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021821.1 protein_id gnl|my_center|LOCUS_12420 102883 103791 gene locus_tag LOCUS_12430 gene pdxS 102883 103791 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876304.1 protein_id gnl|my_center|LOCUS_12430 104338 104084 gene locus_tag LOCUS_12440 104338 104084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12440 105009 104446 gene locus_tag LOCUS_12450 105009 104446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 106094 105006 gene locus_tag LOCUS_12460 106094 105006 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064840.1 protein_id gnl|my_center|LOCUS_12460 106665 106129 gene locus_tag LOCUS_12470 106665 106129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 106835 108178 gene locus_tag LOCUS_12480 106835 108178 CDS product Single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289299.1 protein_id gnl|my_center|LOCUS_12480 108178 109143 gene locus_tag LOCUS_12490 108178 109143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 110101 109289 gene locus_tag LOCUS_12500 gene amrB 110101 109289 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875685.1 protein_id gnl|my_center|LOCUS_12500 110889 110278 gene locus_tag LOCUS_12510 gene rpsB 110889 110278 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878629.1 protein_id gnl|my_center|LOCUS_12510 111072 110899 gene locus_tag LOCUS_12520 111072 110899 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867659.1 protein_id gnl|my_center|LOCUS_12520 111422 113155 gene locus_tag LOCUS_12530 gene acsA 111422 113155 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399030.1 protein_id gnl|my_center|LOCUS_12530 114089 113217 gene locus_tag LOCUS_12540 114089 113217 CDS product DUF4261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681717.1 protein_id gnl|my_center|LOCUS_12540 114500 114099 gene locus_tag LOCUS_12550 114500 114099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 114821 115765 gene locus_tag LOCUS_12560 114821 115765 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963416.1 protein_id gnl|my_center|LOCUS_12560 116299 115787 gene locus_tag LOCUS_12570 116299 115787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 116743 116351 gene locus_tag LOCUS_12580 116743 116351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 117549 116797 gene locus_tag LOCUS_12590 117549 116797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 117715 118110 gene locus_tag LOCUS_12600 117715 118110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 118268 118522 gene locus_tag LOCUS_12610 118268 118522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 118560 119432 gene locus_tag LOCUS_12620 118560 119432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 120833 119433 gene locus_tag LOCUS_12630 gene cls 120833 119433 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722636.1 protein_id gnl|my_center|LOCUS_12630 121432 120908 gene locus_tag LOCUS_12640 121432 120908 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392537.1 protein_id gnl|my_center|LOCUS_12640 121785 121546 gene locus_tag LOCUS_12650 121785 121546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 125166 121873 gene locus_tag LOCUS_12660 125166 121873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 126754 125390 gene locus_tag LOCUS_12670 126754 125390 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_12670 127037 126765 gene locus_tag LOCUS_12680 127037 126765 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_12680 127186 127821 gene locus_tag LOCUS_12690 127186 127821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 128288 127839 gene locus_tag LOCUS_12700 128288 127839 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814552.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence07 1579 1247 gene locus_tag LOCUS_12710 1579 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2228 1581 gene locus_tag LOCUS_12720 gene rnhB 2228 1581 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249756.1 protein_id gnl|my_center|LOCUS_12720 6373 2303 gene locus_tag LOCUS_12730 6373 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 6824 7723 gene locus_tag LOCUS_12740 gene mptA 6824 7723 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496622.1 protein_id gnl|my_center|LOCUS_12740 8191 7754 gene locus_tag LOCUS_12750 8191 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 8314 8838 gene locus_tag LOCUS_12760 8314 8838 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967909.1 protein_id gnl|my_center|LOCUS_12760 9420 10784 gene locus_tag LOCUS_12770 9420 10784 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065247.1 protein_id gnl|my_center|LOCUS_12770 10781 11464 gene locus_tag LOCUS_12780 10781 11464 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876695.1 protein_id gnl|my_center|LOCUS_12780 11967 11467 gene locus_tag LOCUS_12790 11967 11467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 12581 12084 gene locus_tag LOCUS_12800 12581 12084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 12719 12958 gene locus_tag LOCUS_12810 12719 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 13184 13462 gene locus_tag LOCUS_12820 13184 13462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 13459 14769 gene locus_tag LOCUS_12830 gene gatA 13459 14769 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880108.1 protein_id gnl|my_center|LOCUS_12830 14766 16112 gene locus_tag LOCUS_12840 gene gatB 14766 16112 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496410.1 protein_id gnl|my_center|LOCUS_12840 16177 16653 gene locus_tag LOCUS_12850 16177 16653 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948205.1 protein_id gnl|my_center|LOCUS_12850 16758 17009 gene locus_tag LOCUS_12860 16758 17009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 17024 17194 gene locus_tag LOCUS_12870 17024 17194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 17679 17296 gene locus_tag LOCUS_12880 17679 17296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081025014.1 protein_id gnl|my_center|LOCUS_12880 18802 17672 gene locus_tag LOCUS_12890 18802 17672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 19123 19605 gene locus_tag LOCUS_12900 19123 19605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 21604 19775 gene locus_tag LOCUS_12910 gene aspS 21604 19775 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546812.1 protein_id gnl|my_center|LOCUS_12910 22153 21668 gene locus_tag LOCUS_12920 22153 21668 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197463606.1 protein_id gnl|my_center|LOCUS_12920 22248 23429 gene locus_tag LOCUS_12930 22248 23429 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 protein_id gnl|my_center|LOCUS_12930 23528 24871 gene locus_tag LOCUS_12940 gene glnA 23528 24871 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_12940 25115 25477 gene locus_tag LOCUS_12950 25115 25477 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875816.1 protein_id gnl|my_center|LOCUS_12950 25487 25723 gene locus_tag LOCUS_12960 25487 25723 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250951.1 protein_id gnl|my_center|LOCUS_12960 26304 26915 gene locus_tag LOCUS_12970 26304 26915 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861425.1 protein_id gnl|my_center|LOCUS_12970 27392 27931 gene locus_tag LOCUS_12980 27392 27931 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107760.1 protein_id gnl|my_center|LOCUS_12980 27941 28468 gene locus_tag LOCUS_12990 27941 28468 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_12990 28479 29603 gene locus_tag LOCUS_13000 28479 29603 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_13000 29613 30863 gene locus_tag LOCUS_13010 gene larC 29613 30863 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964092.1 protein_id gnl|my_center|LOCUS_13010 30964 31359 gene locus_tag LOCUS_13020 30964 31359 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_13020 31777 33096 gene locus_tag LOCUS_13030 31777 33096 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047961.1 protein_id gnl|my_center|LOCUS_13030 33248 34171 gene locus_tag LOCUS_13040 33248 34171 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_13040 34421 34906 gene locus_tag LOCUS_13050 34421 34906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272655.1 