>Feature sequence001 4222 350 gene locus_tag LOCUS_00010 4222 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00010 10599 4219 gene locus_tag LOCUS_00020 10599 4219 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503026.1 protein_id gnl|my_center|LOCUS_00020 18984 10615 gene locus_tag LOCUS_00030 18984 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00030 19734 31439 gene locus_tag LOCUS_00040 19734 31439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 31664 42061 gene locus_tag LOCUS_00050 31664 42061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 42093 42848 gene locus_tag LOCUS_00060 42093 42848 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_00060 43013 50875 gene locus_tag LOCUS_00070 43013 50875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 51099 52715 gene locus_tag LOCUS_00080 51099 52715 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_00080 52754 53767 gene locus_tag LOCUS_00090 52754 53767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 53844 54779 gene locus_tag LOCUS_00100 53844 54779 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095959.1 protein_id gnl|my_center|LOCUS_00100 58375 55133 gene locus_tag LOCUS_00110 58375 55133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 58814 59503 gene locus_tag LOCUS_00120 58814 59503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 60099 61043 gene locus_tag LOCUS_00130 60099 61043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 61875 61135 gene locus_tag LOCUS_00140 61875 61135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 63179 62031 gene locus_tag LOCUS_00150 gene dnaN 63179 62031 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058182.1 protein_id gnl|my_center|LOCUS_00150 63584 64885 gene locus_tag LOCUS_00160 gene hemL 63584 64885 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797681.1 protein_id gnl|my_center|LOCUS_00160 65411 65791 gene locus_tag LOCUS_00170 65411 65791 CDS product DUF1830 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057308.1 protein_id gnl|my_center|LOCUS_00170 68427 65800 gene locus_tag LOCUS_00180 68427 65800 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144168.1 protein_id gnl|my_center|LOCUS_00180 >Feature sequence002 <1 1282 gene locus_tag LOCUS_00190 <1 1282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057577.1:Fe(2+) transporter permease subunit FeoB 1392 1631 gene locus_tag LOCUS_00200 1392 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 1756 2304 gene locus_tag LOCUS_00210 1756 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 2316 4478 gene locus_tag LOCUS_00220 2316 4478 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056504.1 protein_id gnl|my_center|LOCUS_00220 4475 4639 gene locus_tag LOCUS_00230 4475 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 4878 5186 gene locus_tag LOCUS_00240 4878 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 5392 6375 gene locus_tag LOCUS_00250 5392 6375 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057563.1 protein_id gnl|my_center|LOCUS_00250 6765 6514 gene locus_tag LOCUS_00260 6765 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 7337 6777 gene locus_tag LOCUS_00270 7337 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 8488 8033 gene locus_tag LOCUS_00280 8488 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 8882 8652 gene locus_tag LOCUS_00290 8882 8652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 9730 9014 gene locus_tag LOCUS_00300 9730 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892606.1 protein_id gnl|my_center|LOCUS_00300 10543 9734 gene locus_tag LOCUS_00310 10543 9734 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125718.1 protein_id gnl|my_center|LOCUS_00310 11322 10543 gene locus_tag LOCUS_00320 11322 10543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 12820 11852 gene locus_tag LOCUS_00330 12820 11852 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_00330 14875 13019 gene locus_tag LOCUS_00340 gene thrS 14875 13019 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216087114.1 protein_id gnl|my_center|LOCUS_00340 16825 15224 gene locus_tag LOCUS_00350 16825 15224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 18085 17342 gene locus_tag LOCUS_00360 18085 17342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 18718 18206 gene locus_tag LOCUS_00370 gene fldA 18718 18206 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140318.1 protein_id gnl|my_center|LOCUS_00370 20013 18985 gene locus_tag LOCUS_00380 20013 18985 CDS product chlorophyll a/b binding light-harvesting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921141.1 protein_id gnl|my_center|LOCUS_00380 21039 20473 gene locus_tag LOCUS_00390 21039 20473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 20990 21778 gene locus_tag LOCUS_00400 gene rncS 20990 21778 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_00400 22574 21795 gene locus_tag LOCUS_00410 22574 21795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 22745 23788 gene locus_tag LOCUS_00420 22745 23788 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_00420 23800 24141 gene locus_tag LOCUS_00430 23800 24141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 24161 25003 gene locus_tag LOCUS_00440 gene cysT 24161 25003 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056130.1 protein_id gnl|my_center|LOCUS_00440 25038 25880 gene locus_tag LOCUS_00450 gene cysW 25038 25880 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056131.1 protein_id gnl|my_center|LOCUS_00450 25997 27034 gene locus_tag LOCUS_00460 25997 27034 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057527.1 protein_id gnl|my_center|LOCUS_00460 27491 28678 gene locus_tag LOCUS_00470 27491 28678 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_00470 28703 29314 gene locus_tag LOCUS_00480 28703 29314 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986868.1 protein_id gnl|my_center|LOCUS_00480 32109 29473 gene locus_tag LOCUS_00490 32109 29473 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 protein_id gnl|my_center|LOCUS_00490 32114 32551 gene locus_tag LOCUS_00500 32114 32551 CDS product DUF4079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144373.1 protein_id gnl|my_center|LOCUS_00500 32654 33745 gene locus_tag LOCUS_00510 32654 33745 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_00510 34968 34048 gene locus_tag LOCUS_00520 34968 34048 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530028.1 protein_id gnl|my_center|LOCUS_00520 35103 36902 gene locus_tag LOCUS_00530 gene thrS 35103 36902 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216087114.1 protein_id gnl|my_center|LOCUS_00530 37285 36989 gene locus_tag LOCUS_00540 37285 36989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007358131.1 protein_id gnl|my_center|LOCUS_00540 37623 38348 gene locus_tag LOCUS_00550 37623 38348 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057336.1 protein_id gnl|my_center|LOCUS_00550 38361 38942 gene locus_tag LOCUS_00560 gene coaE 38361 38942 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124208.1 protein_id gnl|my_center|LOCUS_00560 39782 38952 gene locus_tag LOCUS_00570 39782 38952 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641277.1 protein_id gnl|my_center|LOCUS_00570 42164 39996 gene locus_tag LOCUS_00580 42164 39996 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920783.1 protein_id gnl|my_center|LOCUS_00580 42366 42920 gene locus_tag LOCUS_00590 gene cysC 42366 42920 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256588.1 protein_id gnl|my_center|LOCUS_00590 43016 44743 gene locus_tag LOCUS_00600 43016 44743 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142325.1 protein_id gnl|my_center|LOCUS_00600 46086 45139 gene locus_tag LOCUS_00610 46086 45139 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056589.1 protein_id gnl|my_center|LOCUS_00610 47570 46506 gene locus_tag LOCUS_00620 gene hemE 47570 46506 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125231.1 protein_id gnl|my_center|LOCUS_00620 49880 47661 gene locus_tag LOCUS_00630 49880 47661 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_00630 >Feature sequence003 201 1079 gene locus_tag LOCUS_00640 201 1079 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057794.1 protein_id gnl|my_center|LOCUS_00640 1217 2893 gene locus_tag LOCUS_00650 gene ribBA 1217 2893 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920923.1 protein_id gnl|my_center|LOCUS_00650 2960 3661 gene locus_tag LOCUS_00660 2960 3661 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_00660 4777 3719 gene locus_tag LOCUS_00670 4777 3719 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056373.1 protein_id gnl|my_center|LOCUS_00670 6046 5045 gene locus_tag LOCUS_00680 6046 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 6651 6049 gene locus_tag LOCUS_00690 6651 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 7018 6833 gene locus_tag LOCUS_00700 7018 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 7769 7635 gene locus_tag LOCUS_00710 7769 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 9883 7961 gene locus_tag LOCUS_00720 9883 7961 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_00720 10126 10051 gene locus_tag LOCUS_t00010 10126 10051 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 11422 10217 gene locus_tag LOCUS_00730 11422 10217 CDS product FAD-dependent hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921015.1 protein_id gnl|my_center|LOCUS_00730 12867 11734 gene locus_tag LOCUS_00740 12867 11734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 14072 12837 gene locus_tag LOCUS_00750 14072 12837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 14462 14103 gene locus_tag LOCUS_00760 14462 14103 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289874.1 protein_id gnl|my_center|LOCUS_00760 14652 14443 gene locus_tag LOCUS_00770 14652 14443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 18193 14792 gene locus_tag LOCUS_00780 18193 14792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 18742 18347 gene locus_tag LOCUS_00790 18742 18347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 19073 18747 gene locus_tag LOCUS_00800 19073 18747 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199884.1 protein_id gnl|my_center|LOCUS_00800 19510 19196 gene locus_tag LOCUS_00810 19510 19196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 19989 19558 gene locus_tag LOCUS_00820 19989 19558 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_00820 20355 19990 gene locus_tag LOCUS_00830 20355 19990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 20520 20864 gene locus_tag LOCUS_00840 20520 20864 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_00840 20851 21213 gene locus_tag LOCUS_00850 20851 21213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 23902 21662 gene locus_tag LOCUS_00860 23902 21662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 24368 24652 gene locus_tag LOCUS_00870 24368 24652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 24642 25052 gene locus_tag LOCUS_00880 24642 25052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00880 25483 26325 gene locus_tag LOCUS_00890 25483 26325 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 protein_id gnl|my_center|LOCUS_00890 26675 26451 gene locus_tag LOCUS_00900 26675 26451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940650.1 protein_id gnl|my_center|LOCUS_00900 27059 26986 gene locus_tag LOCUS_t00020 27059 26986 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 29004 27151 gene locus_tag LOCUS_00910 29004 27151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 29742 31445 gene locus_tag LOCUS_00920 gene hflX 29742 31445 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144128.1 protein_id gnl|my_center|LOCUS_00920 32895 31783 gene locus_tag LOCUS_00930 32895 31783 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_00930 33193 33969 gene locus_tag LOCUS_00940 gene fetB 33193 33969 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_00940 35103 34087 gene locus_tag LOCUS_00950 35103 34087 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140533.1 protein_id gnl|my_center|LOCUS_00950 35513 36940 gene locus_tag LOCUS_00960 gene murC 35513 36940 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056226.1 protein_id gnl|my_center|LOCUS_00960 37227 38105 gene locus_tag LOCUS_00970 gene murB 37227 38105 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056225.1 protein_id gnl|my_center|LOCUS_00970 39267 38494 gene locus_tag LOCUS_00980 39267 38494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 40002 39760 gene locus_tag LOCUS_00990 40002 39760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 40228 41940 gene locus_tag LOCUS_01000 40228 41940 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041470421.1 protein_id gnl|my_center|LOCUS_01000 41941 42897 gene locus_tag LOCUS_01010 41941 42897 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256681.1 protein_id gnl|my_center|LOCUS_01010 42900 43262 gene locus_tag LOCUS_01020 42900 43262 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143896.1 protein_id gnl|my_center|LOCUS_01020 43281 44009 gene locus_tag LOCUS_01030 43281 44009 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055907.1 protein_id gnl|my_center|LOCUS_01030 44060 45403 gene locus_tag LOCUS_01040 44060 45403 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056530.1 protein_id gnl|my_center|LOCUS_01040 45524 46381 gene locus_tag LOCUS_01050 45524 46381 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057406.1 protein_id gnl|my_center|LOCUS_01050 47212 46382 gene locus_tag LOCUS_01060 47212 46382 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057037.1 protein_id gnl|my_center|LOCUS_01060 47827 48000 gene locus_tag LOCUS_01070 47827 48000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 >Feature sequence004 788 60 gene locus_tag LOCUS_01080 788 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 3475 791 gene locus_tag LOCUS_01090 3475 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 3558 3962 gene locus_tag LOCUS_01100 3558 3962 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_01100 4733 4041 gene locus_tag LOCUS_01110 4733 4041 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058294.1 protein_id gnl|my_center|LOCUS_01110 6449 4797 gene locus_tag LOCUS_01120 gene dndC 6449 4797 CDS product DNA phosphorothioation system sulfurtransferase DndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109921.1 protein_id gnl|my_center|LOCUS_01120 7341 6454 gene locus_tag LOCUS_01130 7341 6454 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199879.1 protein_id gnl|my_center|LOCUS_01130 8403 7669 gene locus_tag LOCUS_01140 8403 7669 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941468.1 protein_id gnl|my_center|LOCUS_01140 9230 8442 gene locus_tag LOCUS_01150 9230 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 9718 9882 gene locus_tag LOCUS_01160 9718 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 10534 10055 gene locus_tag LOCUS_01170 10534 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 15133 10916 gene locus_tag LOCUS_01180 15133 10916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 17007 15130 gene locus_tag LOCUS_01190 17007 15130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 31115 17004 gene locus_tag LOCUS_01200 31115 17004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01200 34396 31112 gene locus_tag LOCUS_01210 34396 31112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01210 37659 34399 gene locus_tag LOCUS_01220 37659 34399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 38346 40415 gene locus_tag LOCUS_01230 38346 40415 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_01230 40426 41646 gene locus_tag LOCUS_01240 40426 41646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 41967 43979 gene locus_tag LOCUS_01250 41967 43979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 44031 44498 gene locus_tag LOCUS_01260 44031 44498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 44610 46271 gene locus_tag LOCUS_01270 44610 46271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 >Feature sequence005 259 6396 gene locus_tag LOCUS_01280 259 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 6525 7016 gene locus_tag LOCUS_01290 6525 7016 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642421.1 protein_id gnl|my_center|LOCUS_01290 10035 7042 gene locus_tag LOCUS_01300 10035 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 10519 13878 gene locus_tag LOCUS_01310 10519 13878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 13941 14432 gene locus_tag LOCUS_01320 13941 14432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 14471 14947 gene locus_tag LOCUS_01330 14471 14947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 14951 15403 gene locus_tag LOCUS_01340 14951 15403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 15442 15888 gene locus_tag LOCUS_01350 15442 15888 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141996.1 protein_id gnl|my_center|LOCUS_01350 15942 17009 gene locus_tag LOCUS_01360 15942 17009 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897713.1 protein_id gnl|my_center|LOCUS_01360 18337 17417 gene locus_tag LOCUS_01370 18337 17417 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056335.1 protein_id gnl|my_center|LOCUS_01370 18677 19216 gene locus_tag LOCUS_01380 18677 19216 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141530.1 protein_id gnl|my_center|LOCUS_01380 20686 19304 gene locus_tag LOCUS_01390 gene thiC 20686 19304 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921089.1 protein_id gnl|my_center|LOCUS_01390 23021 21846 gene locus_tag LOCUS_01400 23021 21846 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141596.1 protein_id gnl|my_center|LOCUS_01400 23231 23434 gene locus_tag LOCUS_01410 gene rpmI 23231 23434 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125970.1 protein_id gnl|my_center|LOCUS_01410 23466 23813 gene locus_tag LOCUS_01420 gene rplT 23466 23813 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057992.1 protein_id gnl|my_center|LOCUS_01420 23827 24783 gene locus_tag LOCUS_01430 23827 24783 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055892.1 protein_id gnl|my_center|LOCUS_01430 26017 24902 gene locus_tag LOCUS_01440 26017 24902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 26693 28162 gene locus_tag LOCUS_01450 26693 28162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 28169 29134 gene locus_tag LOCUS_01460 28169 29134 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030141.1 protein_id gnl|my_center|LOCUS_01460 29131 32016 gene locus_tag LOCUS_01470 29131 32016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 32300 32142 gene locus_tag LOCUS_01480 32300 32142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 32319 32570 gene locus_tag LOCUS_01490 32319 32570 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140617.1 protein_id gnl|my_center|LOCUS_01490 32719 32904 gene locus_tag LOCUS_01500 32719 32904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 33108 33902 gene locus_tag LOCUS_01510 33108 33902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 35075 34146 gene locus_tag LOCUS_01520 35075 34146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 35242 36366 gene locus_tag LOCUS_01530 35242 36366 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921231.1 protein_id gnl|my_center|LOCUS_01530 36584 36862 gene locus_tag LOCUS_01540 36584 36862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 37453 37028 gene locus_tag LOCUS_01550 37453 37028 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_01550 37682 37440 gene locus_tag LOCUS_01560 37682 37440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 40632 38005 gene locus_tag LOCUS_01570 40632 38005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 41065 40730 gene locus_tag LOCUS_01580 41065 40730 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_01580 41355 41062 gene locus_tag LOCUS_01590 41355 41062 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143513.1 protein_id gnl|my_center|LOCUS_01590 42197 41439 gene locus_tag LOCUS_01600 42197 41439 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119071.1 protein_id gnl|my_center|LOCUS_01600 42867 42211 gene locus_tag LOCUS_01610 42867 42211 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003198.1 protein_id gnl|my_center|LOCUS_01610 43473 43108 gene locus_tag LOCUS_01620 43473 43108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 44218 43517 gene locus_tag LOCUS_01630 44218 43517 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056001.1 protein_id gnl|my_center|LOCUS_01630 44512 44811 gene locus_tag LOCUS_01640 44512 44811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 44908 45681 gene locus_tag LOCUS_01650 44908 45681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 >Feature sequence006 509 122 gene locus_tag LOCUS_tm00010 509 122 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2707 1415 gene locus_tag LOCUS_01660 2707 1415 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_01660 4587 4039 gene locus_tag LOCUS_01670 gene frr 4587 4039 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056114.1 protein_id gnl|my_center|LOCUS_01670 5296 4574 gene locus_tag LOCUS_01680 gene pyrH 5296 4574 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_01680 5606 6187 gene locus_tag LOCUS_01690 5606 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 6706 7824 gene locus_tag LOCUS_01700 gene nuoH 6706 7824 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126985484.1 protein_id gnl|my_center|LOCUS_01700 7867 8439 gene locus_tag LOCUS_01710 gene ndhI 7867 8439 CDS product NAD(P)H-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056515.1 protein_id gnl|my_center|LOCUS_01710 8547 9143 gene locus_tag LOCUS_01720 8547 9143 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056516.1 protein_id gnl|my_center|LOCUS_01720 9163 9474 gene locus_tag LOCUS_01730 gene nuoK 9163 9474 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140654.1 protein_id gnl|my_center|LOCUS_01730 10628 9540 gene locus_tag LOCUS_01740 10628 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 11953 10763 gene locus_tag LOCUS_01750 11953 10763 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_01750 12340 13248 gene locus_tag LOCUS_01760 12340 13248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 13351 14688 gene locus_tag LOCUS_01770 13351 14688 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258102.1 protein_id gnl|my_center|LOCUS_01770 14798 15601 gene locus_tag LOCUS_01780 14798 15601 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 protein_id gnl|my_center|LOCUS_01780 15660 16598 gene locus_tag LOCUS_01790 15660 16598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 17374 17631 gene locus_tag LOCUS_01800 17374 17631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 17809 18138 gene locus_tag LOCUS_01810 17809 18138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 18355 18549 gene locus_tag LOCUS_01820 18355 18549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 19040 18615 gene locus_tag LOCUS_01830 19040 18615 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484774.1 protein_id gnl|my_center|LOCUS_01830 19254 19018 gene locus_tag LOCUS_01840 19254 19018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 20544 19987 gene locus_tag LOCUS_01850 20544 19987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 22300 21851 gene locus_tag LOCUS_01860 22300 21851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 22506 22736 gene locus_tag LOCUS_01870 22506 22736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 23719 23291 gene locus_tag LOCUS_01880 23719 23291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 23945 23685 gene locus_tag LOCUS_01890 23945 23685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 24484 24164 gene locus_tag LOCUS_01900 24484 24164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 26379 24919 gene locus_tag LOCUS_01910 26379 24919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 27080 26715 gene locus_tag LOCUS_01920 27080 26715 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140974.1 protein_id gnl|my_center|LOCUS_01920 27291 27220 gene locus_tag LOCUS_t00030 27291 27220 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 27373 27909 gene locus_tag LOCUS_01930 27373 27909 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143393.1 protein_id gnl|my_center|LOCUS_01930 29449 27929 gene locus_tag LOCUS_01940 29449 27929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 30341 29529 gene locus_tag LOCUS_01950 gene proC 30341 29529 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140706.1 protein_id gnl|my_center|LOCUS_01950 31046 30474 gene locus_tag LOCUS_01960 31046 30474 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928580.1 protein_id gnl|my_center|LOCUS_01960 32026 31367 gene locus_tag LOCUS_01970 32026 31367 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056880.1 protein_id gnl|my_center|LOCUS_01970 32302 32030 gene locus_tag LOCUS_01980 32302 32030 CDS product PipX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057448.1 protein_id gnl|my_center|LOCUS_01980 32819 34360 gene locus_tag LOCUS_01990 32819 34360 CDS product NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055900.1 protein_id gnl|my_center|LOCUS_01990 34716 34465 gene locus_tag LOCUS_02000 34716 34465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 35660 35013 gene locus_tag LOCUS_02010 35660 35013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 38069 36051 gene locus_tag LOCUS_02020 38069 36051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 39585 38458 gene locus_tag LOCUS_02030 gene ychF 39585 38458 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057426.1 protein_id gnl|my_center|LOCUS_02030 39929 41962 gene locus_tag LOCUS_02040 39929 41962 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058192.1 protein_id gnl|my_center|LOCUS_02040 44011 42092 gene locus_tag LOCUS_02050 44011 42092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 44177 45238 gene locus_tag LOCUS_02060 44177 45238 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814826.1 protein_id gnl|my_center|LOCUS_02060 >Feature sequence007 1046 558 gene locus_tag LOCUS_02070 1046 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 1144 2358 gene locus_tag LOCUS_02080 1144 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 2367 2618 gene locus_tag LOCUS_02090 2367 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 2621 3115 gene locus_tag LOCUS_02100 2621 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 3218 4516 gene locus_tag LOCUS_02110 3218 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 4503 4967 gene locus_tag LOCUS_02120 4503 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 4985 5485 gene locus_tag LOCUS_02130 4985 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 5516 6118 gene locus_tag LOCUS_02140 5516 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 6465 6265 gene locus_tag LOCUS_02150 6465 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 6487 7050 gene locus_tag LOCUS_02160 6487 7050 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_02160 8145 7486 gene locus_tag LOCUS_02170 8145 7486 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920805.1 protein_id gnl|my_center|LOCUS_02170 8269 8973 gene locus_tag LOCUS_02180 8269 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 9138 10931 gene locus_tag LOCUS_02190 gene typA 9138 10931 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 protein_id gnl|my_center|LOCUS_02190 11077 12036 gene locus_tag LOCUS_02200 11077 12036 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524103.1 protein_id gnl|my_center|LOCUS_02200 12693 12097 gene locus_tag LOCUS_02210 gene lepB 12693 12097 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929024.1 protein_id gnl|my_center|LOCUS_02210 12987 15158 gene locus_tag LOCUS_02220 12987 15158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 15989 15327 gene locus_tag LOCUS_02230 15989 15327 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057649.1 protein_id gnl|my_center|LOCUS_02230 16531 15989 gene locus_tag LOCUS_02240 16531 15989 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057650.1 protein_id gnl|my_center|LOCUS_02240 16809 16540 gene locus_tag LOCUS_02250 16809 16540 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920932.1 protein_id gnl|my_center|LOCUS_02250 17057 16806 gene locus_tag LOCUS_02260 17057 16806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057652.1 protein_id gnl|my_center|LOCUS_02260 17437 17054 gene locus_tag LOCUS_02270 17437 17054 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057653.1 protein_id gnl|my_center|LOCUS_02270 18870 17434 gene locus_tag LOCUS_02280 18870 17434 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920933.1 protein_id gnl|my_center|LOCUS_02280 19214 18867 gene locus_tag LOCUS_02290 19214 18867 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057655.1 protein_id gnl|my_center|LOCUS_02290 19874 19386 gene locus_tag LOCUS_02300 19874 19386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 20844 20212 gene locus_tag LOCUS_02310 20844 20212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188163.1 protein_id gnl|my_center|LOCUS_02310 22235 20862 gene locus_tag LOCUS_02320 22235 20862 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_02320 23397 22351 gene locus_tag LOCUS_02330 gene fbp 23397 22351 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056391.1 protein_id gnl|my_center|LOCUS_02330 24451 23669 gene locus_tag LOCUS_02340 24451 23669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 26706 24454 gene locus_tag LOCUS_02350 26706 24454 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057710.1 protein_id gnl|my_center|LOCUS_02350 27129 27971 gene locus_tag LOCUS_02360 27129 27971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 29698 28502 gene locus_tag LOCUS_02370 29698 28502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 29932 30306 gene locus_tag LOCUS_02380 29932 30306 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056570.1 protein_id gnl|my_center|LOCUS_02380 30366 31088 gene locus_tag LOCUS_02390 30366 31088 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140107.1 protein_id gnl|my_center|LOCUS_02390 31153 31467 gene locus_tag LOCUS_02400 31153 31467 CDS product DUF2488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057339.1 protein_id gnl|my_center|LOCUS_02400 33169 31529 gene locus_tag LOCUS_02410 33169 31529 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058172.1 protein_id gnl|my_center|LOCUS_02410 33391 35817 gene locus_tag LOCUS_02420 33391 35817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 36123 36989 gene locus_tag LOCUS_02430 36123 36989 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_02430 37030 37338 gene locus_tag LOCUS_02440 37030 37338 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_02440 37325 37666 gene locus_tag LOCUS_02450 37325 37666 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020812.1 protein_id gnl|my_center|LOCUS_02450 37817 38416 gene locus_tag LOCUS_02460 37817 38416 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_02460 38466 39362 gene locus_tag LOCUS_02470 38466 39362 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257625.1 protein_id gnl|my_center|LOCUS_02470 40913 39702 gene locus_tag LOCUS_02480 40913 39702 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028529.1 protein_id gnl|my_center|LOCUS_02480 >Feature sequence008 211 735 gene locus_tag LOCUS_02490 gene ilvN 211 735 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056724.1 protein_id gnl|my_center|LOCUS_02490 898 3147 gene locus_tag LOCUS_02500 898 3147 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057331.1 protein_id gnl|my_center|LOCUS_02500 4221 3304 gene locus_tag LOCUS_02510 4221 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 5127 4594 gene locus_tag LOCUS_02520 gene pgsA 5127 4594 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140305.1 protein_id gnl|my_center|LOCUS_02520 6528 5434 gene locus_tag LOCUS_02530 6528 5434 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_02530 6773 7921 gene locus_tag LOCUS_02540 6773 7921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 7938 9302 gene locus_tag LOCUS_02550 7938 9302 CDS product DUF1822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057814.1 protein_id gnl|my_center|LOCUS_02550 9335 11947 gene locus_tag LOCUS_02560 9335 11947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 12055 12774 gene locus_tag LOCUS_02570 12055 12774 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143369.1 protein_id gnl|my_center|LOCUS_02570 12786 14135 gene locus_tag LOCUS_02580 12786 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 14397 15104 gene locus_tag LOCUS_02590 14397 15104 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459569.1 protein_id gnl|my_center|LOCUS_02590 15688 17610 gene locus_tag LOCUS_02600 gene gyrB 15688 17610 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056494.1 protein_id gnl|my_center|LOCUS_02600 18977 17763 gene locus_tag LOCUS_02610 18977 17763 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058160.1 protein_id gnl|my_center|LOCUS_02610 19258 20691 gene locus_tag LOCUS_02620 19258 20691 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124464.1 protein_id gnl|my_center|LOCUS_02620 21428 21048 gene locus_tag LOCUS_02630 21428 21048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057511.1 protein_id gnl|my_center|LOCUS_02630 21668 22285 gene locus_tag LOCUS_02640 gene mtnB 21668 22285 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111958.1 protein_id gnl|my_center|LOCUS_02640 22404 22334 gene locus_tag LOCUS_t00040 22404 22334 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 22542 22874 gene locus_tag LOCUS_02650 22542 22874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 23179 24102 gene locus_tag LOCUS_02660 23179 24102 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_02660 24179 24760 gene locus_tag LOCUS_02670 24179 24760 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141191.1 protein_id gnl|my_center|LOCUS_02670 25033 25785 gene locus_tag LOCUS_02680 25033 25785 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057799.1 protein_id gnl|my_center|LOCUS_02680 26490 26074 gene locus_tag LOCUS_02690 26490 26074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 26667 26530 gene locus_tag LOCUS_02700 26667 26530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 26989 26723 gene locus_tag LOCUS_02710 26989 26723 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_02710 27195 26986 gene locus_tag LOCUS_02720 27195 26986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 27613 27278 gene locus_tag LOCUS_02730 27613 27278 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838298.1 protein_id gnl|my_center|LOCUS_02730 29561 27846 gene locus_tag LOCUS_02740 29561 27846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 29859 30026 gene locus_tag LOCUS_02750 29859 30026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 30646 30029 gene locus_tag LOCUS_02760 30646 30029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 31682 30693 gene locus_tag LOCUS_02770 31682 30693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 32983 31925 gene locus_tag LOCUS_02780 gene mnmA 32983 31925 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058089.1 protein_id gnl|my_center|LOCUS_02780 33086 33730 gene locus_tag LOCUS_02790 33086 33730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 35100 36149 gene locus_tag LOCUS_02800 35100 36149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 37520 36543 gene locus_tag LOCUS_02810 37520 36543 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928745.1 protein_id gnl|my_center|LOCUS_02810 37868 38722 gene locus_tag LOCUS_02820 37868 38722 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920890.1 protein_id gnl|my_center|LOCUS_02820 39267 38725 gene locus_tag LOCUS_02830 39267 38725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 39521 40927 gene locus_tag LOCUS_02840 39521 40927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096324.1 protein_id gnl|my_center|LOCUS_02840 >Feature sequence009 3719 621 gene locus_tag LOCUS_02850 3719 621 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921798.1 protein_id gnl|my_center|LOCUS_02850 5479 3965 gene locus_tag LOCUS_02860 5479 3965 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120143.1 protein_id gnl|my_center|LOCUS_02860 6551 5577 gene locus_tag LOCUS_02870 6551 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 7762 6824 gene locus_tag LOCUS_02880 7762 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 8681 7872 gene locus_tag LOCUS_02890 8681 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 10158 8881 gene locus_tag LOCUS_02900 10158 8881 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_02900 11395 10223 gene locus_tag LOCUS_02910 11395 10223 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446769.1 protein_id gnl|my_center|LOCUS_02910 13076 11520 gene locus_tag LOCUS_02920 13076 11520 CDS product PfaD family polyunsaturated fatty acid/polyketide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142825.1 protein_id gnl|my_center|LOCUS_02920 18162 13159 gene locus_tag LOCUS_02930 18162 13159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 19965 18208 gene locus_tag LOCUS_02940 19965 18208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 20855 20136 gene locus_tag LOCUS_02950 20855 20136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02950 24733 20912 gene locus_tag LOCUS_02960 24733 20912 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190970337.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02960 25076 25564 gene locus_tag LOCUS_02970 25076 25564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 25627 25917 gene locus_tag LOCUS_02980 25627 25917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 26565 27608 gene locus_tag LOCUS_02990 26565 27608 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928642.1 protein_id gnl|my_center|LOCUS_02990 28000 29124 gene locus_tag LOCUS_03000 28000 29124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227417.1 protein_id gnl|my_center|LOCUS_03000 29481 30983 gene locus_tag LOCUS_03010 gene malQ 29481 30983 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056555.1 protein_id gnl|my_center|LOCUS_03010 31459 31034 gene locus_tag LOCUS_03020 31459 31034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797542.1 protein_id gnl|my_center|LOCUS_03020 32518 31592 gene locus_tag LOCUS_03030 gene argF 32518 31592 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920816.1 protein_id gnl|my_center|LOCUS_03030 35964 32728 gene locus_tag LOCUS_03040 35964 32728 CDS product tubulin-like doman-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920803.1 protein_id gnl|my_center|LOCUS_03040 36923 35967 gene locus_tag LOCUS_03050 36923 35967 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224412629.1 protein_id gnl|my_center|LOCUS_03050 37622 38023 gene locus_tag LOCUS_03060 37622 38023 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141008.1 protein_id gnl|my_center|LOCUS_03060 >Feature sequence010 796 539 gene locus_tag LOCUS_03070 796 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 1267 1929 gene locus_tag LOCUS_03080 1267 1929 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056679.1 protein_id gnl|my_center|LOCUS_03080 1991 2506 gene locus_tag LOCUS_03090 1991 2506 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920918.1 protein_id gnl|my_center|LOCUS_03090 3445 2573 gene locus_tag LOCUS_03100 3445 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141513.1 protein_id gnl|my_center|LOCUS_03100 4061 3462 gene locus_tag LOCUS_03110 4061 3462 CDS product DUF1517 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141514.1 protein_id gnl|my_center|LOCUS_03110 4505 5521 gene locus_tag LOCUS_03120 gene hpnH 4505 5521 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_03120 6897 5524 gene locus_tag LOCUS_03130 6897 5524 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929211.1 protein_id gnl|my_center|LOCUS_03130 7470 7021 gene locus_tag LOCUS_03140 gene ndk 7470 7021 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056122.1 protein_id gnl|my_center|LOCUS_03140 8613 7807 gene locus_tag LOCUS_03150 8613 7807 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124685.1 protein_id gnl|my_center|LOCUS_03150 8637 8801 gene locus_tag LOCUS_03160 8637 8801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 9973 9377 gene locus_tag LOCUS_03170 9973 9377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03170 11998 10052 gene locus_tag LOCUS_03180 11998 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03180 12243 13298 gene locus_tag LOCUS_03190 12243 13298 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_03190 14149 13535 gene locus_tag LOCUS_03200 14149 13535 CDS product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143861.1 protein_id gnl|my_center|LOCUS_03200 15027 17663 gene locus_tag LOCUS_03210 gene topA 15027 17663 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057718.1 protein_id gnl|my_center|LOCUS_03210 18569 17784 gene locus_tag LOCUS_03220 18569 17784 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142264.1 protein_id gnl|my_center|LOCUS_03220 19280 23566 gene locus_tag LOCUS_03230 19280 23566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 23928 28700 gene locus_tag LOCUS_03240 23928 28700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 28740 29783 gene locus_tag LOCUS_03250 gene fni 28740 29783 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057243.1 protein_id gnl|my_center|LOCUS_03250 29777 30106 gene locus_tag LOCUS_03260 29777 30106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03260 30212 30409 gene locus_tag LOCUS_03270 30212 30409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03270 30506 31006 gene locus_tag LOCUS_03280 30506 31006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 31181 31951 gene locus_tag LOCUS_03290 gene bacG 31181 31951 CDS product NADPH-dependent reductase BacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244095.1 protein_id gnl|my_center|LOCUS_03290 32120 32383 gene locus_tag LOCUS_03300 32120 32383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 32465 32968 gene locus_tag LOCUS_03310 32465 32968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03310 33053 33280 gene locus_tag LOCUS_03320 33053 33280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03320 33506 34021 gene locus_tag LOCUS_03330 33506 34021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 34082 34537 gene locus_tag LOCUS_03340 34082 34537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 >Feature sequence011 506 327 gene locus_tag LOCUS_03350 506 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 726 508 gene locus_tag LOCUS_03360 726 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 2732 1044 gene locus_tag LOCUS_03370 2732 1044 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 protein_id gnl|my_center|LOCUS_03370 3545 2862 gene locus_tag LOCUS_03380 3545 2862 CDS product Mo-dependent nitrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142802.1 protein_id gnl|my_center|LOCUS_03380 5171 3786 gene locus_tag LOCUS_03390 5171 3786 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 protein_id gnl|my_center|LOCUS_03390 6143 5217 gene locus_tag LOCUS_03400 6143 5217 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056512.1 protein_id gnl|my_center|LOCUS_03400 6335 9205 gene locus_tag LOCUS_03410 gene polA 6335 9205 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057179.1 protein_id gnl|my_center|LOCUS_03410 9210 9455 gene locus_tag LOCUS_03420 9210 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 9531 9740 gene locus_tag LOCUS_03430 9531 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 10289 9999 gene locus_tag LOCUS_03440 10289 9999 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_03440 10444 10596 gene locus_tag LOCUS_03450 10444 10596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 11301 10591 gene locus_tag LOCUS_03460 11301 10591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 14608 11306 gene locus_tag LOCUS_03470 14608 11306 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962208.1 protein_id gnl|my_center|LOCUS_03470 14994 15533 gene locus_tag LOCUS_03480 14994 15533 CDS product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056803.1 protein_id gnl|my_center|LOCUS_03480 15577 16563 gene locus_tag LOCUS_03490 gene petA 15577 16563 CDS product apocytochrome f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056804.1 protein_id gnl|my_center|LOCUS_03490 16696 17757 gene locus_tag LOCUS_03500 16696 17757 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479721.1 protein_id gnl|my_center|LOCUS_03500 18038 19687 gene locus_tag LOCUS_03510 18038 19687 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141468.1 protein_id gnl|my_center|LOCUS_03510 20107 19700 gene locus_tag LOCUS_03520 20107 19700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140148.1 protein_id gnl|my_center|LOCUS_03520 21735 20314 gene locus_tag LOCUS_03530 gene glnA 21735 20314 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057427.1 protein_id gnl|my_center|LOCUS_03530 21959 21789 gene locus_tag LOCUS_03540 21959 21789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 22704 23525 gene locus_tag LOCUS_03550 gene sppA 22704 23525 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057641.1 protein_id gnl|my_center|LOCUS_03550 23594 23995 gene locus_tag LOCUS_03560 gene aroH 23594 23995 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057640.1 protein_id gnl|my_center|LOCUS_03560 25026 24133 gene locus_tag LOCUS_03570 25026 24133 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057729.1 protein_id gnl|my_center|LOCUS_03570 25154 25927 gene locus_tag LOCUS_03580 25154 25927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 26761 25928 gene locus_tag LOCUS_03590 26761 25928 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921020.1 protein_id gnl|my_center|LOCUS_03590 27109 26825 gene locus_tag LOCUS_03600 27109 26825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 27784 28779 gene locus_tag LOCUS_03610 27784 28779 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057048.1 protein_id gnl|my_center|LOCUS_03610 28946 29263 gene locus_tag LOCUS_03620 28946 29263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 29554 31923 gene locus_tag LOCUS_03630 gene glgX 29554 31923 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258959.1 protein_id gnl|my_center|LOCUS_03630 32095 32745 gene locus_tag LOCUS_03640 32095 32745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 32950 33957 gene locus_tag LOCUS_03650 32950 33957 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 protein_id gnl|my_center|LOCUS_03650 >Feature sequence012 682 1209 gene locus_tag LOCUS_03660 682 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 2030 1251 gene locus_tag LOCUS_03670 2030 1251 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015184994.1 protein_id gnl|my_center|LOCUS_03670 5675 2577 gene locus_tag LOCUS_03680 5675 2577 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921798.1 protein_id gnl|my_center|LOCUS_03680 7073 5718 gene locus_tag LOCUS_03690 7073 5718 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 protein_id gnl|my_center|LOCUS_03690 8435 7134 gene locus_tag LOCUS_03700 8435 7134 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_03700 10115 8484 gene locus_tag LOCUS_03710 10115 8484 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390860.1 protein_id gnl|my_center|LOCUS_03710 10801 10196 gene locus_tag LOCUS_03720 10801 10196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 11989 10814 gene locus_tag LOCUS_03730 11989 10814 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_03730 13496 12177 gene locus_tag LOCUS_03740 13496 12177 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198286.1 protein_id gnl|my_center|LOCUS_03740 17487 13525 gene locus_tag LOCUS_03750 17487 13525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 22969 17528 gene locus_tag LOCUS_03760 22969 17528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 26974 23165 gene locus_tag LOCUS_03770 26974 23165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 27730 27068 gene locus_tag LOCUS_03780 gene nox 27730 27068 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227925.1 protein_id gnl|my_center|LOCUS_03780 28691 27762 gene locus_tag LOCUS_03790 28691 27762 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093421.1 protein_id gnl|my_center|LOCUS_03790 29421 30863 gene locus_tag LOCUS_03800 29421 30863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 33577 30860 gene locus_tag LOCUS_03810 33577 30860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence013 157 552 gene locus_tag LOCUS_03820 157 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 714 1814 gene locus_tag LOCUS_03830 gene aroB 714 1814 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056627.1 protein_id gnl|my_center|LOCUS_03830 3300 2044 gene locus_tag LOCUS_03840 3300 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 5462 3297 gene locus_tag LOCUS_03850 5462 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 5823 6008 gene locus_tag LOCUS_03860 5823 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 6001 6165 gene locus_tag LOCUS_03870 6001 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 6697 6419 gene locus_tag LOCUS_03880 6697 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 7075 6767 gene locus_tag LOCUS_03890 7075 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 7328 7068 gene locus_tag LOCUS_03900 7328 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 7664 7335 gene locus_tag LOCUS_03910 7664 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918611.1 protein_id gnl|my_center|LOCUS_03910 8031 7708 gene locus_tag LOCUS_03920 8031 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 9374 8235 gene locus_tag LOCUS_03930 9374 8235 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921229.1 protein_id gnl|my_center|LOCUS_03930 9613 10797 gene locus_tag LOCUS_03940 9613 10797 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_03940 10797 11054 gene locus_tag LOCUS_03950 10797 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 11133 11381 gene locus_tag LOCUS_03960 11133 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 12230 11838 gene locus_tag LOCUS_03970 12230 11838 CDS product DUF4278 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056168.1 protein_id gnl|my_center|LOCUS_03970 12801 12385 gene locus_tag LOCUS_03980 12801 12385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 13274 14323 gene locus_tag LOCUS_03990 13274 14323 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799453.1 protein_id gnl|my_center|LOCUS_03990 14397 14325 gene locus_tag LOCUS_t00050 14397 14325 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 14725 14910 gene locus_tag LOCUS_04000 14725 14910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141741.1 protein_id gnl|my_center|LOCUS_04000 16192 14900 gene locus_tag LOCUS_04010 16192 14900 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057246.1 protein_id gnl|my_center|LOCUS_04010 16438 17259 gene locus_tag LOCUS_04020 16438 17259 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928485.1 protein_id gnl|my_center|LOCUS_04020 17452 18699 gene locus_tag LOCUS_04030 gene ftsZ 17452 18699 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023065873.1 protein_id gnl|my_center|LOCUS_04030 18706 19506 gene locus_tag LOCUS_04040 gene thiD 18706 19506 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141510.1 protein_id gnl|my_center|LOCUS_04040 19897 19700 gene locus_tag LOCUS_04050 19897 19700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 20313 20876 gene locus_tag LOCUS_04060 20313 20876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 21041 21325 gene locus_tag LOCUS_04070 21041 21325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 21385 21822 gene locus_tag LOCUS_04080 21385 21822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 23580 22069 gene locus_tag LOCUS_04090 23580 22069 CDS product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963438.1 protein_id gnl|my_center|LOCUS_04090 23779 24534 gene locus_tag LOCUS_04100 23779 24534 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246180.1 protein_id gnl|my_center|LOCUS_04100 24887 25282 gene locus_tag LOCUS_04110 24887 25282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 25336 26847 gene locus_tag LOCUS_04120 25336 26847 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921199.1 protein_id gnl|my_center|LOCUS_04120 26901 27335 gene locus_tag LOCUS_04130 26901 27335 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124912.1 protein_id gnl|my_center|LOCUS_04130 27436 28077 gene locus_tag LOCUS_04140 27436 28077 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056621.1 protein_id gnl|my_center|LOCUS_04140 28444 28103 gene locus_tag LOCUS_04150 28444 28103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 28665 28441 gene locus_tag LOCUS_04160 28665 28441 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_04160 29219 28944 gene locus_tag LOCUS_04170 29219 28944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_04170 29443 29216 gene locus_tag LOCUS_04180 29443 29216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 30117 30521 gene locus_tag LOCUS_04190 30117 30521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 >Feature sequence014 402 1529 gene locus_tag LOCUS_04200 402 1529 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056272.1 protein_id gnl|my_center|LOCUS_04200 3103 1577 gene locus_tag LOCUS_04210 gene bchB 3103 1577 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058224.1 protein_id gnl|my_center|LOCUS_04210 3855 3259 gene locus_tag LOCUS_04220 3855 3259 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140153.1 protein_id gnl|my_center|LOCUS_04220 4077 4433 gene locus_tag LOCUS_04230 4077 4433 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057662.1 protein_id gnl|my_center|LOCUS_04230 5034 4447 gene locus_tag LOCUS_04240 5034 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 5733 5260 gene locus_tag LOCUS_04250 5733 5260 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057630.1 protein_id gnl|my_center|LOCUS_04250 6279 5938 gene locus_tag LOCUS_04260 6279 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141134.1 protein_id gnl|my_center|LOCUS_04260 7294 6593 gene locus_tag LOCUS_04270 7294 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 8520 7477 gene locus_tag LOCUS_04280 gene dcm 8520 7477 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964364.1 protein_id gnl|my_center|LOCUS_04280 9934 10341 gene locus_tag LOCUS_04290 9934 10341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 10407 10697 gene locus_tag LOCUS_04300 10407 10697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 12457 10808 gene locus_tag LOCUS_04310 12457 10808 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057114.1 protein_id gnl|my_center|LOCUS_04310 14331 12673 gene locus_tag LOCUS_04320 14331 12673 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057517.1 protein_id gnl|my_center|LOCUS_04320 15722 14511 gene locus_tag LOCUS_04330 15722 14511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 18256 16301 gene locus_tag LOCUS_04340 18256 16301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 19235 18321 gene locus_tag LOCUS_04350 gene hslO 19235 18321 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056651.1 protein_id gnl|my_center|LOCUS_04350 19320 19712 gene locus_tag LOCUS_04360 19320 19712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143307.1 protein_id gnl|my_center|LOCUS_04360 19778 21214 gene locus_tag LOCUS_04370 gene ffh 19778 21214 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057808.1 protein_id gnl|my_center|LOCUS_04370 22186 21218 gene locus_tag LOCUS_04380 gene thiL 22186 21218 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921033.1 protein_id gnl|my_center|LOCUS_04380 23330 22659 gene locus_tag LOCUS_04390 23330 22659 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056716.1 protein_id gnl|my_center|LOCUS_04390 23435 24919 gene locus_tag LOCUS_04400 23435 24919 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056715.1 protein_id gnl|my_center|LOCUS_04400 25077 25688 gene locus_tag LOCUS_04410 25077 25688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 25737 26825 gene locus_tag LOCUS_04420 gene cax 25737 26825 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_04420 27505 26828 gene locus_tag LOCUS_04430 gene rsmG 27505 26828 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140710.1 protein_id gnl|my_center|LOCUS_04430 28245 27598 gene locus_tag LOCUS_04440 28245 27598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920666.1 protein_id gnl|my_center|LOCUS_04440 28497 29726 gene locus_tag LOCUS_04450 28497 29726 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 protein_id gnl|my_center|LOCUS_04450 29762 30676 gene locus_tag LOCUS_04460 29762 30676 CDS product Sll0314/Alr1548 family TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524124.1 protein_id gnl|my_center|LOCUS_04460 30940 31980 gene locus_tag LOCUS_04470 30940 31980 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 protein_id gnl|my_center|LOCUS_04470 >Feature sequence015 276 1247 gene locus_tag LOCUS_04480 276 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 1551 3206 gene locus_tag LOCUS_04490 1551 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 5728 3704 gene locus_tag LOCUS_04500 5728 3704 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144393.1 protein_id gnl|my_center|LOCUS_04500 6672 5833 gene locus_tag LOCUS_04510 6672 5833 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142412.1 protein_id gnl|my_center|LOCUS_04510 9808 6686 gene locus_tag LOCUS_04520 9808 6686 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142413.1 protein_id gnl|my_center|LOCUS_04520 11196 10216 gene locus_tag LOCUS_04530 11196 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 12353 11346 gene locus_tag LOCUS_04540 12353 11346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141987.1 protein_id gnl|my_center|LOCUS_04540 13899 12412 gene locus_tag LOCUS_04550 13899 12412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 14790 13942 gene locus_tag LOCUS_04560 14790 13942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 15988 14834 gene locus_tag LOCUS_04570 15988 14834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 16906 15998 gene locus_tag LOCUS_04580 16906 15998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 17863 17048 gene locus_tag LOCUS_04590 17863 17048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 18759 17896 gene locus_tag LOCUS_04600 18759 17896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 20398 18848 gene locus_tag LOCUS_04610 20398 18848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 21219 20467 gene locus_tag LOCUS_04620 21219 20467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 22951 21605 gene locus_tag LOCUS_04630 22951 21605 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_04630 24011 23619 gene locus_tag LOCUS_04640 gene tnpA 24011 23619 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036865.1 protein_id gnl|my_center|LOCUS_04640 24070 25392 gene locus_tag LOCUS_04650 24070 25392 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_04650 25513 26955 gene locus_tag LOCUS_04660 25513 26955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 27045 28142 gene locus_tag LOCUS_04670 27045 28142 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141720.1 protein_id gnl|my_center|LOCUS_04670 28146 29828 gene locus_tag LOCUS_04680 28146 29828 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942368.1 protein_id gnl|my_center|LOCUS_04680 30258 29755 gene locus_tag LOCUS_04690 30258 29755 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257075.1 protein_id gnl|my_center|LOCUS_04690 30991 30503 gene locus_tag LOCUS_04700 30991 30503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 >Feature sequence016 899 300 gene locus_tag LOCUS_04710 899 300 CDS product IS607 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899566.1 protein_id gnl|my_center|LOCUS_04710 2611 1661 gene locus_tag LOCUS_04720 2611 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 3983 2619 gene locus_tag LOCUS_04730 3983 2619 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057393.1 protein_id gnl|my_center|LOCUS_04730 4340 5608 gene locus_tag LOCUS_04740 4340 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055996.1 protein_id gnl|my_center|LOCUS_04740 5925 7190 gene locus_tag LOCUS_04750 gene purD 5925 7190 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920939.1 protein_id gnl|my_center|LOCUS_04750 7374 8600 gene locus_tag LOCUS_04760 7374 8600 CDS product WcaI family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265553.1 protein_id gnl|my_center|LOCUS_04760 8777 10333 gene locus_tag LOCUS_04770 8777 10333 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057727.1 protein_id gnl|my_center|LOCUS_04770 11048 10410 gene locus_tag LOCUS_04780 gene sufR 11048 10410 CDS product iron-sulfur cluster biosynthesis transcriptional regulator SufR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056342.1 protein_id gnl|my_center|LOCUS_04780 11272 12714 gene locus_tag LOCUS_04790 gene sufB 11272 12714 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_04790 12837 13607 gene locus_tag LOCUS_04800 gene sufC 12837 13607 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_04800 14182 15465 gene locus_tag LOCUS_04810 gene sufD 14182 15465 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057742.1 protein_id gnl|my_center|LOCUS_04810 15521 16783 gene locus_tag LOCUS_04820 15521 16783 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057903.1 protein_id gnl|my_center|LOCUS_04820 16817 18322 gene locus_tag LOCUS_04830 16817 18322 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275247.1 protein_id gnl|my_center|LOCUS_04830 18840 19370 gene locus_tag LOCUS_04840 18840 19370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 19642 21441 gene locus_tag LOCUS_04850 19642 21441 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208105.1 protein_id gnl|my_center|LOCUS_04850 21419 21781 gene locus_tag LOCUS_04860 21419 21781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 22726 22103 gene locus_tag LOCUS_04870 22726 22103 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 protein_id gnl|my_center|LOCUS_04870 24535 22859 gene locus_tag LOCUS_04880 gene ctaD 24535 22859 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057845.1 protein_id gnl|my_center|LOCUS_04880 25530 24565 gene locus_tag LOCUS_04890 25530 24565 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057846.1 protein_id gnl|my_center|LOCUS_04890 25845 26765 gene locus_tag LOCUS_04900 25845 26765 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057731.1 