>Feature sequence001 207 1076 gene locus_tag LOCUS_00010 207 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1658 1215 gene locus_tag LOCUS_00020 1658 1215 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762812.1 protein_id gnl|my_center|LOCUS_00020 1757 2509 gene locus_tag LOCUS_00030 1757 2509 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038753.1 protein_id gnl|my_center|LOCUS_00030 2681 2956 gene locus_tag LOCUS_00040 2681 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3145 3894 gene locus_tag LOCUS_00050 3145 3894 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_00050 3891 5099 gene locus_tag LOCUS_00060 3891 5099 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229018.1 protein_id gnl|my_center|LOCUS_00060 6600 5152 gene locus_tag LOCUS_00070 6600 5152 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038505.1 protein_id gnl|my_center|LOCUS_00070 7152 6763 gene locus_tag LOCUS_00080 7152 6763 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071713.1 protein_id gnl|my_center|LOCUS_00080 7399 8163 gene locus_tag LOCUS_00090 7399 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9973 8471 gene locus_tag LOCUS_00100 gene gndA 9973 8471 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_00100 10298 13597 gene locus_tag LOCUS_00110 10298 13597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13594 14778 gene locus_tag LOCUS_00120 13594 14778 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080422.1 protein_id gnl|my_center|LOCUS_00120 14750 15892 gene locus_tag LOCUS_00130 14750 15892 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080423.1 protein_id gnl|my_center|LOCUS_00130 15889 16935 gene locus_tag LOCUS_00140 15889 16935 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_00140 17112 17028 gene locus_tag LOCUS_t00010 17112 17028 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17515 18633 gene locus_tag LOCUS_00150 17515 18633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18630 19205 gene locus_tag LOCUS_00160 18630 19205 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674578.1 protein_id gnl|my_center|LOCUS_00160 19379 19759 gene locus_tag LOCUS_00170 gene rsfS 19379 19759 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038431718.1 protein_id gnl|my_center|LOCUS_00170 20578 19787 gene locus_tag LOCUS_00180 20578 19787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20703 21659 gene locus_tag LOCUS_00190 20703 21659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 23252 21888 gene locus_tag LOCUS_00200 23252 21888 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337521.1 protein_id gnl|my_center|LOCUS_00200 24316 23342 gene locus_tag LOCUS_00210 24316 23342 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_00210 25469 24363 gene locus_tag LOCUS_00220 gene pdhA 25469 24363 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389634.1 protein_id gnl|my_center|LOCUS_00220 26173 25664 gene locus_tag LOCUS_00230 26173 25664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 26346 26984 gene locus_tag LOCUS_00240 26346 26984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27029 28744 gene locus_tag LOCUS_00250 27029 28744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 28756 29661 gene locus_tag LOCUS_00260 28756 29661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 29689 30507 gene locus_tag LOCUS_00270 29689 30507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30701 33463 gene locus_tag LOCUS_00280 30701 33463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 33542 34411 gene locus_tag LOCUS_00290 33542 34411 CDS product 5'-3' exonuclease H3TH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881053.1 protein_id gnl|my_center|LOCUS_00290 34408 34638 gene locus_tag LOCUS_00300 34408 34638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 35082 34750 gene locus_tag LOCUS_00310 35082 34750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34963 38064 gene locus_tag LOCUS_00320 34963 38064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 38183 44512 gene locus_tag LOCUS_00330 38183 44512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 44567 44749 gene locus_tag LOCUS_00340 44567 44749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 45109 46482 gene locus_tag LOCUS_00350 45109 46482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 46493 47632 gene locus_tag LOCUS_00360 46493 47632 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066597.1 protein_id gnl|my_center|LOCUS_00360 47622 48872 gene locus_tag LOCUS_00370 47622 48872 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931950.1 protein_id gnl|my_center|LOCUS_00370 48885 49616 gene locus_tag LOCUS_00380 48885 49616 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919795.1 protein_id gnl|my_center|LOCUS_00380 49645 50142 gene locus_tag LOCUS_00390 49645 50142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 50799 50158 gene locus_tag LOCUS_00400 50799 50158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 51024 51785 gene locus_tag LOCUS_00410 51024 51785 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031344.1 protein_id gnl|my_center|LOCUS_00410 52602 51790 gene locus_tag LOCUS_00420 52602 51790 