protein_id gnl|my_center|LOCUS_13050 35584 34925 gene locus_tag LOCUS_13060 35584 34925 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869954.1 protein_id gnl|my_center|LOCUS_13060 35939 36160 gene locus_tag LOCUS_13070 35939 36160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 37229 36288 gene locus_tag LOCUS_13080 37229 36288 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_13080 38392 37226 gene locus_tag LOCUS_13090 38392 37226 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545720.1 protein_id gnl|my_center|LOCUS_13090 38664 38389 gene locus_tag LOCUS_13100 38664 38389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 39225 38665 gene locus_tag LOCUS_13110 39225 38665 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_13110 40124 39381 gene locus_tag LOCUS_13120 gene purN 40124 39381 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679594.1 protein_id gnl|my_center|LOCUS_13120 40290 40925 gene locus_tag LOCUS_13130 40290 40925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 41133 40933 gene locus_tag LOCUS_13140 41133 40933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 41228 42529 gene locus_tag LOCUS_13150 41228 42529 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023992.1 protein_id gnl|my_center|LOCUS_13150 42526 43647 gene locus_tag LOCUS_13160 gene proB 42526 43647 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023993.1 protein_id gnl|my_center|LOCUS_13160 43686 44936 gene locus_tag LOCUS_13170 43686 44936 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023306.1 protein_id gnl|my_center|LOCUS_13170 44963 45484 gene locus_tag LOCUS_13180 44963 45484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 45571 46068 gene locus_tag LOCUS_13190 45571 46068 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876288.1 protein_id gnl|my_center|LOCUS_13190 46128 46496 gene locus_tag LOCUS_13200 46128 46496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 46674 47873 gene locus_tag LOCUS_13210 46674 47873 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249495.1 protein_id gnl|my_center|LOCUS_13210 49321 47870 gene locus_tag LOCUS_13220 49321 47870 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064301.1 protein_id gnl|my_center|LOCUS_13220 49408 50487 gene locus_tag LOCUS_13230 49408 50487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 50646 50572 gene locus_tag LOCUS_t00250 50646 50572 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 51151 51074 gene locus_tag LOCUS_t00260 51151 51074 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 52115 51240 gene locus_tag LOCUS_13240 52115 51240 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_13240 52901 52125 gene locus_tag LOCUS_13250 52901 52125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 54256 53183 gene locus_tag LOCUS_13260 54256 53183 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_13260 54382 55698 gene locus_tag LOCUS_13270 54382 55698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 55893 57086 gene locus_tag LOCUS_13280 55893 57086 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181452.1 protein_id gnl|my_center|LOCUS_13280 57061 57396 gene locus_tag LOCUS_13290 57061 57396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 57974 57393 gene locus_tag LOCUS_13300 57974 57393 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870158.1 protein_id gnl|my_center|LOCUS_13300 58071 58655 gene locus_tag LOCUS_13310 58071 58655 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496635.1 protein_id gnl|my_center|LOCUS_13310 58652 59917 gene locus_tag LOCUS_13320 58652 59917 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020936.1 protein_id gnl|my_center|LOCUS_13320 59898 61022 gene locus_tag LOCUS_13330 59898 61022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 61072 61296 gene locus_tag LOCUS_13340 61072 61296 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878376.1 protein_id gnl|my_center|LOCUS_13340 61322 61489 gene locus_tag LOCUS_13350 61322 61489 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867766.1 protein_id gnl|my_center|LOCUS_13350 61501 62925 gene locus_tag LOCUS_13360 gene purF 61501 62925 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065634.1 protein_id gnl|my_center|LOCUS_13360 62962 63035 gene locus_tag LOCUS_t00270 62962 63035 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 63312 64202 gene locus_tag LOCUS_13370 63312 64202 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393480.1 protein_id gnl|my_center|LOCUS_13370 64199 64990 gene locus_tag LOCUS_13380 64199 64990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086077.1 protein_id gnl|my_center|LOCUS_13380 64987 66549 gene locus_tag LOCUS_13390 64987 66549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 67637 66621 gene locus_tag LOCUS_13400 67637 66621 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345599.1 protein_id gnl|my_center|LOCUS_13400 68606 67845 gene locus_tag LOCUS_13410 68606 67845 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_13410 68711 69112 gene locus_tag LOCUS_13420 68711 69112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 69184 70089 gene locus_tag LOCUS_13430 69184 70089 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 protein_id gnl|my_center|LOCUS_13430 70134 71210 gene locus_tag LOCUS_13440 70134 71210 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_13440 71351 71980 gene locus_tag LOCUS_13450 71351 71980 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986312.1 protein_id gnl|my_center|LOCUS_13450 72560 72120 gene locus_tag LOCUS_13460 72560 72120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 73063 72560 gene locus_tag LOCUS_13470 73063 72560 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060917.1 protein_id gnl|my_center|LOCUS_13470 73877 73119 gene locus_tag LOCUS_13480 73877 73119 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878746.1 protein_id gnl|my_center|LOCUS_13480 73972 75243 gene locus_tag LOCUS_13490 73972 75243 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_13490 75664 75245 gene locus_tag LOCUS_13500 75664 75245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 75887 75657 gene locus_tag LOCUS_13510 75887 75657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 75823 76569 gene locus_tag LOCUS_13520 75823 76569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 76650 77162 gene locus_tag LOCUS_13530 gene hdrC 76650 77162 CDS product CoB--CoM heterodisulfide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261191.1 protein_id gnl|my_center|LOCUS_13530 77164 77985 gene locus_tag LOCUS_13540 gene hdrB 77164 77985 CDS product CoB--CoM heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870378.1 protein_id gnl|my_center|LOCUS_13540 78364 78795 gene locus_tag LOCUS_13550 78364 78795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 78800 79105 gene locus_tag LOCUS_13560 78800 79105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 79319 80695 gene locus_tag LOCUS_13570 79319 80695 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175182.1 protein_id gnl|my_center|LOCUS_13570 81101 81027 gene locus_tag LOCUS_t00280 81101 81027 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 81904 81119 gene locus_tag LOCUS_13580 81904 81119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 83475 82069 gene locus_tag LOCUS_13590 gene mtaB 83475 82069 CDS product methanol--corrinoid protein co-methyltransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024271.1 protein_id gnl|my_center|LOCUS_13590 83610 83491 gene locus_tag LOCUS_13600 83610 83491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 84248 83622 gene locus_tag LOCUS_13610 gene mtaC 84248 83622 CDS product methanol--corrinoid protein MtaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024270.1 protein_id gnl|my_center|LOCUS_13610 85695 84532 gene locus_tag LOCUS_13620 85695 84532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 86449 85724 gene locus_tag LOCUS_13630 86449 85724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 86936 86556 gene locus_tag LOCUS_13640 86936 86556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 88851 86968 gene locus_tag LOCUS_13650 88851 86968 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022843.1 protein_id gnl|my_center|LOCUS_13650 88999 89598 gene locus_tag