protein_id gnl|my_center|LOCUS_04900 26779 27729 gene locus_tag LOCUS_04910 26779 27729 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920945.1 protein_id gnl|my_center|LOCUS_04910 29185 27851 gene locus_tag LOCUS_04920 gene dnaA 29185 27851 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056451.1 protein_id gnl|my_center|LOCUS_04920 29270 29848 gene locus_tag LOCUS_04930 gene def 29270 29848 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206042.1 protein_id gnl|my_center|LOCUS_04930 30274 30930 gene locus_tag LOCUS_04940 gene folE 30274 30930 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015079151.1 protein_id gnl|my_center|LOCUS_04940 31047 31460 gene locus_tag LOCUS_04950 31047 31460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 >Feature sequence017 1637 270 gene locus_tag LOCUS_04960 gene rlmD 1637 270 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056786.1 protein_id gnl|my_center|LOCUS_04960 2092 1640 gene locus_tag LOCUS_04970 2092 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 3843 2149 gene locus_tag LOCUS_04980 3843 2149 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057930.1 protein_id gnl|my_center|LOCUS_04980 5020 4109 gene locus_tag LOCUS_04990 gene menA 5020 4109 CDS product 2-carboxy-1,4-naphthoquinone phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073592656.1 protein_id gnl|my_center|LOCUS_04990 6177 5605 gene locus_tag LOCUS_05000 6177 5605 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_05000 7237 6224 gene locus_tag LOCUS_05010 7237 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 7516 7274 gene locus_tag LOCUS_05020 7516 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 7955 7524 gene locus_tag LOCUS_05030 7955 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 8364 8849 gene locus_tag LOCUS_05040 8364 8849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05040 8853 9068 gene locus_tag LOCUS_05050 8853 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 9281 9538 gene locus_tag LOCUS_05060 9281 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 9513 9734 gene locus_tag LOCUS_05070 9513 9734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 11198 9822 gene locus_tag LOCUS_05080 11198 9822 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144101.1 protein_id gnl|my_center|LOCUS_05080 12099 11320 gene locus_tag LOCUS_05090 12099 11320 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920674.1 protein_id gnl|my_center|LOCUS_05090 12759 12127 gene locus_tag LOCUS_05100 12759 12127 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929521.1 protein_id gnl|my_center|LOCUS_05100 13624 12848 gene locus_tag LOCUS_05110 13624 12848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 14745 13627 gene locus_tag LOCUS_05120 14745 13627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 14955 17390 gene locus_tag LOCUS_05130 gene pheT 14955 17390 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920733.1 protein_id gnl|my_center|LOCUS_05130 17774 18013 gene locus_tag LOCUS_05140 17774 18013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 18102 19244 gene locus_tag LOCUS_05150 18102 19244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 19245 19817 gene locus_tag LOCUS_05160 19245 19817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 20101 20310 gene locus_tag LOCUS_05170 20101 20310 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393634.1 protein_id gnl|my_center|LOCUS_05170 20307 20546 gene locus_tag LOCUS_05180 20307 20546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 20920 20687 gene locus_tag LOCUS_05190 20920 20687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_05190 21121 20921 gene locus_tag LOCUS_05200 21121 20921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 21376 21615 gene locus_tag LOCUS_05210 21376 21615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 21609 22103 gene locus_tag LOCUS_05220 21609 22103 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248955.1 protein_id gnl|my_center|LOCUS_05220 22353 22174 gene locus_tag LOCUS_05230 22353 22174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 22790 22455 gene locus_tag LOCUS_05240 22790 22455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 23108 22806 gene locus_tag LOCUS_05250 23108 22806 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144191.1 protein_id gnl|my_center|LOCUS_05250 23265 23591 gene locus_tag LOCUS_05260 23265 23591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 23575 23754 gene locus_tag LOCUS_05270 23575 23754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05270 24112 24375 gene locus_tag LOCUS_05280 24112 24375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 24390 24587 gene locus_tag LOCUS_05290 24390 24587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 24985 25245 gene locus_tag LOCUS_05300 24985 25245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 25249 25614 gene locus_tag LOCUS_05310 25249 25614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 28434 26014 gene locus_tag LOCUS_05320 28434 26014 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057028.1 protein_id gnl|my_center|LOCUS_05320 29107 30141 gene locus_tag LOCUS_05330 gene gap 29107 30141 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055898.1 protein_id gnl|my_center|LOCUS_05330 >Feature sequence018 682 1137 gene locus_tag LOCUS_05340 682 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 1124 1450 gene locus_tag LOCUS_05350 1124 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 2046 3731 gene locus_tag LOCUS_05360 gene ilvD 2046 3731 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056900.1 protein_id gnl|my_center|LOCUS_05360 3853 4713 gene locus_tag LOCUS_05370 3853 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 4958 5392 gene locus_tag LOCUS_05380 4958 5392 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025263.1 protein_id gnl|my_center|LOCUS_05380 5427 6347 gene locus_tag LOCUS_05390 5427 6347 CDS product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143278.1 protein_id gnl|my_center|LOCUS_05390 6740 8353 gene locus_tag LOCUS_05400 6740 8353 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057120.1 protein_id gnl|my_center|LOCUS_05400 8397 8855 gene locus_tag LOCUS_05410 8397 8855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 10636 9155 gene locus_tag LOCUS_05420 10636 9155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 10950 11171 gene locus_tag LOCUS_05430 10950 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 11168 11581 gene locus_tag LOCUS_05440 11168 11581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 13206 11968 gene locus_tag LOCUS_05450 gene dcm 13206 11968 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946968.1 protein_id gnl|my_center|LOCUS_05450 14034 13255 gene locus_tag LOCUS_05460 14034 13255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 14999 14136 gene locus_tag LOCUS_05470 14999 14136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05470 15329 15072 gene locus_tag LOCUS_05480 15329 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05480 16425 15439 gene locus_tag LOCUS_05490 16425 15439 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920721.1 protein_id gnl|my_center|LOCUS_05490 17480 16629 gene locus_tag LOCUS_05500 17480 16629 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056034.1 protein_id gnl|my_center|LOCUS_05500 18021 19265 gene locus_tag LOCUS_05510 gene rimO 18021 19265 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057404.1 protein_id gnl|my_center|LOCUS_05510 19307 20746 gene locus_tag LOCUS_05520 19307 20746 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258936.1 protein_id gnl|my_center|LOCUS_05520 20947 22248 gene locus_tag LOCUS_05530 gene tnpB 20947 22248 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_05530 22443 23234 gene locus_tag LOCUS_05540 22443 23234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 23969 23313 gene locus_tag LOCUS_05550 23969 23313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 25081 23969 gene locus_tag LOCUS_05560 25081 23969 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_05560 25801 25448 gene locus_tag LOCUS_05570 25801 25448 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125356.1 protein_id gnl|my_center|LOCUS_05570 29510 26073 gene locus_tag LOCUS_05580 29510 26073 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_05580 29792 30220 gene locus_tag LOCUS_05590 29792 30220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 >Feature sequence019 265 561 gene locus_tag LOCUS_05600 265 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 748 1002 gene locus_tag LOCUS_05610 748 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 1872 1033 gene locus_tag LOCUS_05620 1872 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2535 1957 gene locus_tag LOCUS_05630 2535 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 3446 2559 gene locus_tag LOCUS_05640 3446 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 3826 5121 gene locus_tag LOCUS_05650 3826 5121 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_05650 5672 6532 gene locus_tag LOCUS_05660 5672 6532 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_05660 6568 7158 gene locus_tag LOCUS_05670 6568 7158 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144066.1 protein_id gnl|my_center|LOCUS_05670 8213 7140 gene locus_tag LOCUS_05680 gene murG 8213 7140 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057646.1 protein_id gnl|my_center|LOCUS_05680 8295 9101 gene locus_tag LOCUS_05690 8295 9101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 10179 9361 gene locus_tag LOCUS_05700 10179 9361 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529017.1 protein_id gnl|my_center|LOCUS_05700 11002 10403 gene locus_tag LOCUS_05710 11002 10403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022055.1 protein_id gnl|my_center|LOCUS_05710 11830 11147 gene locus_tag LOCUS_05720 11830 11147 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056259.1 protein_id gnl|my_center|LOCUS_05720 12022 14031 gene locus_tag LOCUS_05730 12022 14031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 14106 14567 gene locus_tag LOCUS_05740 14106 14567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 14564 15205 gene locus_tag LOCUS_05750 14564 15205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 15264 17228 gene locus_tag LOCUS_05760 15264 17228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 17450 18577 gene locus_tag LOCUS_05770 gene proB 17450 18577 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057952.1 protein_id gnl|my_center|LOCUS_05770 18760 19269 gene locus_tag LOCUS_05780 gene apcB 18760 19269 CDS product allophycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057869.1 protein_id gnl|my_center|LOCUS_05780 19510 22158 gene locus_tag LOCUS_05790 gene mutS 19510 22158 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058073.1 protein_id gnl|my_center|LOCUS_05790 22977 22480 gene locus_tag LOCUS_05800 22977 22480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 24376 23039 gene locus_tag LOCUS_05810 gene trmFO 24376 23039 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056303.1 protein_id gnl|my_center|LOCUS_05810 24619 24897 gene locus_tag LOCUS_05820 24619 24897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 26095 25016 gene locus_tag LOCUS_05830 26095 25016 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055863.1 protein_id gnl|my_center|LOCUS_05830 26478 27650 gene locus_tag LOCUS_05840 gene hemW 26478 27650 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799709.1 protein_id gnl|my_center|LOCUS_05840 27988 27668 gene locus_tag LOCUS_05850 27988 27668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 28560 27988 gene locus_tag LOCUS_05860 28560 27988 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056726.1 protein_id gnl|my_center|LOCUS_05860 28794 29867 gene locus_tag LOCUS_05870 28794 29867 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920924.1 protein_id gnl|my_center|LOCUS_05870 30254 29919 gene locus_tag LOCUS_05880 30254 29919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 >Feature sequence020 254 1120 gene locus_tag LOCUS_05890 gene rlmB 254 1120 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056885.1 protein_id gnl|my_center|LOCUS_05890 1233 1529 gene locus_tag LOCUS_05900 1233 1529 CDS product DUF1816 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057540.1 protein_id gnl|my_center|LOCUS_05900 3141 1708 gene locus_tag LOCUS_05910 3141 1708 CDS product bifunctional orotidine-5'-phosphate decarboxylase/orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141081.1 protein_id gnl|my_center|LOCUS_05910 4158 3154 gene locus_tag LOCUS_05920 4158 3154 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057358.1 protein_id gnl|my_center|LOCUS_05920 4277 5806 gene locus_tag LOCUS_05930 4277 5806 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986277.1 protein_id gnl|my_center|LOCUS_05930 7231 5789 gene locus_tag LOCUS_05940 gene cysS 7231 5789 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920936.1 protein_id gnl|my_center|LOCUS_05940 7547 7822 gene locus_tag LOCUS_05950 7547 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 9238 8081 gene locus_tag LOCUS_05960 9238 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 9347 9988 gene locus_tag LOCUS_05970 9347 9988 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140140.1 protein_id gnl|my_center|LOCUS_05970 11719 9992 gene locus_tag LOCUS_05980 gene recN 11719 9992 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140275.1 protein_id gnl|my_center|LOCUS_05980 12450 11770 gene locus_tag LOCUS_05990 12450 11770 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 protein_id gnl|my_center|LOCUS_05990 13612 12554 gene locus_tag LOCUS_06000 13612 12554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444437.1 protein_id gnl|my_center|LOCUS_06000 13949 14419 gene locus_tag LOCUS_06010 13949 14419 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_06010 15053 15493 gene locus_tag LOCUS_06020 15053 15493 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055880.1 protein_id gnl|my_center|LOCUS_06020 15552 17198 gene locus_tag LOCUS_06030 15552 17198 CDS product DUF3685 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058156.1 protein_id gnl|my_center|LOCUS_06030 18973 17252 gene locus_tag LOCUS_06040 gene lysS 18973 17252 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015229441.1 protein_id gnl|my_center|LOCUS_06040 19688 19119 gene locus_tag LOCUS_06050 19688 19119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 20119 21033 gene locus_tag LOCUS_06060 20119 21033 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056888.1 protein_id gnl|my_center|LOCUS_06060 21047 22288 gene locus_tag LOCUS_06070 gene ispG 21047 22288 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056840.1 protein_id gnl|my_center|LOCUS_06070 22380 23426 gene locus_tag LOCUS_06080 gene hisC 22380 23426 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943720.1 protein_id gnl|my_center|LOCUS_06080 23528 23854 gene locus_tag LOCUS_06090 23528 23854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 24856 23975 gene locus_tag LOCUS_06100 gene truB 24856 23975 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057445.1 protein_id gnl|my_center|LOCUS_06100 26171 25137 gene locus_tag LOCUS_06110 gene tsaD 26171 25137 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056353.1 protein_id gnl|my_center|LOCUS_06110 27848 26277 gene locus_tag LOCUS_06120 27848 26277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 28068 28250 gene locus_tag LOCUS_06130 28068 28250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 28667 28251 gene locus_tag LOCUS_06140 28667 28251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 >Feature sequence021 133 441 gene locus_tag LOCUS_06150 133 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 598 852 gene locus_tag LOCUS_06160 598 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 2344 1136 gene locus_tag LOCUS_06170 2344 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 3847 2852 gene locus_tag LOCUS_06180 3847 2852 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143314.1 protein_id gnl|my_center|LOCUS_06180 4084 4431 gene locus_tag LOCUS_06190 4084 4431 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142756.1 protein_id gnl|my_center|LOCUS_06190 5715 4402 gene locus_tag LOCUS_06200 5715 4402 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_06200 7141 6254 gene locus_tag LOCUS_06210 gene cofG 7141 6254 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057355.1 protein_id gnl|my_center|LOCUS_06210 7254 8918 gene locus_tag LOCUS_06220 7254 8918 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056162.1 protein_id gnl|my_center|LOCUS_06220 9181 8915 gene locus_tag LOCUS_06230 9181 8915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 10149 9751 gene locus_tag LOCUS_06240 10149 9751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 10432 10133 gene locus_tag LOCUS_06250 10432 10133 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_06250 10668 11438 gene locus_tag LOCUS_06260 10668 11438 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057734.1 protein_id gnl|my_center|LOCUS_06260 11429 11899 gene locus_tag LOCUS_06270 11429 11899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 12058 13422 gene locus_tag LOCUS_06280 12058 13422 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_06280 13555 14112 gene locus_tag LOCUS_06290 13555 14112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 14477 16165 gene locus_tag LOCUS_06300 14477 16165 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057909.1 protein_id gnl|my_center|LOCUS_06300 16893 16252 gene locus_tag LOCUS_06310 16893 16252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929189.1 protein_id gnl|my_center|LOCUS_06310 18005 16896 gene locus_tag LOCUS_06320 18005 16896 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_06320 18547 18245 gene locus_tag LOCUS_06330 18547 18245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 19096 18602 gene locus_tag LOCUS_06340 19096 18602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 19267 20136 gene locus_tag LOCUS_06350 19267 20136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 21280 20327 gene locus_tag LOCUS_06360 21280 20327 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550332.1 protein_id gnl|my_center|LOCUS_06360 21799 21296 gene locus_tag LOCUS_06370 21799 21296 CDS product CGLD27 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140851.1 protein_id gnl|my_center|LOCUS_06370 22209 21805 gene locus_tag LOCUS_06380 gene rsfS 22209 21805 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057064.1 protein_id gnl|my_center|LOCUS_06380 22861 22265 gene locus_tag LOCUS_06390 gene yqeK 22861 22265 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057165.1 protein_id gnl|my_center|LOCUS_06390 24509 22941 gene locus_tag LOCUS_06400 24509 22941 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_06400 24859 25842 gene locus_tag LOCUS_06410 24859 25842 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056059.1 protein_id gnl|my_center|LOCUS_06410 25869 27275 gene locus_tag LOCUS_06420 gene secD 25869 27275 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056058.1 protein_id gnl|my_center|LOCUS_06420 27418 28350 gene locus_tag LOCUS_06430 gene secF 27418 28350 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056057.1 protein_id gnl|my_center|LOCUS_06430 28875 28393 gene locus_tag LOCUS_06440 28875 28393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 29183 28947 gene locus_tag LOCUS_06450 29183 28947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 >Feature sequence022 1255 1620 gene locus_tag LOCUS_06460 1255 1620 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_06460 1712 2242 gene locus_tag LOCUS_06470 1712 2242 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056202.1 protein_id gnl|my_center|LOCUS_06470 2332 4998 gene locus_tag LOCUS_06480 2332 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 5072 6283 gene locus_tag LOCUS_06490 5072 6283 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056224.1 protein_id gnl|my_center|LOCUS_06490 6730 8067 gene locus_tag LOCUS_06500 6730 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 13878 8089 gene locus_tag LOCUS_06510 13878 8089 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_06510 14962 13970 gene locus_tag LOCUS_06520 14962 13970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 16100 15015 gene locus_tag LOCUS_06530 16100 15015 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_06530 16395 16667 gene locus_tag LOCUS_06540 16395 16667 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_06540 16651 16905 gene locus_tag LOCUS_06550 16651 16905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 17209 16994 gene locus_tag LOCUS_06560 17209 16994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 17532 17206 gene locus_tag LOCUS_06570 17532 17206 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393300.1 protein_id gnl|my_center|LOCUS_06570 18333 19574 gene locus_tag LOCUS_06580 18333 19574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 19825 20112 gene locus_tag LOCUS_06590 19825 20112 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 protein_id gnl|my_center|LOCUS_06590 20090 20362 gene locus_tag LOCUS_06600 20090 20362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 20606 20917 gene locus_tag LOCUS_06610 20606 20917 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038219.1 protein_id gnl|my_center|LOCUS_06610 20914 21408 gene locus_tag LOCUS_06620 20914 21408 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530563.1 protein_id gnl|my_center|LOCUS_06620 21639 21983 gene locus_tag LOCUS_06630 21639 21983 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296467.1 protein_id gnl|my_center|LOCUS_06630 21986 22285 gene locus_tag LOCUS_06640 21986 22285 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838298.1 protein_id gnl|my_center|LOCUS_06640 22511 22320 gene locus_tag LOCUS_06650 22511 22320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 22890 23234 gene locus_tag LOCUS_06660 22890 23234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 25649 23352 gene locus_tag LOCUS_06670 25649 23352 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227744.1 protein_id gnl|my_center|LOCUS_06670 26211 26585 gene locus_tag LOCUS_06680 26211 26585 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057533.1 protein_id gnl|my_center|LOCUS_06680 26759 27685 gene locus_tag LOCUS_06690 26759 27685 CDS product photosynthesis system II assembly factor Ycf48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057532.1 protein_id gnl|my_center|LOCUS_06690 27764 28009 gene locus_tag LOCUS_06700 gene psbE 27764 28009 CDS product cytochrome b559 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057381.1 protein_id gnl|my_center|LOCUS_06700 28035 28169 gene locus_tag LOCUS_06710 gene psbF 28035 28169 CDS product cytochrome b559 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057382.1 protein_id gnl|my_center|LOCUS_06710 28342 28461 gene locus_tag LOCUS_06720 28342 28461 CDS product photosystem II reaction center protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071823295.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence023 394 1635 gene locus_tag LOCUS_06730 394 1635 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056850.1 protein_id gnl|my_center|LOCUS_06730 1635 2087 gene locus_tag LOCUS_06740 gene ruvX 1635 2087 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058162.1 protein_id gnl|my_center|LOCUS_06740 3372 2122 gene locus_tag LOCUS_06750 3372 2122 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058010.1 protein_id gnl|my_center|LOCUS_06750 4412 3597 gene locus_tag LOCUS_06760 4412 3597 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_06760 6131 4908 gene locus_tag LOCUS_06770 6131 4908 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920968.1 protein_id gnl|my_center|LOCUS_06770 6797 7630 gene locus_tag LOCUS_06780 6797 7630 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921038.1 protein_id gnl|my_center|LOCUS_06780 8124 9296 gene locus_tag LOCUS_06790 gene dxr 8124 9296 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921140.1 protein_id gnl|my_center|LOCUS_06790 9495 10790 gene locus_tag LOCUS_06800 9495 10790 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442178.1 protein_id gnl|my_center|LOCUS_06800 10807 11478 gene locus_tag LOCUS_06810 10807 11478 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057523.1 protein_id gnl|my_center|LOCUS_06810 12914 11739 gene locus_tag LOCUS_06820 12914 11739 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065470411.1 protein_id gnl|my_center|LOCUS_06820 13158 14435 gene locus_tag LOCUS_06830 gene ahcY 13158 14435 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058222.1 protein_id gnl|my_center|LOCUS_06830 14586 15191 gene locus_tag LOCUS_06840 14586 15191 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_06840 15334 15633 gene locus_tag LOCUS_06850 15334 15633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 15630 15824 gene locus_tag LOCUS_06860 15630 15824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06860 15975 16226 gene locus_tag LOCUS_06870 15975 16226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 16351 16548 gene locus_tag LOCUS_06880 16351 16548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 16545 16934 gene locus_tag LOCUS_06890 16545 16934 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392206.1 protein_id gnl|my_center|LOCUS_06890 18721 17774 gene locus_tag LOCUS_06900 18721 17774 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056240.1 protein_id gnl|my_center|LOCUS_06900 20421 18913 gene locus_tag LOCUS_06910 gene atpA 20421 18913 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056290.1 protein_id gnl|my_center|LOCUS_06910 21038 20490 gene locus_tag LOCUS_06920 gene atpH 21038 20490 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056289.1 protein_id gnl|my_center|LOCUS_06920 21581 21039 gene locus_tag LOCUS_06930 21581 21039 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524128.1 protein_id gnl|my_center|LOCUS_06930 22139 21708 gene locus_tag LOCUS_06940 22139 21708 CDS product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056287.1 protein_id gnl|my_center|LOCUS_06940 22615 22370 gene locus_tag LOCUS_06950 gene atpE 22615 22370 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125083.1 protein_id gnl|my_center|LOCUS_06950 23595 22846 gene locus_tag LOCUS_06960 gene atpB 23595 22846 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056285.1 protein_id gnl|my_center|LOCUS_06960 24015 23653 gene locus_tag LOCUS_06970 24015 23653 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920689.1 protein_id gnl|my_center|LOCUS_06970 24995 24555 gene locus_tag LOCUS_06980 24995 24555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 25953 25603 gene locus_tag LOCUS_06990 25953 25603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 26104 27399 gene locus_tag LOCUS_07000 26104 27399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 27826 28080 gene locus_tag LOCUS_07010 27826 28080 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 protein_id gnl|my_center|LOCUS_07010 28037 28354 gene locus_tag LOCUS_07020 28037 28354 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_07020 28378 28881 gene locus_tag LOCUS_07030 28378 28881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 >Feature sequence024 447 1628 gene locus_tag LOCUS_07040 447 1628 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243172.1 protein_id gnl|my_center|LOCUS_07040 1635 1991 gene locus_tag LOCUS_07050 1635 1991 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939601.1 protein_id gnl|my_center|LOCUS_07050 2050 2739 gene locus_tag LOCUS_07060 gene hypB 2050 2739 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_07060 2803 3843 gene locus_tag LOCUS_07070 2803 3843 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191315613.1 protein_id gnl|my_center|LOCUS_07070 4091 4906 gene locus_tag LOCUS_07080 4091 4906 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140177.1 protein_id gnl|my_center|LOCUS_07080 4977 5735 gene locus_tag LOCUS_07090 4977 5735 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140178.1 protein_id gnl|my_center|LOCUS_07090 6041 7003 gene locus_tag LOCUS_07100 6041 7003 CDS product orange carotenoid protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140054.1 protein_id gnl|my_center|LOCUS_07100 7188 7559 gene locus_tag LOCUS_07110 7188 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 7727 8242 gene locus_tag LOCUS_07120 7727 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 8316 9230 gene locus_tag LOCUS_07130 8316 9230 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_07130 9586 9302 gene locus_tag LOCUS_07140 9586 9302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 9797 9579 gene locus_tag LOCUS_07150 9797 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 10022 9855 gene locus_tag LOCUS_07160 10022 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 10246 10929 gene locus_tag LOCUS_07170 10246 10929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 11889 11059 gene locus_tag LOCUS_07180 11889 11059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 12345 12839 gene locus_tag LOCUS_07190 12345 12839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 13264 13413 gene locus_tag LOCUS_07200 13264 13413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 13404 13601 gene locus_tag LOCUS_07210 13404 13601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 14015 13683 gene locus_tag LOCUS_07220 14015 13683 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_07220 14242 14021 gene locus_tag LOCUS_07230 14242 14021 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_07230 15873 14317 gene locus_tag LOCUS_07240 15873 14317 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_07240 16226 16047 gene locus_tag LOCUS_07250 16226 16047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 16253 16477 gene locus_tag LOCUS_07260 16253 16477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 16474 16866 gene locus_tag LOCUS_07270 16474 16866 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142729.1 protein_id gnl|my_center|LOCUS_07270 17155 17604 gene locus_tag LOCUS_07280 17155 17604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07280 19239 18037 gene locus_tag LOCUS_07290 19239 18037 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075901854.1 protein_id gnl|my_center|LOCUS_07290 20353 19253 gene locus_tag LOCUS_07300 gene aroC 20353 19253 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_07300 20733 21452 gene locus_tag LOCUS_07310 gene sfsA 20733 21452 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057534.1 protein_id gnl|my_center|LOCUS_07310 22193 21582 gene locus_tag LOCUS_07320 22193 21582 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142986.1 protein_id gnl|my_center|LOCUS_07320 22788 22216 gene locus_tag LOCUS_07330 22788 22216 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920717.1 protein_id gnl|my_center|LOCUS_07330 23277 23008 gene locus_tag LOCUS_07340 23277 23008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124299.1 protein_id gnl|my_center|LOCUS_07340 25149 23536 gene locus_tag LOCUS_07350 25149 23536 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076961.1 protein_id gnl|my_center|LOCUS_07350 25366 25142 gene locus_tag LOCUS_07360 25366 25142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 25757 25494 gene locus_tag LOCUS_07370 25757 25494 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_07370 26010 25750 gene locus_tag LOCUS_07380 26010 25750 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976578.1 protein_id gnl|my_center|LOCUS_07380 27773 26481 gene locus_tag LOCUS_07390 27773 26481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence025 324 130 gene locus_tag LOCUS_07400 324 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 602 318 gene locus_tag LOCUS_07410 602 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 1395 694 gene locus_tag LOCUS_07420 1395 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 2010 1408 gene locus_tag LOCUS_07430 2010 1408 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246350.1 protein_id gnl|my_center|LOCUS_07430 2600 2025 gene locus_tag LOCUS_07440 2600 2025 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236653.1 protein_id gnl|my_center|LOCUS_07440 3710 3078 gene locus_tag LOCUS_07450 gene mtnX 3710 3078 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245748.1 protein_id gnl|my_center|LOCUS_07450 3797 4615 gene locus_tag LOCUS_07460 3797 4615 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_07460 5909 4692 gene locus_tag LOCUS_07470 5909 4692 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056562.1 protein_id gnl|my_center|LOCUS_07470 6004 6252 gene locus_tag LOCUS_07480 6004 6252 CDS product Ycf34 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058288.1 protein_id gnl|my_center|LOCUS_07480 6459 6719 gene locus_tag LOCUS_07490 6459 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 6685 7128 gene locus_tag LOCUS_07500 6685 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 8506 7184 gene locus_tag LOCUS_07510 8506 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 10001 8499 gene locus_tag LOCUS_07520 10001 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 10201 10049 gene locus_tag LOCUS_07530 10201 10049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 10303 11082 gene locus_tag LOCUS_07540 10303 11082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 11163 11486 gene locus_tag LOCUS_07550 11163 11486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 11737 12399 gene locus_tag LOCUS_07560 11737 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 12439 13425 gene locus_tag LOCUS_07570 12439 13425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 13534 16710 gene locus_tag LOCUS_07580 13534 16710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 16766 17926 gene locus_tag LOCUS_07590 16766 17926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 17987 18679 gene locus_tag LOCUS_07600 17987 18679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 18727 19293 gene locus_tag LOCUS_07610 18727 19293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 19353 19769 gene locus_tag LOCUS_07620 19353 19769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 20401 20036 gene locus_tag LOCUS_07630 20401 20036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 20804 24550 gene locus_tag LOCUS_07640 20804 24550 CDS product NB-ARC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530011.1 protein_id gnl|my_center|LOCUS_07640 27157 24770 gene locus_tag LOCUS_07650 27157 24770 CDS product DUF3769 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015184012.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence026 160 2211 gene locus_tag LOCUS_07660 160 2211 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_07660 2353 2904 gene locus_tag LOCUS_07670 2353 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 3184 3408 gene locus_tag LOCUS_07680 3184 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 3405 3686 gene locus_tag LOCUS_07690 3405 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 4072 6378 gene locus_tag LOCUS_07700 4072 6378 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_07700 6317 6763 gene locus_tag LOCUS_07710 6317 6763 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021290.1 protein_id gnl|my_center|LOCUS_07710 7101 8276 gene locus_tag LOCUS_07720 7101 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 9205 8330 gene locus_tag LOCUS_07730 9205 8330 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403590.1 protein_id gnl|my_center|LOCUS_07730 10854 9364 gene locus_tag LOCUS_07740 10854 9364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390741.1 protein_id gnl|my_center|LOCUS_07740 12228 10861 gene locus_tag LOCUS_07750 12228 10861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 12667 12236 gene locus_tag LOCUS_07760 12667 12236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 13446 17432 gene locus_tag LOCUS_07770 13446 17432 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056126.1 protein_id gnl|my_center|LOCUS_07770 18015 17518 gene locus_tag LOCUS_07780 18015 17518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 18268 17999 gene locus_tag LOCUS_07790 18268 17999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 18529 18765 gene locus_tag LOCUS_07800 18529 18765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 19167 20090 gene locus_tag LOCUS_07810 19167 20090 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056938.1 protein_id gnl|my_center|LOCUS_07810 20961 20152 gene locus_tag LOCUS_07820 20961 20152 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818985.1 protein_id gnl|my_center|LOCUS_07820 21396 21806 gene locus_tag LOCUS_07830 21396 21806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 22957 21773 gene locus_tag LOCUS_07840 22957 21773 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_07840 23144 23938 gene locus_tag LOCUS_07850 23144 23938 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141808.1 protein_id gnl|my_center|LOCUS_07850 25675 24323 gene locus_tag LOCUS_07860 25675 24323 CDS product TIGR03279 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057484.1 protein_id gnl|my_center|LOCUS_07860 25761 25991 gene locus_tag LOCUS_07870 25761 25991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 26010 26204 gene locus_tag LOCUS_07880 26010 26204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence027 1402 545 gene locus_tag LOCUS_07890 1402 545 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_07890 3071 1467 gene locus_tag LOCUS_07900 3071 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036215.1 protein_id gnl|my_center|LOCUS_07900 4481 3111 gene locus_tag LOCUS_07910 4481 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 4862 6352 gene locus_tag LOCUS_07920 4862 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 6567 6830 gene locus_tag LOCUS_07930 6567 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 7103 8077 gene locus_tag LOCUS_07940 7103 8077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 8112 9182 gene locus_tag LOCUS_07950 8112 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 9322 10599 gene locus_tag LOCUS_07960 9322 10599 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039737632.1 protein_id gnl|my_center|LOCUS_07960 10608 11012 gene locus_tag LOCUS_07970 10608 11012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 11009 11974 gene locus_tag LOCUS_07980 11009 11974 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_07980 12383 12018 gene locus_tag LOCUS_07990 12383 12018 CDS product DUF1815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987665.1 protein_id gnl|my_center|LOCUS_07990 14399 12954 gene locus_tag LOCUS_08000 14399 12954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 15124 14396 gene locus_tag LOCUS_08010 15124 14396 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929061.1 protein_id gnl|my_center|LOCUS_08010 15496 16206 gene locus_tag LOCUS_08020 15496 16206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056056.1 protein_id gnl|my_center|LOCUS_08020 16509 16937 gene locus_tag LOCUS_08030 16509 16937 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140553.1 protein_id gnl|my_center|LOCUS_08030 17002 20190 gene locus_tag LOCUS_08040 17002 20190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 20425 20649 gene locus_tag LOCUS_08050 20425 20649 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_08050 20646 20978 gene locus_tag LOCUS_08060 20646 20978 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_08060 21495 21289 gene locus_tag LOCUS_08070 21495 21289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 22274 23023 gene locus_tag LOCUS_08080 22274 23023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 23431 24132 gene locus_tag LOCUS_08090 23431 24132 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888749.1 protein_id gnl|my_center|LOCUS_08090 24401 25918 gene locus_tag LOCUS_08100 24401 25918 CDS product NAD(P)H-quinone oxidoreductase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057656.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence028 1252 302 gene locus_tag LOCUS_08110 1252 302 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_08110 1518 2450 gene locus_tag LOCUS_08120 1518 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 2798 2532 gene locus_tag LOCUS_08130 2798 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141287.1 protein_id gnl|my_center|LOCUS_08130 3978 3013 gene locus_tag LOCUS_08140 3978 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 6397 4271 gene locus_tag LOCUS_08150 6397 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 6645 6400 gene locus_tag LOCUS_08160 6645 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 8326 6701 gene locus_tag LOCUS_08170 8326 6701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056296.1 protein_id gnl|my_center|LOCUS_08170 8978 8622 gene locus_tag LOCUS_08180 8978 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 9207 11504 gene locus_tag LOCUS_08190 9207 11504 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920718.1 protein_id gnl|my_center|LOCUS_08190 11662 12660 gene locus_tag LOCUS_08200 11662 12660 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124832.1 protein_id gnl|my_center|LOCUS_08200 12942 14345 gene locus_tag LOCUS_08210 gene leuC 12942 14345 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143406.1 protein_id gnl|my_center|LOCUS_08210 17390 14946 gene locus_tag LOCUS_08220 17390 14946 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892072.1 protein_id gnl|my_center|LOCUS_08220 18395 17415 gene locus_tag LOCUS_08230 18395 17415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 19035 18490 gene locus_tag LOCUS_08240 19035 18490 CDS product IS607 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146551.1 protein_id gnl|my_center|LOCUS_08240 19377 20837 gene locus_tag LOCUS_08250 gene zds 19377 20837 CDS product 9,9'-di-cis-zeta-carotene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056192.1 protein_id gnl|my_center|LOCUS_08250 21009 21704 gene locus_tag LOCUS_08260 21009 21704 CDS product aldehyde oxygenase (deformylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057153.1 protein_id gnl|my_center|LOCUS_08260 21853 22872 gene locus_tag LOCUS_08270 21853 22872 CDS product long-chain acyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057152.1 protein_id gnl|my_center|LOCUS_08270 23233 24369 gene locus_tag LOCUS_08280 23233 24369 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057921.1 protein_id gnl|my_center|LOCUS_08280 24553 25833 gene locus_tag LOCUS_08290 24553 25833 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence029 781 1998 gene locus_tag LOCUS_08300 781 1998 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776584.1 protein_id gnl|my_center|LOCUS_08300 3624 2044 gene locus_tag LOCUS_08310 3624 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 5077 3992 gene locus_tag LOCUS_08320 gene cax 5077 3992 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_08320 5535 5074 gene locus_tag LOCUS_08330 5535 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 6006 5698 gene locus_tag LOCUS_08340 6006 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057985.1 protein_id gnl|my_center|LOCUS_08340 7532 6540 gene locus_tag LOCUS_08350 7532 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 7793 7536 gene locus_tag LOCUS_08360 7793 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 8883 7795 gene locus_tag LOCUS_08370 8883 7795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 9431 9006 gene locus_tag LOCUS_08380 9431 9006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 11481 9544 gene locus_tag LOCUS_08390 gene sir 11481 9544 CDS product sulfite reductase, ferredoxin dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920675.1 protein_id gnl|my_center|LOCUS_08390 11678 14077 gene locus_tag LOCUS_08400 11678 14077 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057093.1 protein_id gnl|my_center|LOCUS_08400 14872 14285 gene locus_tag LOCUS_08410 gene msrA 14872 14285 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_08410 15528 17486 gene locus_tag LOCUS_08420 15528 17486 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261759.1 protein_id gnl|my_center|LOCUS_08420 19515 17875 gene locus_tag LOCUS_08430 19515 17875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142439.1 protein_id gnl|my_center|LOCUS_08430 21624 19591 gene locus_tag LOCUS_08440 21624 19591 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057163.1 protein_id gnl|my_center|LOCUS_08440 22835 21666 gene locus_tag LOCUS_08450 gene sat 22835 21666 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_08450 22967 23671 gene locus_tag LOCUS_08460 22967 23671 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056362.1 protein_id gnl|my_center|LOCUS_08460 24004 25089 gene locus_tag LOCUS_08470 gene hppD 24004 25089 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810922.1 protein_id gnl|my_center|LOCUS_08470 25657 25121 gene locus_tag LOCUS_08480 25657 25121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence030 877 215 gene locus_tag LOCUS_08490 877 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 2099 879 gene locus_tag LOCUS_08500 2099 879 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_08500 3744 2296 gene locus_tag LOCUS_08510 3744 2296 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056475.1 protein_id gnl|my_center|LOCUS_08510 5381 3948 gene locus_tag LOCUS_08520 5381 3948 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920854.1 protein_id gnl|my_center|LOCUS_08520 6425 6763 gene locus_tag LOCUS_08530 6425 6763 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154861.1 protein_id gnl|my_center|LOCUS_08530 6868 7599 gene locus_tag LOCUS_08540 6868 7599 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173416.1 protein_id gnl|my_center|LOCUS_08540 7619 8266 gene locus_tag LOCUS_08550 gene arsH 7619 8266 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928410.1 protein_id gnl|my_center|LOCUS_08550 8290 8685 gene locus_tag LOCUS_08560 gene arsC 8290 8685 CDS product arsenate reductase, glutathione/glutaredoxin type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140008.1 protein_id gnl|my_center|LOCUS_08560 8700 8939 gene locus_tag LOCUS_08570 8700 8939 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057724.1 protein_id gnl|my_center|LOCUS_08570 8969 9952 gene locus_tag LOCUS_08580 8969 9952 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943586.1 protein_id gnl|my_center|LOCUS_08580 10836 9955 gene locus_tag LOCUS_08590 10836 9955 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057174.1 protein_id gnl|my_center|LOCUS_08590 11170 10970 gene locus_tag LOCUS_08600 11170 10970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 11744 12265 gene locus_tag LOCUS_08610 11744 12265 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920888.1 protein_id gnl|my_center|LOCUS_08610 12338 13048 gene locus_tag LOCUS_08620 gene rpiA 12338 13048 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057113.1 protein_id gnl|my_center|LOCUS_08620 14274 13147 gene locus_tag LOCUS_08630 gene recF 14274 13147 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142400.1 protein_id gnl|my_center|LOCUS_08630 14549 15121 gene locus_tag LOCUS_08640 14549 15121 CDS product DUF2808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142565.1 protein_id gnl|my_center|LOCUS_08640 16125 15481 gene locus_tag LOCUS_08650 16125 15481 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_08650 16487 16651 gene locus_tag LOCUS_08660 16487 16651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 16821 17126 gene locus_tag LOCUS_08670 16821 17126 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799703.1 protein_id gnl|my_center|LOCUS_08670 17911 17123 gene locus_tag LOCUS_08680 17911 17123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 18113 21175 gene locus_tag LOCUS_08690 18113 21175 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142263.1 protein_id gnl|my_center|LOCUS_08690 21539 21297 gene locus_tag LOCUS_08700 21539 21297 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140099.1 protein_id gnl|my_center|LOCUS_08700 22401 21631 gene locus_tag LOCUS_08710 22401 21631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 23096 22434 gene locus_tag LOCUS_08720 23096 22434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 23644 25038 gene locus_tag LOCUS_08730 23644 25038 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039725284.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence031 2510 270 gene locus_tag LOCUS_08740 2510 270 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920844.1 protein_id gnl|my_center|LOCUS_08740 3180 3473 gene locus_tag LOCUS_08750 3180 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057054.1 protein_id gnl|my_center|LOCUS_08750 3561 4631 gene locus_tag LOCUS_08760 3561 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 5352 4648 gene locus_tag LOCUS_08770 gene rnc 5352 4648 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142642.1 protein_id gnl|my_center|LOCUS_08770 5664 5897 gene locus_tag LOCUS_08780 5664 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 6401 5979 gene locus_tag LOCUS_08790 6401 5979 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969926.1 protein_id gnl|my_center|LOCUS_08790 6609 6385 gene locus_tag LOCUS_08800 6609 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 8226 6706 gene locus_tag LOCUS_08810 8226 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 9456 10283 gene locus_tag LOCUS_08820 9456 10283 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_08820 11415 10261 gene locus_tag LOCUS_08830 11415 10261 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055884.1 protein_id gnl|my_center|LOCUS_08830 11563 13152 gene locus_tag LOCUS_08840 11563 13152 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_08840 13638 13207 gene locus_tag LOCUS_08850 13638 13207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 14804 13794 gene locus_tag LOCUS_08860 14804 13794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 15580 16494 gene locus_tag LOCUS_08870 15580 16494 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056269.1 protein_id gnl|my_center|LOCUS_08870 16496 17686 gene locus_tag LOCUS_08880 16496 17686 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920967.1 protein_id gnl|my_center|LOCUS_08880 17795 19108 gene locus_tag LOCUS_08890 17795 19108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 19537 19124 gene locus_tag LOCUS_08900 19537 19124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 19797 19534 gene locus_tag LOCUS_08910 19797 19534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 20109 19858 gene locus_tag LOCUS_08920 20109 19858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 20319 20672 gene locus_tag LOCUS_08930 20319 20672 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097692.1 protein_id gnl|my_center|LOCUS_08930 20672 20875 gene locus_tag LOCUS_08940 20672 20875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 21508 21362 gene locus_tag LOCUS_08950 21508 21362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 21747 21499 gene locus_tag LOCUS_08960 21747 21499 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_08960 22033 23121 gene locus_tag LOCUS_08970 22033 23121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 23176 23601 gene locus_tag LOCUS_08980 23176 23601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 23580 23918 gene locus_tag LOCUS_08990 23580 23918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 24097 24306 gene locus_tag LOCUS_09000 24097 24306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 24346 24600 gene locus_tag LOCUS_09010 24346 24600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence032 <1 833 gene locus_tag LOCUS_09020 <1 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459437.1:RNA-guided endonuclease TnpB family protein 905 2140 gene locus_tag LOCUS_09030 905 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 3095 2151 gene locus_tag LOCUS_09040 3095 2151 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119887.1 protein_id gnl|my_center|LOCUS_09040 3451 3098 gene locus_tag LOCUS_09050 3451 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941231.1 protein_id gnl|my_center|LOCUS_09050 4277 3570 gene locus_tag LOCUS_09060 4277 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 4696 5226 gene locus_tag LOCUS_09070 4696 5226 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144198.1 protein_id gnl|my_center|LOCUS_09070 7375 5216 gene locus_tag LOCUS_09080 7375 5216 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057539.1 protein_id gnl|my_center|LOCUS_09080 9243 7429 gene locus_tag LOCUS_09090 gene sppA 9243 7429 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_09090 9886 11277 gene locus_tag LOCUS_09100 9886 11277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 12086 11274 gene locus_tag LOCUS_09110 12086 11274 CDS product TdeIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682206.1 protein_id gnl|my_center|LOCUS_09110 12336 12109 gene locus_tag LOCUS_09120 12336 12109 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016020.1 protein_id gnl|my_center|LOCUS_09120 12711 12481 gene locus_tag LOCUS_09130 12711 12481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 12947 12708 gene locus_tag LOCUS_09140 12947 12708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 13086 14720 gene locus_tag LOCUS_09150 13086 14720 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058039.1 protein_id gnl|my_center|LOCUS_09150 14834 15544 gene locus_tag LOCUS_09160 14834 15544 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799326.1 protein_id gnl|my_center|LOCUS_09160 15741 16772 gene locus_tag LOCUS_09170 15741 16772 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144236.1 protein_id gnl|my_center|LOCUS_09170 17038 18162 gene locus_tag LOCUS_09180 17038 18162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 18180 21329 gene locus_tag LOCUS_09190 18180 21329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 21427 23496 gene locus_tag LOCUS_09200 21427 23496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 23590 24231 gene locus_tag LOCUS_09210 23590 24231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 24310 24543 gene locus_tag LOCUS_09220 24310 24543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence033 2747 123 gene locus_tag LOCUS_09230 2747 123 CDS product trans-splicing intein-formed DNA polymerase III subunit alpha N-terminal partner DnaE-N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057891.1 protein_id gnl|my_center|LOCUS_09230 3596 2832 gene locus_tag LOCUS_09240 3596 2832 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929594.1 protein_id gnl|my_center|LOCUS_09240 5262 3742 gene locus_tag LOCUS_09250 gene kaiC 5262 3742 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259117.1 protein_id gnl|my_center|LOCUS_09250 5589 5738 gene locus_tag LOCUS_09260 5589 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 6743 5817 gene locus_tag LOCUS_09270 6743 5817 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057302.1 protein_id gnl|my_center|LOCUS_09270 8527 6767 gene locus_tag LOCUS_09280 8527 6767 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_09280 11123 8673 gene locus_tag LOCUS_09290 11123 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 11790 11254 gene locus_tag LOCUS_09300 gene mreD 11790 11254 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144384.1 protein_id gnl|my_center|LOCUS_09300 12551 11802 gene locus_tag LOCUS_09310 12551 11802 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056783.1 protein_id gnl|my_center|LOCUS_09310 13679 12642 gene locus_tag LOCUS_09320 13679 12642 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056782.1 protein_id gnl|my_center|LOCUS_09320 13907 14257 gene locus_tag LOCUS_09330 13907 14257 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057330.1 protein_id gnl|my_center|LOCUS_09330 15126 14314 gene locus_tag LOCUS_09340 15126 14314 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142576.1 protein_id gnl|my_center|LOCUS_09340 15546 17171 gene locus_tag LOCUS_09350 15546 17171 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880772.1 protein_id gnl|my_center|LOCUS_09350 17279 20266 gene locus_tag LOCUS_09360 gene gcvP 17279 20266 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140250.1 protein_id gnl|my_center|LOCUS_09360 21535 20306 gene locus_tag LOCUS_09370 gene lpxB 21535 20306 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056176.1 protein_id gnl|my_center|LOCUS_09370 22490 21654 gene locus_tag LOCUS_09380 gene lpxA 22490 21654 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921189.1 protein_id gnl|my_center|LOCUS_09380 22641 23960 gene locus_tag LOCUS_09390 22641 23960 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058262.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence034 258 28 gene locus_tag LOCUS_09400 258 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 671 1447 gene locus_tag LOCUS_09410 671 1447 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_09410 2864 1704 gene locus_tag LOCUS_09420 2864 1704 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121451.1 protein_id gnl|my_center|LOCUS_09420 3203 2973 gene locus_tag LOCUS_09430 3203 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 4452 3319 gene locus_tag LOCUS_09440 4452 3319 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345474.1 protein_id gnl|my_center|LOCUS_09440 5065 7554 gene locus_tag LOCUS_09450 gene priA 5065 7554 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140029.1 protein_id gnl|my_center|LOCUS_09450 7834 7583 gene locus_tag LOCUS_09460 7834 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 8069 8863 gene locus_tag LOCUS_09470 gene pgeF 8069 8863 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799068.1 protein_id gnl|my_center|LOCUS_09470 8926 9903 gene locus_tag LOCUS_09480 gene fmt 8926 9903 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406043.1 protein_id gnl|my_center|LOCUS_09480 10314 9934 gene locus_tag LOCUS_09490 10314 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 11520 10714 gene locus_tag LOCUS_09500 11520 10714 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057297.1 protein_id gnl|my_center|LOCUS_09500 11660 11881 gene locus_tag LOCUS_09510 11660 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 12829 11999 gene locus_tag LOCUS_09520 12829 11999 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_09520 14302 12944 gene locus_tag LOCUS_09530 gene trxB 14302 12944 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057761.1 protein_id gnl|my_center|LOCUS_09530 14653 17280 gene locus_tag LOCUS_09540 14653 17280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 18096 17320 gene locus_tag LOCUS_09550 18096 17320 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142041.1 protein_id gnl|my_center|LOCUS_09550 19363 18170 gene locus_tag LOCUS_09560 19363 18170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 20695 19724 gene locus_tag LOCUS_09570 20695 19724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 22107 20695 gene locus_tag LOCUS_09580 22107 20695 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057779.1 protein_id gnl|my_center|LOCUS_09580 23320 22238 gene locus_tag LOCUS_09590 23320 22238 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388802.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence035 146 547 gene locus_tag LOCUS_09600 146 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 628 1839 gene locus_tag LOCUS_09610 628 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 2102 2626 gene locus_tag LOCUS_09620 2102 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2752 5310 gene locus_tag LOCUS_09630 2752 5310 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169250172.1 protein_id gnl|my_center|LOCUS_09630 6256 5375 gene locus_tag LOCUS_09640 6256 5375 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056446.1 protein_id gnl|my_center|LOCUS_09640 6269 7495 gene locus_tag LOCUS_09650 6269 7495 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 protein_id gnl|my_center|LOCUS_09650 9180 7525 gene locus_tag LOCUS_09660 9180 7525 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056997.1 protein_id gnl|my_center|LOCUS_09660 10263 9733 gene locus_tag LOCUS_09670 10263 9733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 10648 10286 gene locus_tag LOCUS_09680 10648 10286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 11340 10645 gene locus_tag LOCUS_09690 11340 10645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 11410 11688 gene locus_tag LOCUS_09700 11410 11688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 11746 12705 gene locus_tag LOCUS_09710 gene cysK 11746 12705 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056355.1 protein_id gnl|my_center|LOCUS_09710 13651 12923 gene locus_tag LOCUS_09720 13651 12923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 14172 15281 gene locus_tag LOCUS_09730 14172 15281 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226213.1 protein_id gnl|my_center|LOCUS_09730 15361 16878 gene locus_tag LOCUS_09740 15361 16878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 16903 18054 gene locus_tag LOCUS_09750 16903 18054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 18104 18511 gene locus_tag LOCUS_09760 18104 18511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 18631 20307 gene locus_tag LOCUS_09770 18631 20307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 20344 21357 gene locus_tag LOCUS_09780 20344 21357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 21834 22160 gene locus_tag LOCUS_09790 21834 22160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 22288 22722 gene locus_tag LOCUS_09800 22288 22722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence036 689 210 gene locus_tag LOCUS_09810 689 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 2349 922 gene locus_tag LOCUS_09820 2349 922 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039073.1 protein_id gnl|my_center|LOCUS_09820 2739 3269 gene locus_tag LOCUS_09830 gene infC 2739 3269 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106456574.1 protein_id gnl|my_center|LOCUS_09830 3583 3356 gene locus_tag LOCUS_09840 3583 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 4274 3606 gene locus_tag LOCUS_09850 4274 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4667 4371 gene locus_tag LOCUS_09860 4667 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 5187 5050 gene locus_tag LOCUS_09870 5187 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 5371 6594 gene locus_tag LOCUS_09880 5371 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 7811 6591 gene locus_tag LOCUS_09890 7811 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 8212 9585 gene locus_tag LOCUS_09900 gene amt 8212 9585 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_09900 11852 9651 gene locus_tag LOCUS_09910 11852 9651 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140564.1 protein_id gnl|my_center|LOCUS_09910 12141 12830 gene locus_tag LOCUS_09920 12141 12830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 12884 13084 gene locus_tag LOCUS_09930 12884 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 13408 13869 gene locus_tag LOCUS_09940 13408 13869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 14624 13866 gene locus_tag LOCUS_09950 gene cobS 14624 13866 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057177.1 protein_id gnl|my_center|LOCUS_09950 15248 15883 gene locus_tag LOCUS_09960 15248 15883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 16286 16585 gene locus_tag LOCUS_09970 16286 16585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 16599 16769 gene locus_tag LOCUS_09980 16599 16769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 16772 16957 gene locus_tag LOCUS_09990 16772 16957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 17184 17459 gene locus_tag LOCUS_10000 17184 17459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 17737 17958 gene locus_tag LOCUS_10010 17737 17958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 18550 18305 gene locus_tag LOCUS_10020 18550 18305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 18861 20372 gene locus_tag LOCUS_10030 gene ilvA 18861 20372 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_10030 20403 21266 gene locus_tag LOCUS_10040 gene rsmH 20403 21266 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057907.1 protein_id gnl|my_center|LOCUS_10040 22477 21311 gene locus_tag LOCUS_10050 22477 21311 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881286.