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444002.1 protein_id gnl|my_center|LOCUS_00420 53564 52692 gene locus_tag LOCUS_00430 53564 52692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 54673 53561 gene locus_tag LOCUS_00440 gene proB 54673 53561 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_00440 55361 54801 gene locus_tag LOCUS_00450 gene frr 55361 54801 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919786.1 protein_id gnl|my_center|LOCUS_00450 56128 55385 gene locus_tag LOCUS_00460 gene pyrH 56128 55385 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965095.1 protein_id gnl|my_center|LOCUS_00460 56325 57116 gene locus_tag LOCUS_00470 gene trpA 56325 57116 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750470.1 protein_id gnl|my_center|LOCUS_00470 57608 57132 gene locus_tag LOCUS_00480 57608 57132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 58066 57623 gene locus_tag LOCUS_00490 gene nrdR 58066 57623 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_00490 58684 58073 gene locus_tag LOCUS_00500 gene pabA 58684 58073 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602287.1 protein_id gnl|my_center|LOCUS_00500 58771 59916 gene locus_tag LOCUS_00510 gene tgt 58771 59916 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393196.1 protein_id gnl|my_center|LOCUS_00510 60113 63091 gene locus_tag LOCUS_00520 gene secA 60113 63091 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_00520 63258 64883 gene locus_tag LOCUS_00530 gene lnt 63258 64883 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_00530 67295 65016 gene locus_tag LOCUS_00540 67295 65016 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966435.1 protein_id gnl|my_center|LOCUS_00540 67384 67716 gene locus_tag LOCUS_00550 67384 67716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 67968 68762 gene locus_tag LOCUS_00560 67968 68762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 68899 69477 gene locus_tag LOCUS_00570 gene purN 68899 69477 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288010.1 protein_id gnl|my_center|LOCUS_00570 69491 70375 gene locus_tag LOCUS_00580 gene prmA 69491 70375 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 protein_id gnl|my_center|LOCUS_00580 71177 70596 gene locus_tag LOCUS_00590 71177 70596 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115288.1 protein_id gnl|my_center|LOCUS_00590 71925 71368 gene locus_tag LOCUS_00600 gene sufT 71925 71368 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_00600 73349 72033 gene locus_tag LOCUS_00610 gene sufD 73349 72033 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_00610 74945 73533 gene locus_tag LOCUS_00620 gene sufB 74945 73533 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057833.1 protein_id gnl|my_center|LOCUS_00620 75751 74981 gene locus_tag LOCUS_00630 gene sufC 75751 74981 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831944.1 protein_id gnl|my_center|LOCUS_00630 76155 75775 gene locus_tag LOCUS_00640 76155 75775 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_00640 76423 76839 gene locus_tag LOCUS_00650 76423 76839 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943269.1 protein_id gnl|my_center|LOCUS_00650 76973 77974 gene locus_tag LOCUS_00660 gene tal 76973 77974 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533671.1 protein_id gnl|my_center|LOCUS_00660 79145 78057 gene locus_tag LOCUS_00670 79145 78057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 79667 80143 gene locus_tag LOCUS_00680 79667 80143 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403040.1 protein_id gnl|my_center|LOCUS_00680 81208 80411 gene locus_tag LOCUS_00690 81208 80411 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_00690 82334 81417 gene locus_tag LOCUS_00700 gene oppB 82334 81417 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262164.1 protein_id gnl|my_center|LOCUS_00700 83982 82339 gene locus_tag LOCUS_00710 83982 82339 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_00710 85564 84026 gene locus_tag LOCUS_00720 85564 84026 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_00720 85788 86291 gene locus_tag LOCUS_00730 85788 86291 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_00730 86291 87889 gene locus_tag LOCUS_00740 86291 87889 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_00740 87968 88126 gene locus_tag LOCUS_00750 87968 88126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 88287 90557 gene locus_tag LOCUS_00760 88287 90557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 90605 91966 gene locus_tag LOCUS_00770 90605 91966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 92118 93080 gene locus_tag LOCUS_00780 92118 93080 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 protein_id gnl|my_center|LOCUS_00780 93102 94193 gene locus_tag LOCUS_00790 gene allD 93102 94193 CDS product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244926.1 protein_id gnl|my_center|LOCUS_00790 94236 95336 gene locus_tag LOCUS_00800 94236 95336 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_00800 95414 96199 gene locus_tag LOCUS_00810 95414 96199 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_00810 96228 97646 gene locus_tag LOCUS_00820 