LOCUS_13660 88999 89598 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061267.1 protein_id gnl|my_center|LOCUS_13660 91025 89595 gene locus_tag LOCUS_13670 91025 89595 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393791.1 protein_id gnl|my_center|LOCUS_13670 91544 91149 gene locus_tag LOCUS_13680 91544 91149 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878974.1 protein_id gnl|my_center|LOCUS_13680 92484 91597 gene locus_tag LOCUS_13690 92484 91597 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831939.1 protein_id gnl|my_center|LOCUS_13690 92411 92575 gene locus_tag LOCUS_13700 92411 92575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 92626 93141 gene locus_tag LOCUS_13710 92626 93141 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_13710 93606 94985 gene locus_tag LOCUS_13720 93606 94985 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_13720 95034 95492 gene locus_tag LOCUS_13730 95034 95492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 95974 97167 gene locus_tag LOCUS_13740 95974 97167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 98289 97477 gene locus_tag LOCUS_13750 98289 97477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 99238 98294 gene locus_tag LOCUS_13760 99238 98294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948828.1 protein_id gnl|my_center|LOCUS_13760 99425 99931 gene locus_tag LOCUS_13770 99425 99931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 99938 100156 gene locus_tag LOCUS_13780 99938 100156 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721916.1 protein_id gnl|my_center|LOCUS_13780 100352 100277 gene locus_tag LOCUS_t00290 100352 100277 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 101094 100456 gene locus_tag LOCUS_13790 101094 100456 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_13790 101312 101938 gene locus_tag LOCUS_13800 101312 101938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13800 101914 102528 gene locus_tag LOCUS_13810 101914 102528 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867340.1 protein_id gnl|my_center|LOCUS_13810 102552 103772 gene locus_tag LOCUS_13820 102552 103772 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 protein_id gnl|my_center|LOCUS_13820 103854 105011 gene locus_tag LOCUS_13830 103854 105011 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023596.1 protein_id gnl|my_center|LOCUS_13830 105206 105694 gene locus_tag LOCUS_13840 105206 105694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 106178 105684 gene locus_tag LOCUS_13850 106178 105684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 107891 106179 gene locus_tag LOCUS_13860 gene argS 107891 106179 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877057.1 protein_id gnl|my_center|LOCUS_13860 109207 107894 gene locus_tag LOCUS_13870 gene prf1 109207 107894 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_13870 109207 109890 gene locus_tag LOCUS_13880 gene pyrH 109207 109890 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496770.1 protein_id gnl|my_center|LOCUS_13880 110723 109887 gene locus_tag LOCUS_13890 110723 109887 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022038.1 protein_id gnl|my_center|LOCUS_13890 110815 112116 gene locus_tag LOCUS_13900 110815 112116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence08 1422 412 gene locus_tag LOCUS_13910 1422 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 2170 1424 gene locus_tag LOCUS_13920 2170 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 3299 2175 gene locus_tag LOCUS_13930 3299 2175 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_13930 3832 3296 gene locus_tag LOCUS_13940 3832 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 3949 4161 gene locus_tag LOCUS_13950 3949 4161 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358328.1 protein_id gnl|my_center|LOCUS_13950 4436 4675 gene locus_tag LOCUS_13960 4436 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 5246 4884 gene locus_tag LOCUS_13970 5246 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 6159 5821 gene locus_tag LOCUS_13980 6159 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 6041 6307 gene locus_tag LOCUS_13990 6041 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 8260 7148 gene locus_tag LOCUS_14000 8260 7148 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868467.1 protein_id gnl|my_center|LOCUS_14000 8742 8260 gene locus_tag LOCUS_14010 8742 8260 CDS product Isopropylmalate/citramalate isomerase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870790.1 protein_id gnl|my_center|LOCUS_14010 9993 8752 gene locus_tag LOCUS_14020 gene leuC 9993 8752 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_14020 11587 9998 gene locus_tag LOCUS_14030 11587 9998 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877091.1 protein_id gnl|my_center|LOCUS_14030 12190 13212 gene locus_tag LOCUS_14040 12190 13212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 13930 13295 gene locus_tag LOCUS_14050 13930 13295 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545638.1 protein_id gnl|my_center|LOCUS_14050 14610 13927 gene locus_tag LOCUS_14060 gene queC 14610 13927 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272362.1 protein_id gnl|my_center|LOCUS_14060 15092 14607 gene locus_tag LOCUS_14070 15092 14607 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870785.1 protein_id gnl|my_center|LOCUS_14070 15880 15116 gene locus_tag LOCUS_14080 15880 15116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 16284 16754 gene locus_tag LOCUS_14090 16284 16754 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_14090 17672 16770 gene locus_tag LOCUS_14100 gene dph2 17672 16770 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020763.1 protein_id gnl|my_center|LOCUS_14100 18292 17774 gene locus_tag LOCUS_14110 18292 17774 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020241.1 protein_id gnl|my_center|LOCUS_14110 20644 18758 gene locus_tag LOCUS_14120 20644 18758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 21157 21432 gene locus_tag LOCUS_14130 21157 21432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 21467 22744 gene locus_tag LOCUS_14140 gene serS 21467 22744 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023941.1 protein_id gnl|my_center|LOCUS_14140 23462 22758 gene locus_tag LOCUS_14150 23462 22758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 23570 25123 gene locus_tag LOCUS_14160 23570 25123 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021139.1 protein_id gnl|my_center|LOCUS_14160 25142 25315 gene locus_tag LOCUS_14170 25142 25315 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065133.1 protein_id gnl|my_center|LOCUS_14170 25312 26502 gene locus_tag LOCUS_14180 25312 26502 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_14180 27467 26508 gene locus_tag LOCUS_14190 27467 26508 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064922.1 protein_id gnl|my_center|LOCUS_14190 27649 27954 gene locus_tag LOCUS_14200 27649 27954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 29133 27931 gene locus_tag LOCUS_14210 29133 27931 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081138.1 protein_id gnl|my_center|LOCUS_14210 29642 29130 gene locus_tag LOCUS_14220 29642 29130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 31262 29718 gene locus_tag LOCUS_14230 gene lysS 31262 29718 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583287.1 protein_id gnl|my_center|LOCUS_14230 31802 34111 gene locus_tag LOCUS_14240 gene ppsA 31802 34111 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763610.1 protein_id gnl|my_center|LOCUS_14240 34936 34127 gene locus_tag LOCUS_14250 34936 34127 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876899.1 protein_id gnl|my_center|LOCUS_14250 36450 35008 gene locus_tag LOCUS_14260 36450 35008 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392514.1 protein_id gnl|my_center|LOCUS_14260 36884 36959 gene locus_tag LOCUS_t00300 36884 36959 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 37550 37978 gene locus_tag LOCUS_14270 37550 37978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 38261 38040 gene locus_tag LOCUS_14280 38261 38040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 39182 38391 gene locus_tag LOCUS_14290 39182 