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence037 581 171 gene locus_tag LOCUS_10060 581 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1923 571 gene locus_tag LOCUS_10070 1923 571 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056064.1 protein_id gnl|my_center|LOCUS_10070 2624 1920 gene locus_tag LOCUS_10080 2624 1920 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057873.1 protein_id gnl|my_center|LOCUS_10080 3227 2913 gene locus_tag LOCUS_10090 3227 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 3465 3214 gene locus_tag LOCUS_10100 3465 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4393 5649 gene locus_tag LOCUS_10110 4393 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 5826 8078 gene locus_tag LOCUS_10120 5826 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 9607 8090 gene locus_tag LOCUS_10130 gene amt 9607 8090 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_10130 10490 9660 gene locus_tag LOCUS_10140 10490 9660 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056065.1 protein_id gnl|my_center|LOCUS_10140 10770 10483 gene locus_tag LOCUS_10150 gene clpS 10770 10483 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024123996.1 protein_id gnl|my_center|LOCUS_10150 10969 11469 gene locus_tag LOCUS_10160 10969 11469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 11626 11823 gene locus_tag LOCUS_10170 11626 11823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 11827 12093 gene locus_tag LOCUS_10180 11827 12093 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_10180 12166 14391 gene locus_tag LOCUS_10190 12166 14391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 15203 14970 gene locus_tag LOCUS_10200 gene rpmE 15203 14970 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125833.1 protein_id gnl|my_center|LOCUS_10200 15636 15223 gene locus_tag LOCUS_10210 gene rpsI 15636 15223 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055964.1 protein_id gnl|my_center|LOCUS_10210 16096 15641 gene locus_tag LOCUS_10220 gene rplM 16096 15641 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055963.1 protein_id gnl|my_center|LOCUS_10220 17050 16220 gene locus_tag LOCUS_10230 gene truA 17050 16220 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055962.1 protein_id gnl|my_center|LOCUS_10230 17385 17053 gene locus_tag LOCUS_10240 gene rplQ 17385 17053 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055961.1 protein_id gnl|my_center|LOCUS_10240 18366 17425 gene locus_tag LOCUS_10250 18366 17425 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143560.1 protein_id gnl|my_center|LOCUS_10250 18951 18559 gene locus_tag LOCUS_10260 gene rpsK 18951 18559 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055959.1 protein_id gnl|my_center|LOCUS_10260 19374 18991 gene locus_tag LOCUS_10270 gene rpsM 19374 18991 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055958.1 protein_id gnl|my_center|LOCUS_10270 19939 19709 gene locus_tag LOCUS_10280 gene infA 19939 19709 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055956.1 protein_id gnl|my_center|LOCUS_10280 20910 20254 gene locus_tag LOCUS_10290 20910 20254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_10290 21484 21218 gene locus_tag LOCUS_10300 21484 21218 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920742.1 protein_id gnl|my_center|LOCUS_10300 21644 22195 gene locus_tag LOCUS_10310 21644 22195 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920958.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence038 2635 467 gene locus_tag LOCUS_10320 gene ppk1 2635 467 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921077.1 protein_id gnl|my_center|LOCUS_10320 3843 2998 gene locus_tag LOCUS_10330 3843 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 5111 3840 gene locus_tag LOCUS_10340 5111 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 5543 6460 gene locus_tag LOCUS_10350 5543 6460 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057233.1 protein_id gnl|my_center|LOCUS_10350 7265 6435 gene locus_tag LOCUS_10360 7265 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 7498 7734 gene locus_tag LOCUS_10370 7498 7734 CDS product ferredoxin-thioredoxin reductase variable chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057357.1 protein_id gnl|my_center|LOCUS_10370 8968 7751 gene locus_tag LOCUS_10380 gene tyrS 8968 7751 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055905.1 protein_id gnl|my_center|LOCUS_10380 9165 10850 gene locus_tag LOCUS_10390 9165 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 10896 11147 gene locus_tag LOCUS_10400 10896 11147 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057929.1 protein_id gnl|my_center|LOCUS_10400 11347 12084 gene locus_tag LOCUS_10410 11347 12084 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_10410 13314 12229 gene locus_tag LOCUS_10420 gene orr 13314 12229 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_10420 14479 13319 gene locus_tag LOCUS_10430 14479 13319 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_10430 14831 14622 gene locus_tag LOCUS_10440 14831 14622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 15398 15084 gene locus_tag LOCUS_10450 15398 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 16939 15566 gene locus_tag LOCUS_10460 16939 15566 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920957.1 protein_id gnl|my_center|LOCUS_10460 17498 17013 gene locus_tag LOCUS_10470 17498 17013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143287.1 protein_id gnl|my_center|LOCUS_10470 19228 17621 gene locus_tag LOCUS_10480 19228 17621 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257071.1 protein_id gnl|my_center|LOCUS_10480 19766 19257 gene locus_tag LOCUS_10490 gene hoxE 19766 19257 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257070.1 protein_id gnl|my_center|LOCUS_10490 20803 21825 gene locus_tag LOCUS_10500 20803 21825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence039 1888 131 gene locus_tag LOCUS_10510 gene argS 1888 131 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056669.1 protein_id gnl|my_center|LOCUS_10510 2367 1981 gene locus_tag LOCUS_10520 2367 1981 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681559.1 protein_id gnl|my_center|LOCUS_10520 2594 2367 gene locus_tag LOCUS_10530 2594 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 3115 2636 gene locus_tag LOCUS_10540 gene ispF 3115 2636 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168569903.1 protein_id gnl|my_center|LOCUS_10540 6924 4111 gene locus_tag LOCUS_10550 gene secA 6924 4111 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057688.1 protein_id gnl|my_center|LOCUS_10550 7147 8139 gene locus_tag LOCUS_10560 7147 8139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 8142 8798 gene locus_tag LOCUS_10570 8142 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 12268 9080 gene locus_tag LOCUS_10580 12268 9080 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_10580 12732 13448 gene locus_tag LOCUS_10590 12732 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 13445 13867 gene locus_tag LOCUS_10600 13445 13867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 14122 14358 gene locus_tag LOCUS_10610 gene rpmB 14122 14358 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058293.1 protein_id gnl|my_center|LOCUS_10610 14503 14769 gene locus_tag LOCUS_10620 gene psaK 14503 14769 CDS product photosystem I reaction center subunit PsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921012.1 protein_id gnl|my_center|LOCUS_10620 14889 16064 gene locus_tag LOCUS_10630 14889 16064 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259080.1 protein_id gnl|my_center|LOCUS_10630 16519 16274 gene locus_tag LOCUS_10640 16519 16274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 17753 16578 gene locus_tag LOCUS_10650 17753 16578 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125209.1 protein_id gnl|my_center|LOCUS_10650 17812 19077 gene locus_tag LOCUS_10660 17812 19077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 19320 19535 gene locus_tag LOCUS_10670 19320 19535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 20055 19654 gene locus_tag LOCUS_10680 gene cdd 20055 19654 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583680.1 protein_id gnl|my_center|LOCUS_10680 21775 20648 gene locus_tag LOCUS_10690 21775 20648 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920975.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence040 484 3588 gene locus_tag LOCUS_10700 484 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 3762 4403 gene locus_tag LOCUS_10710 3762 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 4498 5046 gene locus_tag LOCUS_10720 4498 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 5182 5706 gene locus_tag LOCUS_10730 5182 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 5849 6115 gene locus_tag LOCUS_10740 5849 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 6118 6549 gene locus_tag LOCUS_10750 6118 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 6886 7194 gene locus_tag LOCUS_10760 6886 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 7191 7571 gene locus_tag LOCUS_10770 7191 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 7729 8256 gene locus_tag LOCUS_10780 7729 8256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 8824 8480 gene locus_tag LOCUS_10790 8824 8480 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869620.1 protein_id gnl|my_center|LOCUS_10790 9122 8814 gene locus_tag LOCUS_10800 9122 8814 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_10800 9752 9360 gene locus_tag LOCUS_10810 9752 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 10123 9752 gene locus_tag LOCUS_10820 10123 9752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 10383 11006 gene locus_tag LOCUS_10830 10383 11006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 11758 12285 gene locus_tag LOCUS_10840 11758 12285 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056728.1 protein_id gnl|my_center|LOCUS_10840 12328 12684 gene locus_tag LOCUS_10850 12328 12684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 12659 13021 gene locus_tag LOCUS_10860 12659 13021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 13926 13057 gene locus_tag LOCUS_10870 13926 13057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 14393 14166 gene locus_tag LOCUS_10880 14393 14166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 14631 14380 gene locus_tag LOCUS_10890 14631 14380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073593944.1 protein_id gnl|my_center|LOCUS_10890 15377 14892 gene locus_tag LOCUS_10900 15377 14892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 16484 15381 gene locus_tag LOCUS_10910 gene wecB 16484 15381 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057875.1 protein_id gnl|my_center|LOCUS_10910 17958 16627 gene locus_tag LOCUS_10920 17958 16627 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144101.1 protein_id gnl|my_center|LOCUS_10920 18787 18005 gene locus_tag LOCUS_10930 18787 18005 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920674.1 protein_id gnl|my_center|LOCUS_10930 19000 21570 gene locus_tag LOCUS_10940 19000 21570 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058092.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence041 708 2048 gene locus_tag LOCUS_10950 708 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 2317 3447 gene locus_tag LOCUS_10960 2317 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 3569 4639 gene locus_tag LOCUS_10970 3569 4639 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_10970 5612 4665 gene locus_tag LOCUS_10980 5612 4665 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_10980 6820 6038 gene locus_tag LOCUS_10990 6820 6038 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058265.1 protein_id gnl|my_center|LOCUS_10990 7200 8627 gene locus_tag LOCUS_11000 gene gndA 7200 8627 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056424.1 protein_id gnl|my_center|LOCUS_11000 9668 9042 gene locus_tag LOCUS_11010 gene rnhB 9668 9042 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_11010 11836 9668 gene locus_tag LOCUS_11020 11836 9668 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056445.1 protein_id gnl|my_center|LOCUS_11020 12667 12524 gene locus_tag LOCUS_11030 12667 12524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 13607 12852 gene locus_tag LOCUS_11040 13607 12852 CDS product DUF2232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057242.1 protein_id gnl|my_center|LOCUS_11040 14481 13777 gene locus_tag LOCUS_11050 14481 13777 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_11050 15859 14564 gene locus_tag LOCUS_11060 15859 14564 CDS product CO2 hydration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141007.1 protein_id gnl|my_center|LOCUS_11060 17467 15917 gene locus_tag LOCUS_11070 17467 15917 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141006.1 protein_id gnl|my_center|LOCUS_11070 18271 17546 gene locus_tag LOCUS_11080 18271 17546 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142086.1 protein_id gnl|my_center|LOCUS_11080 20206 18353 gene locus_tag LOCUS_11090 20206 18353 CDS product NAD(P)H-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056748.1 protein_id gnl|my_center|LOCUS_11090 21197 20253 gene locus_tag LOCUS_11100 21197 20253 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence042 345 590 gene locus_tag LOCUS_11110 345 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 587 1102 gene locus_tag LOCUS_11120 587 1102 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_11120 2269 1133 gene locus_tag LOCUS_11130 2269 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 2576 2821 gene locus_tag LOCUS_11140 2576 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 2814 3065 gene locus_tag LOCUS_11150 2814 3065 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 protein_id gnl|my_center|LOCUS_11150 3678 3226 gene locus_tag LOCUS_11160 3678 3226 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258781.1 protein_id gnl|my_center|LOCUS_11160 3914 3678 gene locus_tag LOCUS_11170 3914 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 4987 5298 gene locus_tag LOCUS_11180 4987 5298 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_11180 5365 5706 gene locus_tag LOCUS_11190 5365 5706 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_11190 5739 6050 gene locus_tag LOCUS_11200 5739 6050 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_11200 6121 8079 gene locus_tag LOCUS_11210 6121 8079 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171949.1 protein_id gnl|my_center|LOCUS_11210 8211 8873 gene locus_tag LOCUS_11220 8211 8873 CDS product carbon dioxide concentrating mechanism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142090.1 protein_id gnl|my_center|LOCUS_11220 9425 10840 gene locus_tag LOCUS_11230 9425 10840 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142153.1 protein_id gnl|my_center|LOCUS_11230 10971 11369 gene locus_tag LOCUS_11240 10971 11369 CDS product chaperonin family protein RbcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142154.1 protein_id gnl|my_center|LOCUS_11240 11385 11720 gene locus_tag LOCUS_11250 11385 11720 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142155.1 protein_id gnl|my_center|LOCUS_11250 12798 11788 gene locus_tag LOCUS_11260 12798 11788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 14264 12822 gene locus_tag LOCUS_11270 14264 12822 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088620334.1 protein_id gnl|my_center|LOCUS_11270 16998 14692 gene locus_tag LOCUS_11280 16998 14692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 17808 17011 gene locus_tag LOCUS_11290 17808 17011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 20269 17798 gene locus_tag LOCUS_11300 20269 17798 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056217.1 protein_id gnl|my_center|LOCUS_11300 21336 20845 gene locus_tag LOCUS_11310 21336 20845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence043 526 1230 gene locus_tag LOCUS_11320 526 1230 CDS product PEP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933411.1 protein_id gnl|my_center|LOCUS_11320 1327 1542 gene locus_tag LOCUS_11330 1327 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1543 1803 gene locus_tag LOCUS_11340 1543 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 2177 1863 gene locus_tag LOCUS_11350 2177 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 2413 3222 gene locus_tag LOCUS_11360 gene larE 2413 3222 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920840.1 protein_id gnl|my_center|LOCUS_11360 3570 4580 gene locus_tag LOCUS_11370 3570 4580 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 protein_id gnl|my_center|LOCUS_11370 4605 5396 gene locus_tag LOCUS_11380 4605 5396 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172597933.1 protein_id gnl|my_center|LOCUS_11380 5612 7090 gene locus_tag LOCUS_11390 5612 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057099.1 protein_id gnl|my_center|LOCUS_11390 7121 8497 gene locus_tag LOCUS_11400 7121 8497 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948760.1 protein_id gnl|my_center|LOCUS_11400 9918 8509 gene locus_tag LOCUS_11410 9918 8509 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057055.1 protein_id gnl|my_center|LOCUS_11410 10558 10154 gene locus_tag LOCUS_11420 10558 10154 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057637.1 protein_id gnl|my_center|LOCUS_11420 10600 11151 gene locus_tag LOCUS_11430 10600 11151 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056210.1 protein_id gnl|my_center|LOCUS_11430 11283 11636 gene locus_tag LOCUS_11440 11283 11636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 11620 13521 gene locus_tag LOCUS_11450 11620 13521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 15518 13554 gene locus_tag LOCUS_11460 gene ftsH 15518 13554 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_11460 15651 16637 gene locus_tag LOCUS_11470 gene ccsB 15651 16637 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057454.1 protein_id gnl|my_center|LOCUS_11470 17019 17912 gene locus_tag LOCUS_11480 17019 17912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 17968 19290 gene locus_tag LOCUS_11490 17968 19290 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140425.1 protein_id gnl|my_center|LOCUS_11490 19528 20799 gene locus_tag LOCUS_11500 19528 20799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence044 2133 229 gene locus_tag LOCUS_11510 gene dnaK 2133 229 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057570.1 protein_id gnl|my_center|LOCUS_11510 3738 2764 gene locus_tag LOCUS_11520 3738 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 4102 5283 gene locus_tag LOCUS_11530 4102 5283 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207588.1 protein_id gnl|my_center|LOCUS_11530 5548 6033 gene locus_tag LOCUS_11540 5548 6033 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920767.1 protein_id gnl|my_center|LOCUS_11540 6204 8135 gene locus_tag LOCUS_11550 6204 8135 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797673.1 protein_id gnl|my_center|LOCUS_11550 8445 9293 gene locus_tag LOCUS_11560 8445 9293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 10024 10599 gene locus_tag LOCUS_11570 10024 10599 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_11570 11512 12273 gene locus_tag LOCUS_11580 11512 12273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 12567 12797 gene locus_tag LOCUS_11590 12567 12797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 12794 13063 gene locus_tag LOCUS_11600 12794 13063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 13221 14030 gene locus_tag LOCUS_11610 13221 14030 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007836183.1 protein_id gnl|my_center|LOCUS_11610 16114 14399 gene locus_tag LOCUS_11620 16114 14399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 17039 16107 gene locus_tag LOCUS_11630 17039 16107 CDS product family 2A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107594.1 protein_id gnl|my_center|LOCUS_11630 18075 17116 gene locus_tag LOCUS_11640 18075 17116 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194474.1 protein_id gnl|my_center|LOCUS_11640 19052 18072 gene locus_tag LOCUS_11650 gene cysK 19052 18072 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172232.1 protein_id gnl|my_center|LOCUS_11650 19406 20215 gene locus_tag LOCUS_11660 19406 20215 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989683.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence045 3822 259 gene locus_tag LOCUS_11670 gene metH 3822 259 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921137.1 protein_id gnl|my_center|LOCUS_11670 5098 3968 gene locus_tag LOCUS_11680 5098 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 5950 5318 gene locus_tag LOCUS_11690 5950 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142966.1 protein_id gnl|my_center|LOCUS_11690 6874 6377 gene locus_tag LOCUS_11700 6874 6377 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_11700 7187 7495 gene locus_tag LOCUS_11710 7187 7495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 7496 7846 gene locus_tag LOCUS_11720 7496 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114894.1 protein_id gnl|my_center|LOCUS_11720 11711 8076 gene locus_tag LOCUS_11730 11711 8076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 11795 12904 gene locus_tag LOCUS_11740 11795 12904 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144408.1 protein_id gnl|my_center|LOCUS_11740 13533 15248 gene locus_tag LOCUS_11750 gene mrdA 13533 15248 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057025.1 protein_id gnl|my_center|LOCUS_11750 16051 15245 gene locus_tag LOCUS_11760 16051 15245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 16163 16070 gene locus_tag LOCUS_t00060 16163 16070 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16943 16224 gene locus_tag LOCUS_11770 16943 16224 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_11770 18134 16962 gene locus_tag LOCUS_11780 gene devC 18134 16962 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056491.1 protein_id gnl|my_center|LOCUS_11780 19425 18142 gene locus_tag LOCUS_11790 19425 18142 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056492.1 protein_id gnl|my_center|LOCUS_11790 20044 19472 gene locus_tag LOCUS_11800 20044 19472 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124477.1 protein_id gnl|my_center|LOCUS_11800 20180 20470 gene locus_tag LOCUS_11810 20180 20470 CDS product DUF2288 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086400.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence046 1190 390 gene locus_tag LOCUS_11820 1190 390 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125923.1 protein_id gnl|my_center|LOCUS_11820 1766 1233 gene locus_tag LOCUS_11830 gene purE 1766 1233 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056434.1 protein_id gnl|my_center|LOCUS_11830 2592 1849 gene locus_tag LOCUS_11840 2592 1849 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_11840 6168 2809 gene locus_tag LOCUS_11850 6168 2809 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_11850 6257 6562 gene locus_tag LOCUS_11860 6257 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 6639 6875 gene locus_tag LOCUS_11870 6639 6875 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587616.1 protein_id gnl|my_center|LOCUS_11870 7326 7078 gene locus_tag LOCUS_11880 7326 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 7678 7409 gene locus_tag LOCUS_11890 7678 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 8091 7912 gene locus_tag LOCUS_11900 8091 7912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 8849 8346 gene locus_tag LOCUS_11910 8849 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 9043 8888 gene locus_tag LOCUS_11920 9043 8888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 9235 11028 gene locus_tag LOCUS_11930 9235 11028 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928895.1 protein_id gnl|my_center|LOCUS_11930 11114 11356 gene locus_tag LOCUS_11940 11114 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 11353 11799 gene locus_tag LOCUS_11950 11353 11799 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_11950 12429 11965 gene locus_tag LOCUS_11960 gene lspA 12429 11965 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058252.1 protein_id gnl|my_center|LOCUS_11960 12992 12441 gene locus_tag LOCUS_11970 12992 12441 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406022.1 protein_id gnl|my_center|LOCUS_11970 14157 13063 gene locus_tag LOCUS_11980 gene bioB 14157 13063 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_11980 14291 14836 gene locus_tag LOCUS_11990 gene rfbC 14291 14836 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771397.1 protein_id gnl|my_center|LOCUS_11990 14842 15717 gene locus_tag LOCUS_12000 gene rfbD 14842 15717 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_12000 15722 16795 gene locus_tag LOCUS_12010 15722 16795 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 protein_id gnl|my_center|LOCUS_12010 16967 18052 gene locus_tag LOCUS_12020 gene leuB 16967 18052 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057439.1 protein_id gnl|my_center|LOCUS_12020 18132 18392 gene locus_tag LOCUS_12030 18132 18392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 18475 20352 gene locus_tag LOCUS_12040 gene uvrC 18475 20352 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057590.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence047 173 1507 gene locus_tag LOCUS_12050 173 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1611 3443 gene locus_tag LOCUS_12060 1611 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 4466 3468 gene locus_tag LOCUS_12070 4466 3468 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_12070 4807 10959 gene locus_tag LOCUS_12080 4807 10959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 11618 11361 gene locus_tag LOCUS_12090 11618 11361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 11874 11599 gene locus_tag LOCUS_12100 11874 11599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 12125 12973 gene locus_tag LOCUS_12110 12125 12973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 13488 13081 gene locus_tag LOCUS_12120 13488 13081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 13793 13485 gene locus_tag LOCUS_12130 13793 13485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 16055 13977 gene locus_tag LOCUS_12140 16055 13977 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920751.1 protein_id gnl|my_center|LOCUS_12140 16637 18103 gene locus_tag LOCUS_12150 16637 18103 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929293.1 protein_id gnl|my_center|LOCUS_12150 18109 18834 gene locus_tag LOCUS_12160 18109 18834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 18942 20036 gene locus_tag LOCUS_12170 18942 20036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence048 3 2843 gene locus_tag LOCUS_12180 3 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 3627 3289 gene locus_tag LOCUS_12190 3627 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 3898 3668 gene locus_tag LOCUS_12200 3898 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 4280 4080 gene locus_tag LOCUS_12210 4280 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 4935 4504 gene locus_tag LOCUS_12220 4935 4504 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227761.1 protein_id gnl|my_center|LOCUS_12220 5195 4944 gene locus_tag LOCUS_12230 5195 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 5763 6443 gene locus_tag LOCUS_12240 5763 6443 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056503.1 protein_id gnl|my_center|LOCUS_12240 6470 7231 gene locus_tag LOCUS_12250 6470 7231 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 protein_id gnl|my_center|LOCUS_12250 7240 8088 gene locus_tag LOCUS_12260 7240 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 8353 8126 gene locus_tag LOCUS_12270 8353 8126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 9613 8477 gene locus_tag LOCUS_12280 9613 8477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 11177 10185 gene locus_tag LOCUS_12290 11177 10185 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125344.1 protein_id gnl|my_center|LOCUS_12290 14294 11229 gene locus_tag LOCUS_12300 14294 11229 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142489.1 protein_id gnl|my_center|LOCUS_12300 15931 14471 gene locus_tag LOCUS_12310 15931 14471 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142490.1 protein_id gnl|my_center|LOCUS_12310 18242 16455 gene locus_tag LOCUS_12320 gene aspS 18242 16455 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056986.1 protein_id gnl|my_center|LOCUS_12320 18463 19245 gene locus_tag LOCUS_12330 18463 19245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 19775 19912 gene locus_tag LOCUS_12340 19775 19912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence049 1969 884 gene locus_tag LOCUS_12350 1969 884 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146544.1 protein_id gnl|my_center|LOCUS_12350 2192 2998 gene locus_tag LOCUS_12360 gene aqpZ 2192 2998 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140371.1 protein_id gnl|my_center|LOCUS_12360 3506 3036 gene locus_tag LOCUS_12370 gene tsaE 3506 3036 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142985.1 protein_id gnl|my_center|LOCUS_12370 3847 5046 gene locus_tag LOCUS_12380 3847 5046 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057470.1 protein_id gnl|my_center|LOCUS_12380 6623 5043 gene locus_tag LOCUS_12390 6623 5043 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056886.1 protein_id gnl|my_center|LOCUS_12390 7109 6717 gene locus_tag LOCUS_12400 gene rbfA 7109 6717 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057468.1 protein_id gnl|my_center|LOCUS_12400 7348 7151 gene locus_tag LOCUS_12410 7348 7151 CDS product DUF751 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057323.1 protein_id gnl|my_center|LOCUS_12410 10341 8248 gene locus_tag LOCUS_12420 10341 8248 CDS product AMIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058177.1 protein_id gnl|my_center|LOCUS_12420 11188 10415 gene locus_tag LOCUS_12430 11188 10415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 11955 11185 gene locus_tag LOCUS_12440 11955 11185 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058175.1 protein_id gnl|my_center|LOCUS_12440 13080 11965 gene locus_tag LOCUS_12450 gene pilM 13080 11965 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921030.1 protein_id gnl|my_center|LOCUS_12450 13591 14583 gene locus_tag LOCUS_12460 gene ilvC 13591 14583 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_12460 15722 14934 gene locus_tag LOCUS_12470 15722 14934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 16536 15751 gene locus_tag LOCUS_12480 16536 15751 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891922.1 protein_id gnl|my_center|LOCUS_12480 17454 16900 gene locus_tag LOCUS_12490 17454 16900 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056346.1 protein_id gnl|my_center|LOCUS_12490 18194 17571 gene locus_tag LOCUS_12500 18194 17571 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141483.1 protein_id gnl|my_center|LOCUS_12500 18314 19477 gene locus_tag LOCUS_12510 gene hemH 18314 19477 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920998.1 protein_id gnl|my_center|LOCUS_12510 19841 19590 gene locus_tag LOCUS_12520 19841 19590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence050 545 276 gene locus_tag LOCUS_12530 545 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 831 493 gene locus_tag LOCUS_12540 831 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1034 837 gene locus_tag LOCUS_12550 1034 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1358 1606 gene locus_tag LOCUS_12560 1358 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1882 2346 gene locus_tag LOCUS_12570 1882 2346 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140032.1 protein_id gnl|my_center|LOCUS_12570 2623 2420 gene locus_tag LOCUS_12580 2623 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 2694 3209 gene locus_tag LOCUS_12590 2694 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 3410 3907 gene locus_tag LOCUS_12600 3410 3907 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_12600 4091 4972 gene locus_tag LOCUS_12610 4091 4972 CDS product 4-hydroxybenzoate solanesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143417.1 protein_id gnl|my_center|LOCUS_12610 7666 5366 gene locus_tag LOCUS_12620 7666 5366 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056167.1 protein_id gnl|my_center|LOCUS_12620 8748 7774 gene locus_tag LOCUS_12630 gene tilS 8748 7774 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057455.1 protein_id gnl|my_center|LOCUS_12630 10026 9004 gene locus_tag LOCUS_12640 gene hemF 10026 9004 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920736.1 protein_id gnl|my_center|LOCUS_12640 10999 10211 gene locus_tag LOCUS_12650 10999 10211 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408189.1 protein_id gnl|my_center|LOCUS_12650 12003 11086 gene locus_tag LOCUS_12660 12003 11086 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056702.1 protein_id gnl|my_center|LOCUS_12660 13004 12027 gene locus_tag LOCUS_12670 13004 12027 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056703.1 protein_id gnl|my_center|LOCUS_12670 13956 13066 gene locus_tag LOCUS_12680 13956 13066 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055901.1 protein_id gnl|my_center|LOCUS_12680 14024 14797 gene locus_tag LOCUS_12690 14024 14797 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_12690 15798 15340 gene locus_tag LOCUS_12700 15798 15340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 16689 15847 gene locus_tag LOCUS_12710 gene folP 16689 15847 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057362.1 protein_id gnl|my_center|LOCUS_12710 17594 16797 gene locus_tag LOCUS_12720 17594 16797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 18410 17751 gene locus_tag LOCUS_12730 18410 17751 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057008.1 protein_id gnl|my_center|LOCUS_12730 18920 18447 gene locus_tag LOCUS_12740 gene coaD 18920 18447 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057007.1 protein_id gnl|my_center|LOCUS_12740 19201 18917 gene locus_tag LOCUS_12750 19201 18917 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057607.1 protein_id gnl|my_center|LOCUS_12750 19552 19235 gene locus_tag LOCUS_12760 gene trxA 19552 19235 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921014.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence051 2886 2584 gene locus_tag LOCUS_12770 2886 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 3764 3120 gene locus_tag LOCUS_12780 gene pdxH 3764 3120 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056186.1 protein_id gnl|my_center|LOCUS_12780 3816 4586 gene locus_tag LOCUS_12790 3816 4586 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920913.1 protein_id gnl|my_center|LOCUS_12790 6511 5027 gene locus_tag LOCUS_12800 6511 5027 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142619.1 protein_id gnl|my_center|LOCUS_12800 6780 8087 gene locus_tag LOCUS_12810 6780 8087 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056829.1 protein_id gnl|my_center|LOCUS_12810 8124 8918 gene locus_tag LOCUS_12820 8124 8918 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_12820 10291 8954 gene locus_tag LOCUS_12830 10291 8954 CDS product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226578028.1 protein_id gnl|my_center|LOCUS_12830 10369 12501 gene locus_tag LOCUS_12840 10369 12501 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920752.1 protein_id gnl|my_center|LOCUS_12840 13486 12674 gene locus_tag LOCUS_12850 gene hypB 13486 12674 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 protein_id gnl|my_center|LOCUS_12850 13821 13477 gene locus_tag LOCUS_12860 gene hypA 13821 13477 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_12860 15038 13968 gene locus_tag LOCUS_12870 gene hypE 15038 13968 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720673.1 protein_id gnl|my_center|LOCUS_12870 16015 15170 gene locus_tag LOCUS_12880 16015 15170 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_12880 16287 17180 gene locus_tag LOCUS_12890 16287 17180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 17248 19716 gene locus_tag LOCUS_12900 gene recG 17248 19716 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence052 177 890 gene locus_tag LOCUS_12910 177 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 896 1168 gene locus_tag LOCUS_12920 896 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920941.1 protein_id gnl|my_center|LOCUS_12920 1528 2271 gene locus_tag LOCUS_12930 1528 2271 CDS product DUF1995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058055.1 protein_id gnl|my_center|LOCUS_12930 7434 2314 gene locus_tag LOCUS_12940 7434 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 8257 7484 gene locus_tag LOCUS_12950 8257 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 8711 12349 gene locus_tag LOCUS_12960 8711 12349 CDS product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203101.1 protein_id gnl|my_center|LOCUS_12960 13067 12393 gene locus_tag LOCUS_12970 gene bioD 13067 12393 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406219.1 protein_id gnl|my_center|LOCUS_12970 13383 15161 gene locus_tag LOCUS_12980 gene ilvB 13383 15161 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057136.1 protein_id gnl|my_center|LOCUS_12980 16055 17632 gene locus_tag LOCUS_12990 gene serA 16055 17632 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056180.1 protein_id gnl|my_center|LOCUS_12990 17767 18663 gene locus_tag LOCUS_13000 gene prmA 17767 18663 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056181.1 protein_id gnl|my_center|LOCUS_13000 18833 18759 gene locus_tag LOCUS_t00070 18833 18759 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18889 19701 gene locus_tag LOCUS_13010 gene surE 18889 19701 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057623.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence053 273 875 gene locus_tag LOCUS_13020 273 875 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057675.1 protein_id gnl|my_center|LOCUS_13020 986 1948 gene locus_tag LOCUS_13030 986 1948 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057967.1 protein_id gnl|my_center|LOCUS_13030 2518 2009 gene locus_tag LOCUS_13040 2518 2009 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142230.1 protein_id gnl|my_center|LOCUS_13040 2938 3741 gene locus_tag LOCUS_13050 2938 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 6682 3755 gene locus_tag LOCUS_13060 6682 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 7014 7949 gene locus_tag LOCUS_13070 7014 7949 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_13070 7946 8728 gene locus_tag LOCUS_13080 7946 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 8910 9446 gene locus_tag LOCUS_13090 8910 9446 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921042.1 protein_id gnl|my_center|LOCUS_13090 11300 9501 gene locus_tag LOCUS_13100 11300 9501 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421615.1 protein_id gnl|my_center|LOCUS_13100 14085 11305 gene locus_tag LOCUS_13110 14085 11305 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057066.1 protein_id gnl|my_center|LOCUS_13110 14376 15806 gene locus_tag LOCUS_13120 gene pds 14376 15806 CDS product 15-cis-phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124322.1 protein_id gnl|my_center|LOCUS_13120 15912 16844 gene locus_tag LOCUS_13130 15912 16844 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057400.1 protein_id gnl|my_center|LOCUS_13130 17147 16938 gene locus_tag LOCUS_13140 17147 16938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 17672 17914 gene locus_tag LOCUS_13150 17672 17914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 18667 17975 gene locus_tag LOCUS_13160 18667 17975 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence054 <1 510 gene locus_tag LOCUS_13170 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054297574.1:IS200/IS605 family element RNA-guided endonuclease TnpB 995 2677 gene locus_tag LOCUS_13180 995 2677 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057114.1 protein_id gnl|my_center|LOCUS_13180 2812 3363 gene locus_tag LOCUS_13190 2812 3363 CDS product DUF2854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056635.1 protein_id gnl|my_center|LOCUS_13190 3364 4125 gene locus_tag LOCUS_13200 3364 4125 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057760.1 protein_id gnl|my_center|LOCUS_13200 4972 4304 gene locus_tag LOCUS_13210 4972 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 5136 5837 gene locus_tag LOCUS_13220 5136 5837 CDS product DUF3120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190832035.1 protein_id gnl|my_center|LOCUS_13220 5912 6985 gene locus_tag LOCUS_13230 5912 6985 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058242.1 protein_id gnl|my_center|LOCUS_13230 8482 7490 gene locus_tag LOCUS_13240 8482 7490 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057881.1 protein_id gnl|my_center|LOCUS_13240 9230 8715 gene locus_tag LOCUS_13250 gene nrdR 9230 8715 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057698.1 protein_id gnl|my_center|LOCUS_13250 9953 9558 gene locus_tag LOCUS_13260 gene rplL 9953 9558 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141601.1 protein_id gnl|my_center|LOCUS_13260 10545 9997 gene locus_tag LOCUS_13270 gene rplJ 10545 9997 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056152.1 protein_id gnl|my_center|LOCUS_13270 11222 12628 gene locus_tag LOCUS_13280 gene mgtE 11222 12628 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125941.1 protein_id gnl|my_center|LOCUS_13280 16462 12821 gene locus_tag LOCUS_13290 gene cobN 16462 12821 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056744.1 protein_id gnl|my_center|LOCUS_13290 17040 16744 gene locus_tag LOCUS_13300 17040 16744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 16998 19199 gene locus_tag LOCUS_13310 16998 19199 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056743.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence055 112 1239 gene locus_tag LOCUS_13320 112 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 3316 1325 gene locus_tag LOCUS_13330 3316 1325 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056794.1 protein_id gnl|my_center|LOCUS_13330 4796 3708 gene locus_tag LOCUS_13340 4796 3708 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214433169.1 protein_id gnl|my_center|LOCUS_13340 5518 4871 gene locus_tag LOCUS_13350 5518 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 6930 5515 gene locus_tag LOCUS_13360 6930 5515 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106970097.1 protein_id gnl|my_center|LOCUS_13360 8074 7001 gene locus_tag LOCUS_13370 gene bchI 8074 7001 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920887.1 protein_id gnl|my_center|LOCUS_13370 8547 8158 gene locus_tag LOCUS_13380 8547 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045052736.1 protein_id gnl|my_center|LOCUS_13380 10944 8812 gene locus_tag LOCUS_13390 gene glyS 10944 8812 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198128218.1 protein_id gnl|my_center|LOCUS_13390 11215 11736 gene locus_tag LOCUS_13400 11215 11736 CDS product DUF3122 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056141.1 protein_id gnl|my_center|LOCUS_13400 11765 12349 gene locus_tag LOCUS_13410 11765 12349 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 protein_id gnl|my_center|LOCUS_13410 13570 12380 gene locus_tag LOCUS_13420 13570 12380 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057699.1 protein_id gnl|my_center|LOCUS_13420 14287 13607 gene locus_tag LOCUS_13430 14287 13607 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106289931.1 protein_id gnl|my_center|LOCUS_13430 14379 16298 gene locus_tag LOCUS_13440 14379 16298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 17201 16347 gene locus_tag LOCUS_13450 gene pheA 17201 16347 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073594784.1 protein_id gnl|my_center|LOCUS_13450 18233 17316 gene locus_tag LOCUS_13460 18233 17316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 18252 18740 gene locus_tag LOCUS_13470 18252 18740 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140692.1 protein_id gnl|my_center|LOCUS_13470 19325 18750 gene locus_tag LOCUS_13480 gene lepB 19325 18750 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056260.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence056 246 1304 gene locus_tag LOCUS_13490 246 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1609 1238 gene locus_tag LOCUS_13500 1609 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 3906 1996 gene locus_tag LOCUS_13510 gene dxs 3906 1996 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056470.1 protein_id gnl|my_center|LOCUS_13510 4750 3980 gene locus_tag LOCUS_13520 gene larB 4750 3980 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057031.1 protein_id gnl|my_center|LOCUS_13520 6687 4939 gene locus_tag LOCUS_13530 6687 4939 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057062.1 protein_id gnl|my_center|LOCUS_13530 7780 6926 gene locus_tag LOCUS_13540 gene dapA 7780 6926 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057061.1 protein_id gnl|my_center|LOCUS_13540 9260 8223 gene locus_tag LOCUS_13550 9260 8223 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524132.1 protein_id gnl|my_center|LOCUS_13550 9585 10976 gene locus_tag LOCUS_13560 gene tig 9585 10976 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144179.1 protein_id gnl|my_center|LOCUS_13560 11198 11899 gene locus_tag LOCUS_13570 gene clpP 11198 11899 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056360.1 protein_id gnl|my_center|LOCUS_13570 11907 13241 gene locus_tag LOCUS_13580 gene clpX 11907 13241 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056361.1 protein_id gnl|my_center|LOCUS_13580 13263 13469 gene locus_tag LOCUS_13590 13263 13469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 13693 14550 gene locus_tag LOCUS_13600 13693 14550 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_13600 14716 14543 gene locus_tag LOCUS_13610 14716 14543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 15716 14766 gene locus_tag LOCUS_13620 15716 14766 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143271.1 protein_id gnl|my_center|LOCUS_13620 15946 16677 gene locus_tag LOCUS_13630 15946 16677 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495223.1 protein_id gnl|my_center|LOCUS_13630 16872 17405 gene locus_tag LOCUS_13640 gene dps 16872 17405 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258826.1 protein_id gnl|my_center|LOCUS_13640 18721 17438 gene locus_tag LOCUS_13650 18721 17438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 19154 19423 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccaactaatcctatttgacctaataggtaagg >Feature sequence057 367 131 gene locus_tag LOCUS_13660 367 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1499 732 gene locus_tag LOCUS_13670 1499 732 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_13670 3296 1680 gene locus_tag LOCUS_13680 3296 1680 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036534662.1 protein_id gnl|my_center|LOCUS_13680 4477 3938 gene locus_tag LOCUS_13690 4477 3938 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143183.1 protein_id gnl|my_center|LOCUS_13690 4547 5164 gene locus_tag LOCUS_13700 4547 5164 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141508.1 protein_id gnl|my_center|LOCUS_13700 5678 6448 gene locus_tag LOCUS_13710 5678 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 7562 6477 gene locus_tag LOCUS_13720 7562 6477 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257672.1 protein_id gnl|my_center|LOCUS_13720 8219 7917 gene locus_tag LOCUS_13730 8219 7917 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_13730 9293 8460 gene locus_tag LOCUS_13740 gene menB 9293 8460 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058289.1 protein_id gnl|my_center|LOCUS_13740 10855 9914 gene locus_tag LOCUS_13750 10855 9914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 11593 10910 gene locus_tag LOCUS_13760 gene ispD 11593 10910 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056453.1 protein_id gnl|my_center|LOCUS_13760 12135 11737 gene locus_tag LOCUS_13770 12135 11737 CDS product DUF1824 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929141.1 protein_id gnl|my_center|LOCUS_13770 13085 12408 gene locus_tag LOCUS_13780 13085 12408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 14159 13269 gene locus_tag LOCUS_13790 14159 13269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920654.1 protein_id gnl|my_center|LOCUS_13790 14673 14170 gene locus_tag LOCUS_13800 14673 14170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797617.1 protein_id gnl|my_center|LOCUS_13800 17039 15039 gene locus_tag LOCUS_13810 gene bchD 17039 15039 CDS product magnesium chelatase ATPase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057253.1 protein_id gnl|my_center|LOCUS_13810 17230 18915 gene locus_tag LOCUS_13820 17230 18915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence058 550 236 gene locus_tag LOCUS_13830 550 236 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_13830 767 531 gene locus_tag LOCUS_13840 767 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 1316 963 gene locus_tag LOCUS_13850 1316 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 1655 1323 gene locus_tag LOCUS_13860 1655 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 4284 2848 gene locus_tag LOCUS_13870 4284 2848 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056643.1 protein_id gnl|my_center|LOCUS_13870 4259 4486 gene locus_tag LOCUS_13880 4259 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 4642 4827 gene locus_tag LOCUS_13890 4642 4827 CDS product DUF3285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928928.1 protein_id gnl|my_center|LOCUS_13890 4839 5348 gene locus_tag LOCUS_13900 gene ybeY 4839 5348 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928724.1 protein_id gnl|my_center|LOCUS_13900 5381 5869 gene locus_tag LOCUS_13910 5381 5869 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920902.1 protein_id gnl|my_center|LOCUS_13910 6341 6580 gene locus_tag LOCUS_13920 6341 6580 CDS product DUF4327 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058280.1 protein_id gnl|my_center|LOCUS_13920 7997 6807 gene locus_tag LOCUS_13930 7997 6807 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057783.1 protein_id gnl|my_center|LOCUS_13930 8284 9558 gene locus_tag LOCUS_13940 8284 9558 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_13940 9555 10187 gene locus_tag LOCUS_13950 9555 10187 CDS product TIGR02646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105321.1 protein_id gnl|my_center|LOCUS_13950 10355 10504 gene locus_tag LOCUS_13960 10355 10504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 10964 10584 gene locus_tag LOCUS_13970 10964 10584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 11387 11022 gene locus_tag LOCUS_13980 11387 11022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 11826 12812 gene locus_tag LOCUS_13990 gene hemB 11826 12812 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144341.1 protein_id gnl|my_center|LOCUS_13990 13191 12970 gene locus_tag LOCUS_14000 13191 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 15064 13250 gene locus_tag LOCUS_14010 15064 13250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056007.1 protein_id gnl|my_center|LOCUS_14010 16016 15333 gene locus_tag LOCUS_14020 16016 15333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 16340 16020 gene locus_tag LOCUS_14030 16340 16020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 17177 16503 gene locus_tag LOCUS_14040 17177 16503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 19044 17233 gene locus_tag LOCUS_14050 gene lepA 19044 17233 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056160.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence059 3163 443 gene locus_tag LOCUS_14060 3163 443 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057343.1 protein_id gnl|my_center|LOCUS_14060 3365 3952 gene locus_tag LOCUS_14070 3365 3952 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_14070 3999 4583 gene locus_tag LOCUS_14080 3999 4583 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_14080 5269 4634 gene locus_tag LOCUS_14090 gene purN 5269 4634 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524113.1 protein_id gnl|my_center|LOCUS_14090 6996 5503 gene locus_tag LOCUS_14100 gene pap 6996 5503 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_14100 7066 8064 gene locus_tag LOCUS_14110 gene galE 7066 8064 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920997.1 protein_id gnl|my_center|LOCUS_14110 8315 8740 gene locus_tag LOCUS_14120 8315 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 9838 8867 gene locus_tag LOCUS_14130 9838 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 10001 11461 gene locus_tag LOCUS_14140 10001 11461 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964010.1 protein_id gnl|my_center|LOCUS_14140 11461 12420 gene locus_tag LOCUS_14150 11461 12420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 12417 13679 gene locus_tag LOCUS_14160 12417 13679 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920820.1 protein_id gnl|my_center|LOCUS_14160 13756 14001 gene locus_tag LOCUS_14170 13756 14001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 14001 14342 gene locus_tag LOCUS_14180 14001 14342 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928563.1 protein_id gnl|my_center|LOCUS_14180 14684 15457 gene locus_tag LOCUS_14190 14684 15457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 17293 15758 gene locus_tag LOCUS_14200 gene purH 17293 15758 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057387.1 protein_id gnl|my_center|LOCUS_14200 17721 17494 gene locus_tag LOCUS_14210 17721 17494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14210 18030 17806 gene locus_tag LOCUS_14220 18030 17806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14220 18500 18958 gene locus_tag LOCUS_14230 18500 18958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence060 362 1366 gene locus_tag LOCUS_14240 gene cas1 362 1366 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_14240 1429 1725 gene locus_tag LOCUS_14250 1429 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1758 2159 gene locus_tag LOCUS_14260 1758 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 2238 3656 gene locus_tag LOCUS_14270 2238 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 3962 6964 gene locus_tag LOCUS_14280 3962 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 6971 8206 gene locus_tag LOCUS_14290 6971 8206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 8203 9120 gene locus_tag LOCUS_14300 gene cmr4 8203 9120 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082339.1 protein_id gnl|my_center|LOCUS_14300 9117 9512 gene locus_tag LOCUS_14310 9117 9512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 9509 11395 gene locus_tag LOCUS_14320 9509 11395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 11515 11758 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccattaattaaacttgctaagaagttaaaag 11756 15289 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccattaattaaacttgctaagaagttaaaag 15944 16153 gene locus_tag LOCUS_14330 15944 16153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 16140 16448 gene locus_tag LOCUS_14340 16140 16448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 16532 17026 gene locus_tag LOCUS_14350 16532 17026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 17056 17724 gene locus_tag LOCUS_14360 17056 17724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 17711 18175 gene locus_tag LOCUS_14370 17711 18175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 18206 18625 gene locus_tag LOCUS_14380 18206 18625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 18622 18930 gene locus_tag LOCUS_14390 18622 18930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence061 2366 225 gene locus_tag LOCUS_14400 2366 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 3074 2385 gene locus_tag LOCUS_14410 3074 2385 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037770.1 protein_id gnl|my_center|LOCUS_14410 4508 3225 gene locus_tag LOCUS_14420 4508 3225 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057168.1 protein_id gnl|my_center|LOCUS_14420 5052 6110 gene locus_tag LOCUS_14430 5052 6110 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140935.1 protein_id gnl|my_center|LOCUS_14430 6329 6111 gene locus_tag LOCUS_14440 6329 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 6521 6342 gene locus_tag LOCUS_14450 6521 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 7480 6518 gene locus_tag LOCUS_14460 7480 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 7837 8520 gene locus_tag LOCUS_14470 7837 8520 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142947.1 protein_id gnl|my_center|LOCUS_14470 8535 9437 gene locus_tag LOCUS_14480 8535 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 9808 11127 gene locus_tag LOCUS_14490 9808 11127 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056402.1 protein_id gnl|my_center|LOCUS_14490 11218 11964 gene locus_tag LOCUS_14500 11218 11964 CDS product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920713.1 protein_id gnl|my_center|LOCUS_14500 12173 11961 gene locus_tag LOCUS_14510 12173 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140926.1 protein_id gnl|my_center|LOCUS_14510 12245 13906 gene locus_tag LOCUS_14520 12245 13906 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_14520 14368 13901 gene locus_tag LOCUS_14530 14368 13901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 15426 14434 gene locus_tag LOCUS_14540 15426 14434 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057700.1 protein_id gnl|my_center|LOCUS_14540 16668 15460 gene locus_tag LOCUS_14550 16668 15460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 17001 17798 gene locus_tag LOCUS_14560 17001 17798 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124285.1 protein_id gnl|my_center|LOCUS_14560 18648 17959 gene locus_tag LOCUS_14570 18648 17959 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056116.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence062 209 748 gene locus_tag LOCUS_14580 209 748 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986783.1 protein_id gnl|my_center|LOCUS_14580 1150 1464 gene locus_tag LOCUS_14590 1150 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14590 2788 2099 gene locus_tag LOCUS_14600 2788 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 4078 3008 gene locus_tag LOCUS_14610 4078 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14610 5108 4110 gene locus_tag LOCUS_14620 5108 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 5759 5418 gene locus_tag LOCUS_14630 5759 5418 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_14630 5989 5756 gene locus_tag LOCUS_14640 5989 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 6472 6188 gene locus_tag LOCUS_14650 6472 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 6683 6465 gene locus_tag LOCUS_14660 6683 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 7675 7055 gene locus_tag LOCUS_14670 7675 7055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 8297 7824 gene locus_tag LOCUS_14680 8297 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 8443 8516 gene locus_tag LOCUS_t00080 8443 8516 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9827 8568 gene locus_tag LOCUS_14690 9827 8568 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 protein_id gnl|my_center|LOCUS_14690 11108 9831 gene locus_tag LOCUS_14700 11108 9831 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_14700 11596 13425 gene locus_tag LOCUS_14710 11596 13425 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143667.1 protein_id gnl|my_center|LOCUS_14710 13425 14522 gene locus_tag LOCUS_14720 13425 14522 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_14720 14638 14728 gene locus_tag LOCUS_t00090 14638 14728 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18451 14954 gene locus_tag LOCUS_14730 gene mfd 18451 14954 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056796.