gene uxaC 96228 97646 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_00820 97860 98591 gene locus_tag LOCUS_00830 97860 98591 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120052.1 protein_id gnl|my_center|LOCUS_00830 98683 99867 gene locus_tag LOCUS_00840 98683 99867 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_00840 100023 100508 gene locus_tag LOCUS_00850 gene ribE 100023 100508 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545200.1 protein_id gnl|my_center|LOCUS_00850 100501 100944 gene locus_tag LOCUS_00860 gene nusB 100501 100944 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 protein_id gnl|my_center|LOCUS_00860 101048 101980 gene locus_tag LOCUS_00870 gene ftsY 101048 101980 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443981.1 protein_id gnl|my_center|LOCUS_00870 102182 105802 gene locus_tag LOCUS_00880 gene nifJ 102182 105802 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_237703763.1 protein_id gnl|my_center|LOCUS_00880 107689 105854 gene locus_tag LOCUS_00890 107689 105854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732216.1 protein_id gnl|my_center|LOCUS_00890 109578 107686 gene locus_tag LOCUS_00900 109578 107686 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_00900 110233 109868 gene locus_tag LOCUS_00910 110233 109868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 110442 111797 gene locus_tag LOCUS_00920 110442 111797 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257295.1 protein_id gnl|my_center|LOCUS_00920 112020 112967 gene locus_tag LOCUS_00930 112020 112967 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267092.1 protein_id gnl|my_center|LOCUS_00930 113226 113690 gene locus_tag LOCUS_00940 113226 113690 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323316.1 protein_id gnl|my_center|LOCUS_00940 114278 113748 gene locus_tag LOCUS_00950 114278 113748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 114664 114275 gene locus_tag LOCUS_00960 gene folB 114664 114275 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242949.1 protein_id gnl|my_center|LOCUS_00960 115553 114798 gene locus_tag LOCUS_00970 115553 114798 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615807.1 protein_id gnl|my_center|LOCUS_00970 116417 115677 gene locus_tag LOCUS_00980 gene rsmI 116417 115677 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918033.1 protein_id gnl|my_center|LOCUS_00980 117547 116765 gene locus_tag LOCUS_00990 117547 116765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 119194 117617 gene locus_tag LOCUS_01000 119194 117617 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941965.1 protein_id gnl|my_center|LOCUS_01000 120919 119267 gene locus_tag LOCUS_01010 gene ilvD 120919 119267 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_01010 121236 122078 gene locus_tag LOCUS_01020 121236 122078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 122096 123163 gene locus_tag LOCUS_01030 gene pheA 122096 123163 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_01030 124171 123188 gene locus_tag LOCUS_01040 124171 123188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 126645 124492 gene locus_tag LOCUS_01050 126645 124492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 126901 127590 gene locus_tag LOCUS_01060 126901 127590 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_01060 >Feature sequence002 1807 3465 gene locus_tag LOCUS_01070 1807 3465 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615908.1 protein_id gnl|my_center|LOCUS_01070 4442 3582 gene locus_tag LOCUS_01080 gene prpC 4442 3582 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_01080 4893 4453 gene locus_tag LOCUS_01090 4893 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 5082 6137 gene locus_tag LOCUS_01100 5082 6137 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392175.1 protein_id gnl|my_center|LOCUS_01100 6574 8472 gene locus_tag LOCUS_01110 6574 8472 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118025.1 protein_id gnl|my_center|LOCUS_01110 8488 11808 gene locus_tag LOCUS_01120 8488 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 11912 11715 gene locus_tag LOCUS_01130 11912 11715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 11951 12745 gene locus_tag LOCUS_01140 11951 12745 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912209.1 protein_id gnl|my_center|LOCUS_01140 12866 13216 gene locus_tag LOCUS_01150 12866 13216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 13314 14051 gene locus_tag LOCUS_01160 13314 14051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 14148 14936 gene locus_tag LOCUS_01170 14148 14936 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246039.1 protein_id gnl|my_center|LOCUS_01170 14943 16130 gene locus_tag LOCUS_01180 gene sucC 14943 16130 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 protein_id gnl|my_center|LOCUS_01180 16178 17053 gene locus_tag LOCUS_01190 gene sucD 16178 17053 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941720.1 protein_id gnl|my_center|LOCUS_01190 17064 17726 gene locus_tag LOCUS_01200 17064 17726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 17692 18765 gene locus_tag LOCUS_01210 17692 