38391 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_14290 40227 39184 gene locus_tag LOCUS_14300 40227 39184 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_14300 41199 40237 gene locus_tag LOCUS_14310 41199 40237 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082604.1 protein_id gnl|my_center|LOCUS_14310 42065 41592 gene locus_tag LOCUS_14320 42065 41592 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_14320 42600 42088 gene locus_tag LOCUS_14330 42600 42088 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948568.1 protein_id gnl|my_center|LOCUS_14330 43203 44255 gene locus_tag LOCUS_14340 gene fen 43203 44255 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867862.1 protein_id gnl|my_center|LOCUS_14340 44399 47542 gene locus_tag LOCUS_14350 gene ileS 44399 47542 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022402.1 protein_id gnl|my_center|LOCUS_14350 48158 47631 gene locus_tag LOCUS_14360 48158 47631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 50391 48244 gene locus_tag LOCUS_14370 50391 48244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 50797 50420 gene locus_tag LOCUS_14380 50797 50420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 51797 50844 gene locus_tag LOCUS_14390 51797 50844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 52940 51822 gene locus_tag LOCUS_14400 52940 51822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14400 53386 52937 gene locus_tag LOCUS_14410 53386 52937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14410 54381 53392 gene locus_tag LOCUS_14420 54381 53392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 56287 55148 gene locus_tag LOCUS_14430 56287 55148 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_14430 57292 56441 gene locus_tag LOCUS_14440 57292 56441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_14440 57911 57258 gene locus_tag LOCUS_14450 57911 57258 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_14450 58653 58030 gene locus_tag LOCUS_14460 58653 58030 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066132.1 protein_id gnl|my_center|LOCUS_14460 60368 58794 gene locus_tag LOCUS_14470 gene hcp 60368 58794 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_14470 61050 60370 gene locus_tag LOCUS_14480 61050 60370 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_14480 61172 61795 gene locus_tag LOCUS_14490 61172 61795 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_14490 61838 62578 gene locus_tag LOCUS_14500 61838 62578 CDS product DUF4241 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099972008.1 protein_id gnl|my_center|LOCUS_14500 63963 62629 gene locus_tag LOCUS_14510 63963 62629 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_14510 64127 65611 gene locus_tag LOCUS_14520 64127 65611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 65613 66341 gene locus_tag LOCUS_14530 65613 66341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 66357 67841 gene locus_tag LOCUS_14540 66357 67841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 67854 69200 gene locus_tag LOCUS_14550 67854 69200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 69311 70093 gene locus_tag LOCUS_14560 69311 70093 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_14560 70294 71658 gene locus_tag LOCUS_14570 70294 71658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 71701 72804 gene locus_tag LOCUS_14580 71701 72804 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_14580 72804 73148 gene locus_tag LOCUS_14590 72804 73148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14590 73166 73615 gene locus_tag LOCUS_14600 73166 73615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14600 73755 75248 gene locus_tag LOCUS_14610 gene katA 73755 75248 CDS product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245322.1 protein_id gnl|my_center|LOCUS_14610 75365 76237 gene locus_tag LOCUS_14620 75365 76237 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680498.1 protein_id gnl|my_center|LOCUS_14620 77757 76330 gene locus_tag LOCUS_14630 77757 76330 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787371.1 protein_id gnl|my_center|LOCUS_14630 78684 77989 gene locus_tag LOCUS_14640 78684 77989 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_14640 80737 78953 gene locus_tag LOCUS_14650 80737 78953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 81070 82416 gene locus_tag LOCUS_14660 81070 82416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 82519 83910 gene locus_tag LOCUS_14670 82519 83910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 83920 84849 gene locus_tag LOCUS_14680 gene twy1 83920 84849 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193384983.1 protein_id gnl|my_center|LOCUS_14680 86835 84928 gene locus_tag LOCUS_14690 86835 84928 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_14690 87547 86882 gene locus_tag LOCUS_14700 gene psmB 87547 86882 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 protein_id gnl|my_center|LOCUS_14700 88673 88161 gene locus_tag LOCUS_14710 88673 88161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 88793 89563 gene locus_tag LOCUS_14720 88793 89563 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250907.1 protein_id gnl|my_center|LOCUS_14720 90735 89560 gene locus_tag LOCUS_14730 90735 89560 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_14730 93387 91132 gene locus_tag LOCUS_14740 93387 91132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 93755 95671 gene locus_tag LOCUS_14750 93755 95671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 96916 95675 gene locus_tag LOCUS_14760 96916 95675 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871137.1 protein_id gnl|my_center|LOCUS_14760 97071 97637 gene locus_tag LOCUS_14770 97071 97637 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020463.1 protein_id gnl|my_center|LOCUS_14770 97761 98138 gene locus_tag LOCUS_14780 97761 98138 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669403.1 protein_id gnl|my_center|LOCUS_14780 98812 99174 gene locus_tag LOCUS_14790 98812 99174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 99294 100097 gene locus_tag LOCUS_14800 gene thiM 99294 100097 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256281.1 protein_id gnl|my_center|LOCUS_14800 100094 100726 gene locus_tag LOCUS_14810 gene thiE 100094 100726 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_14810 101312 100704 gene locus_tag LOCUS_14820 101312 100704 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249090.1 protein_id gnl|my_center|LOCUS_14820 103123 101309 gene locus_tag LOCUS_14830 gene iorA 103123 101309 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877454.1 protein_id gnl|my_center|LOCUS_14830 104013 103135 gene locus_tag LOCUS_14840 104013 103135 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868480.1 protein_id gnl|my_center|LOCUS_14840 105163 104006 gene locus_tag LOCUS_14850 gene porA 105163 104006 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 protein_id gnl|my_center|LOCUS_14850 105429 105160 gene locus_tag LOCUS_14860 105429 105160 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868482.1 protein_id gnl|my_center|LOCUS_14860 105986 105426 gene locus_tag LOCUS_14870 gene porC 105986 105426 CDS product pyruvate synthase subunit PorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892553.