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence063 435 1943 gene locus_tag LOCUS_14740 435 1943 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920839.1 protein_id gnl|my_center|LOCUS_14740 3518 1959 gene locus_tag LOCUS_14750 3518 1959 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142479.1 protein_id gnl|my_center|LOCUS_14750 3990 3655 gene locus_tag LOCUS_14760 3990 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 4167 5768 gene locus_tag LOCUS_14770 4167 5768 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057237.1 protein_id gnl|my_center|LOCUS_14770 6531 7781 gene locus_tag LOCUS_14780 gene rpoD 6531 7781 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173878.1 protein_id gnl|my_center|LOCUS_14780 7996 8289 gene locus_tag LOCUS_14790 gene rpsT 7996 8289 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057030.1 protein_id gnl|my_center|LOCUS_14790 8340 9119 gene locus_tag LOCUS_14800 8340 9119 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057029.1 protein_id gnl|my_center|LOCUS_14800 9276 12587 gene locus_tag LOCUS_14810 gene rpoB 9276 12587 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056489.1 protein_id gnl|my_center|LOCUS_14810 12885 16892 gene locus_tag LOCUS_14820 12885 16892 CDS product DNA-directed RNA polymerase subunit beta'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056487.1 protein_id gnl|my_center|LOCUS_14820 17294 17220 gene locus_tag LOCUS_t00100 17294 17220 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17850 17335 gene locus_tag LOCUS_14830 17850 17335 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057519.1 protein_id gnl|my_center|LOCUS_14830 18042 17956 gene locus_tag LOCUS_t00110 18042 17956 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence064 136 510 gene locus_tag LOCUS_14840 136 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1082 1984 gene locus_tag LOCUS_14850 1082 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 2603 2088 gene locus_tag LOCUS_14860 2603 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2889 3152 gene locus_tag LOCUS_14870 2889 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 3215 4930 gene locus_tag LOCUS_14880 3215 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 5247 9980 gene locus_tag LOCUS_14890 5247 9980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 10058 14881 gene locus_tag LOCUS_14900 10058 14881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 15098 18031 gene locus_tag LOCUS_14910 15098 18031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence065 1209 448 gene locus_tag LOCUS_14920 1209 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 2701 1202 gene locus_tag LOCUS_14930 2701 1202 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_14930 5378 2754 gene locus_tag LOCUS_14940 gene alaS 5378 2754 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057938.1 protein_id gnl|my_center|LOCUS_14940 6280 5450 gene locus_tag LOCUS_14950 6280 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_14950 7137 6277 gene locus_tag LOCUS_14960 7137 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_14960 7508 7314 gene locus_tag LOCUS_14970 7508 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 8378 7878 gene locus_tag LOCUS_14980 8378 7878 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056117.1 protein_id gnl|my_center|LOCUS_14980 8921 9280 gene locus_tag LOCUS_14990 gene psb28 8921 9280 CDS product photosystem II reaction center protein Psb28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928665.1 protein_id gnl|my_center|LOCUS_14990 9452 10399 gene locus_tag LOCUS_15000 9452 10399 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 protein_id gnl|my_center|LOCUS_15000 11248 10523 gene locus_tag LOCUS_15010 11248 10523 CDS product GUN4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057433.1 protein_id gnl|my_center|LOCUS_15010 11477 12880 gene locus_tag LOCUS_15020 gene lysA 11477 12880 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057598.1 protein_id gnl|my_center|LOCUS_15020 12902 13822 gene locus_tag LOCUS_15030 gene cdaA 12902 13822 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057599.1 protein_id gnl|my_center|LOCUS_15030 13819 14568 gene locus_tag LOCUS_15040 gene uppS 13819 14568 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920928.1 protein_id gnl|my_center|LOCUS_15040 14825 15139 gene locus_tag LOCUS_15050 14825 15139 CDS product DUF1825 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057879.1 protein_id gnl|my_center|LOCUS_15050 18305 15393 gene locus_tag LOCUS_15060 18305 15393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence066 1368 664 gene locus_tag LOCUS_15070 1368 664 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390738.1 protein_id gnl|my_center|LOCUS_15070 1991 1365 gene locus_tag LOCUS_15080 1991 1365 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763134.1 protein_id gnl|my_center|LOCUS_15080 3417 1993 gene locus_tag LOCUS_15090 3417 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 4100 10642 gene locus_tag LOCUS_15100 4100 10642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 10743 11483 gene locus_tag LOCUS_15110 10743 11483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 11486 11905 gene locus_tag LOCUS_15120 11486 11905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 11939 12382 gene locus_tag LOCUS_15130 11939 12382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 12674 13906 gene locus_tag LOCUS_15140 gene cbiE 12674 13906 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114023.1 protein_id gnl|my_center|LOCUS_15140 14011 13847 gene locus_tag LOCUS_15150 14011 13847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 14255 14887 gene locus_tag LOCUS_15160 14255 14887 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141012.1 protein_id gnl|my_center|LOCUS_15160 15013 15351 gene locus_tag LOCUS_15170 15013 15351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 17951 15510 gene locus_tag LOCUS_15180 gene ppsA 17951 15510 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence067 <1 806 gene locus_tag LOCUS_15190 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459437.1:RNA-guided endonuclease TnpB family protein 1054 1635 gene locus_tag LOCUS_15200 1054 1635 CDS product DUF1997 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057548.1 protein_id gnl|my_center|LOCUS_15200 1644 1994 gene locus_tag LOCUS_15210 1644 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 3495 2683 gene locus_tag LOCUS_15220 3495 2683 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143024.1 protein_id gnl|my_center|LOCUS_15220 4506 3511 gene locus_tag LOCUS_15230 gene dusA 4506 3511 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888333.1 protein_id gnl|my_center|LOCUS_15230 6033 4669 gene locus_tag LOCUS_15240 6033 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 6240 7529 gene locus_tag LOCUS_15250 6240 7529 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920845.1 protein_id gnl|my_center|LOCUS_15250 8201 8461 gene locus_tag LOCUS_15260 8201 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 8594 9361 gene locus_tag LOCUS_15270 8594 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 9970 9794 gene locus_tag LOCUS_15280 9970 9794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 10275 10090 gene locus_tag LOCUS_15290 10275 10090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 10953 10636 gene locus_tag LOCUS_15300 10953 10636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 11355 11516 gene locus_tag LOCUS_15310 11355 11516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 11730 12827 gene locus_tag LOCUS_15320 11730 12827 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090620535.1 protein_id gnl|my_center|LOCUS_15320 13616 13095 gene locus_tag LOCUS_15330 13616 13095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 14322 13786 gene locus_tag LOCUS_15340 14322 13786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 15150 14335 gene locus_tag LOCUS_15350 15150 14335 CDS product Ycf66 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057849.1 protein_id gnl|my_center|LOCUS_15350 16080 17774 gene locus_tag LOCUS_15360 16080 17774 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence068 497 186 gene locus_tag LOCUS_15370 497 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 742 494 gene locus_tag LOCUS_15380 742 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1067 2668 gene locus_tag LOCUS_15390 1067 2668 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057717.1 protein_id gnl|my_center|LOCUS_15390 2861 4288 gene locus_tag LOCUS_15400 2861 4288 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057120.1 protein_id gnl|my_center|LOCUS_15400 4295 5029 gene locus_tag LOCUS_15410 4295 5029 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920693.1 protein_id gnl|my_center|LOCUS_15410 5633 5040 gene locus_tag LOCUS_15420 gene ureG 5633 5040 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055912.1 protein_id gnl|my_center|LOCUS_15420 6396 5809 gene locus_tag LOCUS_15430 6396 5809 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057142.1 protein_id gnl|my_center|LOCUS_15430 6914 6525 gene locus_tag LOCUS_15440 6914 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 7772 7224 gene locus_tag LOCUS_15450 gene psbP 7772 7224 CDS product photosystem II reaction center PsbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057910.1 protein_id gnl|my_center|LOCUS_15450 7835 8617 gene locus_tag LOCUS_15460 7835 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 8871 8692 gene locus_tag LOCUS_15470 8871 8692 CDS product ssl1498 family light-harvesting-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055918.1 protein_id gnl|my_center|LOCUS_15470 10153 9104 gene locus_tag LOCUS_15480 10153 9104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 11402 10392 gene locus_tag LOCUS_15490 gene trpS 11402 10392 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057831.1 protein_id gnl|my_center|LOCUS_15490 12777 11464 gene locus_tag LOCUS_15500 12777 11464 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058269.1 protein_id gnl|my_center|LOCUS_15500 13420 12794 gene locus_tag LOCUS_15510 13420 12794 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530066.1 protein_id gnl|my_center|LOCUS_15510 15527 13455 gene locus_tag LOCUS_15520 15527 13455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 16326 15547 gene locus_tag LOCUS_15530 16326 15547 CDS product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140394.1 protein_id gnl|my_center|LOCUS_15530 16907 16398 gene locus_tag LOCUS_15540 16907 16398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798166.1 protein_id gnl|my_center|LOCUS_15540 17143 17006 gene locus_tag LOCUS_15550 17143 17006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 17584 17327 gene locus_tag LOCUS_15560 17584 17327 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393298.1 protein_id gnl|my_center|LOCUS_15560 17775 17581 gene locus_tag LOCUS_15570 17775 17581 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence069 385 633 gene locus_tag LOCUS_15580 385 633 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615098.1 protein_id gnl|my_center|LOCUS_15580 703 1953 gene locus_tag LOCUS_15590 gene fabF 703 1953 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057708.1 protein_id gnl|my_center|LOCUS_15590 2036 4042 gene locus_tag LOCUS_15600 gene tkt 2036 4042 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057707.1 protein_id gnl|my_center|LOCUS_15600 4210 4977 gene locus_tag LOCUS_15610 4210 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 4974 5444 gene locus_tag LOCUS_15620 4974 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 5441 5899 gene locus_tag LOCUS_15630 5441 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 6475 5909 gene locus_tag LOCUS_15640 6475 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15640 6801 6544 gene locus_tag LOCUS_15650 6801 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 7197 7015 gene locus_tag LOCUS_15660 7197 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 7196 8719 gene locus_tag LOCUS_15670 7196 8719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 8848 9132 gene locus_tag LOCUS_15680 8848 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 9604 9864 gene locus_tag LOCUS_15690 9604 9864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 9851 10048 gene locus_tag LOCUS_15700 9851 10048 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546452.1 protein_id gnl|my_center|LOCUS_15700 10165 10467 gene locus_tag LOCUS_15710 10165 10467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 10750 10998 gene locus_tag LOCUS_15720 10750 10998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 10998 11444 gene locus_tag LOCUS_15730 10998 11444 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142378.1 protein_id gnl|my_center|LOCUS_15730 11783 11711 gene locus_tag LOCUS_t00120 11783 11711 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11896 12141 gene locus_tag LOCUS_15740 11896 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 12174 13508 gene locus_tag LOCUS_15750 12174 13508 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 protein_id gnl|my_center|LOCUS_15750 13585 14706 gene locus_tag LOCUS_15760 13585 14706 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 protein_id gnl|my_center|LOCUS_15760 14879 16039 gene locus_tag LOCUS_15770 gene grrM 14879 16039 CDS product GRRM system radical SAM/SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970460.1 protein_id gnl|my_center|LOCUS_15770 17503 16535 gene locus_tag LOCUS_15780 17503 16535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence070 204 401 gene locus_tag LOCUS_15790 204 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2669 558 gene locus_tag LOCUS_15800 gene recQ 2669 558 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929065.1 protein_id gnl|my_center|LOCUS_15800 3396 2785 gene locus_tag LOCUS_15810 3396 2785 CDS product DUF3318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058121.1 protein_id gnl|my_center|LOCUS_15810 3810 3613 gene locus_tag LOCUS_15820 3810 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 4696 3821 gene locus_tag LOCUS_15830 4696 3821 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056139.1 protein_id gnl|my_center|LOCUS_15830 6058 4700 gene locus_tag LOCUS_15840 gene der 6058 4700 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056722.1 protein_id gnl|my_center|LOCUS_15840 6513 6313 gene locus_tag LOCUS_15850 6513 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 6980 6573 gene locus_tag LOCUS_15860 6980 6573 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920821.1 protein_id gnl|my_center|LOCUS_15860 8002 6977 gene locus_tag LOCUS_15870 8002 6977 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929295.1 protein_id gnl|my_center|LOCUS_15870 10258 8162 gene locus_tag LOCUS_15880 10258 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 10326 11117 gene locus_tag LOCUS_15890 10326 11117 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141358.1 protein_id gnl|my_center|LOCUS_15890 11349 11128 gene locus_tag LOCUS_15900 11349 11128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 11605 11396 gene locus_tag LOCUS_15910 11605 11396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 13583 11646 gene locus_tag LOCUS_15920 13583 11646 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816805.1 protein_id gnl|my_center|LOCUS_15920 14272 13589 gene locus_tag LOCUS_15930 14272 13589 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929061.1 protein_id gnl|my_center|LOCUS_15930 14869 14291 gene locus_tag LOCUS_15940 14869 14291 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_15940 15389 14925 gene locus_tag LOCUS_15950 15389 14925 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_15950 16291 15395 gene locus_tag LOCUS_15960 16291 15395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 16301 16579 gene locus_tag LOCUS_15970 16301 16579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 16742 16927 gene locus_tag LOCUS_15980 16742 16927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 17441 17187 gene locus_tag LOCUS_15990 17441 17187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence071 1303 842 gene locus_tag LOCUS_16000 1303 842 CDS product DUF2996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799827.1 protein_id gnl|my_center|LOCUS_16000 3617 1608 gene locus_tag LOCUS_16010 gene ligA 3617 1608 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056701.1 protein_id gnl|my_center|LOCUS_16010 4198 3632 gene locus_tag LOCUS_16020 4198 3632 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 protein_id gnl|my_center|LOCUS_16020 4785 4222 gene locus_tag LOCUS_16030 4785 4222 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 protein_id gnl|my_center|LOCUS_16030 6220 4898 gene locus_tag LOCUS_16040 6220 4898 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058098.1 protein_id gnl|my_center|LOCUS_16040 6282 6755 gene locus_tag LOCUS_16050 6282 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143336.1 protein_id gnl|my_center|LOCUS_16050 6970 7914 gene locus_tag LOCUS_16060 6970 7914 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967589.1 protein_id gnl|my_center|LOCUS_16060 7908 8093 gene locus_tag LOCUS_16070 7908 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 8455 10908 gene locus_tag LOCUS_16080 8455 10908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 11569 12432 gene locus_tag LOCUS_16090 11569 12432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 12470 13066 gene locus_tag LOCUS_16100 12470 13066 CDS product LPS biosynthesis O-acetyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965640.1 protein_id gnl|my_center|LOCUS_16100 13121 14329 gene locus_tag LOCUS_16110 13121 14329 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044915.1 protein_id gnl|my_center|LOCUS_16110 14351 15556 gene locus_tag LOCUS_16120 14351 15556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 15901 16374 gene locus_tag LOCUS_16130 15901 16374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 16978 16679 gene locus_tag LOCUS_16140 16978 16679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16140 >Feature sequence072 830 96 gene locus_tag LOCUS_16150 830 96 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056776.1 protein_id gnl|my_center|LOCUS_16150 2253 862 gene locus_tag LOCUS_16160 2253 862 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142146.1 protein_id gnl|my_center|LOCUS_16160 2621 2466 gene locus_tag LOCUS_16170 2621 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 4611 2611 gene locus_tag LOCUS_16180 4611 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16180 6731 4749 gene locus_tag LOCUS_16190 6731 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16190 8902 6749 gene locus_tag LOCUS_16200 8902 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 9418 9107 gene locus_tag LOCUS_16210 9418 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 9627 10688 gene locus_tag LOCUS_16220 9627 10688 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031370.1 protein_id gnl|my_center|LOCUS_16220 11413 10733 gene locus_tag LOCUS_16230 11413 10733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 12475 11660 gene locus_tag LOCUS_16240 12475 11660 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142967.1 protein_id gnl|my_center|LOCUS_16240 12725 12483 gene locus_tag LOCUS_16250 12725 12483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 13372 15336 gene locus_tag LOCUS_16260 13372 15336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056981.1 protein_id gnl|my_center|LOCUS_16260 15925 15674 gene locus_tag LOCUS_16270 15925 15674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16270 16288 15929 gene locus_tag LOCUS_16280 16288 15929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16280 >Feature sequence073 739 173 gene locus_tag LOCUS_16290 gene recR 739 173 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058038.1 protein_id gnl|my_center|LOCUS_16290 1459 926 gene locus_tag LOCUS_16300 1459 926 CDS product DUF4330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920747.1 protein_id gnl|my_center|LOCUS_16300 1809 3848 gene locus_tag LOCUS_16310 gene speA 1809 3848 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057644.1 protein_id gnl|my_center|LOCUS_16310 3926 5941 gene locus_tag LOCUS_16320 3926 5941 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 protein_id gnl|my_center|LOCUS_16320 6338 6613 gene locus_tag LOCUS_16330 6338 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 6906 7184 gene locus_tag LOCUS_16340 6906 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 9410 7314 gene locus_tag LOCUS_16350 9410 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 10087 9935 gene locus_tag LOCUS_16360 10087 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 10404 13718 gene locus_tag LOCUS_16370 10404 13718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 14331 15185 gene locus_tag LOCUS_16380 14331 15185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 15371 15850 gene locus_tag LOCUS_16390 15371 15850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 15834 16232 gene locus_tag LOCUS_16400 15834 16232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence074 169 537 gene locus_tag LOCUS_16410 169 537 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_16410 1869 778 gene locus_tag LOCUS_16420 1869 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 2607 1933 gene locus_tag LOCUS_16430 2607 1933 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921118.1 protein_id gnl|my_center|LOCUS_16430 2685 3401 gene locus_tag LOCUS_16440 2685 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 4377 3424 gene locus_tag LOCUS_16450 4377 3424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_16450 5058 5807 gene locus_tag LOCUS_16460 5058 5807 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039062.1 protein_id gnl|my_center|LOCUS_16460 6576 5836 gene locus_tag LOCUS_16470 6576 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 9912 6880 gene locus_tag LOCUS_16480 gene infB 9912 6880 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056909.1 protein_id gnl|my_center|LOCUS_16480 10305 10024 gene locus_tag LOCUS_16490 10305 10024 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172451.1 protein_id gnl|my_center|LOCUS_16490 11498 10302 gene locus_tag LOCUS_16500 gene nusA 11498 10302 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057772.1 protein_id gnl|my_center|LOCUS_16500 12147 11677 gene locus_tag LOCUS_16510 gene rimP 12147 11677 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920953.1 protein_id gnl|my_center|LOCUS_16510 12362 14257 gene locus_tag LOCUS_16520 gene ftsH2 12362 14257 CDS product ATP-dependent zinc metalloprotease FtsH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056581.1 protein_id gnl|my_center|LOCUS_16520 15131 14343 gene locus_tag LOCUS_16530 15131 14343 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057170.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence075 338 775 gene locus_tag LOCUS_16540 gene cynS 338 775 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896757.1 protein_id gnl|my_center|LOCUS_16540 1155 1463 gene locus_tag LOCUS_16550 1155 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1379 1615 gene locus_tag LOCUS_16560 1379 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 2113 1679 gene locus_tag LOCUS_16570 2113 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 2605 2198 gene locus_tag LOCUS_16580 2605 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 3081 2695 gene locus_tag LOCUS_16590 3081 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 3364 4737 gene locus_tag LOCUS_16600 3364 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 5019 4819 gene locus_tag LOCUS_16610 5019 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 7207 5396 gene locus_tag LOCUS_16620 7207 5396 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_16620 7619 7251 gene locus_tag LOCUS_16630 7619 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 7773 7946 gene locus_tag LOCUS_16640 7773 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 8561 7959 gene locus_tag LOCUS_16650 8561 7959 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040689791.1 protein_id gnl|my_center|LOCUS_16650 9670 8639 gene locus_tag LOCUS_16660 9670 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 9891 11039 gene locus_tag LOCUS_16670 9891 11039 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056563.1 protein_id gnl|my_center|LOCUS_16670 12383 11262 gene locus_tag LOCUS_16680 12383 11262 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141501.1 protein_id gnl|my_center|LOCUS_16680 12555 13184 gene locus_tag LOCUS_16690 gene ruvA 12555 13184 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056382.1 protein_id gnl|my_center|LOCUS_16690 13705 14190 gene locus_tag LOCUS_16700 gene apcA 13705 14190 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056801.1 protein_id gnl|my_center|LOCUS_16700 14270 14755 gene locus_tag LOCUS_16710 gene apcB 14270 14755 CDS product allophycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056800.1 protein_id gnl|my_center|LOCUS_16710 14946 15149 gene locus_tag LOCUS_16720 14946 15149 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056799.1 protein_id gnl|my_center|LOCUS_16720 15618 15202 gene locus_tag LOCUS_16730 gene msrB 15618 15202 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence076 946 119 gene locus_tag LOCUS_16740 946 119 CDS product YaaW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920905.1 protein_id gnl|my_center|LOCUS_16740 1044 2021 gene locus_tag LOCUS_16750 1044 2021 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142872.1 protein_id gnl|my_center|LOCUS_16750 2087 2341 gene locus_tag LOCUS_16760 2087 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920999.1 protein_id gnl|my_center|LOCUS_16760 2575 4638 gene locus_tag LOCUS_16770 2575 4638 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_16770 4818 5351 gene locus_tag LOCUS_16780 4818 5351 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764601.1 protein_id gnl|my_center|LOCUS_16780 6541 5567 gene locus_tag LOCUS_16790 6541 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_16790 7631 6654 gene locus_tag LOCUS_16800 7631 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_16800 8061 7909 gene locus_tag LOCUS_16810 8061 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 9802 8630 gene locus_tag LOCUS_16820 gene rodA 9802 8630 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920901.1 protein_id gnl|my_center|LOCUS_16820 10989 9928 gene locus_tag LOCUS_16830 10989 9928 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921045.1 protein_id gnl|my_center|LOCUS_16830 12098 11307 gene locus_tag LOCUS_16840 12098 11307 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_16840 13365 12085 gene locus_tag LOCUS_16850 13365 12085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 13531 14691 gene locus_tag LOCUS_16860 13531 14691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 15797 14688 gene locus_tag LOCUS_16870 15797 14688 CDS product AtzE family amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965237.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence077 447 1097 gene locus_tag LOCUS_16880 447 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1107 2522 gene locus_tag LOCUS_16890 1107 2522 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057573.1 protein_id gnl|my_center|LOCUS_16890 3534 2752 gene locus_tag LOCUS_16900 3534 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 4751 3531 gene locus_tag LOCUS_16910 4751 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 5149 4757 gene locus_tag LOCUS_16920 5149 4757 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974795.1 protein_id gnl|my_center|LOCUS_16920 5788 5234 gene locus_tag LOCUS_16930 5788 5234 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928657.1 protein_id gnl|my_center|LOCUS_16930 6799 5816 gene locus_tag LOCUS_16940 6799 5816 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920729.1 protein_id gnl|my_center|LOCUS_16940 8046 6829 gene locus_tag LOCUS_16950 8046 6829 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545872.1 protein_id gnl|my_center|LOCUS_16950 9008 8049 gene locus_tag LOCUS_16960 gene gmd 9008 8049 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_16960 9943 9023 gene locus_tag LOCUS_16970 gene aglG 9943 9023 CDS product glucosyl-dolichyl phosphate glucuronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289272.1 protein_id gnl|my_center|LOCUS_16970 10182 11165 gene locus_tag LOCUS_16980 10182 11165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 11297 11653 gene locus_tag LOCUS_16990 gene folB 11297 11653 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798382.1 protein_id gnl|my_center|LOCUS_16990 12182 11640 gene locus_tag LOCUS_17000 12182 11640 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056276.1 protein_id gnl|my_center|LOCUS_17000 12343 12669 gene locus_tag LOCUS_17010 12343 12669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 13247 12666 gene locus_tag LOCUS_17020 13247 12666 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_17020 14160 13504 gene locus_tag LOCUS_17030 gene nth 14160 13504 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_17030 15251 14160 gene locus_tag LOCUS_17040 gene rseP 15251 14160 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057479.1 protein_id gnl|my_center|LOCUS_17040 15401 15772 gene locus_tag LOCUS_17050 15401 15772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence078 995 597 gene locus_tag LOCUS_17060 995 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1278 979 gene locus_tag LOCUS_17070 1278 979 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_17070 1879 1343 gene locus_tag LOCUS_17080 1879 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 2011 2835 gene locus_tag LOCUS_17090 2011 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2933 2733 gene locus_tag LOCUS_17100 2933 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 3327 3521 gene locus_tag LOCUS_17110 3327 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 3964 3548 gene locus_tag LOCUS_17120 3964 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 4540 5646 gene locus_tag LOCUS_17130 4540 5646 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259230.1 protein_id gnl|my_center|LOCUS_17130 7423 5771 gene locus_tag LOCUS_17140 gene mutL 7423 5771 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137908825.1 protein_id gnl|my_center|LOCUS_17140 7993 8217 gene locus_tag LOCUS_17150 7993 8217 CDS product Calvin cycle protein CP12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057657.1 protein_id gnl|my_center|LOCUS_17150 8393 8983 gene locus_tag LOCUS_17160 8393 8983 CDS product DUF3177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057787.1 protein_id gnl|my_center|LOCUS_17160 9019 9303 gene locus_tag LOCUS_17170 9019 9303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921006.1 protein_id gnl|my_center|LOCUS_17170 9533 10543 gene locus_tag LOCUS_17180 gene egtD 9533 10543 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088429091.1 protein_id gnl|my_center|LOCUS_17180 10584 11939 gene locus_tag LOCUS_17190 10584 11939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 12211 12645 gene locus_tag LOCUS_17200 12211 12645 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 protein_id gnl|my_center|LOCUS_17200 12781 14559 gene locus_tag LOCUS_17210 12781 14559 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928808.1 protein_id gnl|my_center|LOCUS_17210 14858 15358 gene locus_tag LOCUS_17220 14858 15358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence079 823 1788 gene locus_tag LOCUS_17230 823 1788 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057016.1 protein_id gnl|my_center|LOCUS_17230 1764 3116 gene locus_tag LOCUS_17240 1764 3116 CDS product 2-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920832.1 protein_id gnl|my_center|LOCUS_17240 4561 3131 gene locus_tag LOCUS_17250 4561 3131 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057580.1 protein_id gnl|my_center|LOCUS_17250 5779 4571 gene locus_tag LOCUS_17260 5779 4571 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_17260 7263 5776 gene locus_tag LOCUS_17270 7263 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 7894 7730 gene locus_tag LOCUS_17280 7894 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 9435 7990 gene locus_tag LOCUS_17290 9435 7990 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201919.1 protein_id gnl|my_center|LOCUS_17290 10293 11765 gene locus_tag LOCUS_17300 10293 11765 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921221.1 protein_id gnl|my_center|LOCUS_17300 12991 11828 gene locus_tag LOCUS_17310 12991 11828 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172598138.1 protein_id gnl|my_center|LOCUS_17310 13237 14091 gene locus_tag LOCUS_17320 13237 14091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 14232 14675 gene locus_tag LOCUS_17330 14232 14675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 14754 15317 gene locus_tag LOCUS_17340 14754 15317 CDS product DUF4334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090605.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence080 1028 234 gene locus_tag LOCUS_17350 1028 234 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190557989.1 protein_id gnl|my_center|LOCUS_17350 1131 2645 gene locus_tag LOCUS_17360 1131 2645 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056025.1 protein_id gnl|my_center|LOCUS_17360 3657 2740 gene locus_tag LOCUS_17370 3657 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 4415 3654 gene locus_tag LOCUS_17380 4415 3654 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131423.1 protein_id gnl|my_center|LOCUS_17380 5953 4442 gene locus_tag LOCUS_17390 5953 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 6458 6060 gene locus_tag LOCUS_17400 gene dndE 6458 6060 CDS product DNA sulfur modification protein DndE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296384.1 protein_id gnl|my_center|LOCUS_17400 8695 6710 gene locus_tag LOCUS_17410 gene dndD 8695 6710 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_17410 8950 10593 gene locus_tag LOCUS_17420 8950 10593 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_17420 10738 12129 gene locus_tag LOCUS_17430 10738 12129 CDS product IctB family putative bicarbonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015158974.1 protein_id gnl|my_center|LOCUS_17430 12365 12811 gene locus_tag LOCUS_17440 12365 12811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 12866 13780 gene locus_tag LOCUS_17450 12866 13780 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023152.1 protein_id gnl|my_center|LOCUS_17450 13963 14718 gene locus_tag LOCUS_17460 13963 14718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence081 503 117 gene locus_tag LOCUS_17470 503 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141236.1 protein_id gnl|my_center|LOCUS_17470 970 3300 gene locus_tag LOCUS_17480 970 3300 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057757.1 protein_id gnl|my_center|LOCUS_17480 4028 3687 gene locus_tag LOCUS_17490 4028 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 4041 5006 gene locus_tag LOCUS_17500 4041 5006 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056369.1 protein_id gnl|my_center|LOCUS_17500 5048 5260 gene locus_tag LOCUS_17510 5048 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 7211 5325 gene locus_tag LOCUS_17520 gene ftsH2 7211 5325 CDS product ATP-dependent zinc metalloprotease FtsH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056581.1 protein_id gnl|my_center|LOCUS_17520 7659 8591 gene locus_tag LOCUS_17530 7659 8591 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259191.1 protein_id gnl|my_center|LOCUS_17530 8926 8627 gene locus_tag LOCUS_17540 8926 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 9956 9309 gene locus_tag LOCUS_17550 9956 9309 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057176.1 protein_id gnl|my_center|LOCUS_17550 10224 9925 gene locus_tag LOCUS_17560 10224 9925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 10480 10839 gene locus_tag LOCUS_17570 10480 10839 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055968.1 protein_id gnl|my_center|LOCUS_17570 10849 11274 gene locus_tag LOCUS_17580 10849 11274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 11428 11928 gene locus_tag LOCUS_17590 11428 11928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 12053 12781 gene locus_tag LOCUS_17600 gene lptB 12053 12781 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045053120.1 protein_id gnl|my_center|LOCUS_17600 12814 13983 gene locus_tag LOCUS_17610 12814 13983 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140933.1 protein_id gnl|my_center|LOCUS_17610 14859 14020 gene locus_tag LOCUS_17620 gene rsmI 14859 14020 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057354.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence082 845 381 gene locus_tag LOCUS_17630 845 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 2510 918 gene locus_tag LOCUS_17640 2510 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 5291 2937 gene locus_tag LOCUS_17650 5291 2937 CDS product GH116 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797719.1 protein_id gnl|my_center|LOCUS_17650 5859 5416 gene locus_tag LOCUS_17660 5859 5416 CDS product DUF3531 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056063.1 protein_id gnl|my_center|LOCUS_17660 6793 6368 gene locus_tag LOCUS_17670 6793 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 7576 6809 gene locus_tag LOCUS_17680 7576 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 10210 7616 gene locus_tag LOCUS_17690 10210 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 10681 10265 gene locus_tag LOCUS_17700 10681 10265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 11737 11159 gene locus_tag LOCUS_17710 11737 11159 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056337.1 protein_id gnl|my_center|LOCUS_17710 12792 11734 gene locus_tag LOCUS_17720 12792 11734 CDS product DUF3326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056519.1 protein_id gnl|my_center|LOCUS_17720 12965 12789 gene locus_tag LOCUS_17730 12965 12789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 13170 13724 gene locus_tag LOCUS_17740 13170 13724 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_17740 14645 13803 gene locus_tag LOCUS_17750 14645 13803 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence083 530 868 gene locus_tag LOCUS_17760 530 868 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920728.1 protein_id gnl|my_center|LOCUS_17760 1043 3748 gene locus_tag LOCUS_17770 1043 3748 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058198.1 protein_id gnl|my_center|LOCUS_17770 3849 5087 gene locus_tag LOCUS_17780 3849 5087 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203374.1 protein_id gnl|my_center|LOCUS_17780 5084 5596 gene locus_tag LOCUS_17790 5084 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 6177 8870 gene locus_tag LOCUS_17800 gene adhE 6177 8870 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056082.1 protein_id gnl|my_center|LOCUS_17800 9710 8937 gene locus_tag LOCUS_17810 gene gloB 9710 8937 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057476.1 protein_id gnl|my_center|LOCUS_17810 11606 9756 gene locus_tag LOCUS_17820 11606 9756 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928942.1 protein_id gnl|my_center|LOCUS_17820 12148 13299 gene locus_tag LOCUS_17830 12148 13299 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_17830 13916 13416 gene locus_tag LOCUS_17840 13916 13416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 14311 13937 gene locus_tag LOCUS_17850 14311 13937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 14904 14311 gene locus_tag LOCUS_17860 14904 14311 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056172.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence084 763 1671 gene locus_tag LOCUS_17870 763 1671 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928449.1 protein_id gnl|my_center|LOCUS_17870 1876 4038 gene locus_tag LOCUS_17880 gene dnaK 1876 4038 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920992.1 protein_id gnl|my_center|LOCUS_17880 4254 5129 gene locus_tag LOCUS_17890 4254 5129 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057983.1 protein_id gnl|my_center|LOCUS_17890 5227 6435 gene locus_tag LOCUS_17900 5227 6435 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056427.1 protein_id gnl|my_center|LOCUS_17900 6671 8356 gene locus_tag LOCUS_17910 6671 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 9339 10928 gene locus_tag LOCUS_17920 9339 10928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 12149 10902 gene locus_tag LOCUS_17930 12149 10902 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798996.1 protein_id gnl|my_center|LOCUS_17930 12958 12233 gene locus_tag LOCUS_17940 12958 12233 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056258.1 protein_id gnl|my_center|LOCUS_17940 12914 13129 gene locus_tag LOCUS_17950 12914 13129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 13290 13706 gene locus_tag LOCUS_17960 13290 13706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 13694 14029 gene locus_tag LOCUS_17970 13694 14029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence085 243 710 gene locus_tag LOCUS_17980 243 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17980 688 1230 gene locus_tag LOCUS_17990 688 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17990 1227 1919 gene locus_tag LOCUS_18000 1227 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 2947 2231 gene locus_tag LOCUS_18010 2947 2231 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142237.1 protein_id gnl|my_center|LOCUS_18010 3103 4716 gene locus_tag LOCUS_18020 gene metG 3103 4716 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056597.1 protein_id gnl|my_center|LOCUS_18020 4817 5422 gene locus_tag LOCUS_18030 4817 5422 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056598.1 protein_id gnl|my_center|LOCUS_18030 6748 5552 gene locus_tag LOCUS_18040 6748 5552 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057505.1 protein_id gnl|my_center|LOCUS_18040 7994 6837 gene locus_tag LOCUS_18050 7994 6837 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_18050 8322 7987 gene locus_tag LOCUS_18060 8322 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 8745 9128 gene locus_tag LOCUS_18070 gene rpsL 8745 9128 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143913.1 protein_id gnl|my_center|LOCUS_18070 9284 9754 gene locus_tag LOCUS_18080 gene rpsG 9284 9754 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057585.1 protein_id gnl|my_center|LOCUS_18080 9897 11972 gene locus_tag LOCUS_18090 gene fusA 9897 11972 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057586.1 protein_id gnl|my_center|LOCUS_18090 12126 13355 gene locus_tag LOCUS_18100 gene tuf 12126 13355 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143916.1 protein_id gnl|my_center|LOCUS_18100 13446 13763 gene locus_tag LOCUS_18110 gene rpsJ 13446 13763 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006042265.1 protein_id gnl|my_center|LOCUS_18110 <15034 13983 gene locus_tag LOCUS_18120 <15034 13983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895542.1:arachidonate 15-lipoxygenase >Feature sequence086 163 1743 gene locus_tag LOCUS_18130 163 1743 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057307.1 protein_id gnl|my_center|LOCUS_18130 1786 3321 gene locus_tag LOCUS_18140 1786 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 3502 5382 gene locus_tag LOCUS_18150 3502 5382 CDS product DNA-directed RNA polymerase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056488.1 protein_id gnl|my_center|LOCUS_18150 5839 5423 gene locus_tag LOCUS_18160 5839 5423 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056577.1 protein_id gnl|my_center|LOCUS_18160 6468 5965 gene locus_tag LOCUS_18170 6468 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 7612 6458 gene locus_tag LOCUS_18180 7612 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 9024 7843 gene locus_tag LOCUS_18190 9024 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 9469 9035 gene locus_tag LOCUS_18200 9469 9035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 12431 9573 gene locus_tag LOCUS_18210 gene ileS 12431 9573 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921027.1 protein_id gnl|my_center|LOCUS_18210 12641 13213 gene locus_tag LOCUS_18220 12641 13213 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_18220 14373 13642 gene locus_tag LOCUS_18230 14373 13642 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125542.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence087 2627 1212 gene locus_tag LOCUS_18240 gene argH 2627 1212 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056221.1 protein_id gnl|my_center|LOCUS_18240 3672 3061 gene locus_tag LOCUS_18250 3672 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 4003 3680 gene locus_tag LOCUS_18260 4003 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 4319 5176 gene locus_tag LOCUS_18270 4319 5176 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142304.1 protein_id gnl|my_center|LOCUS_18270 5340 6404 gene locus_tag LOCUS_18280 5340 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 7214 6483 gene locus_tag LOCUS_18290 7214 6483 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_18290 7421 8098 gene locus_tag LOCUS_18300 7421 8098 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090466.1 protein_id gnl|my_center|LOCUS_18300 8750 8118 gene locus_tag LOCUS_18310 8750 8118 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056571.1 protein_id gnl|my_center|LOCUS_18310 9291 11495 gene locus_tag LOCUS_18320 9291 11495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 11519 13030 gene locus_tag LOCUS_18330 11519 13030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 13580 14581 gene locus_tag LOCUS_18340 13580 14581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence088 406 1185 gene locus_tag LOCUS_18350 406 1185 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_18350 1383 1847 gene locus_tag LOCUS_18360 1383 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2265 3086 gene locus_tag LOCUS_18370 2265 3086 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073519.1 protein_id gnl|my_center|LOCUS_18370 3144 4010 gene locus_tag LOCUS_18380 3144 4010 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142803.1 protein_id gnl|my_center|LOCUS_18380 4241 4537 gene locus_tag LOCUS_18390 4241 4537 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836217.1 protein_id gnl|my_center|LOCUS_18390 4524 4712 gene locus_tag LOCUS_18400 4524 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 5065 4868 gene locus_tag LOCUS_18410 5065 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 5494 5700 gene locus_tag LOCUS_18420 5494 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 5703 6209 gene locus_tag LOCUS_18430 5703 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 8350 6479 gene locus_tag LOCUS_18440 8350 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 9286 8411 gene locus_tag LOCUS_18450 9286 8411 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929069.1 protein_id gnl|my_center|LOCUS_18450 10221 9379 gene locus_tag LOCUS_18460 10221 9379 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012164238.1 protein_id gnl|my_center|LOCUS_18460 11520 10321 gene locus_tag LOCUS_18470 11520 10321 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057053.1 protein_id gnl|my_center|LOCUS_18470 12033 11809 gene locus_tag LOCUS_18480 12033 11809 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057795.1 protein_id gnl|my_center|LOCUS_18480 12484 12335 gene locus_tag LOCUS_18490 12484 12335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 13148 12588 gene locus_tag LOCUS_18500 13148 12588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 14456 13431 gene locus_tag LOCUS_18510 gene rlmN 14456 13431 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058257.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence089 312 1481 gene locus_tag LOCUS_18520 312 1481 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058268.1 protein_id gnl|my_center|LOCUS_18520 2413 1550 gene locus_tag LOCUS_18530 2413 1550 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142464.1 protein_id gnl|my_center|LOCUS_18530 2717 4693 gene locus_tag LOCUS_18540 2717 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18540 4681 4881 gene locus_tag LOCUS_18550 4681 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 4951 5229 gene locus_tag LOCUS_18560 4951 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 5247 5696 gene locus_tag LOCUS_18570 5247 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 5907 9320 gene locus_tag LOCUS_18580 5907 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 9338 10339 gene locus_tag LOCUS_18590 9338 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 10353 11051 gene locus_tag LOCUS_18600 10353 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 11061 11627 gene locus_tag LOCUS_18610 11061 11627 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143802.1 protein_id gnl|my_center|LOCUS_18610 11627 11860 gene locus_tag LOCUS_18620 11627 11860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 11870 12430 gene locus_tag LOCUS_18630 11870 12430 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143802.1 protein_id gnl|my_center|LOCUS_18630 12430 13266 gene locus_tag LOCUS_18640 12430 13266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 13455 14612 gene locus_tag LOCUS_18650 13455 14612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence090 1362 193 gene locus_tag LOCUS_18660 1362 193 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_18660 2354 1359 gene locus_tag LOCUS_18670 2354 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 4390 2663 gene locus_tag LOCUS_18680 4390 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 5887 4448 gene locus_tag LOCUS_18690 gene glmM 5887 4448 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013191710.1 protein_id gnl|my_center|LOCUS_18690 6161 7102 gene locus_tag LOCUS_18700 6161 7102 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142791.1 protein_id gnl|my_center|LOCUS_18700 7407 8816 gene locus_tag LOCUS_18710 7407 8816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 9245 9943 gene locus_tag LOCUS_18720 9245 9943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 11135 10956 gene locus_tag LOCUS_18730 11135 10956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 11614 12135 gene locus_tag LOCUS_18740 11614 12135 CDS product photosystem I assembly protein Ycf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057365.1 protein_id gnl|my_center|LOCUS_18740 12332 12628 gene locus_tag LOCUS_18750 gene gatC 12332 12628 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057364.1 protein_id gnl|my_center|LOCUS_18750 12776 13177 gene locus_tag LOCUS_18760 12776 13177 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172237.1 protein_id gnl|my_center|LOCUS_18760 13978 14349 gene locus_tag LOCUS_18770 13978 14349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence091 1413 460 gene locus_tag LOCUS_18780 1413 460 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056398.1 protein_id gnl|my_center|LOCUS_18780 1977 2549 gene locus_tag LOCUS_18790 1977 2549 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_18790 3268 2576 gene locus_tag LOCUS_18800 gene queC 3268 2576 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126004.1 protein_id gnl|my_center|LOCUS_18800 3630 3268 gene locus_tag LOCUS_18810 3630 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 3944 3627 gene locus_tag LOCUS_18820 3944 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 4696 4079 gene locus_tag LOCUS_18830 4696 4079 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_18830 4673 5230 gene locus_tag LOCUS_18840 4673 5230 CDS product Ycf51 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056935.1 protein_id gnl|my_center|LOCUS_18840 5251 6360 gene locus_tag LOCUS_18850 5251 6360 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524107.1 protein_id gnl|my_center|LOCUS_18850 7008 6607 gene locus_tag LOCUS_18860 7008 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 7274 7005 gene locus_tag LOCUS_18870 7274 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 8584 13017 gene locus_tag LOCUS_18880 8584 13017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 13114 13443 gene locus_tag LOCUS_18890 13114 13443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 13551 13718 gene locus_tag LOCUS_18900 13551 13718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence092 177 3503 gene locus_tag LOCUS_18910 177 3503 CDS product AAA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057338.1 protein_id gnl|my_center|LOCUS_18910 4427 3597 gene locus_tag LOCUS_18920 4427 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 4817 5800 gene locus_tag LOCUS_18930 gene holA 4817 5800 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920898.1 protein_id gnl|my_center|LOCUS_18930 5864 7519 gene locus_tag LOCUS_18940 5864 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 8850 7693 gene locus_tag LOCUS_18950 gene corA 8850 7693 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_18950 9043 10071 gene locus_tag LOCUS_18960 gene pdxA 9043 10071 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173758.1 protein_id gnl|my_center|LOCUS_18960 10096 11460 gene locus_tag LOCUS_18970 10096 11460 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 protein_id gnl|my_center|LOCUS_18970 11525 14185 gene locus_tag LOCUS_18980 11525 14185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence093 1022 813 gene locus_tag LOCUS_18990 1022 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 1728 1276 gene locus_tag LOCUS_19000 1728 1276 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056191.1 protein_id gnl|my_center|LOCUS_19000 1833 2195 gene locus_tag LOCUS_19010 1833 2195 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 protein_id gnl|my_center|LOCUS_19010 2201 3040 gene locus_tag LOCUS_19020 2201 3040 CDS product prephenate/arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921244.1 protein_id gnl|my_center|LOCUS_19020 3114 3572 gene locus_tag LOCUS_19030 3114 3572 CDS product nitrate reductase associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057196.1 protein_id gnl|my_center|LOCUS_19030 4049 3858 gene locus_tag LOCUS_19040 4049 3858 CDS product DUF2949 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921037.1 protein_id gnl|my_center|LOCUS_19040 4319 5275 gene locus_tag LOCUS_19050 4319 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 5566 5318 gene locus_tag LOCUS_19060 5566 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 5803 5967 gene locus_tag LOCUS_19070 5803 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 6110 7510 gene locus_tag LOCUS_19080 6110 7510 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141482.1 protein_id gnl|my_center|LOCUS_19080 7625 8062 gene locus_tag LOCUS_19090 7625 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 9139 8354 gene locus_tag LOCUS_19100 9139 8354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 9235 9627 gene locus_tag LOCUS_19110 9235 9627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 10573 9800 gene locus_tag LOCUS_19120 10573 9800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 11040 10813 gene locus_tag LOCUS_19130 11040 10813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 11361 11783 gene locus_tag LOCUS_19140 11361 11783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 12174 11809 gene locus_tag LOCUS_19150 12174 11809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531260.1 protein_id gnl|my_center|LOCUS_19150 12259 12510 gene locus_tag LOCUS_19160 12259 12510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 12631 14064 gene locus_tag LOCUS_19170 12631 14064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence094 1043 504 gene locus_tag LOCUS_19180 1043 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 1253 2413 gene locus_tag LOCUS_19190 1253 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2761 2468 gene locus_tag LOCUS_19200 2761 2468 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_19200 3101 2811 gene locus_tag LOCUS_19210 3101 2811 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141164.1 protein_id gnl|my_center|LOCUS_19210 3543 3782 gene locus_tag LOCUS_19220 3543 3782 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 protein_id gnl|my_center|LOCUS_19220 3742 4005 gene locus_tag LOCUS_19230 3742 4005 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927120.1 protein_id gnl|my_center|LOCUS_19230 4206 4496 gene locus_tag LOCUS_19240 4206 4496 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_19240 4506 4796 gene locus_tag LOCUS_19250 4506 4796 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_19250 5067 5867 gene locus_tag LOCUS_19260 gene cobA 5067 5867 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055999.1 protein_id gnl|my_center|LOCUS_19260 5878 6297 gene locus_tag LOCUS_19270 5878 6297 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174926.1 protein_id gnl|my_center|LOCUS_19270 6430 6924 gene locus_tag LOCUS_19280 6430 6924 CDS product photosystem I reaction center subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058243.1 protein_id gnl|my_center|LOCUS_19280 7236 8867 gene locus_tag LOCUS_19290 7236 8867 CDS product peptide ligase PGM1-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_19290 9804 8854 gene locus_tag LOCUS_19300 9804 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 10083 9871 gene locus_tag LOCUS_19310 10083 9871 CDS product DUF3148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921047.1 protein_id gnl|my_center|LOCUS_19310 10487 11218 gene locus_tag LOCUS_19320 10487 11218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 11385 11639 gene locus_tag LOCUS_19330 11385 11639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 11640 11891 gene locus_tag LOCUS_19340 11640 11891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 12228 12542 gene locus_tag LOCUS_19350 12228 12542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 13526 12627 gene locus_tag LOCUS_19360 13526 12627 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588823.1 protein_id gnl|my_center|LOCUS_19360 13774 13568 gene locus_tag LOCUS_19370 13774 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence095 682 254 gene locus_tag LOCUS_19380 682 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 2451 730 gene locus_tag LOCUS_19390 2451 730 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929004.1 protein_id gnl|my_center|LOCUS_19390 2960 2478 gene locus_tag LOCUS_19400 2960 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 4920 3178 gene locus_tag LOCUS_19410 4920 3178 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056502.1 protein_id gnl|my_center|LOCUS_19410 5350 5042 gene locus_tag LOCUS_19420 5350 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 5566 7638 gene locus_tag LOCUS_19430 5566 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 8102 7836 gene locus_tag LOCUS_19440 8102 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 8385 8104 gene locus_tag LOCUS_19450 8385 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 9877 8633 gene locus_tag LOCUS_19460 9877 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 10636 9917 gene locus_tag LOCUS_19470 10636 9917 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141338.1 protein_id gnl|my_center|LOCUS_19470 11702 11067 gene locus_tag LOCUS_19480 11702 11067 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798139.1 protein_id gnl|my_center|LOCUS_19480 12399 11761 gene locus_tag LOCUS_19490 12399 11761 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798139.1 protein_id gnl|my_center|LOCUS_19490 13384 12965 gene locus_tag LOCUS_19500 13384 12965 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057574.1 protein_id gnl|my_center|LOCUS_19500 13957 13580 gene locus_tag LOCUS_19510 13957 13580 CDS product DUF3110 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056170.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence096 1626 571 gene locus_tag LOCUS_19520 gene cobD 1626 571 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058099.1 protein_id gnl|my_center|LOCUS_19520 2162 1860 gene locus_tag LOCUS_19530 2162 1860 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921010.1 protein_id gnl|my_center|LOCUS_19530 2708 3193 gene locus_tag LOCUS_19540 2708 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 3271 3747 gene locus_tag LOCUS_19550 gene ureE 3271 3747 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057206.1 protein_id gnl|my_center|LOCUS_19550 4876 4229 gene locus_tag LOCUS_19560 4876 4229 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_19560 5118 5399 gene locus_tag LOCUS_19570 5118 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 6403 5423 gene locus_tag LOCUS_19580 6403 5423 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041243618.1 protein_id gnl|my_center|LOCUS_19580 6487 7089 gene locus_tag LOCUS_19590 6487 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 7203 8660 gene locus_tag LOCUS_19600 7203 8660 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057458.1 protein_id gnl|my_center|LOCUS_19600 8666 9160 gene locus_tag LOCUS_19610 8666 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 10191 9313 gene locus_tag LOCUS_19620 10191 9313 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_19620 10503 10195 gene locus_tag LOCUS_19630 10503 10195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 11699 10638 gene locus_tag LOCUS_19640 11699 10638 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057101.1 protein_id gnl|my_center|LOCUS_19640 12375 11857 gene locus_tag LOCUS_19650 12375 11857 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058171.1 protein_id gnl|my_center|LOCUS_19650 12474 13100 gene locus_tag LOCUS_19660 12474 13100 CDS product DUF3038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799761.1 protein_id gnl|my_center|LOCUS_19660 13103 13756 gene locus_tag LOCUS_19670 13103 13756 CDS product DUF4335 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056686.