18765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 18779 19792 gene locus_tag LOCUS_01220 18779 19792 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921231.1 protein_id gnl|my_center|LOCUS_01220 21015 19804 gene locus_tag LOCUS_01230 21015 19804 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_01230 21640 21188 gene locus_tag LOCUS_01240 21640 21188 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_01240 21821 23746 gene locus_tag LOCUS_01250 21821 23746 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929287.1 protein_id gnl|my_center|LOCUS_01250 24293 23703 gene locus_tag LOCUS_01260 24293 23703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 25274 24483 gene locus_tag LOCUS_01270 gene kdsA 25274 24483 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879994.1 protein_id gnl|my_center|LOCUS_01270 26902 25271 gene locus_tag LOCUS_01280 26902 25271 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326169.1 protein_id gnl|my_center|LOCUS_01280 27078 28358 gene locus_tag LOCUS_01290 27078 28358 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_01290 28465 29229 gene locus_tag LOCUS_01300 28465 29229 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776860.1 protein_id gnl|my_center|LOCUS_01300 29896 29270 gene locus_tag LOCUS_01310 29896 29270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 29971 30531 gene locus_tag LOCUS_01320 29971 30531 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338381.1 protein_id gnl|my_center|LOCUS_01320 30685 32079 gene locus_tag LOCUS_01330 30685 32079 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107138.1 protein_id gnl|my_center|LOCUS_01330 32123 32569 gene locus_tag LOCUS_01340 32123 32569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 32585 33739 gene locus_tag LOCUS_01350 32585 33739 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257480.1 protein_id gnl|my_center|LOCUS_01350 33984 34769 gene locus_tag LOCUS_01360 33984 34769 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067370.1 protein_id gnl|my_center|LOCUS_01360 35127 36938 gene locus_tag LOCUS_01370 gene thiC 35127 36938 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_01370 37137 38468 gene locus_tag LOCUS_01380 37137 38468 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027778.1 protein_id gnl|my_center|LOCUS_01380 38775 39701 gene locus_tag LOCUS_01390 38775 39701 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777096.1 protein_id gnl|my_center|LOCUS_01390 39701 40555 gene locus_tag LOCUS_01400 39701 40555 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056662.1 protein_id gnl|my_center|LOCUS_01400 40560 41549 gene locus_tag LOCUS_01410 40560 41549 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728286.1 protein_id gnl|my_center|LOCUS_01410 42602 41574 gene locus_tag LOCUS_01420 42602 41574 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_01420 44107 42671 gene locus_tag LOCUS_01430 44107 42671 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_01430 44271 45566 gene locus_tag LOCUS_01440 gene purD 44271 45566 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_01440 45718 46740 gene locus_tag LOCUS_01450 45718 46740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 46744 47223 gene locus_tag LOCUS_01460 46744 47223 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_01460 47308 48582 gene locus_tag LOCUS_01470 47308 48582 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_01470 48810 49541 gene locus_tag LOCUS_01480 48810 49541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 49718 51451 gene locus_tag LOCUS_01490 49718 51451 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326733.1 protein_id gnl|my_center|LOCUS_01490 51676 53073 gene locus_tag LOCUS_01500 gene bioA 51676 53073 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942227.1 protein_id gnl|my_center|LOCUS_01500 53077 54090 gene locus_tag LOCUS_01510 gene bioB 53077 54090 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962410.1 protein_id gnl|my_center|LOCUS_01510 54154 54888 gene locus_tag LOCUS_01520 54154 54888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 54885 56048 gene locus_tag LOCUS_01530 gene bioF 54885 56048 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_01530 56045 56662 gene locus_tag LOCUS_01540 56045 56662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 56732 57454 gene locus_tag LOCUS_01550 gene bioC 56732 57454 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957596.1 protein_id gnl|my_center|LOCUS_01550 58139 57495 gene locus_tag LOCUS_01560 58139 57495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 58495 59916 gene locus_tag LOCUS_01570 gene glnA 58495 59916 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_01570 61526 60000 gene locus_tag LOCUS_01580 61526 60000 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460435.1 protein_id gnl|my_center|LOCUS_01580 63177 61519 gene locus_tag LOCUS_01590 63177 61519 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392501.1 protein_id gnl|my_center|LOCUS_01590 65063 63195 gene locus_tag LOCUS_01600 gene nuoL 65063 63195 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_01600 65370 65065 gene locus_tag LOCUS_01610 gene nuoK 65370 65065 