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence09 312 1247 gene locus_tag LOCUS_14880 312 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1331 2338 gene locus_tag LOCUS_14890 gene mtnA 1331 2338 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166394793.1 protein_id gnl|my_center|LOCUS_14890 2349 2963 gene locus_tag LOCUS_14900 2349 2963 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_14900 2976 4058 gene locus_tag LOCUS_14910 2976 4058 CDS product C/D box methylation guide ribonucleoprotein complex aNOP56 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014546.1 protein_id gnl|my_center|LOCUS_14910 4132 4512 gene locus_tag LOCUS_14920 gene eif5A 4132 4512 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878148.1 protein_id gnl|my_center|LOCUS_14920 6527 5166 gene locus_tag LOCUS_14930 gene glmM 6527 5166 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877965.1 protein_id gnl|my_center|LOCUS_14930 8233 7268 gene locus_tag LOCUS_14940 8233 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 8462 8247 gene locus_tag LOCUS_14950 8462 8247 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295846.1 protein_id gnl|my_center|LOCUS_14950 9076 8570 gene locus_tag LOCUS_14960 gene scpB 9076 8570 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879077.1 protein_id gnl|my_center|LOCUS_14960 9956 9078 gene locus_tag LOCUS_14970 9956 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 13558 9953 gene locus_tag LOCUS_14980 gene smc 13558 9953 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024214.1 protein_id gnl|my_center|LOCUS_14980 14505 13672 gene locus_tag LOCUS_14990 14505 13672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 15133 14495 gene locus_tag LOCUS_15000 15133 14495 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024506.1 protein_id gnl|my_center|LOCUS_15000 16065 15175 gene locus_tag LOCUS_15010 gene folD 16065 15175 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_15010 16207 16371 gene locus_tag LOCUS_15020 16207 16371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 16405 16737 gene locus_tag LOCUS_15030 16405 16737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 16776 17030 gene locus_tag LOCUS_15040 16776 17030 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012980461.1 protein_id gnl|my_center|LOCUS_15040 17058 17132 gene locus_tag LOCUS_t00310 17058 17132 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17191 17523 gene locus_tag LOCUS_15050 17191 17523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 17864 18250 gene locus_tag LOCUS_15060 17864 18250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 20306 18399 gene locus_tag LOCUS_15070 20306 18399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 20557 21528 gene locus_tag LOCUS_15080 gene rtcA 20557 21528 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024505.1 protein_id gnl|my_center|LOCUS_15080 21534 22172 gene locus_tag LOCUS_15090 21534 22172 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496578.1 protein_id gnl|my_center|LOCUS_15090 23076 22144 gene locus_tag LOCUS_15100 23076 22144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 24095 23163 gene locus_tag LOCUS_15110 24095 23163 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020659.1 protein_id gnl|my_center|LOCUS_15110 24330 24061 gene locus_tag LOCUS_15120 24330 24061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 25979 24465 gene locus_tag LOCUS_15130 25979 24465 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020142.1 protein_id gnl|my_center|LOCUS_15130 28102 25976 gene locus_tag LOCUS_15140 28102 25976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 30218 28089 gene locus_tag LOCUS_15150 gene ppk1 30218 28089 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755861.1 protein_id gnl|my_center|LOCUS_15150 30648 30869 gene locus_tag LOCUS_15160 30648 30869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 31230 34979 gene locus_tag LOCUS_15170 31230 34979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 35003 35266 gene locus_tag LOCUS_15180 35003 35266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 35276 36691 gene locus_tag LOCUS_15190 35276 36691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 36757 37968 gene locus_tag LOCUS_15200 36757 37968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 38088 38174 gene locus_tag LOCUS_t00320 38088 38174 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 39478 38306 gene locus_tag LOCUS_15210 39478 38306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 39665 40747 gene locus_tag LOCUS_15220 39665 40747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 40744 41676 gene locus_tag LOCUS_15230 40744 41676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250530.1 protein_id gnl|my_center|LOCUS_15230 42037 41894 gene locus_tag LOCUS_15240 42037 41894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 42394 42059 gene locus_tag LOCUS_15250 42394 42059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence10 348 557 gene locus_tag LOCUS_15260 348 557 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989432.1 protein_id gnl|my_center|LOCUS_15260 1143 637 gene locus_tag LOCUS_15270 gene ilvN 1143 637 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006862451.1 protein_id gnl|my_center|LOCUS_15270 2875 1148 gene locus_tag LOCUS_15280 gene ilvB 2875 1148 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458814.1 protein_id gnl|my_center|LOCUS_15280 3797 3051 gene locus_tag LOCUS_15290 3797 3051 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 protein_id gnl|my_center|LOCUS_15290 4681 3794 gene locus_tag LOCUS_15300 4681 3794 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867784.1 protein_id gnl|my_center|LOCUS_15300 4948 6246 gene locus_tag LOCUS_15310 4948 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 6328 7428 gene locus_tag LOCUS_15320 6328 7428 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_15320 7430 8254 gene locus_tag LOCUS_15330 7430 8254 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990612.1 protein_id gnl|my_center|LOCUS_15330 8279 12004 gene locus_tag LOCUS_15340 gene cobN 8279 12004 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496657.1 protein_id gnl|my_center|LOCUS_15340 12088 12624 gene locus_tag LOCUS_15350 12088 12624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 13049 17227 gene locus_tag LOCUS_15360 13049 17227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 17633 17409 gene locus_tag LOCUS_15370 17633 17409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 17722 18090 gene locus_tag LOCUS_15380 17722 18090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 19546 18227 gene locus_tag LOCUS_15390 gene aspS 19546 18227 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868079.1 protein_id gnl|my_center|LOCUS_15390 20404 20970 gene locus_tag LOCUS_15400 20404 20970 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836848.1 protein_id gnl|my_center|LOCUS_15400 21485 21859 gene locus_tag LOCUS_15410 21485 21859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 22308 21907 gene locus_tag LOCUS_15420 22308 21907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 22873 22400 gene locus_tag LOCUS_15430 22873 22400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 23231 23097 gene locus_tag LOCUS_15440 23231 23097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 23470 23694 gene locus_tag LOCUS_15450 23470 23694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 23810 24952 gene locus_tag LOCUS_15460 gene fbp 23810 24952 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877293.1 protein_id gnl|my_center|LOCUS_15460 24945 25622 gene locus_tag LOCUS_15470 gene tpiA 24945 25622 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 protein_id gnl|my_center|LOCUS_15470 25849 26484 gene locus_tag LOCUS_15480 25849 26484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 28810 26594 gene locus_tag LOCUS_15490 28810 26594 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461087.1 protein_id gnl|my_center|LOCUS_15490 29957 28803 gene locus_tag LOCUS_15500 29957 28803 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461088.1 protein_id gnl|my_center|LOCUS_15500 30709 30560 gene locus_tag LOCUS_15510 30709 30560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 33242 30999 gene locus_tag LOCUS_15520 33242 30999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 33810 33235 gene locus_tag LOCUS_15530 33810 33235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 34192 33833 gene locus_tag LOCUS_15540 34192 33833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 34312 36672 gene locus_tag LOCUS_15550 34312 36672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 37015 37980 gene locus_tag LOCUS_15560 37015 37980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence11 1686 181 gene locus_tag LOCUS_15570 1686 181 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020229.1 protein_id gnl|my_center|LOCUS_15570 2836 1718 gene locus_tag LOCUS_15580 2836 1718 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762209.1 protein_id gnl|my_center|LOCUS_15580 3465 2926 gene locus_tag LOCUS_15590 3465 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 4664 3474 gene