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence097 153 596 gene locus_tag LOCUS_19680 153 596 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141597.1 protein_id gnl|my_center|LOCUS_19680 986 765 gene locus_tag LOCUS_19690 986 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 1475 1023 gene locus_tag LOCUS_19700 1475 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 1773 1459 gene locus_tag LOCUS_19710 1773 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 2790 1792 gene locus_tag LOCUS_19720 2790 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480572.1 protein_id gnl|my_center|LOCUS_19720 4107 3325 gene locus_tag LOCUS_19730 4107 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 5384 4170 gene locus_tag LOCUS_19740 5384 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 5636 5881 gene locus_tag LOCUS_19750 gene psaC 5636 5881 CDS product photosystem I iron-sulfur center protein PsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125916.1 protein_id gnl|my_center|LOCUS_19750 6899 6189 gene locus_tag LOCUS_19760 6899 6189 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928653.1 protein_id gnl|my_center|LOCUS_19760 6975 7703 gene locus_tag LOCUS_19770 6975 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 8476 7706 gene locus_tag LOCUS_19780 8476 7706 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194094.1 protein_id gnl|my_center|LOCUS_19780 8938 10047 gene locus_tag LOCUS_19790 gene thrC 8938 10047 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406172.1 protein_id gnl|my_center|LOCUS_19790 10707 10078 gene locus_tag LOCUS_19800 gene hisB 10707 10078 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055988.1 protein_id gnl|my_center|LOCUS_19800 12533 11019 gene locus_tag LOCUS_19810 12533 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 13383 12700 gene locus_tag LOCUS_19820 13383 12700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence098 2798 687 gene locus_tag LOCUS_19830 2798 687 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056358.1 protein_id gnl|my_center|LOCUS_19830 4734 2971 gene locus_tag LOCUS_19840 4734 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 4850 5131 gene locus_tag LOCUS_19850 4850 5131 CDS product sulfiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056018.1 protein_id gnl|my_center|LOCUS_19850 5145 5837 gene locus_tag LOCUS_19860 5145 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 6271 6507 gene locus_tag LOCUS_19870 6271 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 7974 6985 gene locus_tag LOCUS_19880 7974 6985 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 protein_id gnl|my_center|LOCUS_19880 8084 9463 gene locus_tag LOCUS_19890 8084 9463 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899946.1 protein_id gnl|my_center|LOCUS_19890 12069 9544 gene locus_tag LOCUS_19900 12069 9544 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143331.1 protein_id gnl|my_center|LOCUS_19900 12629 12704 gene locus_tag LOCUS_t00130 12629 12704 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13603 13055 gene locus_tag LOCUS_19910 13603 13055 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920976.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence099 525 647 gene locus_tag LOCUS_19920 525 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 634 1650 gene locus_tag LOCUS_19930 634 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 1711 1929 gene locus_tag LOCUS_19940 1711 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 1926 2135 gene locus_tag LOCUS_19950 1926 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2364 2702 gene locus_tag LOCUS_19960 2364 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 4683 2872 gene locus_tag LOCUS_19970 4683 2872 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056620.1 protein_id gnl|my_center|LOCUS_19970 5152 5427 gene locus_tag LOCUS_19980 5152 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 5561 5791 gene locus_tag LOCUS_19990 5561 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 7570 6347 gene locus_tag LOCUS_20000 7570 6347 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888753.1 protein_id gnl|my_center|LOCUS_20000 7485 7709 gene locus_tag LOCUS_20010 7485 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 7842 8147 gene locus_tag LOCUS_20020 7842 8147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144163.1 protein_id gnl|my_center|LOCUS_20020 8238 9926 gene locus_tag LOCUS_20030 8238 9926 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088894694.1 protein_id gnl|my_center|LOCUS_20030 9971 10693 gene locus_tag LOCUS_20040 9971 10693 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_20040 12265 10892 gene locus_tag LOCUS_20050 12265 10892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 13419 12313 gene locus_tag LOCUS_20060 13419 12313 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence100 261 446 gene locus_tag LOCUS_20070 261 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 820 1554 gene locus_tag LOCUS_20080 820 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 2439 1597 gene locus_tag LOCUS_20090 2439 1597 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921210.1 protein_id gnl|my_center|LOCUS_20090 2567 2482 gene locus_tag LOCUS_t00140 2567 2482 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2746 4071 gene locus_tag LOCUS_20100 gene murA 2746 4071 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056623.1 protein_id gnl|my_center|LOCUS_20100 5070 4234 gene locus_tag LOCUS_20110 5070 4234 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920966.1 protein_id gnl|my_center|LOCUS_20110 6483 5080 gene locus_tag LOCUS_20120 6483 5080 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929421.1 protein_id gnl|my_center|LOCUS_20120 7327 6488 gene locus_tag LOCUS_20130 gene ntrB 7327 6488 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705090.1 protein_id gnl|my_center|LOCUS_20130 7757 7563 gene locus_tag LOCUS_20140 7757 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 8353 7751 gene locus_tag LOCUS_20150 8353 7751 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_20150 9082 10557 gene locus_tag LOCUS_20160 9082 10557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 11148 10738 gene locus_tag LOCUS_20170 11148 10738 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_20170 11450 11145 gene locus_tag LOCUS_20180 11450 11145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 12619 11687 gene locus_tag LOCUS_20190 12619 11687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_20190 13032 13673 gene locus_tag LOCUS_20200 13032 13673 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007353051.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence101 486 94 gene locus_tag LOCUS_20210 486 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 1130 2251 gene locus_tag LOCUS_20220 gene pstS 1130 2251 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530168.1 protein_id gnl|my_center|LOCUS_20220 2346 3305 gene locus_tag LOCUS_20230 gene pstC 2346 3305 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124751.1 protein_id gnl|my_center|LOCUS_20230 3613 4506 gene locus_tag LOCUS_20240 gene pstA 3613 4506 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140450.1 protein_id gnl|my_center|LOCUS_20240 4606 5409 gene locus_tag LOCUS_20250 gene pstB 4606 5409 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124749.1 protein_id gnl|my_center|LOCUS_20250 5556 6353 gene locus_tag LOCUS_20260 gene pstB 5556 6353 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124749.1 protein_id gnl|my_center|LOCUS_20260 6553 6819 gene locus_tag LOCUS_20270 6553 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 7463 8476 gene locus_tag LOCUS_20280 gene pstS 7463 8476 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140448.1 protein_id gnl|my_center|LOCUS_20280 8652 9626 gene locus_tag LOCUS_20290 gene pstC 8652 9626 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140449.1 protein_id gnl|my_center|LOCUS_20290 9630 10514 gene locus_tag LOCUS_20300 gene pstA 9630 10514 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140450.1 protein_id gnl|my_center|LOCUS_20300 10526 11335 gene locus_tag LOCUS_20310 gene pstB 10526 11335 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140451.1 protein_id gnl|my_center|LOCUS_20310 11536 12300 gene locus_tag LOCUS_20320 gene map 11536 12300 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142406.1 protein_id gnl|my_center|LOCUS_20320 12483 13664 gene locus_tag LOCUS_20330 12483 13664 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920725.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence102 1935 835 gene locus_tag LOCUS_20340 1935 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2495 4102 gene locus_tag LOCUS_20350 2495 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 6447 4603 gene locus_tag LOCUS_20360 6447 4603 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530091.1 protein_id gnl|my_center|LOCUS_20360 8432 6531 gene locus_tag LOCUS_20370 gene arsA 8432 6531 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461627.1 protein_id gnl|my_center|LOCUS_20370 9056 8445 gene locus_tag LOCUS_20380 9056 8445 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928988.1 protein_id gnl|my_center|LOCUS_20380 9269 9553 gene locus_tag LOCUS_20390 9269 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 9971 9708 gene locus_tag LOCUS_20400 9971 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 10720 9986 gene locus_tag LOCUS_20410 10720 9986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 11209 10736 gene locus_tag LOCUS_20420 11209 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 11767 11495 gene locus_tag LOCUS_20430 11767 11495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 12182 11760 gene locus_tag LOCUS_20440 12182 11760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 13241 12201 gene locus_tag LOCUS_20450 13241 12201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 >Feature sequence103 297 1436 gene locus_tag LOCUS_20460 297 1436 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_20460 1474 2379 gene locus_tag LOCUS_20470 gene crtB 1474 2379 CDS product cyanoexosortase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214431335.1 protein_id gnl|my_center|LOCUS_20470 2372 3118 gene locus_tag LOCUS_20480 2372 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 3239 4456 gene locus_tag LOCUS_20490 3239 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 4584 6806 gene locus_tag LOCUS_20500 4584 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 8261 6813 gene locus_tag LOCUS_20510 8261 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073592997.1 protein_id gnl|my_center|LOCUS_20510 8828 9583 gene locus_tag LOCUS_20520 8828 9583 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390736.1 protein_id gnl|my_center|LOCUS_20520 11350 10163 gene locus_tag LOCUS_20530 11350 10163 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057679.1 protein_id gnl|my_center|LOCUS_20530 11844 11425 gene locus_tag LOCUS_20540 gene panD 11844 11425 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225586.1 protein_id gnl|my_center|LOCUS_20540 11843 12709 gene locus_tag LOCUS_20550 11843 12709 CDS product DUF3598 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141575.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence104 563 946 gene locus_tag LOCUS_20560 563 946 CDS product DUF4346 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056206.1 protein_id gnl|my_center|LOCUS_20560 2155 1325 gene locus_tag LOCUS_20570 2155 1325 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_20570 2415 2924 gene locus_tag LOCUS_20580 2415 2924 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125313.1 protein_id gnl|my_center|LOCUS_20580 2921 4048 gene locus_tag LOCUS_20590 2921 4048 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057098.1 protein_id gnl|my_center|LOCUS_20590 4324 5100 gene locus_tag LOCUS_20600 4324 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 6530 5193 gene locus_tag LOCUS_20610 6530 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 7948 7010 gene locus_tag LOCUS_20620 7948 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 8031 8165 gene locus_tag LOCUS_20630 8031 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 8483 10411 gene locus_tag LOCUS_20640 8483 10411 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057496.1 protein_id gnl|my_center|LOCUS_20640 10574 11779 gene locus_tag LOCUS_20650 10574 11779 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056559.1 protein_id gnl|my_center|LOCUS_20650 12009 12425 gene locus_tag LOCUS_20660 12009 12425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 12413 12754 gene locus_tag LOCUS_20670 12413 12754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 12839 13225 gene locus_tag LOCUS_20680 12839 13225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142930.1 protein_id gnl|my_center|LOCUS_20680 13222 13371 gene locus_tag LOCUS_20690 13222 13371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence105 803 189 gene locus_tag LOCUS_20700 803 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056873.1 protein_id gnl|my_center|LOCUS_20700 1549 959 gene locus_tag LOCUS_20710 1549 959 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140532.1 protein_id gnl|my_center|LOCUS_20710 2303 1560 gene locus_tag LOCUS_20720 2303 1560 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056184.1 protein_id gnl|my_center|LOCUS_20720 2988 3374 gene locus_tag LOCUS_20730 2988 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 4723 5514 gene locus_tag LOCUS_20740 4723 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 5531 5974 gene locus_tag LOCUS_20750 5531 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 5974 6780 gene locus_tag LOCUS_20760 5974 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 6828 7016 gene locus_tag LOCUS_20770 6828 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 7098 7466 gene locus_tag LOCUS_20780 7098 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 9894 7453 gene locus_tag LOCUS_20790 9894 7453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 10803 10594 gene locus_tag LOCUS_20800 10803 10594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 10982 10800 gene locus_tag LOCUS_20810 10982 10800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 11230 10979 gene locus_tag LOCUS_20820 11230 10979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 11535 11774 gene locus_tag LOCUS_20830 11535 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 12495 12247 gene locus_tag LOCUS_20840 12495 12247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 12633 13232 gene locus_tag LOCUS_20850 12633 13232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence106 544 846 gene locus_tag LOCUS_20860 544 846 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 protein_id gnl|my_center|LOCUS_20860 990 1074 gene locus_tag LOCUS_t00150 990 1074 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1083 1154 gene locus_tag LOCUS_t00160 1083 1154 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1299 4307 gene locus_tag LOCUS_20870 1299 4307 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056145.1 protein_id gnl|my_center|LOCUS_20870 4435 4304 gene locus_tag LOCUS_20880 4435 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 4604 5452 gene locus_tag LOCUS_20890 4604 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 5673 6035 gene locus_tag LOCUS_20900 gene rplS 5673 6035 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057143.1 protein_id gnl|my_center|LOCUS_20900 6137 6209 gene locus_tag LOCUS_t00170 6137 6209 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 6334 6570 gene locus_tag LOCUS_20910 gene secE 6334 6570 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056148.1 protein_id gnl|my_center|LOCUS_20910 6567 7184 gene locus_tag LOCUS_20920 gene nusG 6567 7184 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056149.1 protein_id gnl|my_center|LOCUS_20920 7188 7613 gene locus_tag LOCUS_20930 gene rplK 7188 7613 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056150.1 protein_id gnl|my_center|LOCUS_20930 7669 8382 gene locus_tag LOCUS_20940 gene rplA 7669 8382 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056151.1 protein_id gnl|my_center|LOCUS_20940 8778 8455 gene locus_tag LOCUS_20950 8778 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 9028 8744 gene locus_tag LOCUS_20960 9028 8744 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_20960 9589 10512 gene locus_tag LOCUS_20970 9589 10512 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012163110.1 protein_id gnl|my_center|LOCUS_20970 10781 10509 gene locus_tag LOCUS_20980 10781 10509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 11204 10821 gene locus_tag LOCUS_20990 11204 10821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 11921 12844 gene locus_tag LOCUS_21000 11921 12844 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057395.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence107 1110 310 gene locus_tag LOCUS_21010 1110 310 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839609.1 protein_id gnl|my_center|LOCUS_21010 1756 1130 gene locus_tag LOCUS_21020 1756 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 2408 1773 gene locus_tag LOCUS_21030 gene trmB 2408 1773 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057818.1 protein_id gnl|my_center|LOCUS_21030 2475 3611 gene locus_tag LOCUS_21040 2475 3611 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057388.1 protein_id gnl|my_center|LOCUS_21040 3644 4174 gene locus_tag LOCUS_21050 3644 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 5269 4718 gene locus_tag LOCUS_21060 5269 4718 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201440.1 protein_id gnl|my_center|LOCUS_21060 5400 5474 gene locus_tag LOCUS_t00180 5400 5474 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7740 5515 gene locus_tag LOCUS_21070 7740 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 8815 7751 gene locus_tag LOCUS_21080 8815 7751 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546142.1 protein_id gnl|my_center|LOCUS_21080 9563 8874 gene locus_tag LOCUS_21090 9563 8874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 10863 9589 gene locus_tag LOCUS_21100 10863 9589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 12124 11057 gene locus_tag LOCUS_21110 12124 11057 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_21110 12974 12195 gene locus_tag LOCUS_21120 12974 12195 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142987.1 protein_id gnl|my_center|LOCUS_21120 >Feature sequence108 321 1460 gene locus_tag LOCUS_21130 321 1460 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056246.1 protein_id gnl|my_center|LOCUS_21130 1575 2054 gene locus_tag LOCUS_21140 gene fabZ 1575 2054 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057628.1 protein_id gnl|my_center|LOCUS_21140 2058 2825 gene locus_tag LOCUS_21150 2058 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 3286 2822 gene locus_tag LOCUS_21160 3286 2822 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143783.1 protein_id gnl|my_center|LOCUS_21160 4173 3355 gene locus_tag LOCUS_21170 4173 3355 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_21170 5046 4252 gene locus_tag LOCUS_21180 5046 4252 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058253.1 protein_id gnl|my_center|LOCUS_21180 5523 6581 gene locus_tag LOCUS_21190 gene nagA 5523 6581 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057928.1 protein_id gnl|my_center|LOCUS_21190 6980 6537 gene locus_tag LOCUS_21200 6980 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 8252 7239 gene locus_tag LOCUS_21210 8252 7239 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_21210 8798 8481 gene locus_tag LOCUS_21220 8798 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056366.1 protein_id gnl|my_center|LOCUS_21220 9505 8945 gene locus_tag LOCUS_21230 9505 8945 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524131.1 protein_id gnl|my_center|LOCUS_21230 9538 9855 gene locus_tag LOCUS_21240 gene grxC 9538 9855 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056751.1 protein_id gnl|my_center|LOCUS_21240 9840 10328 gene locus_tag LOCUS_21250 9840 10328 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141055.1 protein_id gnl|my_center|LOCUS_21250 10416 10598 gene locus_tag LOCUS_21260 10416 10598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 10830 11132 gene locus_tag LOCUS_21270 10830 11132 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958263.1 protein_id gnl|my_center|LOCUS_21270 >Feature sequence109 180 1466 gene locus_tag LOCUS_21280 180 1466 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057575.1 protein_id gnl|my_center|LOCUS_21280 1797 2984 gene locus_tag LOCUS_21290 1797 2984 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_21290 3003 3677 gene locus_tag LOCUS_21300 3003 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 4111 5166 gene locus_tag LOCUS_21310 4111 5166 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140060.1 protein_id gnl|my_center|LOCUS_21310 5182 6069 gene locus_tag LOCUS_21320 5182 6069 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267092.1 protein_id gnl|my_center|LOCUS_21320 6082 6423 gene locus_tag LOCUS_21330 6082 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 6549 7631 gene locus_tag LOCUS_21340 gene gmd 6549 7631 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_21340 7644 8582 gene locus_tag LOCUS_21350 7644 8582 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056480.1 protein_id gnl|my_center|LOCUS_21350 9314 8637 gene locus_tag LOCUS_21360 9314 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 10261 11478 gene locus_tag LOCUS_21370 10261 11478 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057832.1 protein_id gnl|my_center|LOCUS_21370 11539 12723 gene locus_tag LOCUS_21380 11539 12723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence110 1837 650 gene locus_tag LOCUS_21390 1837 650 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_21390 2348 2058 gene locus_tag LOCUS_21400 2348 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 2369 2857 gene locus_tag LOCUS_21410 2369 2857 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140769.1 protein_id gnl|my_center|LOCUS_21410 2857 3705 gene locus_tag LOCUS_21420 2857 3705 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140768.1 protein_id gnl|my_center|LOCUS_21420 3708 4175 gene locus_tag LOCUS_21430 gene bcp 3708 4175 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233532.1 protein_id gnl|my_center|LOCUS_21430 4332 5129 gene locus_tag LOCUS_21440 gene rpsB 4332 5129 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057525.1 protein_id gnl|my_center|LOCUS_21440 5246 6001 gene locus_tag LOCUS_21450 gene tsf 5246 6001 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124978.1 protein_id gnl|my_center|LOCUS_21450 6491 6805 gene locus_tag LOCUS_21460 6491 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 6908 7963 gene locus_tag LOCUS_21470 6908 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 8041 9936 gene locus_tag LOCUS_21480 8041 9936 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612386.1 protein_id gnl|my_center|LOCUS_21480 9936 11072 gene locus_tag LOCUS_21490 9936 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 11125 12384 gene locus_tag LOCUS_21500 11125 12384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence111 492 1604 gene locus_tag LOCUS_21510 492 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 1654 2259 gene locus_tag LOCUS_21520 1654 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 3486 2281 gene locus_tag LOCUS_21530 3486 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 4445 3516 gene locus_tag LOCUS_21540 4445 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 5175 4552 gene locus_tag LOCUS_21550 5175 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 6424 5336 gene locus_tag LOCUS_21560 gene aksF 6424 5336 CDS product homoisocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875823.1 protein_id gnl|my_center|LOCUS_21560 6862 6626 gene locus_tag LOCUS_21570 6862 6626 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798862.1 protein_id gnl|my_center|LOCUS_21570 7583 6936 gene locus_tag LOCUS_21580 7583 6936 CDS product DUF3386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056760.1 protein_id gnl|my_center|LOCUS_21580 7772 8008 gene locus_tag LOCUS_21590 7772 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 8001 8243 gene locus_tag LOCUS_21600 8001 8243 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755925.1 protein_id gnl|my_center|LOCUS_21600 8324 8992 gene locus_tag LOCUS_21610 8324 8992 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_21610 9703 9368 gene locus_tag LOCUS_21620 9703 9368 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 protein_id gnl|my_center|LOCUS_21620 9993 9700 gene locus_tag LOCUS_21630 9993 9700 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143513.1 protein_id gnl|my_center|LOCUS_21630 10314 12092 gene locus_tag LOCUS_21640 10314 12092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 >Feature sequence112 805 116 gene locus_tag LOCUS_21650 805 116 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056267.1 protein_id gnl|my_center|LOCUS_21650 2213 879 gene locus_tag LOCUS_21660 2213 879 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799062.1 protein_id gnl|my_center|LOCUS_21660 3371 2223 gene locus_tag LOCUS_21670 3371 2223 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056182.1 protein_id gnl|my_center|LOCUS_21670 3733 4533 gene locus_tag LOCUS_21680 3733 4533 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057950.1 protein_id gnl|my_center|LOCUS_21680 4561 5742 gene locus_tag LOCUS_21690 4561 5742 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920982.1 protein_id gnl|my_center|LOCUS_21690 6012 5746 gene locus_tag LOCUS_21700 6012 5746 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056266.1 protein_id gnl|my_center|LOCUS_21700 6021 6260 gene locus_tag LOCUS_21710 6021 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 6444 7169 gene locus_tag LOCUS_21720 6444 7169 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929453.1 protein_id gnl|my_center|LOCUS_21720 7341 9059 gene locus_tag LOCUS_21730 7341 9059 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057497.1 protein_id gnl|my_center|LOCUS_21730 9096 9473 gene locus_tag LOCUS_21740 9096 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057498.1 protein_id gnl|my_center|LOCUS_21740 9603 10940 gene locus_tag LOCUS_21750 9603 10940 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920668.1 protein_id gnl|my_center|LOCUS_21750 11047 12012 gene locus_tag LOCUS_21760 11047 12012 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence113 804 97 gene locus_tag LOCUS_21770 804 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 1779 1150 gene locus_tag LOCUS_21780 1779 1150 CDS product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140730.1 protein_id gnl|my_center|LOCUS_21780 2199 1783 gene locus_tag LOCUS_21790 2199 1783 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056339.1 protein_id gnl|my_center|LOCUS_21790 2725 2207 gene locus_tag LOCUS_21800 2725 2207 CDS product cofactor assembly of complex C subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143752.1 protein_id gnl|my_center|LOCUS_21800 2860 3765 gene locus_tag LOCUS_21810 2860 3765 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929260.1 protein_id gnl|my_center|LOCUS_21810 4094 4732 gene locus_tag LOCUS_21820 4094 4732 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920671.1 protein_id gnl|my_center|LOCUS_21820 4751 5320 gene locus_tag LOCUS_21830 4751 5320 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920634.1 protein_id gnl|my_center|LOCUS_21830 5671 5321 gene locus_tag LOCUS_21840 5671 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055984.1 protein_id gnl|my_center|LOCUS_21840 7141 6179 gene locus_tag LOCUS_21850 gene csaB 7141 6179 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057733.1 protein_id gnl|my_center|LOCUS_21850 8563 7484 gene locus_tag LOCUS_21860 8563 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142156.1 protein_id gnl|my_center|LOCUS_21860 8777 9577 gene locus_tag LOCUS_21870 8777 9577 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048869675.1 protein_id gnl|my_center|LOCUS_21870 9727 10029 gene locus_tag LOCUS_21880 9727 10029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 10267 10695 gene locus_tag LOCUS_21890 10267 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 10733 11743 gene locus_tag LOCUS_21900 10733 11743 CDS product adenine-specific methyltransferase EcoRI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874555.1 protein_id gnl|my_center|LOCUS_21900 12037 12318 gene locus_tag LOCUS_21910 12037 12318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence114 1248 319 gene locus_tag LOCUS_21920 1248 319 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 protein_id gnl|my_center|LOCUS_21920 1699 1241 gene locus_tag LOCUS_21930 1699 1241 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_21930 2167 1712 gene locus_tag LOCUS_21940 2167 1712 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_21940 2634 2179 gene locus_tag LOCUS_21950 2634 2179 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_21950 3102 2665 gene locus_tag LOCUS_21960 3102 2665 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_21960 4848 3322 gene locus_tag LOCUS_21970 gene radA 4848 3322 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142401.1 protein_id gnl|my_center|LOCUS_21970 4914 5066 gene locus_tag LOCUS_21980 4914 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 5082 5810 gene locus_tag LOCUS_21990 5082 5810 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929702.1 protein_id gnl|my_center|LOCUS_21990 5820 6461 gene locus_tag LOCUS_22000 5820 6461 CDS product cofactor assembly of complex C subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056532.1 protein_id gnl|my_center|LOCUS_22000 9479 6828 gene locus_tag LOCUS_22010 9479 6828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 12144 9511 gene locus_tag LOCUS_22020 gene cphA 12144 9511 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058004.1 protein_id gnl|my_center|LOCUS_22020 >Feature sequence115 891 139 gene locus_tag LOCUS_22030 891 139 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294685.1 protein_id gnl|my_center|LOCUS_22030 2928 952 gene locus_tag LOCUS_22040 2928 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 3077 3703 gene locus_tag LOCUS_22050 3077 3703 CDS product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142018.1 protein_id gnl|my_center|LOCUS_22050 5031 3985 gene locus_tag LOCUS_22060 5031 3985 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142088.1 protein_id gnl|my_center|LOCUS_22060 7037 5031 gene locus_tag LOCUS_22070 7037 5031 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057192.1 protein_id gnl|my_center|LOCUS_22070 8005 7178 gene locus_tag LOCUS_22080 gene ntrB 8005 7178 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142085.1 protein_id gnl|my_center|LOCUS_22080 9531 8209 gene locus_tag LOCUS_22090 9531 8209 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057190.1 protein_id gnl|my_center|LOCUS_22090 10659 11825 gene locus_tag LOCUS_22100 10659 11825 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056757.1 protein_id gnl|my_center|LOCUS_22100 12024 11827 gene locus_tag LOCUS_22110 12024 11827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 >Feature sequence116 144 392 gene locus_tag LOCUS_22120 144 392 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512153.1 protein_id gnl|my_center|LOCUS_22120 942 409 gene locus_tag LOCUS_22130 gene pyrR 942 409 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921232.1 protein_id gnl|my_center|LOCUS_22130 1064 2449 gene locus_tag LOCUS_22140 1064 2449 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528760.1 protein_id gnl|my_center|LOCUS_22140 3277 2441 gene locus_tag LOCUS_22150 3277 2441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166908820.1 protein_id gnl|my_center|LOCUS_22150 4076 3279 gene locus_tag LOCUS_22160 gene cbiQ 4076 3279 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058272.1 protein_id gnl|my_center|LOCUS_22160 4357 4082 gene locus_tag LOCUS_22170 4357 4082 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986836.1 protein_id gnl|my_center|LOCUS_22170 5065 4406 gene locus_tag LOCUS_22180 5065 4406 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235551391.1 protein_id gnl|my_center|LOCUS_22180 7407 5563 gene locus_tag LOCUS_22190 7407 5563 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920781.1 protein_id gnl|my_center|LOCUS_22190 9195 7945 gene locus_tag LOCUS_22200 gene metK 9195 7945 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056822.1 protein_id gnl|my_center|LOCUS_22200 9521 11842 gene locus_tag LOCUS_22210 gene pcrA 9521 11842 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058290.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence117 572 249 gene locus_tag LOCUS_22220 572 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 948 562 gene locus_tag LOCUS_22230 948 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 3864 1012 gene locus_tag LOCUS_22240 3864 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 4952 3864 gene locus_tag LOCUS_22250 4952 3864 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030141.1 protein_id gnl|my_center|LOCUS_22250 6561 4954 gene locus_tag LOCUS_22260 6561 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 7721 6564 gene locus_tag LOCUS_22270 7721 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 8928 7714 gene locus_tag LOCUS_22280 8928 7714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 9161 8925 gene locus_tag LOCUS_22290 9161 8925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 9690 9457 gene locus_tag LOCUS_22300 9690 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 10124 9687 gene locus_tag LOCUS_22310 10124 9687 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928694.1 protein_id gnl|my_center|LOCUS_22310 10886 10332 gene locus_tag LOCUS_22320 10886 10332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 11337 11068 gene locus_tag LOCUS_22330 11337 11068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 11528 11334 gene locus_tag LOCUS_22340 11528 11334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 11692 12030 gene locus_tag LOCUS_22350 11692 12030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence118 207 584 gene locus_tag LOCUS_22360 207 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057860.1 protein_id gnl|my_center|LOCUS_22360 620 1696 gene locus_tag LOCUS_22370 620 1696 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057861.1 protein_id gnl|my_center|LOCUS_22370 1737 3551 gene locus_tag LOCUS_22380 1737 3551 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056407.1 protein_id gnl|my_center|LOCUS_22380 3726 5165 gene locus_tag LOCUS_22390 3726 5165 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393748.1 protein_id gnl|my_center|LOCUS_22390 6560 5157 gene locus_tag LOCUS_22400 6560 5157 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058264.1 protein_id gnl|my_center|LOCUS_22400 6931 7461 gene locus_tag LOCUS_22410 6931 7461 CDS product DUF4242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171919.1 protein_id gnl|my_center|LOCUS_22410 7471 8589 gene locus_tag LOCUS_22420 7471 8589 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117847.1 protein_id gnl|my_center|LOCUS_22420 8586 9368 gene locus_tag LOCUS_22430 8586 9368 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115101.1 protein_id gnl|my_center|LOCUS_22430 9373 10581 gene locus_tag LOCUS_22440 9373 10581 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107732.1 protein_id gnl|my_center|LOCUS_22440 10594 11364 gene locus_tag LOCUS_22450 10594 11364 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107734.1 protein_id gnl|my_center|LOCUS_22450 11772 11419 gene locus_tag LOCUS_22460 11772 11419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 >Feature sequence119 1032 349 gene locus_tag LOCUS_22470 1032 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2382 1033 gene locus_tag LOCUS_22480 2382 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 3549 2608 gene locus_tag LOCUS_22490 3549 2608 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058107.1 protein_id gnl|my_center|LOCUS_22490 3660 4322 gene locus_tag LOCUS_22500 3660 4322 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142845.1 protein_id gnl|my_center|LOCUS_22500 4383 5516 gene locus_tag LOCUS_22510 4383 5516 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 protein_id gnl|my_center|LOCUS_22510 5572 5865 gene locus_tag LOCUS_22520 gene clpS 5572 5865 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056930.1 protein_id gnl|my_center|LOCUS_22520 5868 6152 gene locus_tag LOCUS_22530 5868 6152 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920842.1 protein_id gnl|my_center|LOCUS_22530 6242 8104 gene locus_tag LOCUS_22540 6242 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 8974 9366 gene locus_tag LOCUS_22550 gene ruvX 8974 9366 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920731.1 protein_id gnl|my_center|LOCUS_22550 9406 10560 gene locus_tag LOCUS_22560 gene gshA 9406 10560 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056177.1 protein_id gnl|my_center|LOCUS_22560 10852 10565 gene locus_tag LOCUS_22570 10852 10565 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920900.1 protein_id gnl|my_center|LOCUS_22570 11367 11098 gene locus_tag LOCUS_22580 11367 11098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 11573 11367 gene locus_tag LOCUS_22590 11573 11367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 >Feature sequence120 898 542 gene locus_tag LOCUS_22600 898 542 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986038.1 protein_id gnl|my_center|LOCUS_22600 1548 1243 gene locus_tag LOCUS_22610 1548 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 1832 2185 gene locus_tag LOCUS_22620 1832 2185 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_22620 2786 3532 gene locus_tag LOCUS_22630 2786 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140907.1 protein_id gnl|my_center|LOCUS_22630 3787 4845 gene locus_tag LOCUS_22640 3787 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 5036 5962 gene locus_tag LOCUS_22650 5036 5962 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057378.1 protein_id gnl|my_center|LOCUS_22650 6960 5959 gene locus_tag LOCUS_22660 6960 5959 CDS product saccharopine dehydrogenase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928537.1 protein_id gnl|my_center|LOCUS_22660 7271 7486 gene locus_tag LOCUS_22670 7271 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 7531 7917 gene locus_tag LOCUS_22680 7531 7917 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057973.1 protein_id gnl|my_center|LOCUS_22680 7917 8324 gene locus_tag LOCUS_22690 7917 8324 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142874.1 protein_id gnl|my_center|LOCUS_22690 8569 8871 gene locus_tag LOCUS_22700 8569 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 8872 9261 gene locus_tag LOCUS_22710 8872 9261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 9456 9725 gene locus_tag LOCUS_22720 9456 9725 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_22720 9726 9968 gene locus_tag LOCUS_22730 9726 9968 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809228.1 protein_id gnl|my_center|LOCUS_22730 10381 11535 gene locus_tag LOCUS_22740 10381 11535 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_22740 >Feature sequence121 809 594 gene locus_tag LOCUS_22750 809 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22750 2873 1416 gene locus_tag LOCUS_22760 2873 1416 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140837.1 protein_id gnl|my_center|LOCUS_22760 5240 2928 gene locus_tag LOCUS_22770 5240 2928 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_22770 7925 6939 gene locus_tag LOCUS_22780 gene nadA 7925 6939 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_22780 8216 8977 gene locus_tag LOCUS_22790 gene tatC 8216 8977 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141910.1 protein_id gnl|my_center|LOCUS_22790 9044 9367 gene locus_tag LOCUS_22800 9044 9367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055877.1 protein_id gnl|my_center|LOCUS_22800 9967 11493 gene locus_tag LOCUS_22810 gene psbB 9967 11493 CDS product photosystem II chlorophyll-binding protein CP47 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057370.1 protein_id gnl|my_center|LOCUS_22810 >Feature sequence122 1189 179 gene locus_tag LOCUS_22820 gene prfB 1189 179 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126988096.1 protein_id gnl|my_center|LOCUS_22820 2678 1566 gene locus_tag LOCUS_22830 2678 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 2840 4189 gene locus_tag LOCUS_22840 gene murD 2840 4189 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055928.1 protein_id gnl|my_center|LOCUS_22840 4384 7035 gene locus_tag LOCUS_22850 4384 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 7226 7441 gene locus_tag LOCUS_22860 gene ndhO 7226 7441 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055872.1 protein_id gnl|my_center|LOCUS_22860 7468 8445 gene locus_tag LOCUS_22870 gene mdh 7468 8445 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142537.1 protein_id gnl|my_center|LOCUS_22870 9573 8446 gene locus_tag LOCUS_22880 9573 8446 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 protein_id gnl|my_center|LOCUS_22880 10363 10013 gene locus_tag LOCUS_22890 10363 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 10929 10759 gene locus_tag LOCUS_22900 10929 10759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 10868 11527 gene locus_tag LOCUS_22910 10868 11527 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056123.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence123 1053 352 gene locus_tag LOCUS_22920 1053 352 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141595.1 protein_id gnl|my_center|LOCUS_22920 2611 1268 gene locus_tag LOCUS_22930 gene pyk 2611 1268 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143313.1 protein_id gnl|my_center|LOCUS_22930 2833 2985 gene locus_tag LOCUS_22940 2833 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 3206 2994 gene locus_tag LOCUS_22950 3206 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 4603 3323 gene locus_tag LOCUS_22960 4603 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 5195 5887 gene locus_tag LOCUS_22970 gene bchM 5195 5887 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056304.1 protein_id gnl|my_center|LOCUS_22970 5891 6658 gene locus_tag LOCUS_22980 gene panB 5891 6658 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928599.1 protein_id gnl|my_center|LOCUS_22980 6651 7133 gene locus_tag LOCUS_22990 gene msrA 6651 7133 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 protein_id gnl|my_center|LOCUS_22990 7197 7505 gene locus_tag LOCUS_23000 7197 7505 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142093.1 protein_id gnl|my_center|LOCUS_23000 7610 7957 gene locus_tag LOCUS_23010 7610 7957 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_23010 8432 8025 gene locus_tag LOCUS_23020 8432 8025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 10028 8511 gene locus_tag LOCUS_23030 gene cobA 10028 8511 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920993.1 protein_id gnl|my_center|LOCUS_23030 11017 10106 gene locus_tag LOCUS_23040 11017 10106 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057942.1 protein_id gnl|my_center|LOCUS_23040 11656 11066 gene locus_tag LOCUS_23050 gene cbiT 11656 11066 CDS product precorrin-6Y C5,15-methyltransferase subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057353.1 protein_id gnl|my_center|LOCUS_23050 >Feature sequence124 233 1102 gene locus_tag LOCUS_23060 233 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2437 1127 gene locus_tag LOCUS_23070 2437 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 3320 2442 gene locus_tag LOCUS_23080 3320 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 4935 3598 gene locus_tag LOCUS_23090 4935 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 6227 4965 gene locus_tag LOCUS_23100 6227 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 7226 6234 gene locus_tag LOCUS_23110 7226 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 8082 7270 gene locus_tag LOCUS_23120 8082 7270 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333455.1 protein_id gnl|my_center|LOCUS_23120 9698 8109 gene locus_tag LOCUS_23130 9698 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 10501 9731 gene locus_tag LOCUS_23140 10501 9731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 10887 10600 gene locus_tag LOCUS_23150 10887 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 11313 10972 gene locus_tag LOCUS_23160 11313 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence125 253 501 gene locus_tag LOCUS_23170 253 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 677 889 gene locus_tag LOCUS_23180 677 889 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813809.1 protein_id gnl|my_center|LOCUS_23180 1044 1265 gene locus_tag LOCUS_23190 1044 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 1267 1479 gene locus_tag LOCUS_23200 1267 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 3150 2542 gene locus_tag LOCUS_23210 gene rpsD 3150 2542 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056002.1 protein_id gnl|my_center|LOCUS_23210 3429 3929 gene locus_tag LOCUS_23220 3429 3929 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920972.1 protein_id gnl|my_center|LOCUS_23220 4312 5379 gene locus_tag LOCUS_23230 4312 5379 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143741.1 protein_id gnl|my_center|LOCUS_23230 5512 6591 gene locus_tag LOCUS_23240 gene fba 5512 6591 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056231.1 protein_id gnl|my_center|LOCUS_23240 6782 8020 gene locus_tag LOCUS_23250 6782 8020 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057446.1 protein_id gnl|my_center|LOCUS_23250 8488 9792 gene locus_tag LOCUS_23260 8488 9792 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_23260 <11722 10112 gene locus_tag LOCUS_23270 <11722 10112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015613294.1:N-6 DNA methylase >Feature sequence126 1611 772 gene locus_tag LOCUS_23280 1611 772 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920966.1 protein_id gnl|my_center|LOCUS_23280 3747 1729 gene locus_tag LOCUS_23290 3747 1729 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057837.1 protein_id gnl|my_center|LOCUS_23290 4647 3817 gene locus_tag LOCUS_23300 gene ntrB 4647 3817 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920965.1 protein_id gnl|my_center|LOCUS_23300 6118 4760 gene locus_tag LOCUS_23310 6118 4760 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057835.1 protein_id gnl|my_center|LOCUS_23310 6750 7661 gene locus_tag LOCUS_23320 6750 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 8282 7884 gene locus_tag LOCUS_23330 8282 7884 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140846.1 protein_id gnl|my_center|LOCUS_23330 8518 8282 gene locus_tag LOCUS_23340 8518 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 8880 8689 gene locus_tag LOCUS_23350 8880 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 10685 9483 gene locus_tag LOCUS_23360 10685 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 11468 11013 gene locus_tag LOCUS_23370 11468 11013 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057290.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence127 1879 542 gene locus_tag LOCUS_23380 1879 542 CDS product DUF4335 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057325.1 protein_id gnl|my_center|LOCUS_23380 2594 2043 gene locus_tag LOCUS_23390 2594 2043 CDS product DUF3038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057324.1 protein_id gnl|my_center|LOCUS_23390 2719 4290 gene locus_tag LOCUS_23400 2719 4290 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_23400 5165 4407 gene locus_tag LOCUS_23410 5165 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 5520 5747 gene locus_tag LOCUS_23420 5520 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 5751 6137 gene locus_tag LOCUS_23430 5751 6137 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_23430 6531 6875 gene locus_tag LOCUS_23440 6531 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 6860 7057 gene locus_tag LOCUS_23450 6860 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 7086 7250 gene locus_tag LOCUS_23460 7086 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23460 7512 7736 gene locus_tag LOCUS_23470 7512 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 7738 7959 gene locus_tag LOCUS_23480 7738 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 7938 8252 gene locus_tag LOCUS_23490 7938 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 8374 9294 gene locus_tag LOCUS_23500 8374 9294 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_23500 9394 10344 gene locus_tag LOCUS_23510 9394 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 10368 11093 gene locus_tag LOCUS_23520 10368 11093 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407647.1 protein_id gnl|my_center|LOCUS_23520 11192 11485 gene locus_tag LOCUS_23530 11192 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 >Feature sequence128 662 1174 gene locus_tag LOCUS_23540 662 1174 CDS product diheme cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524126.1 protein_id gnl|my_center|LOCUS_23540 2092 1229 gene locus_tag LOCUS_23550 2092 1229 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144381.1 protein_id gnl|my_center|LOCUS_23550 2481 2984 gene locus_tag LOCUS_23560 2481 2984 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732689.1 protein_id gnl|my_center|LOCUS_23560 3597 2986 gene locus_tag LOCUS_23570 3597 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 3732 4397 gene locus_tag LOCUS_23580 3732 4397 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057205.1 protein_id gnl|my_center|LOCUS_23580 4627 5577 gene locus_tag LOCUS_23590 4627 5577 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_23590 5583 6173 gene locus_tag LOCUS_23600 gene wcaF 5583 6173 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097875.1 protein_id gnl|my_center|LOCUS_23600 8197 6521 gene locus_tag LOCUS_23610 8197 6521 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942368.1 protein_id gnl|my_center|LOCUS_23610 9151 8444 gene locus_tag LOCUS_23620 9151 8444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 9936 9277 gene locus_tag LOCUS_23630 9936 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 10219 9965 gene locus_tag LOCUS_23640 10219 9965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 10403 10957 gene locus_tag LOCUS_23650 10403 10957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence129 691 512 gene locus_tag LOCUS_23660 691 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 906 688 gene locus_tag LOCUS_23670 906 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 1252 1458 gene locus_tag LOCUS_23680 1252 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 1455 1661 gene locus_tag LOCUS_23690 1455 1661 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214976.1 protein_id gnl|my_center|LOCUS_23690 2353 2087 gene locus_tag LOCUS_23700 2353 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 2754 2368 gene locus_tag LOCUS_23710 2754 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 <11492 3162 gene locus_tag LOCUS_23720 <11492 3162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051754043.1:polymorphic toxin-type HINT domain-containing protein >Feature sequence130 657 115 gene locus_tag LOCUS_23730 657 115 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057036.1 protein_id gnl|my_center|LOCUS_23730 1084 860 gene locus_tag LOCUS_23740 1084 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 1201 2541 gene locus_tag LOCUS_23750 gene aroA 1201 2541 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056198.1 protein_id gnl|my_center|LOCUS_23750 3265 5028 gene locus_tag LOCUS_23760 3265 5028 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392228.1 protein_id gnl|my_center|LOCUS_23760 6806 5343 gene locus_tag LOCUS_23770 gene purF 6806 5343 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057521.1 protein_id gnl|my_center|LOCUS_23770 9360 7090 gene locus_tag LOCUS_23780 gene purL 9360 7090 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057520.1 protein_id gnl|my_center|LOCUS_23780 9510 10013 gene locus_tag LOCUS_23790 9510 10013 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_23790 10055 10240 gene locus_tag LOCUS_23800 10055 10240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 10218 10556 gene locus_tag LOCUS_23810 10218 10556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 10725 11081 gene locus_tag LOCUS_23820 10725 11081 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142926.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence131 1843 164 gene locus_tag LOCUS_23830 1843 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 2280 1960 gene locus_tag LOCUS_23840 2280 1960 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103126030.1 protein_id gnl|my_center|LOCUS_23840 2473 2850 gene locus_tag LOCUS_23850 gene petE 2473 2850 CDS product plastocyanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125233.1 protein_id gnl|my_center|LOCUS_23850 3053 4780 gene locus_tag LOCUS_23860 3053 4780 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057217.1 protein_id gnl|my_center|LOCUS_23860 4864 4937 gene locus_tag LOCUS_t00190 4864 4937 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5702 4974 gene locus_tag LOCUS_23870 5702 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 5870 10360 gene locus_tag LOCUS_23880 5870 10360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 10507 10923 gene locus_tag LOCUS_23890 10507 10923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 10911 11246 gene locus_tag LOCUS_23900 10911 11246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence132 1338 184 gene locus_tag LOCUS_23910 1338 184 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057305.1 protein_id gnl|my_center|LOCUS_23910 2462 1572 gene locus_tag LOCUS_23920 gene trpC 2462 1572 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056545.1 protein_id gnl|my_center|LOCUS_23920 2821 2609 gene locus_tag LOCUS_23930 2821 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 3121 3735 gene locus_tag LOCUS_23940 3121 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 3738 4028 gene locus_tag LOCUS_23950 3738 4028 CDS product DUF3288 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057272.1 protein_id gnl|my_center|LOCUS_23950 4976 4071 gene locus_tag LOCUS_23960 4976 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 6254 5259 gene locus_tag LOCUS_23970 6254 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 6373 6768 gene locus_tag LOCUS_23980 6373 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 8736 6829 gene locus_tag LOCUS_23990 gene shc 8736 6829 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058142.1 protein_id gnl|my_center|LOCUS_23990 9423 9106 gene locus_tag LOCUS_24000 9423 9106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 10481 9963 gene locus_tag LOCUS_24010 10481 9963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 10834 10625 gene locus_tag LOCUS_24020 10834 10625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 >Feature sequence133 160 528 gene locus_tag LOCUS_24030 160 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799199.1 protein_id gnl|my_center|LOCUS_24030 525 1538 gene locus_tag LOCUS_24040 525 1538 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057784.1 protein_id gnl|my_center|LOCUS_24040 3392 1734 gene locus_tag LOCUS_24050 3392 1734 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057022.1 protein_id gnl|my_center|LOCUS_24050 4133 3405 gene locus_tag LOCUS_24060 4133 3405 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057021.1 protein_id gnl|my_center|LOCUS_24060 4696 4130 gene locus_tag LOCUS_24070 4696 4130 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057020.1 protein_id gnl|my_center|LOCUS_24070 5481 5029 gene locus_tag LOCUS_24080 5481 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 5891 5658 gene locus_tag LOCUS_24090 5891 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 6160 6309 gene locus_tag LOCUS_24100 6160 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 6530 6291 gene locus_tag LOCUS_24110 6530 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 6752 7165 gene locus_tag LOCUS_24120 6752 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 7207 9321 gene locus_tag LOCUS_24130 7207 9321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 9830 10141 gene locus_tag LOCUS_24140 9830 10141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 10388 10705 gene locus_tag LOCUS_24150 10388 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 11032 10826 gene locus_tag LOCUS_24160 11032 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 >Feature sequence134 331 612 gene locus_tag LOCUS_24170 331 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 614 1102 gene locus_tag LOCUS_24180 614 1102 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582524.1 protein_id gnl|my_center|LOCUS_24180 1360 1581 gene locus_tag LOCUS_24190 1360 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 1812 2198 gene locus_tag LOCUS_24200 1812 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 2286 2624 gene locus_tag LOCUS_24210 2286 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 2806 3036 gene locus_tag LOCUS_24220 2806 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 3222 3557 gene locus_tag LOCUS_24230 3222 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 4752 3790 gene locus_tag LOCUS_24240 4752 3790 CDS product protochlorophyllide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056423.1 protein_id gnl|my_center|LOCUS_24240 6073 5072 gene locus_tag LOCUS_24250 6073 5072 CDS product curli production assembly/transport component CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869127.1 protein_id gnl|my_center|LOCUS_24250 7139 6147 gene locus_tag LOCUS_24260 7139 6147 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057591.1 protein_id gnl|my_center|LOCUS_24260 7663 8049 gene locus_tag LOCUS_24270 7663 8049 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056992.1 protein_id gnl|my_center|LOCUS_24270 8402 9196 gene locus_tag LOCUS_24280 8402 9196 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928875.1 protein_id gnl|my_center|LOCUS_24280 9976 9179 gene locus_tag LOCUS_24290 9976 9179 CDS product Tab2/Atab2 family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057694.1 protein_id gnl|my_center|LOCUS_24290 10122 10700 gene locus_tag LOCUS_24300 gene rimM 10122 10700 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125913.1 protein_id gnl|my_center|LOCUS_24300 >Feature sequence135 383 697 gene locus_tag LOCUS_24310 383 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 2322 1165 gene locus_tag LOCUS_24320 2322 1165 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339450.1 protein_id gnl|my_center|LOCUS_24320 2542 3732 gene locus_tag LOCUS_24330 2542 3732 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228024.1 protein_id gnl|my_center|LOCUS_24330 3745 4461 gene locus_tag LOCUS_24340 gene fabG 3745 4461 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106013.1 protein_id gnl|my_center|LOCUS_24340 4524 4718 gene locus_tag LOCUS_24350 4524 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 4702 4914 gene locus_tag LOCUS_24360 4702 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 4994 5974 gene locus_tag LOCUS_24370 4994 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 6152 7246 gene locus_tag LOCUS_24380 6152 7246 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_24380 7496 8713 gene locus_tag LOCUS_24390 gene chlP 7496 8713 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056005.1 protein_id gnl|my_center|LOCUS_24390 9757 8873 gene locus_tag LOCUS_24400 9757 8873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 9905 10726 gene locus_tag LOCUS_24410 9905 10726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 11038 10823 gene locus_tag LOCUS_24420 11038 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057807.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence136 808 557 gene locus_tag LOCUS_24430 808 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 1184 921 gene locus_tag LOCUS_24440 1184 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 2613 1438 gene locus_tag LOCUS_24450 2613 1438 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142934.1 protein_id gnl|my_center|LOCUS_24450 3082 2621 gene locus_tag LOCUS_24460 3082 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 3663 3280 gene locus_tag LOCUS_24470 3663 3280 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143403.1 protein_id gnl|my_center|LOCUS_24470 3959 5668 gene locus_tag LOCUS_24480 gene menD 3959 5668 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055985.1 protein_id gnl|my_center|LOCUS_24480 5865 6998 gene locus_tag LOCUS_24490 5865 6998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 7415 7005 gene locus_tag LOCUS_24500 7415 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 7714 7457 gene locus_tag LOCUS_24510 7714 7457 CDS product chlororespiratory reduction protein 7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920866.1 protein_id gnl|my_center|LOCUS_24510 7746 9221 gene locus_tag LOCUS_24520 7746 9221 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345479.1 protein_id gnl|my_center|LOCUS_24520 9512 9754 gene locus_tag LOCUS_24530 9512 9754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 9748 10068 gene locus_tag LOCUS_24540 9748 10068 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074374.1 protein_id gnl|my_center|LOCUS_24540 10339 10551 gene locus_tag LOCUS_24550 10339 10551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 11051 10776 gene locus_tag LOCUS_24560 11051 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 11220 10936 gene locus_tag LOCUS_24570 11220 10936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence137 1017 1379 gene locus_tag LOCUS_24580 gene ndhC 1017 1379 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986108.1 protein_id gnl|my_center|LOCUS_24580 1427 2170 gene locus_tag LOCUS_24590 gene ndhK 1427 2170 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056552.1 protein_id gnl|my_center|LOCUS_24590 2171 2674 gene locus_tag LOCUS_24600 2171 2674 CDS product NAD(P)H-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057270.1 protein_id gnl|my_center|LOCUS_24600 4282 2777 gene locus_tag LOCUS_24610 4282 2777 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058059.1 protein_id gnl|my_center|LOCUS_24610 4463 5557 gene locus_tag LOCUS_24620 4463 5557 CDS product ATP/GTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616490.1 protein_id gnl|my_center|LOCUS_24620 5550 6251 gene locus_tag LOCUS_24630 5550 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 6789 6304 gene locus_tag LOCUS_24640 gene psbV 6789 6304 CDS product photosystem II cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057125.1 protein_id gnl|my_center|LOCUS_24640 7124 6918 gene locus_tag LOCUS_24650 7124 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 7539 7808 gene locus_tag LOCUS_24660 7539 7808 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_24660 7821 8375 gene locus_tag LOCUS_24670 gene gmk 7821 8375 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055909.1 protein_id gnl|my_center|LOCUS_24670 8738 9340 gene locus_tag LOCUS_24680 gene clpP 8738 9340 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125072.1 protein_id gnl|my_center|LOCUS_24680 9848 9654 gene locus_tag LOCUS_24690 9848 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 10271 9942 gene locus_tag LOCUS_24700 10271 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 10533 11066 gene locus_tag LOCUS_24710 10533 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140803.