locus_tag LOCUS_15600 4664 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 4903 5265 gene locus_tag LOCUS_15610 4903 5265 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867655.1 protein_id gnl|my_center|LOCUS_15610 5270 5689 gene locus_tag LOCUS_15620 gene rplM 5270 5689 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878624.1 protein_id gnl|my_center|LOCUS_15620 5694 6095 gene locus_tag LOCUS_15630 5694 6095 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_15630 6102 6293 gene locus_tag LOCUS_15640 6102 6293 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867658.1 protein_id gnl|my_center|LOCUS_15640 6332 6407 gene locus_tag LOCUS_t00330 6332 6407 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6750 6917 gene locus_tag LOCUS_15650 6750 6917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 7243 7449 gene locus_tag LOCUS_15660 7243 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 7439 8572 gene locus_tag LOCUS_15670 7439 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 8569 9432 gene locus_tag LOCUS_15680 8569 9432 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255985.1 protein_id gnl|my_center|LOCUS_15680 9429 9692 gene locus_tag LOCUS_15690 9429 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 9694 9942 gene locus_tag LOCUS_15700 9694 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 9939 10127 gene locus_tag LOCUS_15710 9939 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 10127 10363 gene locus_tag LOCUS_15720 10127 10363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 10363 10722 gene locus_tag LOCUS_15730 10363 10722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 10722 11357 gene locus_tag LOCUS_15740 10722 11357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 11439 11726 gene locus_tag LOCUS_15750 11439 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 12578 11730 gene locus_tag LOCUS_15760 12578 11730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 12841 15123 gene locus_tag LOCUS_15770 12841 15123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 15120 17054 gene locus_tag LOCUS_15780 15120 17054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 17059 18957 gene locus_tag LOCUS_15790 17059 18957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 18936 19097 gene locus_tag LOCUS_15800 18936 19097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 19094 19906 gene locus_tag LOCUS_15810 19094 19906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 19903 20433 gene locus_tag LOCUS_15820 19903 20433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 20430 21437 gene locus_tag LOCUS_15830 20430 21437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 21593 21946 gene locus_tag LOCUS_15840 21593 21946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 21943 22095 gene locus_tag LOCUS_15850 21943 22095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 22243 22476 gene locus_tag LOCUS_15860 22243 22476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 22786 22628 gene locus_tag LOCUS_15870 22786 22628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 22875 23114 gene locus_tag LOCUS_15880 22875 23114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 23317 23108 gene locus_tag LOCUS_15890 23317 23108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 23672 23292 gene locus_tag LOCUS_15900 23672 23292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 24362 24159 gene locus_tag LOCUS_15910 24362 24159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 24500 24673 gene locus_tag LOCUS_15920 24500 24673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 24695 25006 gene locus_tag LOCUS_15930 24695 25006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 25323 25087 gene locus_tag LOCUS_15940 25323 25087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 25366 25815 gene locus_tag LOCUS_15950 25366 25815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 26616 26314 gene locus_tag LOCUS_15960 26616 26314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 26943 26746 gene locus_tag LOCUS_15970 26943 26746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 26942 27202 gene locus_tag LOCUS_15980 26942 27202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 27199 27477 gene locus_tag LOCUS_15990 27199 27477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 27490 28431 gene locus_tag LOCUS_16000 27490 28431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 29027 28656 gene locus_tag LOCUS_16010 29027 28656 CDS product ech hydrogenase subunit EchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937736.1 protein_id gnl|my_center|LOCUS_16010 30106 29027 gene locus_tag LOCUS_16020 30106 29027 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937737.1 protein_id gnl|my_center|LOCUS_16020 30488 30108 gene locus_tag LOCUS_16030 30488 30108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 30931 30485 gene locus_tag LOCUS_16040 30931 30485 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937739.1 protein_id gnl|my_center|LOCUS_16040 31815 30943 gene locus_tag LOCUS_16050 31815 30943 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937740.1 protein_id gnl|my_center|LOCUS_16050 33719 31812 gene locus_tag LOCUS_16060 33719 31812 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937741.1 protein_id gnl|my_center|LOCUS_16060 35196 33988 gene locus_tag LOCUS_16070 35196 33988 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_16070 35933 35238 gene locus_tag LOCUS_16080 35933 35238 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792164.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence12 <1 2027 gene locus_tag LOCUS_16090 <1 2027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015942796.1:InlB B-repeat-containing protein 2105 3502 gene locus_tag LOCUS_16100 2105 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 5474 3795 gene locus_tag LOCUS_16110 gene gltX 5474 3795 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870894.1 protein_id gnl|my_center|LOCUS_16110 5598 6824 gene locus_tag LOCUS_16120 5598 6824 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249880.1 protein_id gnl|my_center|LOCUS_16120 7709 7029 gene locus_tag LOCUS_16130 7709 7029 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813444.1 protein_id gnl|my_center|LOCUS_16130 8605 7739 gene locus_tag LOCUS_16140 8605 7739 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166996.1 protein_id gnl|my_center|LOCUS_16140 10131 8785 gene locus_tag LOCUS_16150 10131 8785 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861931.1 protein_id gnl|my_center|LOCUS_16150 10574 10128 gene locus_tag LOCUS_16160 10574 10128 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048431.1 protein_id gnl|my_center|LOCUS_16160 11411 10875 gene locus_tag LOCUS_16170 11411 10875 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860658.1 protein_id gnl|my_center|LOCUS_16170 11505 12722 gene locus_tag LOCUS_16180 11505 12722 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868127.1 protein_id gnl|my_center|LOCUS_16180 12732 13877 gene locus_tag LOCUS_16190 12732 13877 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053095240.1 protein_id gnl|my_center|LOCUS_16190 13864 14658 gene locus_tag LOCUS_16200 13864 14658 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877937.1 protein_id gnl|my_center|LOCUS_16200 15191 14712 gene locus_tag LOCUS_16210 15191 14712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814545.1 protein_id gnl|my_center|LOCUS_16210 16391 15207 gene locus_tag LOCUS_16220 16391 15207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 17773 16472 gene locus_tag LOCUS_16230 17773 16472 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056381.1 protein_id gnl|my_center|LOCUS_16230 18591 18241 gene locus_tag LOCUS_16240 18591 18241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 19654 18557 gene locus_tag LOCUS_16250 19654 18557 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146544.1 protein_id gnl|my_center|LOCUS_16250 20196 19651 gene locus_tag LOCUS_16260 20196 19651 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023327.1 protein_id gnl|my_center|LOCUS_16260 20843 20385 gene locus_tag LOCUS_16270 20843 20385 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861143.1 protein_id gnl|my_center|LOCUS_16270 21059 21409 gene locus_tag LOCUS_16280 21059 21409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 21985 21599 gene locus_tag LOCUS_16290 21985 21599 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060955.1 protein_id gnl|my_center|LOCUS_16290 22071 22973 gene locus_tag LOCUS_16300 gene nadA 22071 22973 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020997.1 protein_id gnl|my_center|LOCUS_16300 23001 24497 gene locus_tag LOCUS_16310 23001 24497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 24529 24990 gene locus_tag LOCUS_16320 24529 24990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 25201 25971 gene locus_tag LOCUS_16330 25201 25971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 25965 26522 gene locus_tag LOCUS_16340 25965 26522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 26659 27645 gene locus_tag LOCUS_16350 26659 27645 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066493.1 protein_id gnl|my_center|LOCUS_16350 27645 28697 gene locus_tag LOCUS_16360 27645 28697 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065319.1 protein_id gnl|my_center|LOCUS_16360 28704 29540 gene locus_tag LOCUS_16370 28704 29540 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_16370 29554 29817 gene locus_tag LOCUS_16380 29554 29817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 30142 29930 gene locus_tag LOCUS_16390 30142 29930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence13 1782 250 gene locus_tag LOCUS_16400 1782 250 CDS product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876525.1 protein_id gnl|my_center|LOCUS_16400 3184 1775 gene locus_tag LOCUS_16410 gene dnaG 3184 1775 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867599.1 protein_id gnl|my_center|LOCUS_16410 3659 3459 gene locus_tag LOCUS_16420 3659 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 3860 3669 gene locus_tag LOCUS_16430 3860 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 4210 5724 gene locus_tag LOCUS_16440 4210 5724 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203343.1 protein_id gnl|my_center|LOCUS_16440 5956 7050 gene locus_tag LOCUS_16450 5956 7050 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_16450 7041 7814 gene locus_tag LOCUS_16460 7041 7814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_16460 7828 9195 gene locus_tag LOCUS_16470 7828 9195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 9253 10620 gene locus_tag LOCUS_16480 9253 10620 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023126.1 protein_id gnl|my_center|LOCUS_16480 11114 10617 gene locus_tag LOCUS_16490 11114 10617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 11283 12029 gene locus_tag LOCUS_16500 11283 12029 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065321.1 protein_id gnl|my_center|LOCUS_16500 12825 12085 gene locus_tag LOCUS_16510 12825 12085 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023383.1 protein_id gnl|my_center|LOCUS_16510 15400 12947 gene locus_tag LOCUS_16520 15400 12947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 15645 16379 gene locus_tag LOCUS_16530 15645 16379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 16519 16908 gene locus_tag LOCUS_16540 16519 16908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 16922 17332 gene locus_tag LOCUS_16550 16922 17332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 18016 17324 gene locus_tag LOCUS_16560 18016 17324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16560 19175 17991 gene locus_tag LOCUS_16570 19175 17991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16570 19345 22440 gene locus_tag LOCUS_16580 gene leuS 19345 22440 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879908.1 protein_id gnl|my_center|LOCUS_16580 22982 22443 gene locus_tag LOCUS_16590 22982 22443 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249464.1 protein_id gnl|my_center|LOCUS_16590 24026 24295 gene locus_tag LOCUS_16600 24026 24295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 24749 25177 gene locus_tag LOCUS_16610 24749 25177 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870197.1 protein_id gnl|my_center|LOCUS_16610 25200 25541 gene locus_tag LOCUS_16620 25200 25541 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064758.1 protein_id gnl|my_center|LOCUS_16620 25708 25992 gene locus_tag LOCUS_16630 25708 25992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 26010 26666 gene locus_tag LOCUS_16640 26010 26666 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879557.1 protein_id gnl|my_center|LOCUS_16640 27339 26704 gene locus_tag LOCUS_16650 27339 26704 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583839.1 protein_id gnl|my_center|LOCUS_16650 27373 27597 gene locus_tag LOCUS_16660 27373 27597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 27594 28715 gene locus_tag LOCUS_16670 27594 28715 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879550.1 protein_id gnl|my_center|LOCUS_16670 28722 29363 gene locus_tag LOCUS_16680 28722 29363 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022401.1 protein_id gnl|my_center|LOCUS_16680 29655 29338 gene locus_tag LOCUS_16690 gene cutA 29655 29338 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080448.1 protein_id gnl|my_center|LOCUS_16690 29732 31327 gene locus_tag LOCUS_16700 29732 31327 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878819.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence14 3 2846 gene locus_tag LOCUS_16710 3 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 5334 3070 gene locus_tag LOCUS_16720 5334 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 5418 5503 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6628 6701 gene locus_tag LOCUS_t00340 6628 6701 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7436 7618 gene locus_tag LOCUS_16730 7436 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 8258 8461 gene locus_tag LOCUS_16740 8258 8461 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814946.1 protein_id gnl|my_center|LOCUS_16740 8553 8981 gene locus_tag LOCUS_16750 8553 8981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 9945 8992 gene locus_tag LOCUS_16760 gene msrB 9945 8992 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203359.1 protein_id gnl|my_center|LOCUS_16760 10229 10056 gene locus_tag LOCUS_16770 10229 10056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 10807 10229 gene locus_tag LOCUS_16780 10807 10229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 11133 10804 gene locus_tag LOCUS_16790 11133 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 13519 11780 gene locus_tag LOCUS_16800 13519 11780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 14570 13641 gene locus_tag LOCUS_16810 14570 13641 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775527.1 protein_id gnl|my_center|LOCUS_16810 14854 16215 gene locus_tag LOCUS_16820 14854 16215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 16226 17242 gene locus_tag LOCUS_16830 16226 17242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 17239 18534 gene locus_tag LOCUS_16840 17239 18534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 18534 20438 gene locus_tag LOCUS_16850 18534 20438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 20435 21280 gene locus_tag LOCUS_16860 20435 21280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 21277 21729 gene locus_tag LOCUS_16870 21277 21729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 21719 22246 gene locus_tag LOCUS_16880 21719 22246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 22243 23316 gene locus_tag LOCUS_16890 22243 23316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 23457 24455 gene locus_tag LOCUS_16900 23457 24455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 24452 24799 gene locus_tag LOCUS_16910 24452 24799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 25452 25207 gene locus_tag LOCUS_16920 25452 25207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 25581 28037 gene locus_tag LOCUS_16930 25581 28037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 25584 25674 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28270 28289 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence15 67 207 gene locus_tag LOCUS_16940 67 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 