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence138 1165 281 gene locus_tag LOCUS_24720 gene lipA 1165 281 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056422.1 protein_id gnl|my_center|LOCUS_24720 1372 3120 gene locus_tag LOCUS_24730 1372 3120 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929136.1 protein_id gnl|my_center|LOCUS_24730 3571 4497 gene locus_tag LOCUS_24740 3571 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 5424 5065 gene locus_tag LOCUS_24750 gene grxD 5424 5065 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125804.1 protein_id gnl|my_center|LOCUS_24750 7158 5476 gene locus_tag LOCUS_24760 7158 5476 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056974.1 protein_id gnl|my_center|LOCUS_24760 7927 7100 gene locus_tag LOCUS_24770 7927 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 8946 11138 gene locus_tag LOCUS_24780 8946 11138 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921160.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence139 <1 521 gene locus_tag LOCUS_24790 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143123.1:Uma2 family endonuclease 556 1410 gene locus_tag LOCUS_24800 556 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 1448 2233 gene locus_tag LOCUS_24810 1448 2233 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_24810 2278 3336 gene locus_tag LOCUS_24820 2278 3336 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160648704.1 protein_id gnl|my_center|LOCUS_24820 3349 4152 gene locus_tag LOCUS_24830 3349 4152 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546302.1 protein_id gnl|my_center|LOCUS_24830 4170 5081 gene locus_tag LOCUS_24840 4170 5081 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002733687.1 protein_id gnl|my_center|LOCUS_24840 5086 5463 gene locus_tag LOCUS_24850 5086 5463 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062081852.1 protein_id gnl|my_center|LOCUS_24850 5463 6395 gene locus_tag LOCUS_24860 5463 6395 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_24860 6819 7088 gene locus_tag LOCUS_24870 6819 7088 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056004.1 protein_id gnl|my_center|LOCUS_24870 7332 10694 gene locus_tag LOCUS_24880 gene smc 7332 10694 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057762.1 protein_id gnl|my_center|LOCUS_24880 >Feature sequence140 259 870 gene locus_tag LOCUS_24890 259 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 873 1214 gene locus_tag LOCUS_24900 873 1214 CDS product DUF565 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057010.1 protein_id gnl|my_center|LOCUS_24900 1670 1416 gene locus_tag LOCUS_24910 1670 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 1849 3702 gene locus_tag LOCUS_24920 gene ftsH3 1849 3702 CDS product ATP-dependent zinc metalloprotease FtsH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055986.1 protein_id gnl|my_center|LOCUS_24920 4193 5140 gene locus_tag LOCUS_24930 gene miaA 4193 5140 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056495.1 protein_id gnl|my_center|LOCUS_24930 6488 5082 gene locus_tag LOCUS_24940 6488 5082 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124536.1 protein_id gnl|my_center|LOCUS_24940 7358 6501 gene locus_tag LOCUS_24950 7358 6501 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167919.1 protein_id gnl|my_center|LOCUS_24950 8375 7377 gene locus_tag LOCUS_24960 8375 7377 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799453.1 protein_id gnl|my_center|LOCUS_24960 9071 9856 gene locus_tag LOCUS_24970 9071 9856 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920643.1 protein_id gnl|my_center|LOCUS_24970 9887 10354 gene locus_tag LOCUS_24980 9887 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 11037 10372 gene locus_tag LOCUS_24990 11037 10372 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920739.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence141 187 1044 gene locus_tag LOCUS_25000 187 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 1169 2011 gene locus_tag LOCUS_25010 1169 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_25010 2025 2684 gene locus_tag LOCUS_25020 2025 2684 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057788.1 protein_id gnl|my_center|LOCUS_25020 2711 3574 gene locus_tag LOCUS_25030 2711 3574 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972530.1 protein_id gnl|my_center|LOCUS_25030 4414 4064 gene locus_tag LOCUS_25040 4414 4064 CDS product DUF760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057859.1 protein_id gnl|my_center|LOCUS_25040 5067 4549 gene locus_tag LOCUS_25050 gene scpB 5067 4549 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056690.1 protein_id gnl|my_center|LOCUS_25050 5129 5941 gene locus_tag LOCUS_25060 5129 5941 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 protein_id gnl|my_center|LOCUS_25060 5931 6770 gene locus_tag LOCUS_25070 5931 6770 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057606.1 protein_id gnl|my_center|LOCUS_25070 7414 8085 gene locus_tag LOCUS_25080 7414 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 8533 9039 gene locus_tag LOCUS_25090 8533 9039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 10695 9112 gene locus_tag LOCUS_25100 gene ndhD1 10695 9112 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit D1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056566.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence142 40 1035 gene locus_tag LOCUS_25110 40 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 1182 2525 gene locus_tag LOCUS_25120 1182 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 2528 4156 gene locus_tag LOCUS_25130 2528 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 4211 4468 gene locus_tag LOCUS_25140 4211 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 4465 4887 gene locus_tag LOCUS_25150 4465 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 5111 5359 gene locus_tag LOCUS_25160 5111 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 5361 5777 gene locus_tag LOCUS_25170 5361 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 5894 6112 gene locus_tag LOCUS_25180 5894 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 6114 6302 gene locus_tag LOCUS_25190 6114 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 6582 6313 gene locus_tag LOCUS_25200 6582 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 6949 8577 gene locus_tag LOCUS_25210 gene hcp 6949 8577 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545464.1 protein_id gnl|my_center|LOCUS_25210 8662 9378 gene locus_tag LOCUS_25220 gene hoxU 8662 9378 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_25220 9387 9782 gene locus_tag LOCUS_25230 9387 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 9785 10246 gene locus_tag LOCUS_25240 9785 10246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 10323 10871 gene locus_tag LOCUS_25250 10323 10871 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence143 537 1670 gene locus_tag LOCUS_25260 537 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 2073 3587 gene locus_tag LOCUS_25270 2073 3587 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003043195.1 protein_id gnl|my_center|LOCUS_25270 3682 4023 gene locus_tag LOCUS_25280 3682 4023 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_25280 4033 4500 gene locus_tag LOCUS_25290 gene tspO 4033 4500 CDS product tryptophan-rich sensory protein TspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338115.1 protein_id gnl|my_center|LOCUS_25290 5637 4849 gene locus_tag LOCUS_25300 gene cobM 5637 4849 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056411.1 protein_id gnl|my_center|LOCUS_25300 5860 7617 gene locus_tag LOCUS_25310 5860 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 7619 9196 gene locus_tag LOCUS_25320 7619 9196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 9289 10605 gene locus_tag LOCUS_25330 9289 10605 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence144 210 611 gene locus_tag LOCUS_25340 210 611 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920646.1 protein_id gnl|my_center|LOCUS_25340 1050 1274 gene locus_tag LOCUS_25350 1050 1274 CDS product DUF2811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140944.1 protein_id gnl|my_center|LOCUS_25350 1324 1950 gene locus_tag LOCUS_25360 gene pth 1324 1950 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140541.1 protein_id gnl|my_center|LOCUS_25360 2085 4412 gene locus_tag LOCUS_25370 2085 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 4547 6049 gene locus_tag LOCUS_25380 4547 6049 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190570100.1 protein_id gnl|my_center|LOCUS_25380 7592 6189 gene locus_tag LOCUS_25390 gene fumC 7592 6189 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083118.1 protein_id gnl|my_center|LOCUS_25390 8248 9483 gene locus_tag LOCUS_25400 8248 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 10063 10353 gene locus_tag LOCUS_25410 10063 10353 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_25410 10362 10481 gene locus_tag LOCUS_25420 10362 10481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence145 174 854 gene locus_tag LOCUS_25430 174 854 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143139.1 protein_id gnl|my_center|LOCUS_25430 1126 1998 gene locus_tag LOCUS_25440 1126 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142558.1 protein_id gnl|my_center|LOCUS_25440 2062 2133 gene locus_tag LOCUS_t00200 2062 2133 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2163 2765 gene locus_tag LOCUS_25450 gene tsaB 2163 2765 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055917.1 protein_id gnl|my_center|LOCUS_25450 4421 2766 gene locus_tag LOCUS_25460 4421 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 4636 5409 gene locus_tag LOCUS_25470 gene cysE 4636 5409 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056695.1 protein_id gnl|my_center|LOCUS_25470 5611 8490 gene locus_tag LOCUS_25480 gene uvrA 5611 8490 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524117.1 protein_id gnl|my_center|LOCUS_25480 9256 8480 gene locus_tag LOCUS_25490 9256 8480 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202282.1 protein_id gnl|my_center|LOCUS_25490 9533 9249 gene locus_tag LOCUS_25500 9533 9249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence146 1043 777 gene locus_tag LOCUS_25510 1043 777 CDS product TIGR02450 family Trp-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142102.1 protein_id gnl|my_center|LOCUS_25510 1786 1172 gene locus_tag LOCUS_25520 gene lexA 1786 1172 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125487.1 protein_id gnl|my_center|LOCUS_25520 2709 6263 gene locus_tag LOCUS_25530 gene nifJ 2709 6263 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933292.1 protein_id gnl|my_center|LOCUS_25530 6266 7291 gene locus_tag LOCUS_25540 6266 7291 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_25540 7678 8886 gene locus_tag LOCUS_25550 7678 8886 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057156.1 protein_id gnl|my_center|LOCUS_25550 9342 9130 gene locus_tag LOCUS_25560 9342 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 9564 9349 gene locus_tag LOCUS_25570 9564 9349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 9815 9567 gene locus_tag LOCUS_25580 9815 9567 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391712.1 protein_id gnl|my_center|LOCUS_25580 10721 10053 gene locus_tag LOCUS_25590 10721 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 >Feature sequence147 116 1033 gene locus_tag LOCUS_25600 gene thrB 116 1033 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057602.1 protein_id gnl|my_center|LOCUS_25600 1149 2093 gene locus_tag LOCUS_25610 1149 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 2992 2090 gene locus_tag LOCUS_25620 2992 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 3220 3005 gene locus_tag LOCUS_25630 3220 3005 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640562.1 protein_id gnl|my_center|LOCUS_25630 3381 4886 gene locus_tag LOCUS_25640 gene crtD 3381 4886 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056087.1 protein_id gnl|my_center|LOCUS_25640 6366 5029 gene locus_tag LOCUS_25650 6366 5029 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057372.1 protein_id gnl|my_center|LOCUS_25650 6797 8044 gene locus_tag LOCUS_25660 6797 8044 CDS product DUF4912 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057902.1 protein_id gnl|my_center|LOCUS_25660 9821 8169 gene locus_tag LOCUS_25670 9821 8169 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920935.1 protein_id gnl|my_center|LOCUS_25670 10604 10041 gene locus_tag LOCUS_25680 10604 10041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 >Feature sequence148 >Feature sequence149 1 927 gene locus_tag LOCUS_25690 1 927 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035329735.1 protein_id gnl|my_center|LOCUS_25690 962 2008 gene locus_tag LOCUS_25700 962 2008 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478388.1 protein_id gnl|my_center|LOCUS_25700 2058 2729 gene locus_tag LOCUS_25710 2058 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 3106 3885 gene locus_tag LOCUS_25720 3106 3885 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 protein_id gnl|my_center|LOCUS_25720 3916 4896 gene locus_tag LOCUS_25730 3916 4896 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433078.1 protein_id gnl|my_center|LOCUS_25730 7627 4919 gene locus_tag LOCUS_25740 7627 4919 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057097.1 protein_id gnl|my_center|LOCUS_25740 7958 8353 gene locus_tag LOCUS_25750 gene gcvH 7958 8353 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057515.1 protein_id gnl|my_center|LOCUS_25750 8513 9685 gene locus_tag LOCUS_25760 gene moeB 8513 9685 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058235.1 protein_id gnl|my_center|LOCUS_25760 9858 10445 gene locus_tag LOCUS_25770 9858 10445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence150 275 1162 gene locus_tag LOCUS_25780 275 1162 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143051.1 protein_id gnl|my_center|LOCUS_25780 1172 1582 gene locus_tag LOCUS_25790 1172 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 3108 1744 gene locus_tag LOCUS_25800 3108 1744 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088430287.1 protein_id gnl|my_center|LOCUS_25800 3855 3517 gene locus_tag LOCUS_25810 3855 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 5061 3940 gene locus_tag LOCUS_25820 5061 3940 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379429.1 protein_id gnl|my_center|LOCUS_25820 5410 5156 gene locus_tag LOCUS_25830 5410 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 5681 6601 gene locus_tag LOCUS_25840 5681 6601 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_25840 8527 6650 gene locus_tag LOCUS_25850 gene ftsH 8527 6650 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_25850 9789 8605 gene locus_tag LOCUS_25860 9789 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 <10511 9924 gene locus_tag LOCUS_25870 <10511 9924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041233550.1:RNA-guided endonuclease TnpB family protein >Feature sequence151 2310 2786 gene locus_tag LOCUS_25880 2310 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 3225 2911 gene locus_tag LOCUS_25890 3225 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 4425 3313 gene locus_tag LOCUS_25900 gene hypD 4425 3313 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225639.1 protein_id gnl|my_center|LOCUS_25900 4830 4567 gene locus_tag LOCUS_25910 4830 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 5221 7122 gene locus_tag LOCUS_25920 5221 7122 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929297.1 protein_id gnl|my_center|LOCUS_25920 7572 10190 gene locus_tag LOCUS_25930 gene clpB 7572 10190 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057229.1 protein_id gnl|my_center|LOCUS_25930 >Feature sequence152 263 1291 gene locus_tag LOCUS_25940 gene obgE 263 1291 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058186.1 protein_id gnl|my_center|LOCUS_25940 1666 1301 gene locus_tag LOCUS_25950 1666 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 1907 1659 gene locus_tag LOCUS_25960 1907 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 2243 2001 gene locus_tag LOCUS_25970 2243 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2864 2307 gene locus_tag LOCUS_25980 2864 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 3398 2913 gene locus_tag LOCUS_25990 3398 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 4727 3429 gene locus_tag LOCUS_26000 4727 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 6110 5019 gene locus_tag LOCUS_26010 gene rfbB 6110 5019 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143225.1 protein_id gnl|my_center|LOCUS_26010 7068 6142 gene locus_tag LOCUS_26020 7068 6142 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920864.1 protein_id gnl|my_center|LOCUS_26020 8035 7319 gene locus_tag LOCUS_26030 gene purQ 8035 7319 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141325.1 protein_id gnl|my_center|LOCUS_26030 8475 8203 gene locus_tag LOCUS_26040 gene purS 8475 8203 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140445.1 protein_id gnl|my_center|LOCUS_26040 8507 8890 gene locus_tag LOCUS_26050 8507 8890 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056047.1 protein_id gnl|my_center|LOCUS_26050 9926 8976 gene locus_tag LOCUS_26060 gene accD 9926 8976 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057480.1 protein_id gnl|my_center|LOCUS_26060 10154 9945 gene locus_tag LOCUS_26070 10154 9945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 >Feature sequence153 774 331 gene locus_tag LOCUS_26080 gene rplO 774 331 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055953.1 protein_id gnl|my_center|LOCUS_26080 1306 785 gene locus_tag LOCUS_26090 gene rpsE 1306 785 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055952.1 protein_id gnl|my_center|LOCUS_26090 1695 1333 gene locus_tag LOCUS_26100 gene rplR 1695 1333 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143899.1 protein_id gnl|my_center|LOCUS_26100 2268 1699 gene locus_tag LOCUS_26110 gene rplF 2268 1699 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055950.1 protein_id gnl|my_center|LOCUS_26110 2776 2375 gene locus_tag LOCUS_26120 gene rpsH 2776 2375 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055949.1 protein_id gnl|my_center|LOCUS_26120 3524 2985 gene locus_tag LOCUS_26130 gene rplE 3524 2985 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055948.1 protein_id gnl|my_center|LOCUS_26130 3932 3579 gene locus_tag LOCUS_26140 gene rplX 3932 3579 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055947.1 protein_id gnl|my_center|LOCUS_26140 4340 3972 gene locus_tag LOCUS_26150 gene rplN 4340 3972 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055946.1 protein_id gnl|my_center|LOCUS_26150 4603 4361 gene locus_tag LOCUS_26160 gene rpsQ 4603 4361 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055945.1 protein_id gnl|my_center|LOCUS_26160 4828 4610 gene locus_tag LOCUS_26170 gene rpmC 4828 4610 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143907.1 protein_id gnl|my_center|LOCUS_26170 5247 4828 gene locus_tag LOCUS_26180 gene rplP 5247 4828 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055943.1 protein_id gnl|my_center|LOCUS_26180 6006 5278 gene locus_tag LOCUS_26190 gene rpsC 6006 5278 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055942.1 protein_id gnl|my_center|LOCUS_26190 6389 6030 gene locus_tag LOCUS_26200 gene rplV 6389 6030 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055941.1 protein_id gnl|my_center|LOCUS_26200 6859 6578 gene locus_tag LOCUS_26210 gene rpsS 6859 6578 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055940.1 protein_id gnl|my_center|LOCUS_26210 7723 6890 gene locus_tag LOCUS_26220 gene rplB 7723 6890 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055939.1 protein_id gnl|my_center|LOCUS_26220 8062 7757 gene locus_tag LOCUS_26230 8062 7757 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055938.1 protein_id gnl|my_center|LOCUS_26230 8684 8052 gene locus_tag LOCUS_26240 gene rplD 8684 8052 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055937.1 protein_id gnl|my_center|LOCUS_26240 9343 8705 gene locus_tag LOCUS_26250 gene rplC 9343 8705 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055936.1 protein_id gnl|my_center|LOCUS_26250 >Feature sequence154 295 1740 gene locus_tag LOCUS_26260 295 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 2199 1747 gene locus_tag LOCUS_26270 2199 1747 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_26270 3181 2186 gene locus_tag LOCUS_26280 3181 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 3946 3296 gene locus_tag LOCUS_26290 3946 3296 CDS product DUF3318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056895.1 protein_id gnl|my_center|LOCUS_26290 4870 4241 gene locus_tag LOCUS_26300 4870 4241 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056926.1 protein_id gnl|my_center|LOCUS_26300 6064 5144 gene locus_tag LOCUS_26310 6064 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 6605 6991 gene locus_tag LOCUS_26320 6605 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140108.1 protein_id gnl|my_center|LOCUS_26320 7843 7073 gene locus_tag LOCUS_26330 7843 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 8069 9595 gene locus_tag LOCUS_26340 gene lnt 8069 9595 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057504.1 protein_id gnl|my_center|LOCUS_26340 9655 9897 gene locus_tag LOCUS_26350 9655 9897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 >Feature sequence155 72 710 gene locus_tag LOCUS_26360 72 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 774 1034 gene locus_tag LOCUS_26370 gene grxC 774 1034 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143672.1 protein_id gnl|my_center|LOCUS_26370 1050 2033 gene locus_tag LOCUS_26380 gene gshB 1050 2033 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056752.1 protein_id gnl|my_center|LOCUS_26380 2142 2453 gene locus_tag LOCUS_26390 2142 2453 CDS product DUF2499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057277.1 protein_id gnl|my_center|LOCUS_26390 2446 2769 gene locus_tag LOCUS_26400 2446 2769 CDS product DUF3593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144013.1 protein_id gnl|my_center|LOCUS_26400 2881 3900 gene locus_tag LOCUS_26410 2881 3900 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125825.1 protein_id gnl|my_center|LOCUS_26410 4136 5011 gene locus_tag LOCUS_26420 4136 5011 CDS product Tab2/Atab2 family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057821.1 protein_id gnl|my_center|LOCUS_26420 6525 5056 gene locus_tag LOCUS_26430 6525 5056 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042464373.1 protein_id gnl|my_center|LOCUS_26430 8810 6639 gene locus_tag LOCUS_26440 8810 6639 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_26440 9336 9956 gene locus_tag LOCUS_26450 9336 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence156 280 555 gene locus_tag LOCUS_26460 280 555 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055881.1 protein_id gnl|my_center|LOCUS_26460 1232 2548 gene locus_tag LOCUS_26470 gene urtA 1232 2548 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_26470 2643 3839 gene locus_tag LOCUS_26480 2643 3839 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056963.1 protein_id gnl|my_center|LOCUS_26480 3843 4997 gene locus_tag LOCUS_26490 gene urtC 3843 4997 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 protein_id gnl|my_center|LOCUS_26490 5105 5851 gene locus_tag LOCUS_26500 gene urtD 5105 5851 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 protein_id gnl|my_center|LOCUS_26500 5890 6588 gene locus_tag LOCUS_26510 gene urtE 5890 6588 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_26510 6609 7826 gene locus_tag LOCUS_26520 6609 7826 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_26520 9609 7930 gene locus_tag LOCUS_26530 gene pckA 9609 7930 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_26530 >Feature sequence157 1316 255 gene locus_tag LOCUS_26540 gene argC 1316 255 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058053.1 protein_id gnl|my_center|LOCUS_26540 1788 1525 gene locus_tag LOCUS_26550 1788 1525 CDS product DUF3146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058048.1 protein_id gnl|my_center|LOCUS_26550 2795 1875 gene locus_tag LOCUS_26560 2795 1875 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057303.1 protein_id gnl|my_center|LOCUS_26560 2977 3822 gene locus_tag LOCUS_26570 2977 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_26570 4740 4183 gene locus_tag LOCUS_26580 4740 4183 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140402.1 protein_id gnl|my_center|LOCUS_26580 6111 4768 gene locus_tag LOCUS_26590 6111 4768 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056381.1 protein_id gnl|my_center|LOCUS_26590 6406 6239 gene locus_tag LOCUS_26600 6406 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 7630 6467 gene locus_tag LOCUS_26610 7630 6467 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055867.1 protein_id gnl|my_center|LOCUS_26610 7942 8994 gene locus_tag LOCUS_26620 7942 8994 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202993.1 protein_id gnl|my_center|LOCUS_26620 8987 10030 gene locus_tag LOCUS_26630 8987 10030 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121962.1 protein_id gnl|my_center|LOCUS_26630 >Feature sequence158 113 505 gene locus_tag LOCUS_26640 113 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 518 1345 gene locus_tag LOCUS_26650 gene minC 518 1345 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141990.1 protein_id gnl|my_center|LOCUS_26650 1547 2347 gene locus_tag LOCUS_26660 gene minD 1547 2347 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057852.1 protein_id gnl|my_center|LOCUS_26660 2377 2664 gene locus_tag LOCUS_26670 gene minE 2377 2664 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057853.1 protein_id gnl|my_center|LOCUS_26670 2661 2849 gene locus_tag LOCUS_26680 2661 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 3128 6184 gene locus_tag LOCUS_26690 gene ppc 3128 6184 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057749.1 protein_id gnl|my_center|LOCUS_26690 6659 7942 gene locus_tag LOCUS_26700 6659 7942 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057961.1 protein_id gnl|my_center|LOCUS_26700 8022 9089 gene locus_tag LOCUS_26710 8022 9089 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 protein_id gnl|my_center|LOCUS_26710 9412 9152 gene locus_tag LOCUS_26720 9412 9152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 <10157 9633 gene locus_tag LOCUS_26730 <10157 9633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404760.1:IS607-like element IS1535 family transposase >Feature sequence159 268 1899 gene locus_tag LOCUS_26740 268 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 3247 2327 gene locus_tag LOCUS_26750 3247 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 5532 3886 gene locus_tag LOCUS_26760 5532 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 6509 5586 gene locus_tag LOCUS_26770 6509 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 6732 7424 gene locus_tag LOCUS_26780 6732 7424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 8739 7852 gene locus_tag LOCUS_26790 gene sucD 8739 7852 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694247.1 protein_id gnl|my_center|LOCUS_26790 9692 9531 gene locus_tag LOCUS_26800 9692 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence160 806 1519 gene locus_tag LOCUS_26810 806 1519 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_26810 2572 1571 gene locus_tag LOCUS_26820 2572 1571 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057751.1 protein_id gnl|my_center|LOCUS_26820 4705 2885 gene locus_tag LOCUS_26830 4705 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 5497 7023 gene locus_tag LOCUS_26840 5497 7023 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056133.1 protein_id gnl|my_center|LOCUS_26840 7097 7660 gene locus_tag LOCUS_26850 7097 7660 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_26850 7876 9927 gene locus_tag LOCUS_26860 7876 9927 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142700.1 protein_id gnl|my_center|LOCUS_26860 >Feature sequence161 2387 174 gene locus_tag LOCUS_26870 gene psaB 2387 174 CDS product photosystem I core protein PsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056579.1 protein_id gnl|my_center|LOCUS_26870 4812 2566 gene locus_tag LOCUS_26880 gene psaA 4812 2566 CDS product photosystem I core protein PsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920748.1 protein_id gnl|my_center|LOCUS_26880 5408 6688 gene locus_tag LOCUS_26890 5408 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 7301 7867 gene locus_tag LOCUS_26900 7301 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 8638 7991 gene locus_tag LOCUS_26910 8638 7991 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 protein_id gnl|my_center|LOCUS_26910 8955 8650 gene locus_tag LOCUS_26920 8955 8650 CDS product DUF2973 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057538.1 protein_id gnl|my_center|LOCUS_26920 9461 9054 gene locus_tag LOCUS_26930 9461 9054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 9755 9477 gene locus_tag LOCUS_26940 9755 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 >Feature sequence162 109 282 gene locus_tag LOCUS_26950 109 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 379 1299 gene locus_tag LOCUS_26960 379 1299 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_26960 1514 2413 gene locus_tag LOCUS_26970 1514 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 2456 4834 gene locus_tag LOCUS_26980 2456 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 4849 5634 gene locus_tag LOCUS_26990 4849 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 5666 6310 gene locus_tag LOCUS_27000 5666 6310 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407647.1 protein_id gnl|my_center|LOCUS_27000 6382 7653 gene locus_tag LOCUS_27010 6382 7653 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058221.1 protein_id gnl|my_center|LOCUS_27010 7755 8534 gene locus_tag LOCUS_27020 7755 8534 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929453.1 protein_id gnl|my_center|LOCUS_27020 8902 9834 gene locus_tag LOCUS_27030 8902 9834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence163 470 649 gene locus_tag LOCUS_27040 470 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 725 1072 gene locus_tag LOCUS_27050 725 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 1187 3178 gene locus_tag LOCUS_27060 1187 3178 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056292.1 protein_id gnl|my_center|LOCUS_27060 3563 3159 gene locus_tag LOCUS_27070 3563 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 4003 3596 gene locus_tag LOCUS_27080 4003 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 4048 4953 gene locus_tag LOCUS_27090 4048 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 5295 6023 gene locus_tag LOCUS_27100 5295 6023 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057150.1 protein_id gnl|my_center|LOCUS_27100 6073 6771 gene locus_tag LOCUS_27110 gene folE 6073 6771 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015079151.1 protein_id gnl|my_center|LOCUS_27110 7490 6855 gene locus_tag LOCUS_27120 7490 6855 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058105.1 protein_id gnl|my_center|LOCUS_27120 7611 7877 gene locus_tag LOCUS_27130 gene psaK 7611 7877 CDS product photosystem I reaction center subunit PsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921012.1 protein_id gnl|my_center|LOCUS_27130 8375 8133 gene locus_tag LOCUS_27140 8375 8133 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878574.1 protein_id gnl|my_center|LOCUS_27140 8619 8392 gene locus_tag LOCUS_27150 8619 8392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 9654 9127 gene locus_tag LOCUS_27160 9654 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 >Feature sequence164 316 948 gene locus_tag LOCUS_27170 316 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_27170 1454 1269 gene locus_tag LOCUS_27180 1454 1269 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061317.1 protein_id gnl|my_center|LOCUS_27180 1675 1451 gene locus_tag LOCUS_27190 1675 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 1969 1721 gene locus_tag LOCUS_27200 1969 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 2239 2439 gene locus_tag LOCUS_27210 2239 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 2436 2726 gene locus_tag LOCUS_27220 2436 2726 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942007.1 protein_id gnl|my_center|LOCUS_27220 5885 2973 gene locus_tag LOCUS_27230 5885 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 6199 5882 gene locus_tag LOCUS_27240 6199 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 7150 6428 gene locus_tag LOCUS_27250 7150 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 8913 7147 gene locus_tag LOCUS_27260 8913 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 9356 9126 gene locus_tag LOCUS_27270 9356 9126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 >Feature sequence165 235 1650 gene locus_tag LOCUS_27280 235 1650 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_27280 1647 2246 gene locus_tag LOCUS_27290 1647 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 2472 2260 gene locus_tag LOCUS_27300 2472 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 4643 2493 gene locus_tag LOCUS_27310 4643 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 5667 5029 gene locus_tag LOCUS_27320 5667 5029 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948539.1 protein_id gnl|my_center|LOCUS_27320 6273 5698 gene locus_tag LOCUS_27330 6273 5698 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 protein_id gnl|my_center|LOCUS_27330 7106 6432 gene locus_tag LOCUS_27340 7106 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 7847 7311 gene locus_tag LOCUS_27350 7847 7311 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929789.1 protein_id gnl|my_center|LOCUS_27350 8992 8045 gene locus_tag LOCUS_27360 gene cysK 8992 8045 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056355.1 protein_id gnl|my_center|LOCUS_27360 9659 9808 gene locus_tag LOCUS_27370 9659 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 >Feature sequence166 116 1132 gene locus_tag LOCUS_27380 116 1132 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920956.1 protein_id gnl|my_center|LOCUS_27380 1263 1472 gene locus_tag LOCUS_27390 gene thiS 1263 1472 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056654.1 protein_id gnl|my_center|LOCUS_27390 1506 2642 gene locus_tag LOCUS_27400 1506 2642 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058228.1 protein_id gnl|my_center|LOCUS_27400 2639 3409 gene locus_tag LOCUS_27410 2639 3409 CDS product AhpC/TSA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125038.1 protein_id gnl|my_center|LOCUS_27410 3722 4033 gene locus_tag LOCUS_27420 3722 4033 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143612.1 protein_id gnl|my_center|LOCUS_27420 4245 4946 gene locus_tag LOCUS_27430 4245 4946 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057465.1 protein_id gnl|my_center|LOCUS_27430 4969 5520 gene locus_tag LOCUS_27440 4969 5520 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920907.1 protein_id gnl|my_center|LOCUS_27440 5709 6587 gene locus_tag LOCUS_27450 5709 6587 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057467.1 protein_id gnl|my_center|LOCUS_27450 7574 6615 gene locus_tag LOCUS_27460 gene hemC 7574 6615 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057483.1 protein_id gnl|my_center|LOCUS_27460 7959 9584 gene locus_tag LOCUS_27470 7959 9584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence167 179 370 gene locus_tag LOCUS_27480 179 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 416 1375 gene locus_tag LOCUS_27490 416 1375 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_27490 1486 2061 gene locus_tag LOCUS_27500 1486 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 3687 2044 gene locus_tag LOCUS_27510 3687 2044 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 protein_id gnl|my_center|LOCUS_27510 3823 5517 gene locus_tag LOCUS_27520 3823 5517 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 protein_id gnl|my_center|LOCUS_27520 5567 6022 gene locus_tag LOCUS_27530 5567 6022 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920697.1 protein_id gnl|my_center|LOCUS_27530 6587 7858 gene locus_tag LOCUS_27540 6587 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 8280 9497 gene locus_tag LOCUS_27550 8280 9497 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056036.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence168 733 2178 gene locus_tag LOCUS_27560 733 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057099.1 protein_id gnl|my_center|LOCUS_27560 2394 4631 gene locus_tag LOCUS_27570 2394 4631 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036738.1 protein_id gnl|my_center|LOCUS_27570 6701 4635 gene locus_tag LOCUS_27580 6701 4635 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 protein_id gnl|my_center|LOCUS_27580 6957 6781 gene locus_tag LOCUS_27590 6957 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 7648 7058 gene locus_tag LOCUS_27600 gene leuD 7648 7058 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 protein_id gnl|my_center|LOCUS_27600 8452 7658 gene locus_tag LOCUS_27610 8452 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 9009 8458 gene locus_tag LOCUS_27620 gene cobU 9009 8458 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056947.1 protein_id gnl|my_center|LOCUS_27620 9435 9058 gene locus_tag LOCUS_27630 9435 9058 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172237.1 protein_id gnl|my_center|LOCUS_27630 >Feature sequence169 396 214 gene locus_tag LOCUS_27640 396 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 518 1753 gene locus_tag LOCUS_27650 518 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 3383 1863 gene locus_tag LOCUS_27660 gene trpE 3383 1863 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057509.1 protein_id gnl|my_center|LOCUS_27660 4202 3777 gene locus_tag LOCUS_27670 4202 3777 CDS product photosystem I reaction center subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125882.1 protein_id gnl|my_center|LOCUS_27670 6506 4560 gene locus_tag LOCUS_27680 6506 4560 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_27680 7213 6776 gene locus_tag LOCUS_27690 7213 6776 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814887.1 protein_id gnl|my_center|LOCUS_27690 7446 7213 gene locus_tag LOCUS_27700 7446 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 7778 7503 gene locus_tag LOCUS_27710 7778 7503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 8736 7927 gene locus_tag LOCUS_27720 8736 7927 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920882.1 protein_id gnl|my_center|LOCUS_27720 9385 8798 gene locus_tag LOCUS_27730 9385 8798 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057311.1 protein_id gnl|my_center|LOCUS_27730 >Feature sequence170 484 1818 gene locus_tag LOCUS_27740 484 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 2165 1989 gene locus_tag LOCUS_27750 2165 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 3905 2805 gene locus_tag LOCUS_27760 3905 2805 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_27760 4710 4495 gene locus_tag LOCUS_27770 4710 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 5079 6644 gene locus_tag LOCUS_27780 5079 6644 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193934126.1 protein_id gnl|my_center|LOCUS_27780 8385 6949 gene locus_tag LOCUS_27790 8385 6949 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258690.1 protein_id gnl|my_center|LOCUS_27790 8639 8388 gene locus_tag LOCUS_27800 8639 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 9047 8643 gene locus_tag LOCUS_27810 9047 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 9470 9177 gene locus_tag LOCUS_27820 9470 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence171 250 612 gene locus_tag LOCUS_27830 250 612 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27830 736 984 gene locus_tag LOCUS_27840 736 984 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_27840 981 1349 gene locus_tag LOCUS_27850 981 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 1589 1912 gene locus_tag LOCUS_27860 1589 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 1929 2153 gene locus_tag LOCUS_27870 1929 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 2309 3370 gene locus_tag LOCUS_27880 2309 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 3451 4077 gene locus_tag LOCUS_27890 3451 4077 CDS product CPP1-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058181.1 protein_id gnl|my_center|LOCUS_27890 4733 4074 gene locus_tag LOCUS_27900 4733 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 5063 6034 gene locus_tag LOCUS_27910 gene sds 5063 6034 CDS product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057594.1 protein_id gnl|my_center|LOCUS_27910 6576 6031 gene locus_tag LOCUS_27920 6576 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056601.1 protein_id gnl|my_center|LOCUS_27920 7044 8684 gene locus_tag LOCUS_27930 gene cimA 7044 8684 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056694.1 protein_id gnl|my_center|LOCUS_27930 9321 8827 gene locus_tag LOCUS_27940 9321 8827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041243886.1 protein_id gnl|my_center|LOCUS_27940 >Feature sequence172 1103 711 gene locus_tag LOCUS_27950 1103 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 2097 1288 gene locus_tag LOCUS_27960 2097 1288 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_27960 2517 3575 gene locus_tag LOCUS_27970 2517 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 3612 5132 gene locus_tag LOCUS_27980 3612 5132 CDS product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387742.1 protein_id gnl|my_center|LOCUS_27980 6727 5609 gene locus_tag LOCUS_27990 6727 5609 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056664.1 protein_id gnl|my_center|LOCUS_27990 6980 8140 gene locus_tag LOCUS_28000 gene mtnW 6980 8140 CDS product 2,3-diketo-5-methylthiopentyl-1-phosphate enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245108.1 protein_id gnl|my_center|LOCUS_28000 9479 8196 gene locus_tag LOCUS_28010 gene serS 9479 8196 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057392.1 protein_id gnl|my_center|LOCUS_28010 >Feature sequence173 2079 433 gene locus_tag LOCUS_28020 2079 433 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140397.1 protein_id gnl|my_center|LOCUS_28020 2225 2548 gene locus_tag LOCUS_28030 2225 2548 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057408.1 protein_id gnl|my_center|LOCUS_28030 3685 2549 gene locus_tag LOCUS_28040 3685 2549 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_28040 3858 4301 gene locus_tag LOCUS_28050 3858 4301 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_28050 4270 5094 gene locus_tag LOCUS_28060 4270 5094 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_28060 5449 6000 gene locus_tag LOCUS_28070 5449 6000 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056641.1 protein_id gnl|my_center|LOCUS_28070 7242 6067 gene locus_tag LOCUS_28080 7242 6067 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057862.1 protein_id gnl|my_center|LOCUS_28080 7280 8470 gene locus_tag LOCUS_28090 7280 8470 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218596652.1 protein_id gnl|my_center|LOCUS_28090 8578 9303 gene locus_tag LOCUS_28100 8578 9303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28100 9339 9545 gene locus_tag LOCUS_28110 9339 9545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28110 >Feature sequence174 1044 235 gene locus_tag LOCUS_28120 1044 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 1641 1291 gene locus_tag LOCUS_28130 1641 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 3212 1812 gene locus_tag LOCUS_28140 3212 1812 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058178.1 protein_id gnl|my_center|LOCUS_28140 3621 3229 gene locus_tag LOCUS_28150 3621 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 4729 3860 gene locus_tag LOCUS_28160 gene bchL 4729 3860 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921031.1 protein_id gnl|my_center|LOCUS_28160 4901 5083 gene locus_tag LOCUS_28170 4901 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 5190 6035 gene locus_tag LOCUS_28180 5190 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 6040 6225 gene locus_tag LOCUS_28190 6040 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 7973 6765 gene locus_tag LOCUS_28200 7973 6765 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056884.1 protein_id gnl|my_center|LOCUS_28200 8541 8068 gene locus_tag LOCUS_28210 8541 8068 CDS product CRR6 family NdhI maturation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057132.1 protein_id gnl|my_center|LOCUS_28210 8832 9533 gene locus_tag LOCUS_28220 8832 9533 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 protein_id gnl|my_center|LOCUS_28220 >Feature sequence175 400 1623 gene locus_tag LOCUS_28230 400 1623 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057105.1 protein_id gnl|my_center|LOCUS_28230 1676 2170 gene locus_tag LOCUS_28240 gene sixA 1676 2170 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057106.1 protein_id gnl|my_center|LOCUS_28240 2239 2595 gene locus_tag LOCUS_28250 2239 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 2592 2978 gene locus_tag LOCUS_28260 2592 2978 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_28260 3650 3030 gene locus_tag LOCUS_28270 3650 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 3694 3861 gene locus_tag LOCUS_28280 3694 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 3848 4066 gene locus_tag LOCUS_28290 3848 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 9535 4160 gene locus_tag LOCUS_28300 9535 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 >Feature sequence176 189 1619 gene locus_tag LOCUS_28310 gene lpdA 189 1619 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920772.1 protein_id gnl|my_center|LOCUS_28310 1754 1930 gene locus_tag LOCUS_28320 1754 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 3583 2180 gene locus_tag LOCUS_28330 3583 2180 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929201.1 protein_id gnl|my_center|LOCUS_28330 6925 3680 gene locus_tag LOCUS_28340 gene carB 6925 3680 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058165.1 protein_id gnl|my_center|LOCUS_28340 7214 8254 gene locus_tag LOCUS_28350 7214 8254 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920837.1 protein_id gnl|my_center|LOCUS_28350 8752 8345 gene locus_tag LOCUS_28360 8752 8345 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056937.1 protein_id gnl|my_center|LOCUS_28360 9267 8761 gene locus_tag LOCUS_28370 9267 8761 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920769.1 protein_id gnl|my_center|LOCUS_28370 >Feature sequence177 147 377 gene locus_tag LOCUS_28380 147 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 1419 382 gene locus_tag LOCUS_28390 1419 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 4466 1464 gene locus_tag LOCUS_28400 4466 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 6224 4560 gene locus_tag LOCUS_28410 6224 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 7704 6541 gene locus_tag LOCUS_28420 7704 6541 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_28420 <9522 7909 gene locus_tag LOCUS_28430 <9522 7909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015613294.1:N-6 DNA methylase >Feature sequence178 1008 295 gene locus_tag LOCUS_28440 1008 295 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125174.1 protein_id gnl|my_center|LOCUS_28440 1235 2128 gene locus_tag LOCUS_28450 1235 2128 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986764.1 protein_id gnl|my_center|LOCUS_28450 2248 2556 gene locus_tag LOCUS_28460 2248 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 2579 3064 gene locus_tag LOCUS_28470 2579 3064 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056942.1 protein_id gnl|my_center|LOCUS_28470 3157 5817 gene locus_tag LOCUS_28480 gene clpB 3157 5817 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058284.1 protein_id gnl|my_center|LOCUS_28480 6448 5927 gene locus_tag LOCUS_28490 6448 5927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 7775 6606 gene locus_tag LOCUS_28500 gene acsF 7775 6606 CDS product magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920870.1 protein_id gnl|my_center|LOCUS_28500 8267 9373 gene locus_tag LOCUS_28510 8267 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 >Feature sequence179 1203 64 gene locus_tag LOCUS_28520 gene ribD 1203 64 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057986.1 protein_id gnl|my_center|LOCUS_28520 1595 3031 gene locus_tag LOCUS_28530 1595 3031 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920960.1 protein_id gnl|my_center|LOCUS_28530 3206 4630 gene locus_tag LOCUS_28540 3206 4630 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530022.1 protein_id gnl|my_center|LOCUS_28540 4665 4841 gene locus_tag LOCUS_28550 4665 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 5850 4906 gene locus_tag LOCUS_28560 5850 4906 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 protein_id gnl|my_center|LOCUS_28560 6793 5924 gene locus_tag LOCUS_28570 6793 5924 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_28570 6952 7869 gene locus_tag LOCUS_28580 6952 7869 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141275.1 protein_id gnl|my_center|LOCUS_28580 7984 9177 gene locus_tag LOCUS_28590 7984 9177 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986860.1 protein_id gnl|my_center|LOCUS_28590 9409 9224 gene locus_tag LOCUS_28600 9409 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 >Feature sequence180 481 107 gene locus_tag LOCUS_28610 481 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 775 512 gene locus_tag LOCUS_28620 775 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 1390 1106 gene locus_tag LOCUS_28630 1390 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 1695 3035 gene locus_tag LOCUS_28640 gene miaB 1695 3035 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057155.1 protein_id gnl|my_center|LOCUS_28640 3100 3486 gene locus_tag LOCUS_28650 3100 3486 CDS product DUF2358 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929025.1 protein_id gnl|my_center|LOCUS_28650 4908 3496 gene locus_tag LOCUS_28660 4908 3496 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_28660 5086 5280 gene locus_tag LOCUS_28670 gene rpmG 5086 5280 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057895.1 protein_id gnl|my_center|LOCUS_28670 5321 5536 gene locus_tag LOCUS_28680 gene rpsR 5321 5536 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057896.1 protein_id gnl|my_center|LOCUS_28680 6152 8380 gene locus_tag LOCUS_28690 6152 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 8457 8529 gene locus_tag LOCUS_t00210 8457 8529 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 8959 9339 gene locus_tag LOCUS_28700 8959 9339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 >Feature sequence181 2162 147 gene locus_tag LOCUS_28710 2162 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 3419 2217 gene locus_tag LOCUS_28720 3419 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 4834 3497 gene locus_tag LOCUS_28730 4834 3497 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_28730 5385 5963 gene locus_tag LOCUS_28740 5385 5963 CDS product DUF3172 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920879.1 protein_id gnl|my_center|LOCUS_28740 6473 6156 gene locus_tag LOCUS_28750 6473 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 7527 6547 gene locus_tag LOCUS_28760 7527 6547 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_28760 8219 8797 gene locus_tag LOCUS_28770 gene rimI 8219 8797 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056322.1 protein_id gnl|my_center|LOCUS_28770 8951 9301 gene locus_tag LOCUS_28780 8951 9301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 >Feature sequence182 437 757 gene locus_tag LOCUS_28790 437 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 1676 1125 gene locus_tag LOCUS_28800 1676 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 1941 1660 gene locus_tag LOCUS_28810 1941 1660 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057702.1 protein_id gnl|my_center|LOCUS_28810 2446 3207 gene locus_tag LOCUS_28820 gene hisA 2446 3207 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140708.1 protein_id gnl|my_center|LOCUS_28820 4973 3204 gene locus_tag LOCUS_28830 4973 3204 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966765.1 protein_id gnl|my_center|LOCUS_28830 8056 5063 gene locus_tag LOCUS_28840 8056 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 8894 8133 gene locus_tag LOCUS_28850 8894 8133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 >Feature sequence183 730 572 gene locus_tag LOCUS_28860 730 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 1155 2102 gene locus_tag LOCUS_28870 gene queG 1155 2102 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920720.1 protein_id gnl|my_center|LOCUS_28870 2092 2730 gene locus_tag LOCUS_28880 2092 2730 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025687389.1 protein_id gnl|my_center|LOCUS_28880 3014 2929 gene locus_tag LOCUS_t00220 3014 2929 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3187 3426 gene locus_tag LOCUS_28890 gene ndhL 3187 3426 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056553.1 protein_id gnl|my_center|LOCUS_28890 3447 3752 gene locus_tag LOCUS_28900 3447 3752 CDS product DUF3007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056554.1 protein_id gnl|my_center|LOCUS_28900 3975 4403 gene locus_tag LOCUS_28910 3975 4403 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_28910 5900 4473 gene locus_tag LOCUS_28920 5900 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 7657 5912 gene locus_tag LOCUS_28930 7657 5912 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056587.1 protein_id gnl|my_center|LOCUS_28930 8776 7775 gene locus_tag LOCUS_28940 8776 7775 CDS product LdpA C-terminal domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056586.1 protein_id gnl|my_center|LOCUS_28940 >Feature sequence184 551 1117 gene locus_tag LOCUS_28950 551 1117 CDS product photosystem I assembly protein Ycf4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057228.1 protein_id gnl|my_center|LOCUS_28950 1146 1883 gene locus_tag LOCUS_28960 1146 1883 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055992.1 protein_id gnl|my_center|LOCUS_28960 2045 3169 gene locus_tag LOCUS_28970 2045 3169 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056469.1 protein_id gnl|my_center|LOCUS_28970 3652 5532 gene locus_tag LOCUS_28980 gene dnaG 3652 5532 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057157.1 protein_id gnl|my_center|LOCUS_28980 6831 5545 gene locus_tag LOCUS_28990 6831 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142706.1 protein_id gnl|my_center|LOCUS_28990 8077 6917 gene locus_tag LOCUS_29000 8077 6917 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056459.1 protein_id gnl|my_center|LOCUS_29000 9149 8598 gene locus_tag LOCUS_29010 9149 8598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 >Feature sequence185 636 154 gene locus_tag LOCUS_29020 636 154 CDS product photosystem I reaction center protein subunit XI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058236.1 protein_id gnl|my_center|LOCUS_29020 1514 1104 gene locus_tag LOCUS_29030 1514 1104 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058102.1 protein_id gnl|my_center|LOCUS_29030 1678 2886 gene locus_tag LOCUS_29040 1678 2886 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058101.1 protein_id gnl|my_center|LOCUS_29040 3663 3079 gene locus_tag LOCUS_29050 3663 3079 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_29050 5176 3821 gene locus_tag LOCUS_29060 gene opcA 5176 3821 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056389.1 protein_id gnl|my_center|LOCUS_29060 6972 5443 gene locus_tag LOCUS_29070 gene zwf 6972 5443 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056390.1 protein_id gnl|my_center|LOCUS_29070 8584 7394 gene locus_tag LOCUS_29080 8584 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 >Feature sequence186 548 5122 gene locus_tag LOCUS_29090 gene gltB 548 5122 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_29090 5184 6518 gene locus_tag LOCUS_29100 5184 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 7046 7252 gene locus_tag LOCUS_29110 7046 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 7398 7625 gene locus_tag LOCUS_29120 7398 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 7999 7616 gene locus_tag LOCUS_29130 7999 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 8362 9111 gene locus_tag LOCUS_29140 8362 9111 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124783.1 protein_id gnl|my_center|LOCUS_29140 >Feature sequence187 159 395 gene locus_tag LOCUS_29150 159 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 407 682 gene locus_tag LOCUS_29160 407 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 713 1672 gene locus_tag LOCUS_29170 gene xerD 713 1672 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068014.1 protein_id gnl|my_center|LOCUS_29170 2303 1737 gene locus_tag LOCUS_29180 2303 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 2973 3755 gene locus_tag LOCUS_29190 2973 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 7265 4065 gene locus_tag LOCUS_29200 7265 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 7895 7689 gene locus_tag LOCUS_29210 7895 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 8287 8105 gene locus_tag LOCUS_29220 8287 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 9034 8522 gene locus_tag LOCUS_29230 9034 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 >Feature sequence188 2973 181 gene locus_tag LOCUS_29240 2973 181 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057035.1 protein_id gnl|my_center|LOCUS_29240 4422 3196 gene locus_tag LOCUS_29250 4422 3196 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_29250 5598 4471 gene locus_tag LOCUS_29260 5598 4471 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056993.1 protein_id gnl|my_center|LOCUS_29260 5683 6618 gene locus_tag LOCUS_29270 5683 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 8886 6688 gene locus_tag LOCUS_29280 8886 6688 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143066.1 protein_id gnl|my_center|LOCUS_29280 >Feature sequence189 393 73 gene locus_tag LOCUS_29290 393 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 634 377 gene locus_tag LOCUS_29300 634 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 2175 664 gene locus_tag LOCUS_29310 gene gpmI 2175 664 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056006.1 protein_id gnl|my_center|LOCUS_29310 2369 3346 gene locus_tag LOCUS_29320 2369 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 3738 4217 gene locus_tag LOCUS_29330 3738 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 4202 4852 gene locus_tag LOCUS_29340 4202 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 4928 7477 gene locus_tag LOCUS_29350 4928 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 7548 8759 gene locus_tag LOCUS_29360 7548 8759 CDS product DUF4407 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_29360 >Feature sequence190 327 701 gene locus_tag LOCUS_29370 327 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 1622 642 gene locus_tag LOCUS_29380 gene cbiB 1622 642 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058209.1 protein_id gnl|my_center|LOCUS_29380 2032 1625 gene locus_tag LOCUS_29390 2032 1625 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530041.1 protein_id gnl|my_center|LOCUS_29390 2489 2046 gene locus_tag LOCUS_29400 2489 2046 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056024.1 protein_id gnl|my_center|LOCUS_29400 2790 3179 gene locus_tag LOCUS_29410 2790 3179 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058006.1 protein_id gnl|my_center|LOCUS_29410 3615 3448 gene locus_tag LOCUS_29420 3615 3448 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390272.1 protein_id gnl|my_center|LOCUS_29420 3724 4089 gene locus_tag LOCUS_29430 3724 4089 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_29430 5594 4296 gene locus_tag LOCUS_29440 gene eno 5594 4296 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056505.1 protein_id gnl|my_center|LOCUS_29440 6402 5641 gene locus_tag LOCUS_29450 6402 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 8596 6518 gene locus_tag LOCUS_29460 gene glgX 8596 6518 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706229.1 protein_id gnl|my_center|LOCUS_29460 8659 8844 gene locus_tag LOCUS_29470 8659 8844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 >Feature sequence191 1455 466 gene locus_tag LOCUS_29480 1455 466 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057151.1 protein_id gnl|my_center|LOCUS_29480 1629 2576 gene locus_tag LOCUS_29490 gene speE 1629 2576 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583812.1 protein_id gnl|my_center|LOCUS_29490 4942 2660 gene locus_tag LOCUS_29500 gene recJ 4942 2660 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056029.1 protein_id gnl|my_center|LOCUS_29500 5241 4987 gene locus_tag LOCUS_29510 5241 4987 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144349.1 protein_id gnl|my_center|LOCUS_29510 8284 5261 gene locus_tag LOCUS_29520 8284 5261 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058009.1 protein_id gnl|my_center|LOCUS_29520 >Feature sequence192 546 70 gene locus_tag LOCUS_29530 546 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 1206 973 gene locus_tag LOCUS_29540 1206 973 CDS product photosystem I reaction center subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057407.1 protein_id gnl|my_center|LOCUS_29540 1914 1285 gene locus_tag LOCUS_29550 1914 1285 CDS product DUF6391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140118.1 protein_id gnl|my_center|LOCUS_29550 3032 1911 gene locus_tag LOCUS_29560 3032 1911 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056632.1 protein_id gnl|my_center|LOCUS_29560 3749 3048 gene locus_tag LOCUS_29570 3749 3048 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920927.1 protein_id gnl|my_center|LOCUS_29570 4072 4242 gene locus_tag LOCUS_29580 4072 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 4551 6491 gene locus_tag LOCUS_29590 4551 6491 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 protein_id gnl|my_center|LOCUS_29590 6491 6898 gene locus_tag LOCUS_29600 6491 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 7192 6941 gene locus_tag LOCUS_29610 7192 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056812.1 protein_id gnl|my_center|LOCUS_29610 7976 7197 gene locus_tag LOCUS_29620 7976 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105219828.1 protein_id gnl|my_center|LOCUS_29620 8378 7986 gene locus_tag LOCUS_29630 8378 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 >Feature sequence193 113 856 gene locus_tag LOCUS_29640 113 856 CDS product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057089.1 protein_id gnl|my_center|LOCUS_29640 1151 2410 gene locus_tag LOCUS_29650 1151 2410 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057139.1 protein_id gnl|my_center|LOCUS_29650 2675 3622 gene locus_tag LOCUS_29660 2675 3622 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920765.1 protein_id gnl|my_center|LOCUS_29660 3997 3770 gene locus_tag LOCUS_29670 3997 3770 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391794.1 protein_id gnl|my_center|LOCUS_29670 4199 3990 gene locus_tag LOCUS_29680 4199 3990 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021610.1 protein_id gnl|my_center|LOCUS_29680 4691 4416 gene locus_tag LOCUS_29690 4691 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_29690 5768 4929 gene locus_tag LOCUS_29700 5768 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 6563 6123 gene locus_tag LOCUS_29710 6563 6123 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_29710 8264 7278 gene locus_tag LOCUS_29720 8264 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 8741 8268 gene locus_tag LOCUS_29730 8741 8268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 >Feature sequence194 362 228 gene locus_tag LOCUS_29740 362 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 581 1939 gene locus_tag LOCUS_29750 gene glmU 581 1939 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920683.1 protein_id gnl|my_center|LOCUS_29750 3734 2289 gene locus_tag LOCUS_29760 3734 2289 CDS product DUF3370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921041.1 protein_id gnl|my_center|LOCUS_29760 4152 3922 gene locus_tag LOCUS_29770 4152 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 4331 4912 gene locus_tag LOCUS_29780 4331 4912 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_29780 6222 4972 gene locus_tag LOCUS_29790 6222 4972 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920846.1 protein_id gnl|my_center|LOCUS_29790 6306 7283 gene locus_tag LOCUS_29800 6306 7283 CDS product tocopherol cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530023.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29800 7377 7727 gene locus_tag LOCUS_29810 7377 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 >Feature sequence195 281 910 gene locus_tag LOCUS_29820 281 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 932 1087 gene locus_tag LOCUS_29830 932 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 1150 1848 gene locus_tag LOCUS_29840 1150 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29840 1861 3621 gene locus_tag LOCUS_29850 1861 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29850 3671 3859 gene locus_tag LOCUS_29860 3671 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 3908 4237 gene locus_tag LOCUS_29870 3908 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29870 4402 6006 gene locus_tag LOCUS_29880 4402 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 7032 6091 gene locus_tag LOCUS_29890 7032 6091 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957516.1 protein_id gnl|my_center|LOCUS_29890 7087 7299 gene locus_tag LOCUS_29900 7087 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 7296 7709 gene locus_tag LOCUS_29910 7296 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 8105 7722 gene locus_tag LOCUS_29920 8105 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 8409 8768 gene locus_tag LOCUS_29930 8409 8768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 >Feature sequence196 250 44 gene locus_tag LOCUS_29940 250 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 935 853 gene locus_tag LOCUS_t00230 935 853 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1008 1859 gene locus_tag LOCUS_29950 gene lgt 1008 1859 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057991.1 protein_id gnl|my_center|LOCUS_29950 1872 2822 gene locus_tag LOCUS_29960 1872 2822 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479942.1 protein_id gnl|my_center|LOCUS_29960 3827 2829 gene locus_tag LOCUS_29970 3827 2829 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928617.1 protein_id gnl|my_center|LOCUS_29970 4347 4072 gene locus_tag LOCUS_29980 4347 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 5284 4724 gene locus_tag LOCUS_29990 5284 4724 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056696.1 protein_id gnl|my_center|LOCUS_29990 5363 6253 gene locus_tag LOCUS_30000 5363 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 6276 6932 gene locus_tag LOCUS_30010 6276 6932 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057529.1 protein_id gnl|my_center|LOCUS_30010 7476 8249 gene locus_tag LOCUS_30020 7476 8249 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_30020 >Feature sequence197 155 1474 gene locus_tag LOCUS_30030 155 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 2612 1710 gene locus_tag LOCUS_30040 2612 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 3283 4401 gene locus_tag LOCUS_30050 gene rfbG 3283 4401 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_30050 4476 5813 gene locus_tag LOCUS_30060 gene rfbH 4476 5813 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_30060 7358 7062 gene locus_tag LOCUS_30070 7358 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 7653 8024 gene locus_tag LOCUS_30080 7653 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 8121 8435 gene locus_tag LOCUS_30090 8121 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 >Feature sequence198 457 384 gene locus_tag LOCUS_t00240 457 384 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 559 945 gene locus_tag LOCUS_30100 559 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 1326 1198 gene locus_tag LOCUS_30110 1326 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 1591 1319 gene locus_tag LOCUS_30120 1591 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 2024 1704 gene locus_tag LOCUS_30130 2024 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 3259 2024 gene locus_tag LOCUS_30140 3259 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 3751 5004 gene locus_tag LOCUS_30150 3751 5004 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073594983.1 protein_id gnl|my_center|LOCUS_30150 5201 5332 gene locus_tag LOCUS_30160 5201 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 7011 5416 gene locus_tag LOCUS_30170 7011 5416 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058049.1 protein_id gnl|my_center|LOCUS_30170 7204 7803 gene locus_tag LOCUS_30180 7204 7803 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_30180 7926 8393 gene locus_tag LOCUS_30190 7926 8393 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_30190 >Feature sequence199 571 362 gene locus_tag LOCUS_30200 571 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 747 574 gene locus_tag LOCUS_30210 747 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 1189 881 gene locus_tag LOCUS_30220 1189 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 1196 3106 gene locus_tag LOCUS_30230 1196 3106 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083755.1 protein_id gnl|my_center|LOCUS_30230 3127 4407 gene locus_tag LOCUS_30240 gene hisS 3127 4407 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057735.1 protein_id gnl|my_center|LOCUS_30240 4449 5099 gene locus_tag LOCUS_30250 4449 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 5312 5515 gene locus_tag LOCUS_30260 5312 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 5531 5860 gene locus_tag LOCUS_30270 5531 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 7669 5936 gene locus_tag LOCUS_30280 gene murJ 7669 5936 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058183.1 protein_id gnl|my_center|LOCUS_30280 7812 8426 gene locus_tag LOCUS_30290 7812 8426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 >Feature sequence200 1155 301 gene locus_tag LOCUS_30300 1155 301 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058003.1 protein_id gnl|my_center|LOCUS_30300 1529 2224 gene locus_tag LOCUS_30310 gene trmD 1529 2224 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057450.1 protein_id gnl|my_center|LOCUS_30310 3745 2249 gene locus_tag LOCUS_30320 3745 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 3938 3867 gene locus_tag LOCUS_t00250 3938 3867 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5305 4259 gene locus_tag LOCUS_30330 5305 4259 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920885.1 protein_id gnl|my_center|LOCUS_30330 5594 6235 gene locus_tag LOCUS_30340 5594 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056166.1 protein_id gnl|my_center|LOCUS_30340 6512 6258 gene locus_tag LOCUS_30350 6512 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 7945 6569 gene locus_tag LOCUS_30360 7945 6569 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329291.1 protein_id gnl|my_center|LOCUS_30360 >Feature sequence201 949 494 gene locus_tag LOCUS_30370 949 494 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929341.1 protein_id gnl|my_center|LOCUS_30370 1423 1262 gene locus_tag LOCUS_30380 1423 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 1558 2349 gene locus_tag LOCUS_30390 1558 2349 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_30390 3194 2346 gene locus_tag LOCUS_30400 gene nadC 3194 2346 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057550.1 protein_id gnl|my_center|LOCUS_30400 3832 3266 gene locus_tag LOCUS_30410 3832 3266 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_30410 3994 4461 gene locus_tag LOCUS_30420 3994 4461 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057639.1 protein_id gnl|my_center|LOCUS_30420 4504 4728 gene locus_tag LOCUS_30430 4504 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 4740 5783 gene locus_tag LOCUS_30440 4740 5783 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_30440 6080 7132 gene locus_tag LOCUS_30450 6080 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 7339 7719 gene locus_tag LOCUS_30460 7339 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057706.1 protein_id gnl|my_center|LOCUS_30460 8225 7758 gene locus_tag LOCUS_30470 8225 7758 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141481.1 protein_id gnl|my_center|LOCUS_30470 >Feature sequence202 116 556 gene locus_tag LOCUS_30480 116 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920753.1 protein_id gnl|my_center|LOCUS_30480 840 553 gene locus_tag LOCUS_30490 840 553 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929315.1 protein_id gnl|my_center|LOCUS_30490 1158 1616 gene locus_tag LOCUS_30500 gene rplI 1158 1616 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058245.1 protein_id gnl|my_center|LOCUS_30500 1716 2300 gene locus_tag LOCUS_30510 1716 2300 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057990.1 protein_id gnl|my_center|LOCUS_30510 2323 3123 gene locus_tag LOCUS_30520 gene xth 2323 3123 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920930.1 protein_id gnl|my_center|LOCUS_30520 3261 3815 gene locus_tag LOCUS_30530 3261 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 4133 3816 gene locus_tag LOCUS_30540 4133 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 5122 4229 gene locus_tag LOCUS_30550 5122 4229 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057737.1 protein_id gnl|my_center|LOCUS_30550 5691 5272 gene locus_tag LOCUS_30560 5691 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 5974 5675 gene locus_tag LOCUS_30570 5974 5675 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_30570 6500 7375 gene locus_tag LOCUS_30580 6500 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 7688 8128 gene locus_tag LOCUS_30590 7688 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30590 8149 8430 gene locus_tag LOCUS_30600 8149 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 >Feature sequence203 361 167 gene locus_tag LOCUS_30610 361 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 570 908 gene locus_tag LOCUS_30620 570 908 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055899.1 protein_id gnl|my_center|LOCUS_30620 1045 2121 gene locus_tag LOCUS_30630 gene hrcA 1045 2121 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056606.1 protein_id gnl|my_center|LOCUS_30630 2401 2108 gene locus_tag LOCUS_30640 2401 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 2780 3220 gene locus_tag LOCUS_30650 2780 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 6345 3349 gene locus_tag LOCUS_30660 6345 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 6545 6470 gene locus_tag LOCUS_t00260 6545 6470 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6646 7521 gene locus_tag LOCUS_30670 gene lipA 6646 7521 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921111.1 protein_id gnl|my_center|LOCUS_30670 8077 7484 gene locus_tag LOCUS_30680 gene rdgB 8077 7484 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057634.1 protein_id gnl|my_center|LOCUS_30680 >Feature sequence204 898 389 gene locus_tag LOCUS_30690 898 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 1435 923 gene locus_tag LOCUS_30700 1435 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 2178 1693 gene locus_tag LOCUS_30710 2178 1693 CDS product allophycocyanin subunit alpha-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920894.1 protein_id gnl|my_center|LOCUS_30710 2411 3190 gene locus_tag LOCUS_30720 2411 3190 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258918.1 protein_id gnl|my_center|LOCUS_30720 4843 3491 gene locus_tag LOCUS_30730 gene gor 4843 3491 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057447.1 protein_id gnl|my_center|LOCUS_30730 5018 6442 gene locus_tag LOCUS_30740 gene dacB 5018 6442 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057215.1 protein_id gnl|my_center|LOCUS_30740 6623 8101 gene locus_tag LOCUS_30750 gene glgA 6623 8101 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_30750 >Feature sequence205 119 1546 gene locus_tag LOCUS_30760 119 1546 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057441.1 protein_id gnl|my_center|LOCUS_30760 1555 2568 gene locus_tag LOCUS_30770 gene cydB 1555 2568 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057440.1 protein_id gnl|my_center|LOCUS_30770 3193 2651 gene locus_tag LOCUS_30780 3193 2651 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057399.1 protein_id gnl|my_center|LOCUS_30780 3401 3168 gene locus_tag LOCUS_30790 3401 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 3482 4171 gene locus_tag LOCUS_30800 3482 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 4581 5744 gene locus_tag LOCUS_30810 4581 5744 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058024.1 protein_id gnl|my_center|LOCUS_30810 5939 6280 gene locus_tag LOCUS_30820 5939 6280 CDS product DUF760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124133.1 protein_id gnl|my_center|LOCUS_30820 8308 6455 gene locus_tag LOCUS_30830 8308 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 >Feature sequence206 211 999 gene locus_tag LOCUS_30840 211 999 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545759.1 protein_id gnl|my_center|LOCUS_30840 1159 1743 gene locus_tag LOCUS_30850 1159 1743 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056493.1 protein_id gnl|my_center|LOCUS_30850 1847 3235 gene locus_tag LOCUS_30860 1847 3235 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_30860 3235 3804 gene locus_tag LOCUS_30870 3235 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 4307 3879 gene locus_tag LOCUS_30880 4307 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056982.1 protein_id gnl|my_center|LOCUS_30880 4505 5806 gene locus_tag LOCUS_30890 4505 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057293.1 protein_id gnl|my_center|LOCUS_30890 7714 6188 gene locus_tag LOCUS_30900 7714 6188 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_30900 7895 8236 gene locus_tag LOCUS_30910 7895 8236 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_30910 >Feature sequence207 375 226 gene locus_tag LOCUS_30920 375 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 561 1163 gene locus_tag LOCUS_30930 561 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 1179 2210 gene locus_tag LOCUS_30940 1179 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 2218 3642 gene locus_tag LOCUS_30950 2218 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 3653 4636 gene locus_tag LOCUS_30960 3653 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 4772 5005 gene locus_tag LOCUS_30970 4772 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 5142 5969 gene locus_tag LOCUS_30980 gene cmr4 5142 5969 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880200.1 protein_id gnl|my_center|LOCUS_30980 5989 6396 gene locus_tag LOCUS_30990 5989 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 6402 8015 gene locus_tag LOCUS_31000 6402 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 >Feature sequence208 60 716 gene locus_tag LOCUS_31010 60 716 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141012.1 protein_id gnl|my_center|LOCUS_31010 1112 723 gene locus_tag LOCUS_31020 1112 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 1111 2049 gene locus_tag LOCUS_31030 1111 2049 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057118.1 protein_id gnl|my_center|LOCUS_31030 2728 2036 gene locus_tag LOCUS_31040 gene tpiA 2728 2036 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798681.1 protein_id gnl|my_center|LOCUS_31040 3138 3902 gene locus_tag LOCUS_31050 3138 3902 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337498.1 protein_id gnl|my_center|LOCUS_31050 5068 3821 gene locus_tag LOCUS_31060 5068 3821 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920848.1 protein_id gnl|my_center|LOCUS_31060 5843 5217 gene locus_tag LOCUS_31070 5843 5217 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057328.1 protein_id gnl|my_center|LOCUS_31070 6632 5910 gene locus_tag LOCUS_31080 gene pgl 6632 5910 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_31080 6957 7748 gene locus_tag LOCUS_31090 6957 7748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 >Feature sequence209 516 1670 gene locus_tag LOCUS_31100 516 1670 CDS product NAD(P)H-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057128.1 protein_id gnl|my_center|LOCUS_31100 1971 1807 gene locus_tag LOCUS_31110 1971 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 2098 3444 gene locus_tag LOCUS_31120 2098 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 3553 4524 gene locus_tag LOCUS_31130 3553 4524 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_31130 4533 7490 gene locus_tag LOCUS_31140 4533 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 7823 8026 gene locus_tag LOCUS_31150 7823 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 >Feature sequence210 1053 115 gene locus_tag LOCUS_31160 1053 115 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056037.1 protein_id gnl|my_center|LOCUS_31160 1927 1106 gene locus_tag LOCUS_31170 1927 1106 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057494.1 protein_id gnl|my_center|LOCUS_31170 2310 1942 gene locus_tag LOCUS_31180 2310 1942 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057493.1 protein_id gnl|my_center|LOCUS_31180 3116 2892 gene locus_tag LOCUS_31190 3116 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 3402 3094 gene locus_tag LOCUS_31200 3402 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 5931 3685 gene locus_tag LOCUS_31210 5931 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 6869 5928 gene locus_tag LOCUS_31220 6869 5928 CDS product homogentisate phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140287.1 protein_id gnl|my_center|LOCUS_31220 7115 7203 gene locus_tag LOCUS_t00270 7115 7203 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8031 7369 gene locus_tag LOCUS_31230 8031 7369 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_31230 >Feature sequence211 850 305 gene locus_tag LOCUS_31240 gene rsmD 850 305 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056896.1 protein_id gnl|my_center|LOCUS_31240 1531 854 gene locus_tag LOCUS_31250 1531 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 2671 1715 gene locus_tag LOCUS_31260 gene era 2671 1715 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055911.1 protein_id gnl|my_center|LOCUS_31260 2728 3474 gene locus_tag LOCUS_31270 2728 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929385.1 protein_id gnl|my_center|LOCUS_31270 3815 4939 gene locus_tag LOCUS_31280 gene cbiD 3815 4939 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056612.1 protein_id gnl|my_center|LOCUS_31280 5074 6708 gene locus_tag LOCUS_31290 gene guaA 5074 6708 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058250.1 protein_id gnl|my_center|LOCUS_31290 7354 8127 gene locus_tag LOCUS_31300 7354 8127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 >Feature sequence212 1251 430 gene locus_tag LOCUS_31310 1251 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 1243 1404 gene locus_tag LOCUS_31320 1243 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 1692 1564 gene locus_tag LOCUS_31330 1692 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 3181 1913 gene locus_tag LOCUS_31340 3181 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 3357 4628 gene locus_tag LOCUS_31350 3357 4628 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088243667.1 protein_id gnl|my_center|LOCUS_31350 4713 5873 gene locus_tag LOCUS_31360 4713 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 5900 6472 gene locus_tag LOCUS_31370 5900 6472 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_31370 7983 6559 gene locus_tag LOCUS_31380 7983 6559 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_31380 >Feature sequence213 2702 168 gene locus_tag LOCUS_31390 2702 168 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141000.1 protein_id gnl|my_center|LOCUS_31390 2872 3858 gene locus_tag LOCUS_31400 2872 3858 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_31400 4335 3931 gene locus_tag LOCUS_31410 gene crcB 4335 3931 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927153.1 protein_id gnl|my_center|LOCUS_31410 4765 4352 gene locus_tag LOCUS_31420 gene crcB 4765 4352 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258331.1 protein_id gnl|my_center|LOCUS_31420 4890 5696 gene locus_tag LOCUS_31430 gene rsmA 4890 5696 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056506.1 protein_id gnl|my_center|LOCUS_31430 5714 6655 gene locus_tag LOCUS_31440 gene ispE 5714 6655 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056351.1 protein_id gnl|my_center|LOCUS_31440 7489 6677 gene locus_tag LOCUS_31450 7489 6677 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056386.1 protein_id gnl|my_center|LOCUS_31450 7660 7493 gene locus_tag LOCUS_31460 7660 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 >Feature sequence214 <1 2621 gene locus_tag LOCUS_31470 <1 2621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099797887.1:bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase 2641 3873 gene locus_tag LOCUS_31480 2641 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 3873 4583 gene locus_tag LOCUS_31490 3873 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 4612 4734 gene locus_tag LOCUS_31500 4612 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 4913 5833 gene locus_tag LOCUS_31510 4913 5833 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_31510 5915 7624 gene locus_tag LOCUS_31520 gene ureC 5915 7624 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055860.1 protein_id gnl|my_center|LOCUS_31520 7922 7668 gene locus_tag LOCUS_31530 7922 7668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 >Feature sequence215 <1 511 gene locus_tag LOCUS_31540 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929167.1:PIN domain-containing protein 726 1046 gene locus_tag LOCUS_31550 726 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 2012 1515 gene locus_tag LOCUS_31560 2012 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 2116 3111 gene locus_tag LOCUS_31570 2116 3111 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190761.1 protein_id gnl|my_center|LOCUS_31570 3310 3687 gene locus_tag LOCUS_31580 3310 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 3753 4613 gene locus_tag LOCUS_31590 3753 4613 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056438.1 protein_id gnl|my_center|LOCUS_31590 4643 5686 gene locus_tag LOCUS_31600 4643 5686 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141878.1 protein_id gnl|my_center|LOCUS_31600 5754 6740 gene locus_tag LOCUS_31610 5754 6740 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056617.1 protein_id gnl|my_center|LOCUS_31610 7946 6717 gene locus_tag LOCUS_31620 7946 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 >Feature sequence216 1067 135 gene locus_tag LOCUS_31630 1067 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 1483 1214 gene locus_tag LOCUS_31640 gene rpmA 1483 1214 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140826.1 protein_id gnl|my_center|LOCUS_31640 1907 1518 gene locus_tag LOCUS_31650 gene rplU 1907 1518 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056022.1 protein_id gnl|my_center|LOCUS_31650 2103 3023 gene locus_tag LOCUS_31660 gene murQ 2103 3023 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057013.1 protein_id gnl|my_center|LOCUS_31660 3051 4541 gene locus_tag LOCUS_31670 3051 4541 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057032.1 protein_id gnl|my_center|LOCUS_31670 4721 5086 gene locus_tag LOCUS_31680 4721 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 5196 5774 gene locus_tag LOCUS_31690 5196 5774 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125221.1 protein_id gnl|my_center|LOCUS_31690 6536 5946 gene locus_tag LOCUS_31700 6536 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 7047 6538 gene locus_tag LOCUS_31710 7047 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31710 <8085 7049 gene locus_tag LOCUS_31720 <8085 7049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023520.1:HEAT repeat domain-containing protein >Feature sequence217 3268 413 gene locus_tag LOCUS_31730 3268 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 4836 3997 gene locus_tag LOCUS_31740 gene ylqF 4836 3997 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057347.1 protein_id gnl|my_center|LOCUS_31740 4944 5486 gene locus_tag LOCUS_31750 4944 5486 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_31750 5611 6552 gene locus_tag LOCUS_31760 5611 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_31760 7533 6592 gene locus_tag LOCUS_31770 7533 6592 CDS product TIGR04168 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235619519.1 protein_id gnl|my_center|LOCUS_31770 7635 7838 gene locus_tag LOCUS_31780 7635 7838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31780 >Feature sequence218 979 443 gene locus_tag LOCUS_31790 979 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524130.1 protein_id gnl|my_center|LOCUS_31790 2288 1074 gene locus_tag LOCUS_31800 2288 1074 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798964.1 protein_id gnl|my_center|LOCUS_31800 3796 2696 gene locus_tag LOCUS_31810 3796 2696 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055976.1 protein_id gnl|my_center|LOCUS_31810 5971 3956 gene locus_tag LOCUS_31820 5971 3956 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055977.1 protein_id gnl|my_center|LOCUS_31820 6301 7023 gene locus_tag LOCUS_31830 gene grpE 6301 7023 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057154.1 protein_id gnl|my_center|LOCUS_31830 7774 7055 gene locus_tag LOCUS_31840 7774 7055 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920819.1 protein_id gnl|my_center|LOCUS_31840 >Feature sequence219 1166 1405 gene locus_tag LOCUS_31850 1166 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 1395 1733 gene locus_tag LOCUS_31860 1395 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 2122 3270 gene locus_tag LOCUS_31870 gene dprA 2122 3270 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920872.1 protein_id gnl|my_center|LOCUS_31870 3603 3280 gene locus_tag LOCUS_31880 gene trxA 3603 3280 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140882.1 protein_id gnl|my_center|LOCUS_31880 3981 5186 gene locus_tag LOCUS_31890 3981 5186 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141002.1 protein_id gnl|my_center|LOCUS_31890 5741 5190 gene locus_tag LOCUS_31900 5741 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 6511 5855 gene locus_tag LOCUS_31910 6511 5855 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141737.1 protein_id gnl|my_center|LOCUS_31910 7369 6779 gene locus_tag LOCUS_31920 7369 6779 CDS product PAP/fibrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056274.1 protein_id gnl|my_center|LOCUS_31920 >Feature sequence220 946 1194 gene locus_tag LOCUS_31930 946 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142425.1 protein_id gnl|my_center|LOCUS_31930 1187 1597 gene locus_tag LOCUS_31940 1187 1597 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_31940 2006 2554 gene locus_tag LOCUS_31950 2006 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 2574 2819 gene locus_tag LOCUS_31960 2574 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 2829 3068 gene locus_tag LOCUS_31970 2829 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 3068 3496 gene locus_tag LOCUS_31980 3068 3496 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393815.1 protein_id gnl|my_center|LOCUS_31980 3812 4051 gene locus_tag LOCUS_31990 3812 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 4041 4463 gene locus_tag LOCUS_32000 4041 4463 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_32000 4653 4784 gene locus_tag LOCUS_32010 4653 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 4817 5101 gene locus_tag LOCUS_32020 4817 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 5486 5665 gene locus_tag LOCUS_32030 5486 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 6374 5922 gene locus_tag LOCUS_32040 6374 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 6606 7469 gene locus_tag LOCUS_32050 6606 7469 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_32050 >Feature sequence221 641 1558 gene locus_tag LOCUS_32060 641 1558 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_32060 1569 2264 gene locus_tag LOCUS_32070 1569 2264 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_32070 2407 2847 gene locus_tag LOCUS_32080 2407 2847 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141481.1 protein_id gnl|my_center|LOCUS_32080 3928 2975 gene locus_tag LOCUS_32090 3928 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 5434 3947 gene locus_tag LOCUS_32100 5434 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 6207 6545 gene locus_tag LOCUS_32110 6207 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 6810 7046 gene locus_tag LOCUS_32120 6810 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 7150 7644 gene locus_tag LOCUS_32130 7150 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 >Feature sequence222 316 717 gene locus_tag LOCUS_32140 316 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057265.1 protein_id gnl|my_center|LOCUS_32140 1107 2582 gene locus_tag LOCUS_32150 1107 2582 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057553.1 protein_id gnl|my_center|LOCUS_32150 2592 2831 gene locus_tag LOCUS_32160 2592 2831 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141646.1 protein_id gnl|my_center|LOCUS_32160 3119 3736 gene locus_tag LOCUS_32170 3119 3736 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403388.1 protein_id gnl|my_center|LOCUS_32170 4541 3837 gene locus_tag LOCUS_32180 4541 3837 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144068.1 protein_id gnl|my_center|LOCUS_32180 4558 5328 gene locus_tag LOCUS_32190 4558 5328 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550381.1 protein_id gnl|my_center|LOCUS_32190 5389 6420 gene locus_tag LOCUS_32200 5389 6420 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 protein_id gnl|my_center|LOCUS_32200 7310 6423 gene locus_tag LOCUS_32210 7310 6423 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 protein_id gnl|my_center|LOCUS_32210 >Feature sequence223 264 2321 gene locus_tag LOCUS_32220 gene htpG 264 2321 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057033.1 protein_id gnl|my_center|LOCUS_32220 2551 4053 gene locus_tag LOCUS_32230 2551 4053 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_32230 4114 4464 gene locus_tag LOCUS_32240 4114 4464 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085898.1 protein_id gnl|my_center|LOCUS_32240 5339 4461 gene locus_tag LOCUS_32250 5339 4461 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_32250 7311 5428 gene locus_tag LOCUS_32260 7311 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 >Feature sequence224 453 214 gene locus_tag LOCUS_32270 453 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 713 489 gene locus_tag LOCUS_32280 713 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 1214 2362 gene locus_tag LOCUS_32290 1214 2362 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_32290 2479 2775 gene locus_tag LOCUS_32300 2479 2775 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_32300 2772 4181 gene locus_tag LOCUS_32310 2772 4181 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_32310 4481 4242 gene locus_tag LOCUS_32320 4481 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 4543 4710 gene locus_tag LOCUS_32330 4543 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 5025 6500 gene locus_tag LOCUS_32340 5025 6500 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057582.1 protein_id gnl|my_center|LOCUS_32340 >Feature sequence225 <1 560 gene locus_tag LOCUS_32350 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967016.1:M10 family metallopeptidase C-terminal domain-containing protein 938 1423 gene locus_tag LOCUS_32360 938 1423 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_32360 1529 2434 gene locus_tag LOCUS_32370 1529 2434 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 protein_id gnl|my_center|LOCUS_32370 2584 3348 gene locus_tag LOCUS_32380 gene fabG 2584 3348 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057342.1 protein_id gnl|my_center|LOCUS_32380 3617 4384 gene locus_tag LOCUS_32390 3617 4384 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920648.1 protein_id gnl|my_center|LOCUS_32390 4416 5153 gene locus_tag LOCUS_32400 4416 5153 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975024.1 protein_id gnl|my_center|LOCUS_32400 5273 5692 gene locus_tag LOCUS_32410 5273 5692 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920771.1 protein_id gnl|my_center|LOCUS_32410 5685 6572 gene locus_tag LOCUS_32420 5685 6572 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056486.1 protein_id gnl|my_center|LOCUS_32420 6551 6635 gene locus_tag LOCUS_t00280 6551 6635 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6948 7373 gene locus_tag LOCUS_32430 6948 7373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 >Feature sequence226 489 211 gene locus_tag LOCUS_32440 489 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 810 1103 gene locus_tag LOCUS_32450 810 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 1100 1444 gene locus_tag LOCUS_32460 1100 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 1849 2124 gene locus_tag LOCUS_32470 1849 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 2121 2486 gene locus_tag LOCUS_32480 2121 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 3938 2670 gene locus_tag LOCUS_32490 3938 2670 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228237.1 protein_id gnl|my_center|LOCUS_32490 5680 3938 gene locus_tag LOCUS_32500 5680 3938 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 protein_id gnl|my_center|LOCUS_32500 7018 5879 gene locus_tag LOCUS_32510 7018 5879 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058225.1 protein_id gnl|my_center|LOCUS_32510 >Feature sequence227 144 566 gene locus_tag LOCUS_32520 144 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 595 804 gene locus_tag LOCUS_32530 595 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 1527 2501 gene locus_tag LOCUS_32540 gene arsM 1527 2501 CDS product arsenosugar biosynthesis arsenite methyltransferase ArsM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_32540 2615 3592 gene locus_tag LOCUS_32550 gene arsS 2615 3592 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272452.1 protein_id gnl|my_center|LOCUS_32550 4072 3800 gene locus_tag LOCUS_32560 4072 3800 CDS product DUF3143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055972.1 protein_id gnl|my_center|LOCUS_32560 4572 4078 gene locus_tag LOCUS_32570 4572 4078 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055973.1 protein_id gnl|my_center|LOCUS_32570 4621 5184 gene locus_tag LOCUS_32580 4621 5184 CDS product thylakoid membrane photosystem I accumulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798220.1 protein_id gnl|my_center|LOCUS_32580 5456 7018 gene locus_tag LOCUS_32590 5456 7018 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_32590 >Feature sequence228 899 540 gene locus_tag LOCUS_32600 899 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 1231 896 gene locus_tag LOCUS_32610 1231 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 3994 1502 gene locus_tag LOCUS_32620 3994 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 6217 4151 gene locus_tag LOCUS_32630 6217 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 >Feature sequence229 1757 1413 gene locus_tag LOCUS_32640 1757 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 4029 1768 gene locus_tag LOCUS_32650 4029 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 4655 4203 gene locus_tag LOCUS_32660 4655 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 6612 4774 gene locus_tag LOCUS_32670 6612 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 7413 6616 gene locus_tag LOCUS_32680 gene modA 7413 6616 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032249.1 protein_id gnl|my_center|LOCUS_32680 >Feature sequence230 737 1741 gene locus_tag LOCUS_32690 737 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 2481 1858 gene locus_tag LOCUS_32700 2481 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 3371 2718 gene locus_tag LOCUS_32710 3371 2718 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889576.1 protein_id gnl|my_center|LOCUS_32710 4312 3386 gene locus_tag LOCUS_32720 4312 3386 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143466.1 protein_id gnl|my_center|LOCUS_32720 4515 5711 gene locus_tag LOCUS_32730 4515 5711 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058195.1 protein_id gnl|my_center|LOCUS_32730 5954 5700 gene locus_tag LOCUS_32740 5954 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 7279 6017 gene locus_tag LOCUS_32750 7279 6017 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166117.1 protein_id gnl|my_center|LOCUS_32750 >Feature sequence231 2252 522 gene locus_tag LOCUS_32760 2252 522 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057893.1 protein_id gnl|my_center|LOCUS_32760 3609 2503 gene locus_tag LOCUS_32770 gene gcvT 3609 2503 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143519.1 protein_id gnl|my_center|LOCUS_32770 5461 3752 gene locus_tag LOCUS_32780 5461 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 6721 5624 gene locus_tag LOCUS_32790 gene queA 6721 5624 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056766.1 protein_id gnl|my_center|LOCUS_32790 6883 7272 gene locus_tag LOCUS_32800 6883 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056454.1 protein_id gnl|my_center|LOCUS_32800 >Feature sequence232 185 1732 gene locus_tag LOCUS_32810 185 1732 CDS product bifunctional pantoate--beta-alanine ligase/(d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058282.1 protein_id gnl|my_center|LOCUS_32810 1717 2217 gene locus_tag LOCUS_32820 1717 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 2228 4051 gene locus_tag LOCUS_32830 2228 4051 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057687.1 protein_id gnl|my_center|LOCUS_32830 4066 4389 gene locus_tag LOCUS_32840 4066 4389 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056944.1 protein_id gnl|my_center|LOCUS_32840 4396 4914 gene locus_tag LOCUS_32850 4396 4914 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140843.1 protein_id gnl|my_center|LOCUS_32850 5317 4979 gene locus_tag LOCUS_32860 gene psb28 5317 4979 CDS product photosystem II reaction center protein Psb28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920702.1 protein_id gnl|my_center|LOCUS_32860 6231 7241 gene locus_tag LOCUS_32870 6231 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 >Feature sequence233 1111 131 gene locus_tag LOCUS_32880 gene chlG 1111 131 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920891.1 protein_id gnl|my_center|LOCUS_32880 2194 1118 gene locus_tag LOCUS_32890 2194 1118 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141227.1 protein_id gnl|my_center|LOCUS_32890 2522 2217 gene locus_tag LOCUS_32900 2522 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 3235 2903 gene locus_tag LOCUS_32910 3235 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 4442 3546 gene locus_tag LOCUS_32920 4442 3546 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057164.1 protein_id gnl|my_center|LOCUS_32920 5398 4766 gene locus_tag LOCUS_32930 5398 4766 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258297.1 protein_id gnl|my_center|LOCUS_32930 5914 5597 gene locus_tag LOCUS_32940 5914 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 6415 6128 gene locus_tag LOCUS_32950 6415 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 7083 6430 gene locus_tag LOCUS_32960 gene upp 7083 6430 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920929.1 protein_id gnl|my_center|LOCUS_32960 >Feature sequence234 1267 413 gene locus_tag LOCUS_32970 gene purU 1267 413 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524116.1 protein_id gnl|my_center|LOCUS_32970 1965 1390 gene locus_tag LOCUS_32980 1965 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 2252 2010 gene locus_tag LOCUS_32990 2252 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 2462 3313 gene locus_tag LOCUS_33000 2462 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 4585 3419 gene locus_tag LOCUS_33010 4585 3419 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920638.1 protein_id gnl|my_center|LOCUS_33010 4719 4647 gene locus_tag LOCUS_t00290 4719 4647 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5040 4840 gene locus_tag LOCUS_33020 5040 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 6142 5378 gene locus_tag LOCUS_33030 gene hisF 6142 5378 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799407.1 protein_id gnl|my_center|LOCUS_33030 6166 7221 gene locus_tag LOCUS_33040 gene ruvB 6166 7221 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058086.1 protein_id gnl|my_center|LOCUS_33040 >Feature sequence235 1738 245 gene locus_tag LOCUS_33050 1738 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 2366 1743 gene locus_tag LOCUS_33060 gene tmk 2366 1743 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250354.1 protein_id gnl|my_center|LOCUS_33060 3777 2392 gene locus_tag LOCUS_33070 gene lpdA 3777 2392 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830471.1 protein_id gnl|my_center|LOCUS_33070 4489 3854 gene locus_tag LOCUS_33080 gene hisIE 4489 3854 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056088.1 protein_id gnl|my_center|LOCUS_33080 5583 4936 gene locus_tag LOCUS_33090 5583 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 6429 7040 gene locus_tag LOCUS_33100 6429 7040 CDS product IS607-like element ISTko1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 protein_id gnl|my_center|LOCUS_33100 >Feature sequence236 844 215 gene locus_tag LOCUS_33110 844 215 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895592.1 protein_id gnl|my_center|LOCUS_33110 1990 1622 gene locus_tag LOCUS_33120 1990 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 2262 1987 gene locus_tag LOCUS_33130 2262 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_33130 2746 2330 gene locus_tag LOCUS_33140 2746 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 3579 3115 gene locus_tag LOCUS_33150 3579 3115 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_33150 4606 3623 gene locus_tag LOCUS_33160 gene msrP 4606 3623 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_33160 6122 4692 gene locus_tag LOCUS_33170 6122 4692 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_33170 6342 7097 gene locus_tag LOCUS_33180 6342 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 >Feature sequence237 988 266 gene locus_tag LOCUS_33190 988 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 1856 1002 gene locus_tag LOCUS_33200 1856 1002 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057597.1 protein_id gnl|my_center|LOCUS_33200 2333 1860 gene locus_tag LOCUS_33210 2333 1860 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125731.1 protein_id gnl|my_center|LOCUS_33210 2763 4112 gene locus_tag LOCUS_33220 2763 4112 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921237.1 protein_id gnl|my_center|LOCUS_33220 4206 4134 gene locus_tag LOCUS_t00300 4206 4134 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4334 5818 gene locus_tag LOCUS_33230 4334 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 6025 7029 gene locus_tag LOCUS_33240 6025 7029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 >Feature sequence238 374 628 gene locus_tag LOCUS_33250 374 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 609 869 gene locus_tag LOCUS_33260 609 869 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417760.1 protein_id gnl|my_center|LOCUS_33260 1324 3894 gene locus_tag LOCUS_33270 1324 3894 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058103.1 protein_id gnl|my_center|LOCUS_33270 4115 5362 gene locus_tag LOCUS_33280 gene trpB 4115 5362 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058306.1 protein_id gnl|my_center|LOCUS_33280 5854 7065 gene locus_tag LOCUS_33290 5854 7065 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162850918.1 protein_id gnl|my_center|LOCUS_33290 >Feature sequence239 714 475 gene locus_tag LOCUS_33300 714 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 1351 746 gene locus_tag LOCUS_33310 1351 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33310 3274 1781 gene locus_tag LOCUS_33320 3274 1781 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058069.1 protein_id gnl|my_center|LOCUS_33320 4079 3297 gene locus_tag LOCUS_33330 gene recO 4079 3297 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058068.1 protein_id gnl|my_center|LOCUS_33330 4357 4285 gene locus_tag LOCUS_t00310 4357 4285 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4435 5247 gene locus_tag LOCUS_33340 4435 5247 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085861.1 protein_id gnl|my_center|LOCUS_33340 6861 5296 gene locus_tag LOCUS_33350 6861 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 >Feature sequence240 235 603 gene locus_tag LOCUS_33360 235 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 693 1259 gene locus_tag LOCUS_33370 693 1259 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928692.1 protein_id gnl|my_center|LOCUS_33370 1274 1438 gene locus_tag LOCUS_33380 1274 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 1413 1574 gene locus_tag LOCUS_33390 1413 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 2935 1601 gene locus_tag LOCUS_33400 2935 1601 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460095.1 protein_id gnl|my_center|LOCUS_33400 3305 2964 gene locus_tag LOCUS_33410 3305 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 3845 3354 gene locus_tag LOCUS_33420 3845 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057012.1 protein_id gnl|my_center|LOCUS_33420 4322 4672 gene locus_tag LOCUS_33430 4322 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 4841 5347 gene locus_tag LOCUS_33440 4841 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 5535 6119 gene locus_tag LOCUS_33450 5535 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 6348 6623 gene locus_tag LOCUS_33460 6348 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_33460 6620 6991 gene locus_tag LOCUS_33470 6620 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 >Feature sequence241 707 519 gene locus_tag LOCUS_33480 707 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 1731 898 gene locus_tag LOCUS_33490 1731 898 CDS product photosystem II manganese-stabilizing polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056297.1 protein_id gnl|my_center|LOCUS_33490 1981 2325 gene locus_tag LOCUS_33500 1981 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 2394 3827 gene locus_tag LOCUS_33510 2394 3827 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920889.1 protein_id gnl|my_center|LOCUS_33510 5491 4136 gene locus_tag LOCUS_33520 5491 4136 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_33520 6787 5501 gene locus_tag LOCUS_33530 6787 5501 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_33530 >Feature sequence242 1713 241 gene locus_tag LOCUS_33540 gene gatB 1713 241 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058226.1 protein_id gnl|my_center|LOCUS_33540 2190 3719 gene locus_tag LOCUS_33550 2190 3719 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056367.1 protein_id gnl|my_center|LOCUS_33550 4096 3902 gene locus_tag LOCUS_33560 4096 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 4333 4908 gene locus_tag LOCUS_33570 4333 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 4910 6589 gene locus_tag LOCUS_33580 4910 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 6828 7037 gene locus_tag LOCUS_33590 6828 7037 CDS product glycogen debranching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921159.1 protein_id gnl|my_center|LOCUS_33590 >Feature sequence243 357 97 gene locus_tag LOCUS_33600 357 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 668 895 gene locus_tag LOCUS_33610 668 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 1180 923 gene locus_tag LOCUS_33620 1180 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 2028 1339 gene locus_tag LOCUS_33630 2028 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_33630 2263 3048 gene locus_tag LOCUS_33640 2263 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 3136 3372 gene locus_tag LOCUS_33650 3136 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 3376 3723 gene locus_tag LOCUS_33660 3376 3723 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817423.1 protein_id gnl|my_center|LOCUS_33660 4040 4462 gene locus_tag LOCUS_33670 4040 4462 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015159351.1 protein_id gnl|my_center|LOCUS_33670 5018 4467 gene locus_tag LOCUS_33680 5018 4467 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920633.1 protein_id gnl|my_center|LOCUS_33680 5124 6389 gene locus_tag LOCUS_33690 5124 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 6995 6342 gene locus_tag LOCUS_33700 6995 6342 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530085.1 protein_id gnl|my_center|LOCUS_33700 >Feature sequence244 304 98 gene locus_tag LOCUS_33710 304 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 1458 880 gene locus_tag LOCUS_33720 1458 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 4112 1743 gene locus_tag LOCUS_33730 4112 1743 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143626.1 protein_id gnl|my_center|LOCUS_33730 4906 4478 gene locus_tag LOCUS_33740 4906 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 6946 5756 gene locus_tag LOCUS_33750 6946 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 >Feature sequence245 1519 299 gene locus_tag LOCUS_33760 1519 299 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920707.1 protein_id gnl|my_center|LOCUS_33760 1784 1563 gene locus_tag LOCUS_33770 1784 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 3019 2132 gene locus_tag LOCUS_33780 gene argB 3019 2132 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_33780 4320 3097 gene locus_tag LOCUS_33790 4320 3097 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921052.1 protein_id gnl|my_center|LOCUS_33790 4933 5451 gene locus_tag LOCUS_33800 4933 5451 CDS product phycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057792.1 protein_id gnl|my_center|LOCUS_33800 5518 6006 gene locus_tag LOCUS_33810 gene cpcA 5518 6006 CDS product phycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057793.1 protein_id gnl|my_center|LOCUS_33810 6126 6941 gene locus_tag LOCUS_33820 6126 6941 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057794.1 protein_id gnl|my_center|LOCUS_33820 >Feature sequence246 751 1185 gene locus_tag LOCUS_33830 gene tnpA 751 1185 CDS product IS200/IS605-like element IS609 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604912.1 protein_id gnl|my_center|LOCUS_33830 1440 1874 gene locus_tag LOCUS_33840 1440 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 2262 3017 gene locus_tag LOCUS_33850 2262 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057863.1 protein_id gnl|my_center|LOCUS_33850 3060 3944 gene locus_tag LOCUS_33860 gene prmC 3060 3944 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172187304.1 protein_id gnl|my_center|LOCUS_33860 4477 3941 gene locus_tag LOCUS_33870 4477 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 5142 4441 gene locus_tag LOCUS_33880 gene pyrF 5142 4441 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141657.1 protein_id gnl|my_center|LOCUS_33880 5621 5157 gene locus_tag LOCUS_33890 5621 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 6825 5644 gene locus_tag LOCUS_33900 6825 5644 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055868.1 protein_id gnl|my_center|LOCUS_33900 >Feature sequence247 210 1529 gene locus_tag LOCUS_33910 gene secY 210 1529 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055954.1 protein_id gnl|my_center|LOCUS_33910 1600 2166 gene locus_tag LOCUS_33920 1600 2166 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038393.1 protein_id gnl|my_center|LOCUS_33920 2947 3633 gene locus_tag LOCUS_33930 2947 3633 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125538.1 protein_id gnl|my_center|LOCUS_33930 3669 4268 gene locus_tag LOCUS_33940 3669 4268 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125539.1 protein_id gnl|my_center|LOCUS_33940 4375 4785 gene locus_tag LOCUS_33950 4375 4785 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706948.1 protein_id gnl|my_center|LOCUS_33950 5558 4878 gene locus_tag LOCUS_33960 5558 4878 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056891.1 protein_id gnl|my_center|LOCUS_33960 6389 5934 gene locus_tag LOCUS_33970 6389 5934 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056015.1 protein_id gnl|my_center|LOCUS_33970 6747 6445 gene locus_tag LOCUS_33980 6747 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 >Feature sequence248 1604 402 gene locus_tag LOCUS_33990 1604 402 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057642.1 protein_id gnl|my_center|LOCUS_33990 2780 1647 gene locus_tag LOCUS_34000 2780 1647 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902302.