275 457 gene locus_tag LOCUS_16950 275 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1610 1759 gene locus_tag LOCUS_16960 1610 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 2328 2516 gene locus_tag LOCUS_16970 2328 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 18419 18487 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence16 824 898 gene locus_tag LOCUS_t00350 824 898 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1126 1569 gene locus_tag LOCUS_16980 1126 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 2813 1632 gene locus_tag LOCUS_16990 2813 1632 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020733.1 protein_id gnl|my_center|LOCUS_16990 2990 4780 gene locus_tag LOCUS_17000 2990 4780 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937741.1 protein_id gnl|my_center|LOCUS_17000 4781 5605 gene locus_tag LOCUS_17010 4781 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 5602 6099 gene locus_tag LOCUS_17020 5602 6099 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937739.1 protein_id gnl|my_center|LOCUS_17020 6011 6337 gene locus_tag LOCUS_17030 6011 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 6334 7407 gene locus_tag LOCUS_17040 6334 7407 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937737.1 protein_id gnl|my_center|LOCUS_17040 7413 7757 gene locus_tag LOCUS_17050 7413 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 7819 8703 gene locus_tag LOCUS_17060 7819 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 9140 10189 gene locus_tag LOCUS_17070 9140 10189 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_17070 10337 11644 gene locus_tag LOCUS_17080 10337 11644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 11907 11578 gene locus_tag LOCUS_17090 11907 11578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 12825 11950 gene locus_tag LOCUS_17100 12825 11950 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228395.1 protein_id gnl|my_center|LOCUS_17100 12915 14120 gene locus_tag LOCUS_17110 12915 14120 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545699.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence17 638 237 gene locus_tag LOCUS_17120 638 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1082 1978 gene locus_tag LOCUS_17130 1082 1978 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393480.1 protein_id gnl|my_center|LOCUS_17130 1978 2787 gene locus_tag LOCUS_17140 1978 2787 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086077.1 protein_id gnl|my_center|LOCUS_17140 2784 3767 gene locus_tag LOCUS_17150 2784 3767 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974852.1 protein_id gnl|my_center|LOCUS_17150 3776 4810 gene locus_tag LOCUS_17160 3776 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 4938 5381 gene locus_tag LOCUS_17170 4938 5381 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358219.1 protein_id gnl|my_center|LOCUS_17170 5386 6366 gene locus_tag LOCUS_17180 5386 6366 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345599.1 protein_id gnl|my_center|LOCUS_17180 7203 6385 gene locus_tag LOCUS_17190 7203 6385 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_17190 8370 7204 gene locus_tag LOCUS_17200 8370 7204 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_17200 8881 8393 gene locus_tag LOCUS_17210 8881 8393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 10222 8918 gene locus_tag LOCUS_17220 10222 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 10648 11037 gene locus_tag LOCUS_17230 10648 11037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence18 655 582 gene locus_tag LOCUS_t00360 655 582 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 767 1630 gene locus_tag LOCUS_17240 767 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1627 2187 gene locus_tag LOCUS_17250 1627 2187 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496456.1 protein_id gnl|my_center|LOCUS_17250 2263 3174 gene locus_tag LOCUS_17260 2263 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 3222 4040 gene locus_tag LOCUS_17270 3222 4040 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060166.1 protein_id gnl|my_center|LOCUS_17270 4105 6045 gene locus_tag LOCUS_17280 4105 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 6045 6971 gene locus_tag LOCUS_17290 6045 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 7000 7425 gene locus_tag LOCUS_17300 7000 7425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 8861 7431 gene locus_tag LOCUS_17310 8861 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 9568 9245 gene locus_tag LOCUS_17320 9568 9245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence19 940 611 gene locus_tag LOCUS_17330 940 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1040 2962 gene locus_tag LOCUS_17340 gene rqcH 1040 2962 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871150.1 protein_id gnl|my_center|LOCUS_17340 3042 2968 gene locus_tag LOCUS_t00370 3042 2968 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3389 3198 gene locus_tag LOCUS_17350 3389 3198 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251242.1 protein_id gnl|my_center|LOCUS_17350 3487 4287 gene locus_tag LOCUS_17360 3487 4287 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020095.1 protein_id gnl|my_center|LOCUS_17360 4954 4265 gene locus_tag LOCUS_17370 gene thyX 4954 4265 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459086.1 protein_id gnl|my_center|LOCUS_17370 5711 4989 gene locus_tag LOCUS_17380 5711 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 5814 6500 gene locus_tag LOCUS_17390 5814 6500 CDS product HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147184.1 protein_id gnl|my_center|LOCUS_17390 7012 6491 gene locus_tag LOCUS_17400 7012 6491 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876461.1 protein_id gnl|my_center|LOCUS_17400 8853 7411 gene locus_tag LOCUS_17410 8853 7411 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence20 666 1097 gene locus_tag LOCUS_17420 666 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 2556 1525 gene locus_tag LOCUS_17430 gene hypE 2556 1525 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870181.1 protein_id gnl|my_center|LOCUS_17430 2670 3242 gene locus_tag LOCUS_17440 2670 3242 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966771.1 protein_id gnl|my_center|LOCUS_17440 3293 3913 gene locus_tag LOCUS_17450 3293 3913 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948225.1 protein_id gnl|my_center|LOCUS_17450 3939 5156 gene locus_tag LOCUS_17460 3939 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 5188 6294 gene locus_tag LOCUS_17470 5188 6294 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869579.1 protein_id gnl|my_center|LOCUS_17470 6363 6438 gene locus_tag LOCUS_t00380 6363 6438 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence21 1188 580 gene locus_tag LOCUS_17480 gene tmk 1188 580 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024311.1 protein_id gnl|my_center|LOCUS_17480 1622 1215 gene locus_tag LOCUS_17490 1622 1215 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023990.1 protein_id gnl|my_center|LOCUS_17490 1920 1588 gene locus_tag LOCUS_17500 1920 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 3087 1930 gene locus_tag LOCUS_17510 3087 1930 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143005.1 protein_id gnl|my_center|LOCUS_17510 4886 3222 gene locus_tag LOCUS_17520 4886 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 6756 5368 gene locus_tag LOCUS_17530 6756 5368 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence22 >Feature sequence23 4066 2981 gene locus_tag LOCUS_17540 4066 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence24 >Feature sequence25 431 150 gene locus_tag LOCUS_17550 431 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 538 1500 gene locus_tag LOCUS_17560 538 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1520 1963 gene locus_tag LOCUS_17570 gene rimI 1520 1963 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868792.1 protein_id gnl|my_center|LOCUS_17570 2057 3256 gene locus_tag LOCUS_17580 2057 3256 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972257.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence26 >Feature sequence27 >Feature sequence28 >Feature sequence29