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34000 3139 4326 gene locus_tag LOCUS_34010 3139 4326 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012165757.1 protein_id gnl|my_center|LOCUS_34010 4961 4638 gene locus_tag LOCUS_34020 4961 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 >Feature sequence249 <1 789 gene locus_tag LOCUS_34030 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929431.1:Uma2 family endonuclease 864 1469 gene locus_tag LOCUS_34040 gene cobO 864 1469 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056120.1 protein_id gnl|my_center|LOCUS_34040 2711 1971 gene locus_tag LOCUS_34050 2711 1971 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057232.1 protein_id gnl|my_center|LOCUS_34050 2786 3538 gene locus_tag LOCUS_34060 2786 3538 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056437.1 protein_id gnl|my_center|LOCUS_34060 3586 4878 gene locus_tag LOCUS_34070 3586 4878 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056769.1 protein_id gnl|my_center|LOCUS_34070 5058 5726 gene locus_tag LOCUS_34080 gene phoU 5058 5726 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583268.1 protein_id gnl|my_center|LOCUS_34080 6544 5753 gene locus_tag LOCUS_34090 6544 5753 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920815.1 protein_id gnl|my_center|LOCUS_34090 >Feature sequence250 451 963 gene locus_tag LOCUS_34100 451 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 1020 1808 gene locus_tag LOCUS_34110 1020 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058196.1 protein_id gnl|my_center|LOCUS_34110 2272 1817 gene locus_tag LOCUS_34120 2272 1817 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_34120 2843 2397 gene locus_tag LOCUS_34130 2843 2397 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391317.1 protein_id gnl|my_center|LOCUS_34130 3064 3999 gene locus_tag LOCUS_34140 3064 3999 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125025.1 protein_id gnl|my_center|LOCUS_34140 4262 4050 gene locus_tag LOCUS_34150 4262 4050 CDS product DUF2839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057932.1 protein_id gnl|my_center|LOCUS_34150 4419 5654 gene locus_tag LOCUS_34160 4419 5654 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057937.1 protein_id gnl|my_center|LOCUS_34160 5740 6576 gene locus_tag LOCUS_34170 5740 6576 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143597.1 protein_id gnl|my_center|LOCUS_34170 >Feature sequence251 737 363 gene locus_tag LOCUS_34180 737 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 1651 752 gene locus_tag LOCUS_34190 1651 752 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938053.1 protein_id gnl|my_center|LOCUS_34190 2909 1740 gene locus_tag LOCUS_34200 2909 1740 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_34200 3153 2983 gene locus_tag LOCUS_34210 3153 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 3938 3153 gene locus_tag LOCUS_34220 3938 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 4182 3997 gene locus_tag LOCUS_34230 4182 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 4818 4438 gene locus_tag LOCUS_34240 4818 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 5023 5472 gene locus_tag LOCUS_34250 5023 5472 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_34250 5485 6234 gene locus_tag LOCUS_34260 5485 6234 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_34260 >Feature sequence252 901 1353 gene locus_tag LOCUS_34270 901 1353 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141996.1 protein_id gnl|my_center|LOCUS_34270 2758 1502 gene locus_tag LOCUS_34280 gene larC 2758 1502 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058129.1 protein_id gnl|my_center|LOCUS_34280 2735 3376 gene locus_tag LOCUS_34290 2735 3376 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055998.1 protein_id gnl|my_center|LOCUS_34290 3627 4037 gene locus_tag LOCUS_34300 3627 4037 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_34300 4695 4096 gene locus_tag LOCUS_34310 gene raiA 4695 4096 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056677.1 protein_id gnl|my_center|LOCUS_34310 5446 5850 gene locus_tag LOCUS_34320 5446 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34320 6184 6363 gene locus_tag LOCUS_34330 6184 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 >Feature sequence253 780 91 gene locus_tag LOCUS_34340 780 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 1809 793 gene locus_tag LOCUS_34350 gene dcm 1809 793 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222381.1 protein_id gnl|my_center|LOCUS_34350 3150 2065 gene locus_tag LOCUS_34360 gene ald 3150 2065 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143957.1 protein_id gnl|my_center|LOCUS_34360 3708 3406 gene locus_tag LOCUS_34370 3708 3406 CDS product DUF3181 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920922.1 protein_id gnl|my_center|LOCUS_34370 3955 3701 gene locus_tag LOCUS_34380 3955 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057356.1 protein_id gnl|my_center|LOCUS_34380 5907 4039 gene locus_tag LOCUS_34390 5907 4039 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920876.1 protein_id gnl|my_center|LOCUS_34390 6510 6235 gene locus_tag LOCUS_34400 6510 6235 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812628.1 protein_id gnl|my_center|LOCUS_34400 >Feature sequence254 405 689 gene locus_tag LOCUS_34410 405 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34410 756 977 gene locus_tag LOCUS_34420 756 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 1905 1123 gene locus_tag LOCUS_34430 1905 1123 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140293.1 protein_id gnl|my_center|LOCUS_34430 2693 1920 gene locus_tag LOCUS_34440 gene cbiQ 2693 1920 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140294.1 protein_id gnl|my_center|LOCUS_34440 3156 2833 gene locus_tag LOCUS_34450 3156 2833 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140295.1 protein_id gnl|my_center|LOCUS_34450 3913 3170 gene locus_tag LOCUS_34460 3913 3170 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530095.1 protein_id gnl|my_center|LOCUS_34460 4382 5572 gene locus_tag LOCUS_34470 4382 5572 CDS product ScyD/ScyE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092108067.1 protein_id gnl|my_center|LOCUS_34470 5776 6312 gene locus_tag LOCUS_34480 5776 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 >Feature sequence255 1539 193 gene locus_tag LOCUS_34490 gene accC 1539 193 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 protein_id gnl|my_center|LOCUS_34490 1853 3109 gene locus_tag LOCUS_34500 gene hisD 1853 3109 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058085.1 protein_id gnl|my_center|LOCUS_34500 4329 3115 gene locus_tag LOCUS_34510 4329 3115 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_34510 6300 4726 gene locus_tag LOCUS_34520 6300 4726 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056564.1 protein_id gnl|my_center|LOCUS_34520 >Feature sequence256 328 83 gene locus_tag LOCUS_34530 328 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 1719 331 gene locus_tag LOCUS_34540 1719 331 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057595.1 protein_id gnl|my_center|LOCUS_34540 2348 3025 gene locus_tag LOCUS_34550 2348 3025 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058023.1 protein_id gnl|my_center|LOCUS_34550 3194 6241 gene locus_tag LOCUS_34560 3194 6241 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057001.1 protein_id gnl|my_center|LOCUS_34560 >Feature sequence257 1856 126 gene locus_tag LOCUS_34570 1856 126 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141774.1 protein_id gnl|my_center|LOCUS_34570 2222 2512 gene locus_tag LOCUS_34580 2222 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 4901 2637 gene locus_tag LOCUS_34590 gene hypF 4901 2637 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_34590 5625 4951 gene locus_tag LOCUS_34600 5625 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141964.1 protein_id gnl|my_center|LOCUS_34600 6088 5678 gene locus_tag LOCUS_34610 6088 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 >Feature sequence258 224 1117 gene locus_tag LOCUS_34620 224 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 1255 1734 gene locus_tag LOCUS_34630 1255 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143509.1 protein_id gnl|my_center|LOCUS_34630 2138 2419 gene locus_tag LOCUS_34640 2138 2419 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928995.1 protein_id gnl|my_center|LOCUS_34640 2474 2686 gene locus_tag LOCUS_34650 2474 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 2683 3036 gene locus_tag LOCUS_34660 2683 3036 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143142.1 protein_id gnl|my_center|LOCUS_34660 3043 3729 gene locus_tag LOCUS_34670 3043 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 4741 3965 gene locus_tag LOCUS_34680 4741 3965 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_34680 4890 5102 gene locus_tag LOCUS_34690 4890 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 5267 6265 gene locus_tag LOCUS_34700 5267 6265 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_34700 >Feature sequence259 1164 271 gene locus_tag LOCUS_34710 1164 271 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926022.1 protein_id gnl|my_center|LOCUS_34710 1480 1836 gene locus_tag LOCUS_34720 1480 1836 CDS product DUF1823 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057769.1 protein_id gnl|my_center|LOCUS_34720 1868 2998 gene locus_tag LOCUS_34730 1868 2998 CDS product CO2 hydration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057960.1 protein_id gnl|my_center|LOCUS_34730 3052 3615 gene locus_tag LOCUS_34740 3052 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 3619 3870 gene locus_tag LOCUS_34750 3619 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 3982 4155 gene locus_tag LOCUS_34760 3982 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 5454 4195 gene locus_tag LOCUS_34770 5454 4195 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544926.1 protein_id gnl|my_center|LOCUS_34770 6222 5623 gene locus_tag LOCUS_34780 6222 5623 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057294.1 protein_id gnl|my_center|LOCUS_34780 >Feature sequence260 403 1020 gene locus_tag LOCUS_34790 403 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 2042 1116 gene locus_tag LOCUS_34800 gene fabD 2042 1116 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920631.1 protein_id gnl|my_center|LOCUS_34800 3288 2314 gene locus_tag LOCUS_34810 3288 2314 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056689.1 protein_id gnl|my_center|LOCUS_34810 4911 3856 gene locus_tag LOCUS_34820 gene plsX 4911 3856 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056688.1 protein_id gnl|my_center|LOCUS_34820 5061 6353 gene locus_tag LOCUS_34830 5061 6353 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057931.1 protein_id gnl|my_center|LOCUS_34830 >Feature sequence261 196 411 gene locus_tag LOCUS_34840 196 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 417 701 gene locus_tag LOCUS_34850 417 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 2152 782 gene locus_tag LOCUS_34860 2152 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 2943 2500 gene locus_tag LOCUS_34870 2943 2500 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_34870 3202 2930 gene locus_tag LOCUS_34880 3202 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 3728 3303 gene locus_tag LOCUS_34890 3728 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 4021 5691 gene locus_tag LOCUS_34900 4021 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 5859 6206 gene locus_tag LOCUS_34910 5859 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 6206 6427 gene locus_tag LOCUS_34920 6206 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 >Feature sequence262 <1 2047 gene locus_tag LOCUS_34930 <1 2047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065100.1:tetratricopeptide repeat protein 2052 2591 gene locus_tag LOCUS_34940 2052 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 2599 2907 gene locus_tag LOCUS_34950 2599 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 3846 3070 gene locus_tag LOCUS_34960 gene fabI 3846 3070 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057530.1 protein_id gnl|my_center|LOCUS_34960 4061 4738 gene locus_tag LOCUS_34970 gene ntcA 4061 4738 CDS product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920910.1 protein_id gnl|my_center|LOCUS_34970 4746 6233 gene locus_tag LOCUS_34980 4746 6233 CDS product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057621.1 protein_id gnl|my_center|LOCUS_34980 >Feature sequence263 712 2631 gene locus_tag LOCUS_34990 712 2631 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057141.1 protein_id gnl|my_center|LOCUS_34990 2693 3142 gene locus_tag LOCUS_35000 2693 3142 CDS product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141484.1 protein_id gnl|my_center|LOCUS_35000 3390 4754 gene locus_tag LOCUS_35010 3390 4754 CDS product DUF3370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921041.1 protein_id gnl|my_center|LOCUS_35010 4841 5725 gene locus_tag LOCUS_35020 4841 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 6158 5988 gene locus_tag LOCUS_35030 6158 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 >Feature sequence264 1940 1152 gene locus_tag LOCUS_35040 1940 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 4478 2103 gene locus_tag LOCUS_35050 4478 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 4843 5685 gene locus_tag LOCUS_35060 4843 5685 CDS product circadian clock protein KaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056332.1 protein_id gnl|my_center|LOCUS_35060 5742 6056 gene locus_tag LOCUS_35070 gene kaiB 5742 6056 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056333.1 protein_id gnl|my_center|LOCUS_35070 >Feature sequence265 266 111 gene locus_tag LOCUS_35080 266 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 4964 363 gene locus_tag LOCUS_35090 4964 363 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057208.1 protein_id gnl|my_center|LOCUS_35090 >Feature sequence266 770 393 gene locus_tag LOCUS_35100 770 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 998 810 gene locus_tag LOCUS_35110 998 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 1331 1140 gene locus_tag LOCUS_35120 1331 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 >Feature sequence267 805 194 gene locus_tag LOCUS_35130 805 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 1994 2311 gene locus_tag LOCUS_35140 1994 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 3025 2477 gene locus_tag LOCUS_35150 3025 2477 CDS product DUF2808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056648.1 protein_id gnl|my_center|LOCUS_35150 3608 3144 gene locus_tag LOCUS_35160 gene smpB 3608 3144 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057764.1 protein_id gnl|my_center|LOCUS_35160 3810 4511 gene locus_tag LOCUS_35170 gene psb29 3810 4511 CDS product photosystem II biogenesis protein Psp29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056976.1 protein_id gnl|my_center|LOCUS_35170 4649 5785 gene locus_tag LOCUS_35180 gene cofH 4649 5785 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057436.1 protein_id gnl|my_center|LOCUS_35180 6158 5880 gene locus_tag LOCUS_35190 6158 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 >Feature sequence268 <1 1141 gene locus_tag LOCUS_35200 <1 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459437.1:RNA-guided endonuclease TnpB family protein 1398 1192 gene locus_tag LOCUS_35210 1398 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 1731 1985 gene locus_tag LOCUS_35220 1731 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 1987 2340 gene locus_tag LOCUS_35230 1987 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 2841 3218 gene locus_tag LOCUS_35240 2841 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 3229 5991 gene locus_tag LOCUS_35250 3229 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 >Feature sequence269 1147 401 gene locus_tag LOCUS_35260 1147 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 3055 1349 gene locus_tag LOCUS_35270 3055 1349 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120704930.1 protein_id gnl|my_center|LOCUS_35270 3664 4683 gene locus_tag LOCUS_35280 gene pyrC 3664 4683 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_35280 6019 4724 gene locus_tag LOCUS_35290 6019 4724 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682315.1 protein_id gnl|my_center|LOCUS_35290 >Feature sequence270 3578 276 gene locus_tag LOCUS_35300 3578 276 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143976.1 protein_id gnl|my_center|LOCUS_35300 4784 3585 gene locus_tag LOCUS_35310 4784 3585 CDS product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226578028.1 protein_id gnl|my_center|LOCUS_35310 6160 5027 gene locus_tag LOCUS_35320 6160 5027 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_35320 >Feature sequence271 324 1349 gene locus_tag LOCUS_35330 324 1349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057039.1 protein_id gnl|my_center|LOCUS_35330 2427 1510 gene locus_tag LOCUS_35340 2427 1510 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_35340 2692 3486 gene locus_tag LOCUS_35350 gene trpA 2692 3486 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056294.1 protein_id gnl|my_center|LOCUS_35350 3716 3525 gene locus_tag LOCUS_35360 3716 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 4915 3668 gene locus_tag LOCUS_35370 4915 3668 CDS product GDL motif peptide-associated radical SAM/SPASM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200682.1 protein_id gnl|my_center|LOCUS_35370 5135 4932 gene locus_tag LOCUS_35380 5135 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 5561 5196 gene locus_tag LOCUS_35390 5561 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 6043 5813 gene locus_tag LOCUS_35400 6043 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 >Feature sequence272 84 803 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccttacctattaggtcaaataggattagttggaaac 1897 989 gene locus_tag LOCUS_35410 1897 989 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085605.1 protein_id gnl|my_center|LOCUS_35410 2027 3478 gene locus_tag LOCUS_35420 2027 3478 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_35420 3990 3694 gene locus_tag LOCUS_35430 3990 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 4163 3975 gene locus_tag LOCUS_35440 4163 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 4518 5210 gene locus_tag LOCUS_35450 4518 5210 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057508.1 protein_id gnl|my_center|LOCUS_35450 5383 5865 gene locus_tag LOCUS_35460 5383 5865 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_35460 >Feature sequence273 600 250 gene locus_tag LOCUS_35470 600 250 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562568.1 protein_id gnl|my_center|LOCUS_35470 960 1154 gene locus_tag LOCUS_35480 960 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 1545 1889 gene locus_tag LOCUS_35490 1545 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056501.1 protein_id gnl|my_center|LOCUS_35490 1968 3182 gene locus_tag LOCUS_35500 1968 3182 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_35500 3753 3292 gene locus_tag LOCUS_35510 3753 3292 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_35510 5557 4184 gene locus_tag LOCUS_35520 5557 4184 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141145.1 protein_id gnl|my_center|LOCUS_35520 >Feature sequence274 1117 188 gene locus_tag LOCUS_35530 1117 188 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143656.1 protein_id gnl|my_center|LOCUS_35530 1247 1678 gene locus_tag LOCUS_35540 1247 1678 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_35540 2956 1739 gene locus_tag LOCUS_35550 2956 1739 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_35550 4642 3215 gene locus_tag LOCUS_35560 4642 3215 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057580.1 protein_id gnl|my_center|LOCUS_35560 4822 5703 gene locus_tag LOCUS_35570 4822 5703 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550718.1 protein_id gnl|my_center|LOCUS_35570 >Feature sequence275 81 371 gene locus_tag LOCUS_35580 81 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35580 909 472 gene locus_tag LOCUS_35590 909 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 2681 996 gene locus_tag LOCUS_35600 2681 996 CDS product DUF6345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226017.1 protein_id gnl|my_center|LOCUS_35600 4440 2713 gene locus_tag LOCUS_35610 4440 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 5097 4579 gene locus_tag LOCUS_35620 5097 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 5681 5499 gene locus_tag LOCUS_35630 5681 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 >Feature sequence276 1582 239 gene locus_tag LOCUS_35640 1582 239 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920812.1 protein_id gnl|my_center|LOCUS_35640 2229 1687 gene locus_tag LOCUS_35650 2229 1687 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036612.1 protein_id gnl|my_center|LOCUS_35650 3701 2232 gene locus_tag LOCUS_35660 3701 2232 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056379.1 protein_id gnl|my_center|LOCUS_35660 3886 4350 gene locus_tag LOCUS_35670 3886 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920763.1 protein_id gnl|my_center|LOCUS_35670 6001 4745 gene locus_tag LOCUS_35680 gene dcm 6001 4745 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963014.1 protein_id gnl|my_center|LOCUS_35680 >Feature sequence277 705 361 gene locus_tag LOCUS_35690 705 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 1723 719 gene locus_tag LOCUS_35700 gene pheS 1723 719 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056537.1 protein_id gnl|my_center|LOCUS_35700 1965 2258 gene locus_tag LOCUS_35710 1965 2258 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_35710 2697 2861 gene locus_tag LOCUS_35720 2697 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 5557 2858 gene locus_tag LOCUS_35730 5557 2858 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056370.1 protein_id gnl|my_center|LOCUS_35730 >Feature sequence278 224 1036 gene locus_tag LOCUS_35740 224 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 1082 2152 gene locus_tag LOCUS_35750 1082 2152 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197529999.1 protein_id gnl|my_center|LOCUS_35750 2154 3353 gene locus_tag LOCUS_35760 2154 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 3346 3570 gene locus_tag LOCUS_35770 3346 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 3666 4136 gene locus_tag LOCUS_35780 3666 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 4202 4930 gene locus_tag LOCUS_35790 4202 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 5395 5132 gene locus_tag LOCUS_35800 5395 5132 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_35800 5579 5388 gene locus_tag LOCUS_35810 5579 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 >Feature sequence279 442 909 gene locus_tag LOCUS_35820 442 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 917 3535 gene locus_tag LOCUS_35830 917 3535 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 protein_id gnl|my_center|LOCUS_35830 3538 4992 gene locus_tag LOCUS_35840 3538 4992 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625978.1 protein_id gnl|my_center|LOCUS_35840 5093 5827 gene locus_tag LOCUS_35850 5093 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 >Feature sequence280 1291 1488 gene locus_tag LOCUS_35860 1291 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 1783 2292 gene locus_tag LOCUS_35870 1783 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 2405 2749 gene locus_tag LOCUS_35880 2405 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 2808 4376 gene locus_tag LOCUS_35890 2808 4376 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_35890 >Feature sequence281 116 1303 gene locus_tag LOCUS_35900 116 1303 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057885.1 protein_id gnl|my_center|LOCUS_35900 1401 2132 gene locus_tag LOCUS_35910 gene radC 1401 2132 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920920.1 protein_id gnl|my_center|LOCUS_35910 2506 2216 gene locus_tag LOCUS_35920 2506 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 2917 3969 gene locus_tag LOCUS_35930 gene purM 2917 3969 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057648.1 protein_id gnl|my_center|LOCUS_35930 4489 4743 gene locus_tag LOCUS_35940 4489 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35940 4783 5835 gene locus_tag LOCUS_35950 4783 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35950 >Feature sequence282 380 913 gene locus_tag LOCUS_35960 380 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 910 1062 gene locus_tag LOCUS_35970 910 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 1125 2126 gene locus_tag LOCUS_35980 1125 2126 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_35980 2285 4795 gene locus_tag LOCUS_35990 2285 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 4874 5818 gene locus_tag LOCUS_36000 4874 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 >Feature sequence283 574 119 gene locus_tag LOCUS_36010 gene aroQ 574 119 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_36010 1296 2606 gene locus_tag LOCUS_36020 1296 2606 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190570100.1 protein_id gnl|my_center|LOCUS_36020 4895 2784 gene locus_tag LOCUS_36030 4895 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 5117 5797 gene locus_tag LOCUS_36040 5117 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 >Feature sequence284 371 4036 gene locus_tag LOCUS_36050 371 4036 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388379.1 protein_id gnl|my_center|LOCUS_36050 4693 4193 gene locus_tag LOCUS_36060 gene moaC 4693 4193 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087579.1 protein_id gnl|my_center|LOCUS_36060 4737 4810 gene locus_tag LOCUS_t00320 4737 4810 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence285 253 1677 gene locus_tag LOCUS_36070 253 1677 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058070.1 protein_id gnl|my_center|LOCUS_36070 2947 1706 gene locus_tag LOCUS_36080 2947 1706 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056626.1 protein_id gnl|my_center|LOCUS_36080 3290 3874 gene locus_tag LOCUS_36090 3290 3874 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057925.1 protein_id gnl|my_center|LOCUS_36090 4248 5582 gene locus_tag LOCUS_36100 4248 5582 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058187.1 protein_id gnl|my_center|LOCUS_36100 >Feature sequence286 1 933 gene locus_tag LOCUS_36110 1 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 1346 1636 gene locus_tag LOCUS_36120 1346 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 1706 2299 gene locus_tag LOCUS_36130 1706 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 2360 3427 gene locus_tag LOCUS_36140 2360 3427 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387716.1 protein_id gnl|my_center|LOCUS_36140 3488 4600 gene locus_tag LOCUS_36150 3488 4600 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_36150 4590 5492 gene locus_tag LOCUS_36160 4590 5492 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921254.1 protein_id gnl|my_center|LOCUS_36160 >Feature sequence287 299 1294 gene locus_tag LOCUS_36170 299 1294 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056195.1 protein_id gnl|my_center|LOCUS_36170 2591 1599 gene locus_tag LOCUS_36180 2591 1599 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140505.1 protein_id gnl|my_center|LOCUS_36180 2961 3431 gene locus_tag LOCUS_36190 2961 3431 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171945.1 protein_id gnl|my_center|LOCUS_36190 4176 3367 gene locus_tag LOCUS_36200 4176 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 4766 4179 gene locus_tag LOCUS_36210 4766 4179 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920984.1 protein_id gnl|my_center|LOCUS_36210 5078 5605 gene locus_tag LOCUS_36220 5078 5605 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057421.1 protein_id gnl|my_center|LOCUS_36220 >Feature sequence288 956 219 gene locus_tag LOCUS_36230 956 219 CDS product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058141.1 protein_id gnl|my_center|LOCUS_36230 1125 3437 gene locus_tag LOCUS_36240 1125 3437 CDS product DUF3488 and DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056828.1 protein_id gnl|my_center|LOCUS_36240 3673 3921 gene locus_tag LOCUS_36250 3673 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 3914 4324 gene locus_tag LOCUS_36260 3914 4324 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_36260 4493 4753 gene locus_tag LOCUS_36270 4493 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 4756 5184 gene locus_tag LOCUS_36280 4756 5184 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141572.1 protein_id gnl|my_center|LOCUS_36280 5561 5403 gene locus_tag LOCUS_36290 5561 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 >Feature sequence289 149 1255 gene locus_tag LOCUS_36300 149 1255 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_36300 1468 4254 gene locus_tag LOCUS_36310 1468 4254 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057066.1 protein_id gnl|my_center|LOCUS_36310 4518 4931 gene locus_tag LOCUS_36320 4518 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 >Feature sequence290 470 1090 gene locus_tag LOCUS_36330 470 1090 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157768333.1 protein_id gnl|my_center|LOCUS_36330 3162 1123 gene locus_tag LOCUS_36340 3162 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 3247 3525 gene locus_tag LOCUS_36350 3247 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 3585 4343 gene locus_tag LOCUS_36360 3585 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 4534 4367 gene locus_tag LOCUS_36370 4534 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 5057 4650 gene locus_tag LOCUS_36380 5057 4650 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868296.1 protein_id gnl|my_center|LOCUS_36380 5266 5057 gene locus_tag LOCUS_36390 5266 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 >Feature sequence291 513 97 gene locus_tag LOCUS_36400 513 97 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_36400 751 497 gene locus_tag LOCUS_36410 751 497 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771148.1 protein_id gnl|my_center|LOCUS_36410 932 1621 gene locus_tag LOCUS_36420 932 1621 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143931.1 protein_id gnl|my_center|LOCUS_36420 2536 1859 gene locus_tag LOCUS_36430 2536 1859 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_36430 3206 2595 gene locus_tag LOCUS_36440 3206 2595 CDS product Coq4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141416.1 protein_id gnl|my_center|LOCUS_36440 3669 3415 gene locus_tag LOCUS_36450 3669 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 3804 4454 gene locus_tag LOCUS_36460 3804 4454 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140806.1 protein_id gnl|my_center|LOCUS_36460 4831 5106 gene locus_tag LOCUS_36470 4831 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_36470 5244 5522 gene locus_tag LOCUS_36480 5244 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 >Feature sequence292 2407 311 gene locus_tag LOCUS_36490 gene pta 2407 311 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_36490 4667 2871 gene locus_tag LOCUS_36500 4667 2871 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199341128.1 protein_id gnl|my_center|LOCUS_36500 4892 5326 gene locus_tag LOCUS_36510 4892 5326 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057040.1 protein_id gnl|my_center|LOCUS_36510 >Feature sequence293 2852 1503 gene locus_tag LOCUS_36520 2852 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 3301 3032 gene locus_tag LOCUS_36530 3301 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 3784 3470 gene locus_tag LOCUS_36540 3784 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 4334 3987 gene locus_tag LOCUS_36550 4334 3987 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941219.1 protein_id gnl|my_center|LOCUS_36550 4611 4315 gene locus_tag LOCUS_36560 4611 4315 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045668639.1 protein_id gnl|my_center|LOCUS_36560 4916 4731 gene locus_tag LOCUS_36570 4916 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 5248 4946 gene locus_tag LOCUS_36580 5248 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 >Feature sequence294 473 336 gene locus_tag LOCUS_36590 473 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 1683 505 gene locus_tag LOCUS_36600 1683 505 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124972844.1 protein_id gnl|my_center|LOCUS_36600 2059 1700 gene locus_tag LOCUS_36610 gene trxA 2059 1700 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191795.1 protein_id gnl|my_center|LOCUS_36610 2986 2108 gene locus_tag LOCUS_36620 2986 2108 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084173.1 protein_id gnl|my_center|LOCUS_36620 3620 3910 gene locus_tag LOCUS_36630 3620 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 3898 4308 gene locus_tag LOCUS_36640 3898 4308 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_36640 4336 5415 gene locus_tag LOCUS_36650 4336 5415 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799067.1 protein_id gnl|my_center|LOCUS_36650 >Feature sequence295 1191 325 gene locus_tag LOCUS_36660 1191 325 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057619.1 protein_id gnl|my_center|LOCUS_36660 2192 1191 gene locus_tag LOCUS_36670 2192 1191 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_36670 3743 2307 gene locus_tag LOCUS_36680 3743 2307 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_36680 3982 4650 gene locus_tag LOCUS_36690 3982 4650 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056639.1 protein_id gnl|my_center|LOCUS_36690 4702 5184 gene locus_tag LOCUS_36700 gene petD 4702 5184 CDS product cytochrome b6-f complex subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056640.1 protein_id gnl|my_center|LOCUS_36700 >Feature sequence296 1656 580 gene locus_tag LOCUS_36710 gene rsgA 1656 580 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056831.1 protein_id gnl|my_center|LOCUS_36710 1878 1657 gene locus_tag LOCUS_36720 1878 1657 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056832.1 protein_id gnl|my_center|LOCUS_36720 3005 1881 gene locus_tag LOCUS_36730 gene dnaJ 3005 1881 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920758.1 protein_id gnl|my_center|LOCUS_36730 5293 3245 gene locus_tag LOCUS_36740 gene dnaK 5293 3245 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056634.1 protein_id gnl|my_center|LOCUS_36740 >Feature sequence297 860 201 gene locus_tag LOCUS_36750 860 201 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141522.1 protein_id gnl|my_center|LOCUS_36750 1456 878 gene locus_tag LOCUS_36760 1456 878 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_36760 1860 1471 gene locus_tag LOCUS_36770 1860 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36770 2060 1836 gene locus_tag LOCUS_36780 2060 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 2091 2351 gene locus_tag LOCUS_36790 2091 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 2461 3099 gene locus_tag LOCUS_36800 gene hisH 2461 3099 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057376.1 protein_id gnl|my_center|LOCUS_36800 3840 3088 gene locus_tag LOCUS_36810 3840 3088 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_36810 5265 4150 gene locus_tag LOCUS_36820 5265 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 >Feature sequence298 599 814 gene locus_tag LOCUS_36830 599 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 985 1353 gene locus_tag LOCUS_36840 985 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 1350 1769 gene locus_tag LOCUS_36850 1350 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 1762 1920 gene locus_tag LOCUS_36860 1762 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 2112 1915 gene locus_tag LOCUS_36870 2112 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 2281 2466 gene locus_tag LOCUS_36880 2281 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 3776 3009 gene locus_tag LOCUS_36890 3776 3009 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618819.1 protein_id gnl|my_center|LOCUS_36890 4048 5124 gene locus_tag LOCUS_36900 4048 5124 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171974.1 protein_id gnl|my_center|LOCUS_36900 >Feature sequence299 398 93 gene locus_tag LOCUS_36910 398 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 741 1463 gene locus_tag LOCUS_36920 741 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 1535 4702 gene locus_tag LOCUS_36930 1535 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 5241 4780 gene locus_tag LOCUS_36940 5241 4780 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_36940 >Feature sequence300 1826 726 gene locus_tag LOCUS_36950 gene prfA 1826 726 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056003.1 protein_id gnl|my_center|LOCUS_36950 2447 4600 gene locus_tag LOCUS_36960 2447 4600 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058027.1 protein_id gnl|my_center|LOCUS_36960 >Feature sequence301 1665 100 gene locus_tag LOCUS_36970 1665 100 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057213.1 protein_id gnl|my_center|LOCUS_36970 2337 1837 gene locus_tag LOCUS_36980 2337 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 4225 2501 gene locus_tag LOCUS_36990 4225 2501 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056931.1 protein_id gnl|my_center|LOCUS_36990 4938 4735 gene locus_tag LOCUS_37000 4938 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 >Feature sequence302 1006 194 gene locus_tag LOCUS_37010 gene lpxC 1006 194 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057627.1 protein_id gnl|my_center|LOCUS_37010 3120 1099 gene locus_tag LOCUS_37020 3120 1099 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057626.1 protein_id gnl|my_center|LOCUS_37020 4392 3514 gene locus_tag LOCUS_37030 4392 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 >Feature sequence303 720 1529 gene locus_tag LOCUS_37040 720 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 1589 4003 gene locus_tag LOCUS_37050 1589 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 3978 5138 gene locus_tag LOCUS_37060 3978 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37060 >Feature sequence304 359 2218 gene locus_tag LOCUS_37070 359 2218 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_37070 2554 2225 gene locus_tag LOCUS_37080 2554 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 2786 3463 gene locus_tag LOCUS_37090 2786 3463 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_37090 3749 4483 gene locus_tag LOCUS_37100 3749 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 >Feature sequence305 281 2926 gene locus_tag LOCUS_37110 281 2926 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141744.1 protein_id gnl|my_center|LOCUS_37110 4357 2933 gene locus_tag LOCUS_37120 4357 2933 CDS product deoxyribodipyrimidine photo-lyase, 8-HDF type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056280.1 protein_id gnl|my_center|LOCUS_37120 >Feature sequence306 <5126 84 gene locus_tag LOCUS_37130 <5126 84 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940952.1:Calx-beta domain-containing protein >Feature sequence307 123 2492 gene locus_tag LOCUS_37140 gene atsD 123 2492 CDS product arylsulfatase AtsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 protein_id gnl|my_center|LOCUS_37140 2668 3342 gene locus_tag LOCUS_37150 2668 3342 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190428.1 protein_id gnl|my_center|LOCUS_37150 3439 4044 gene locus_tag LOCUS_37160 3439 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 4096 4857 gene locus_tag LOCUS_37170 4096 4857 CDS product Coq4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141416.1 protein_id gnl|my_center|LOCUS_37170 >Feature sequence308 1164 103 gene locus_tag LOCUS_37180 gene metX 1164 103 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_37180 2478 1180 gene locus_tag LOCUS_37190 2478 1180 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_37190 3608 2679 gene locus_tag LOCUS_37200 3608 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 4188 5042 gene locus_tag LOCUS_37210 4188 5042 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_37210 >Feature sequence309 2091 127 gene locus_tag LOCUS_37220 2091 127 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_37220 2182 2319 gene locus_tag LOCUS_37230 gene rpmH 2182 2319 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141474.1 protein_id gnl|my_center|LOCUS_37230 2346 2708 gene locus_tag LOCUS_37240 2346 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37240 2698 3093 gene locus_tag LOCUS_37250 2698 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37250 3178 4326 gene locus_tag LOCUS_37260 gene yidC 3178 4326 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056448.1 protein_id gnl|my_center|LOCUS_37260 4326 4820 gene locus_tag LOCUS_37270 4326 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142229.1 protein_id gnl|my_center|LOCUS_37270 >Feature sequence310 639 1046 gene locus_tag LOCUS_37280 gene psbU 639 1046 CDS product photosystem II complex extrinsic protein PsbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058241.1 protein_id gnl|my_center|LOCUS_37280 1238 2905 gene locus_tag LOCUS_37290 gene nadB 1238 2905 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058240.1 protein_id gnl|my_center|LOCUS_37290 3114 4208 gene locus_tag LOCUS_37300 3114 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 4205 4522 gene locus_tag LOCUS_37310 4205 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37310 4583 4879 gene locus_tag LOCUS_37320 4583 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37320 >Feature sequence311 391 1047 gene locus_tag LOCUS_37330 391 1047 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058278.1 protein_id gnl|my_center|LOCUS_37330 1589 1062 gene locus_tag LOCUS_37340 1589 1062 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143166.1 protein_id gnl|my_center|LOCUS_37340 1876 1583 gene locus_tag LOCUS_37350 1876 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 2660 2022 gene locus_tag LOCUS_37360 2660 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057488.1 protein_id gnl|my_center|LOCUS_37360 4386 2863 gene locus_tag LOCUS_37370 4386 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193329014.1 protein_id gnl|my_center|LOCUS_37370 >Feature sequence312 <1 795 gene locus_tag LOCUS_37380 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020316.1:IS200/IS605 family element RNA-guided endonuclease TnpB 872 1258 gene locus_tag LOCUS_37390 872 1258 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143142.1 protein_id gnl|my_center|LOCUS_37390 1258 1788 gene locus_tag LOCUS_37400 1258 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 4462 1910 gene locus_tag LOCUS_37410 gene gyrA 4462 1910 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057209.1 protein_id gnl|my_center|LOCUS_37410 >Feature sequence313 275 1837 gene locus_tag LOCUS_37420 gene kaiC 275 1837 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056334.1 protein_id gnl|my_center|LOCUS_37420 2854 1859 gene locus_tag LOCUS_37430 2854 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 4064 2967 gene locus_tag LOCUS_37440 4064 2967 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202512.1 protein_id gnl|my_center|LOCUS_37440 4261 4070 gene locus_tag LOCUS_37450 4261 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 4841 4290 gene locus_tag LOCUS_37460 4841 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 >Feature sequence314 437 255 gene locus_tag LOCUS_37470 437 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 826 2955 gene locus_tag LOCUS_37480 826 2955 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057632.1 protein_id gnl|my_center|LOCUS_37480 3230 4810 gene locus_tag LOCUS_37490 3230 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 >Feature sequence315 744 445 gene locus_tag LOCUS_37500 744 445 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057369.1 protein_id gnl|my_center|LOCUS_37500 2047 788 gene locus_tag LOCUS_37510 gene coaBC 2047 788 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249472.1 protein_id gnl|my_center|LOCUS_37510 2205 3146 gene locus_tag LOCUS_37520 2205 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 4178 3228 gene locus_tag LOCUS_37530 4178 3228 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 protein_id gnl|my_center|LOCUS_37530 >Feature sequence316 289 1521 gene locus_tag LOCUS_37540 gene aroB 289 1521 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_37540 1518 2321 gene locus_tag LOCUS_37550 1518 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 2749 3735 gene locus_tag LOCUS_37560 2749 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 3739 4791 gene locus_tag LOCUS_37570 3739 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 >Feature sequence317 1629 895 gene locus_tag LOCUS_37580 1629 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 2576 2178 gene locus_tag LOCUS_37590 2576 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 >Feature sequence318 319 1248 gene locus_tag LOCUS_37600 319 1248 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056823.1 protein_id gnl|my_center|LOCUS_37600 1276 1608 gene locus_tag LOCUS_37610 1276 1608 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174551.1 protein_id gnl|my_center|LOCUS_37610 1755 4307 gene locus_tag LOCUS_37620 gene leuS 1755 4307 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057933.1 protein_id gnl|my_center|LOCUS_37620 4455 4778 gene locus_tag LOCUS_37630 4455 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 >Feature sequence319 253 447 gene locus_tag LOCUS_37640 253 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 1592 948 gene locus_tag LOCUS_37650 1592 948 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055897.1 protein_id gnl|my_center|LOCUS_37650 2003 2203 gene locus_tag LOCUS_37660 2003 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 3654 2467 gene locus_tag LOCUS_37670 3654 2467 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799340.1 protein_id gnl|my_center|LOCUS_37670 4669 3725 gene locus_tag LOCUS_37680 4669 3725 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056551.1 protein_id gnl|my_center|LOCUS_37680 >Feature sequence320 249 563 gene locus_tag LOCUS_37690 249 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 560 958 gene locus_tag LOCUS_37700 560 958 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392906.1 protein_id gnl|my_center|LOCUS_37700 1842 3215 gene locus_tag LOCUS_37710 gene mnmE 1842 3215 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056805.1 protein_id gnl|my_center|LOCUS_37710 3664 3389 gene locus_tag LOCUS_37720 3664 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 4093 3797 gene locus_tag LOCUS_37730 4093 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 >Feature sequence321 1767 181 gene locus_tag LOCUS_37740 1767 181 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057166.1 protein_id gnl|my_center|LOCUS_37740 3650 2160 gene locus_tag LOCUS_37750 3650 2160 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057081.1 protein_id gnl|my_center|LOCUS_37750 3932 4678 gene locus_tag LOCUS_37760 3932 4678 CDS product DUF4079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057843.1 protein_id gnl|my_center|LOCUS_37760 >Feature sequence322 1144 119 gene locus_tag LOCUS_37770 1144 119 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199695.1 protein_id gnl|my_center|LOCUS_37770 1565 2248 gene locus_tag LOCUS_37780 1565 2248 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948539.1 protein_id gnl|my_center|LOCUS_37780 2517 3446 gene locus_tag LOCUS_37790 2517 3446 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_37790 3531 4472 gene locus_tag LOCUS_37800 3531 4472 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227811.1 protein_id gnl|my_center|LOCUS_37800 >Feature sequence323 1 207 gene locus_tag LOCUS_37810 1 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 449 1933 gene locus_tag LOCUS_37820 449 1933 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_37820 2831 2091 gene locus_tag LOCUS_37830 2831 2091 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058255.1 protein_id gnl|my_center|LOCUS_37830 3532 4251 gene locus_tag LOCUS_37840 3532 4251 CDS product heme oxygenase (biliverdin-producing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920678.1 protein_id gnl|my_center|LOCUS_37840 >Feature sequence324 461 2353 gene locus_tag LOCUS_37850 461 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 2583 2428 gene locus_tag LOCUS_37860 2583 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 3001 3450 gene locus_tag LOCUS_37870 3001 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 3470 4540 gene locus_tag LOCUS_37880 3470 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 >Feature sequence325 1201 581 gene locus_tag LOCUS_37890 1201 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 2776 1250 gene locus_tag LOCUS_37900 2776 1250 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_37900 3609 2779 gene locus_tag LOCUS_37910 3609 2779 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524099.1 protein_id gnl|my_center|LOCUS_37910 4540 3599 gene locus_tag LOCUS_37920 4540 3599 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_37920 >Feature sequence326 293 2275 gene locus_tag LOCUS_37930 gene kdpB 293 2275 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140577.1 protein_id gnl|my_center|LOCUS_37930 2275 3492 gene locus_tag LOCUS_37940 2275 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 3742 4386 gene locus_tag LOCUS_37950 gene kdpC 3742 4386 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140578.1 protein_id gnl|my_center|LOCUS_37950 >Feature sequence327 717 463 gene locus_tag LOCUS_37960 717 463 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377382.1 protein_id gnl|my_center|LOCUS_37960 1343 843 gene locus_tag LOCUS_37970 1343 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 1509 2384 gene locus_tag LOCUS_37980 1509 2384 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_37980 2809 3558 gene locus_tag LOCUS_37990 2809 3558 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143325.1 protein_id gnl|my_center|LOCUS_37990 3559 4314 gene locus_tag LOCUS_38000 3559 4314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143324.1 protein_id gnl|my_center|LOCUS_38000 >Feature sequence328 434 580 gene locus_tag LOCUS_38010 434 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 1105 1365 gene locus_tag LOCUS_38020 1105 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 1405 1563 gene locus_tag LOCUS_38030 1405 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 1587 1724 gene locus_tag LOCUS_38040 1587 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 1879 2082 gene locus_tag LOCUS_38050 1879 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 2079 2348 gene locus_tag LOCUS_38060 2079 2348 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_38060 2942 3157 gene locus_tag LOCUS_38070 2942 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 3391 3879 gene locus_tag LOCUS_38080 3391 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 4516 4286 gene locus_tag LOCUS_38090 4516 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 >Feature sequence329 197 901 gene locus_tag LOCUS_38100 197 901 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921011.1 protein_id gnl|my_center|LOCUS_38100 2308 1046 gene locus_tag LOCUS_38110 2308 1046 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231833781.1 protein_id gnl|my_center|LOCUS_38110 3024 2320 gene locus_tag LOCUS_38120 gene ubiE 3024 2320 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140131.1 protein_id gnl|my_center|LOCUS_38120 4101 3232 gene locus_tag LOCUS_38130 4101 3232 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_38130 >Feature sequence330 948 34 gene locus_tag LOCUS_38140 948 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 1239 1430 gene locus_tag LOCUS_38150 1239 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 1619 1849 gene locus_tag LOCUS_38160 1619 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 1846 2136 gene locus_tag LOCUS_38170 1846 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 2737 2411 gene locus_tag LOCUS_38180 2737 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 3473 3745 gene locus_tag LOCUS_38190 3473 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141573.1 protein_id gnl|my_center|LOCUS_38190 4509 4177 gene locus_tag LOCUS_38200 4509 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 >Feature sequence331 356 799 gene locus_tag LOCUS_38210 356 799 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 protein_id gnl|my_center|LOCUS_38210 1875 802 gene locus_tag LOCUS_38220 1875 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 3795 2233 gene locus_tag LOCUS_38230 3795 2233 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_38230 4072 4215 gene locus_tag LOCUS_38240 4072 4215 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124265.1 protein_id gnl|my_center|LOCUS_38240 >Feature sequence332 208 414 gene locus_tag LOCUS_38250 208 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 458 1054 gene locus_tag LOCUS_38260 458 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 2145 1078 gene locus_tag LOCUS_38270 gene recA 2145 1078 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125865.1 protein_id gnl|my_center|LOCUS_38270 3225 2272 gene locus_tag LOCUS_38280 3225 2272 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141923.1 protein_id gnl|my_center|LOCUS_38280 >Feature sequence333 302 2539 gene locus_tag LOCUS_38290 302 2539 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141880.1 protein_id gnl|my_center|LOCUS_38290 2707 3132 gene locus_tag LOCUS_38300 2707 3132 CDS product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816150.1 protein_id gnl|my_center|LOCUS_38300 3262 3192 gene locus_tag LOCUS_t00330 3262 3192 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4065 3340 gene locus_tag LOCUS_38310 4065 3340 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056544.1 protein_id gnl|my_center|LOCUS_38310 >Feature sequence334 148 558 gene locus_tag LOCUS_38320 gene gloA 148 558 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143550.1 protein_id gnl|my_center|LOCUS_38320 580 1053 gene locus_tag LOCUS_38330 580 1053 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_38330 1725 1072 gene locus_tag LOCUS_38340 gene nusB 1725 1072 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056630.1 protein_id gnl|my_center|LOCUS_38340 3344 1881 gene locus_tag LOCUS_38350 3344 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 4298 3711 gene locus_tag LOCUS_38360 gene hemJ 4298 3711 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143033.1 protein_id gnl|my_center|LOCUS_38360 >Feature sequence335 212 475 gene locus_tag LOCUS_38370 212 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 1003 374 gene locus_tag LOCUS_38380 1003 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 1419 1120 gene locus_tag LOCUS_38390 1419 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 3962 1497 gene locus_tag LOCUS_38400 3962 1497 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 protein_id gnl|my_center|LOCUS_38400 >Feature sequence336 3565 86 gene locus_tag LOCUS_38410 3565 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 3882 4223 gene locus_tag LOCUS_38420 3882 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 >Feature sequence337 1848 337 gene locus_tag LOCUS_38430 gene crtH 1848 337 CDS product carotene isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891794.1 protein_id gnl|my_center|LOCUS_38430 2301 4130 gene locus_tag LOCUS_38440 2301 4130 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261053.1 protein_id gnl|my_center|LOCUS_38440 >Feature sequence338 527 1303 gene locus_tag LOCUS_38450 527 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 2890 1796 gene locus_tag LOCUS_38460 2890 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 4011 2929 gene locus_tag LOCUS_38470 4011 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 >Feature sequence339 1602 355 gene locus_tag LOCUS_38480 1602 355 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143911.1 protein_id gnl|my_center|LOCUS_38480 2020 1613 gene locus_tag LOCUS_38490 2020 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057546.1 protein_id gnl|my_center|LOCUS_38490 2263 2192 gene locus_tag LOCUS_t00340 2263 2192 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2654 2334 gene locus_tag LOCUS_38500 2654 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 3255 2710 gene locus_tag LOCUS_38510 gene ribH 3255 2710 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055922.1 protein_id gnl|my_center|LOCUS_38510 3536 3348 gene locus_tag LOCUS_38520 3536 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 4368 3919 gene locus_tag LOCUS_38530 4368 3919 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112796.1 protein_id gnl|my_center|LOCUS_38530 >Feature sequence340 202 615 gene locus_tag LOCUS_38540 202 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 1382 612 gene locus_tag LOCUS_38550 1382 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 2685 1492 gene locus_tag LOCUS_38560 2685 1492 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920820.1 protein_id gnl|my_center|LOCUS_38560 3363 3073 gene locus_tag LOCUS_38570 gene kaiB 3363 3073 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056333.1 protein_id gnl|my_center|LOCUS_38570 4199 3360 gene locus_tag LOCUS_38580 4199 3360 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391041.1 protein_id gnl|my_center|LOCUS_38580 >Feature sequence341 352 618 gene locus_tag LOCUS_38590 352 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_38590 777 2678 gene locus_tag LOCUS_38600 gene glmS 777 2678 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921151.1 protein_id gnl|my_center|LOCUS_38600 2859 3176 gene locus_tag LOCUS_38610 2859 3176 CDS product DUF3067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056802.1 protein_id gnl|my_center|LOCUS_38610 4079 3321 gene locus_tag LOCUS_38620 4079 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 4216 4076 gene locus_tag LOCUS_38630 4216 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 >Feature sequence342 1140 283 gene locus_tag LOCUS_38640 gene folD 1140 283 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920629.1 protein_id gnl|my_center|LOCUS_38640 1230 1940 gene locus_tag LOCUS_38650 1230 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 2009 2368 gene locus_tag LOCUS_38660 2009 2368 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_38660 2435 2854 gene locus_tag LOCUS_38670 2435 2854 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057899.1 protein_id gnl|my_center|LOCUS_38670 2955 4322 gene locus_tag LOCUS_38680 2955 4322 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172187164.1 protein_id gnl|my_center|LOCUS_38680 >Feature sequence343 4233 106 gene locus_tag LOCUS_38690 4233 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 >Feature sequence344 192 626 gene locus_tag LOCUS_38700 192 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 1607 1918 gene locus_tag LOCUS_38710 gene groES 1607 1918 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125740.1 protein_id gnl|my_center|LOCUS_38710 1965 3590 gene locus_tag LOCUS_38720 gene groL 1965 3590 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056040.1 protein_id gnl|my_center|LOCUS_38720 4171 3860 gene locus_tag LOCUS_38730 4171 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 >Feature sequence345 1133 135 gene locus_tag LOCUS_38740 1133 135 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876261.1 protein_id gnl|my_center|LOCUS_38740 2168 1512 gene locus_tag LOCUS_38750 2168 1512 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 protein_id gnl|my_center|LOCUS_38750 2545 2165 gene locus_tag LOCUS_38760 2545 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 3888 2806 gene locus_tag LOCUS_38770 3888 2806 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_38770 >Feature sequence346 284 1432 gene locus_tag LOCUS_38780 gene chrA 284 1432 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 protein_id gnl|my_center|LOCUS_38780 2127 1477 gene locus_tag LOCUS_38790 gene hisG 2127 1477 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056035.1 protein_id gnl|my_center|LOCUS_38790 2991 2257 gene locus_tag LOCUS_38800 2991 2257 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057310.1 protein_id gnl|my_center|LOCUS_38800 3813 3136 gene locus_tag LOCUS_38810 gene deoC 3813 3136 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056922.1 protein_id gnl|my_center|LOCUS_38810 >Feature sequence347 554 225 gene locus_tag LOCUS_38820 554 225 CDS product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141521.1 protein_id gnl|my_center|LOCUS_38820 839 1108 gene locus_tag LOCUS_38830 gene rpsO 839 1108 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144014.1 protein_id gnl|my_center|LOCUS_38830 1133 1597 gene locus_tag LOCUS_38840 1133 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 1656 2711 gene locus_tag LOCUS_38850 gene aroF 1656 2711 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 protein_id gnl|my_center|LOCUS_38850 2776 3432 gene locus_tag LOCUS_38860 2776 3432 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017653748.1 protein_id gnl|my_center|LOCUS_38860 3453 4109 gene locus_tag LOCUS_38870 3453 4109 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017653748.1 protein_id gnl|my_center|LOCUS_38870 >Feature sequence348 118 1797 gene locus_tag LOCUS_38880 118 1797 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058118.1 protein_id gnl|my_center|LOCUS_38880 2330 2485 gene locus_tag LOCUS_38890 2330 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 3303 4100 gene locus_tag LOCUS_38900 3303 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 >Feature sequence349 364 1167 gene locus_tag LOCUS_38910 gene udp 364 1167 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016796.1 protein_id gnl|my_center|LOCUS_38910 1671 2081 gene locus_tag LOCUS_38920 1671 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 <4387 2175 gene locus_tag LOCUS_38930 <4387 2175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007510795.1:CHAT domain-containing protein >Feature sequence350 461 228 gene locus_tag LOCUS_38940 461 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 708 1001 gene locus_tag LOCUS_38950 708 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 1255 2532 gene locus_tag LOCUS_38960 1255 2532 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056607.1 protein_id gnl|my_center|LOCUS_38960 2723 3784 gene locus_tag LOCUS_38970 gene corA 2723 3784 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_38970 4020 3844 gene locus_tag LOCUS_38980 4020 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 >Feature sequence351 282 908 gene locus_tag LOCUS_38990 282 908 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929250.1 protein_id gnl|my_center|LOCUS_38990 1574 2563 gene locus_tag LOCUS_39000 1574 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 2843 3259 gene locus_tag LOCUS_39010 2843 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39010 3513 3268 gene locus_tag LOCUS_39020 3513 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 3991 3587 gene locus_tag LOCUS_39030 3991 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 >Feature sequence352 218 2116 gene locus_tag LOCUS_39040 218 2116 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920663.1 protein_id gnl|my_center|LOCUS_39040 2214 3065 gene locus_tag LOCUS_39050 gene murI 2214 3065 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056314.1 protein_id gnl|my_center|LOCUS_39050 >Feature sequence353 238 1248 gene locus_tag LOCUS_39060 238 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 1445 1807 gene locus_tag LOCUS_39070 1445 1807 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056614.1 protein_id gnl|my_center|LOCUS_39070 1862 2524 gene locus_tag LOCUS_39080 1862 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 3016 2825 gene locus_tag LOCUS_39090 3016 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 4137 3013 gene locus_tag LOCUS_39100 gene tgt 4137 3013 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055935.1 protein_id gnl|my_center|LOCUS_39100 >Feature sequence354 176 1180 gene locus_tag LOCUS_39110 176 1180 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 protein_id gnl|my_center|LOCUS_39110 1569 2261 gene locus_tag LOCUS_39120 1569 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 2261 3004 gene locus_tag LOCUS_39130 2261 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 3740 3871 gene locus_tag LOCUS_39140 3740 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 3858 4172 gene locus_tag LOCUS_39150 3858 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 >Feature sequence355 188 1963 gene locus_tag LOCUS_39160 gene pyk 188 1963 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058108.1 protein_id gnl|my_center|LOCUS_39160 2129 2941 gene locus_tag LOCUS_39170 2129 2941 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009454959.1 protein_id gnl|my_center|LOCUS_39170 2997 3428 gene locus_tag LOCUS_39180 2997 3428 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_39180 3670 3798 gene locus_tag LOCUS_39190 3670 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 >Feature sequence356 958 1641 gene locus_tag LOCUS_39200 958 1641 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633409.1 protein_id gnl|my_center|LOCUS_39200 1959 2393 gene locus_tag LOCUS_39210 1959 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 3201 2404 gene locus_tag LOCUS_39220 3201 2404 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223173767.1 protein_id gnl|my_center|LOCUS_39220 3476 4042 gene locus_tag LOCUS_39230 3476 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 >Feature sequence357 259 77 gene locus_tag LOCUS_39240 259 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 2347 359 gene locus_tag LOCUS_39250 2347 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 3471 2401 gene locus_tag LOCUS_39260 3471 2401 CDS product HaeII family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686885.1 protein_id gnl|my_center|LOCUS_39260 <4156 3475 gene locus_tag LOCUS_39270 <4156 3475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010951379.1:DNA cytosine methyltransferase >Feature sequence358 <1 1098 gene locus_tag LOCUS_39280 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459437.1:RNA-guided endonuclease TnpB family protein 1095 1427 gene locus_tag LOCUS_39290 1095 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 1525 3640 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccaattaatcttaagccctattagggattgaaac >Feature sequence359 1872 1162 gene locus_tag LOCUS_39300 1872 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 2177 2713 gene locus_tag LOCUS_39310 2177 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 4034 3753 gene locus_tag LOCUS_39320 4034 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39320 >Feature sequence360 736 347 gene locus_tag LOCUS_39330 736 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 1447 2535 gene locus_tag LOCUS_39340 1447 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 3073 2600 gene locus_tag LOCUS_39350 3073 2600 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_39350 3336 3070 gene locus_tag LOCUS_39360 3336 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 3356 3700 gene locus_tag LOCUS_39370 3356 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 >Feature sequence361 333 470 gene locus_tag LOCUS_39380 333 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 695 1270 gene locus_tag LOCUS_39390 gene def 695 1270 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057513.1 protein_id gnl|my_center|LOCUS_39390 1302 1499 gene locus_tag LOCUS_39400 1302 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057514.1 protein_id gnl|my_center|LOCUS_39400 1761 2078 gene locus_tag LOCUS_39410 1761 2078 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056338.1 protein_id gnl|my_center|LOCUS_39410 3800 2160 gene locus_tag LOCUS_39420 3800 2160 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056613.1 protein_id gnl|my_center|LOCUS_39420 >Feature sequence362 621 2528 gene locus_tag LOCUS_39430 gene mnmG 621 2528 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056385.1 protein_id gnl|my_center|LOCUS_39430 3766 2573 gene locus_tag LOCUS_39440 3766 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 >Feature sequence363 698 2002 gene locus_tag LOCUS_39450 gene thrC 698 2002 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056826.1 protein_id gnl|my_center|LOCUS_39450 2081 2356 gene locus_tag LOCUS_39460 2081 2356 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 protein_id gnl|my_center|LOCUS_39460 2870 2580 gene locus_tag LOCUS_39470 2870 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 3037 2858 gene locus_tag LOCUS_39480 3037 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 3715 3248 gene locus_tag LOCUS_39490 3715 3248 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_39490 >Feature sequence364 640 3390 gene locus_tag LOCUS_39500 640 3390 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142684.1 protein_id gnl|my_center|LOCUS_39500 >Feature sequence365 1778 1014 gene locus_tag LOCUS_39510 1778 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 2307 2056 gene locus_tag LOCUS_39520 2307 2056 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 protein_id gnl|my_center|LOCUS_39520 2480 2286 gene locus_tag LOCUS_39530 2480 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 2900 3151 gene locus_tag LOCUS_39540 2900 3151 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140617.1 protein_id gnl|my_center|LOCUS_39540 3144 3632 gene locus_tag LOCUS_39550 3144 3632 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140618.1 protein_id gnl|my_center|LOCUS_39550