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_01610 65954 65409 gene locus_tag LOCUS_01620 65954 65409 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_01620 66405 68300 gene locus_tag LOCUS_01630 gene aceB 66405 68300 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107325.1 protein_id gnl|my_center|LOCUS_01630 71341 68738 gene locus_tag LOCUS_01640 71341 68738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 74808 71257 gene locus_tag LOCUS_01650 74808 71257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01650 74831 75091 gene locus_tag LOCUS_01660 74831 75091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 75181 76170 gene locus_tag LOCUS_01670 75181 76170 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014745580.1 protein_id gnl|my_center|LOCUS_01670 76867 76409 gene locus_tag LOCUS_01680 76867 76409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 77165 77959 gene locus_tag LOCUS_01690 77165 77959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 78169 79122 gene locus_tag LOCUS_01700 78169 79122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 80060 79293 gene locus_tag LOCUS_01710 80060 79293 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_01710 80514 80263 gene locus_tag LOCUS_01720 80514 80263 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224398.1 protein_id gnl|my_center|LOCUS_01720 81464 80619 gene locus_tag LOCUS_01730 gene prmC 81464 80619 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122233.1 protein_id gnl|my_center|LOCUS_01730 81995 81486 gene locus_tag LOCUS_01740 81995 81486 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258042.1 protein_id gnl|my_center|LOCUS_01740 83180 82023 gene locus_tag LOCUS_01750 gene dnaJ 83180 82023 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522147.1 protein_id gnl|my_center|LOCUS_01750 83900 83199 gene locus_tag LOCUS_01760 gene grpE 83900 83199 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_01760 84704 83997 gene locus_tag LOCUS_01770 84704 83997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 85640 84777 gene locus_tag LOCUS_01780 85640 84777 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_01780 85956 88289 gene locus_tag LOCUS_01790 85956 88289 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_01790 88341 89129 gene locus_tag LOCUS_01800 88341 89129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 90425 89232 gene locus_tag LOCUS_01810 90425 89232 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930937.1 protein_id gnl|my_center|LOCUS_01810 90619 90804 gene locus_tag LOCUS_01820 90619 90804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 92786 90975 gene locus_tag LOCUS_01830 92786 90975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333317.1 protein_id gnl|my_center|LOCUS_01830 94764 92767 gene locus_tag LOCUS_01840 94764 92767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120829.1 protein_id gnl|my_center|LOCUS_01840 94883 95839 gene locus_tag LOCUS_01850 94883 95839 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528681.1 protein_id gnl|my_center|LOCUS_01850 95851 96759 gene locus_tag LOCUS_01860 95851 96759 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528680.1 protein_id gnl|my_center|LOCUS_01860 96956 97558 gene locus_tag LOCUS_01870 96956 97558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 98612 97752 gene locus_tag LOCUS_01880 gene hisG 98612 97752 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_01880 98832 99623 gene locus_tag LOCUS_01890 gene phoP 98832 99623 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065226.1 protein_id gnl|my_center|LOCUS_01890 99748 101010 gene locus_tag LOCUS_01900 99748 101010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 102646 101231 gene locus_tag LOCUS_01910 gene gltX 102646 101231 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082426.1 protein_id gnl|my_center|LOCUS_01910 102970 102749 gene locus_tag LOCUS_01920 102970 102749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 102857 103660 gene locus_tag LOCUS_01930 102857 103660 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886481.1 protein_id gnl|my_center|LOCUS_01930 104171 103614 gene locus_tag LOCUS_01940 104171 103614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 104492 104860 gene locus_tag LOCUS_01950 104492 104860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 104979 105055 gene locus_tag LOCUS_t00020 104979 105055 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 105494 106546 gene locus_tag LOCUS_01960 105494 106546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 106571 107056 gene locus_tag LOCUS_01970 106571 107056 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969374.1 protein_id gnl|my_center|LOCUS_01970 107483 107707 gene locus_tag LOCUS_01980 107483 107707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 108971 108201 gene locus_tag LOCUS_01990 108971 108201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 <109579 108941 gene locus_tag LOCUS_02000 <109579 108941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870227.1:BREX-3 system phosphatase PglZ >Feature sequence003 304 1191 gene locus_tag LOCUS_02010 304 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 1892 1284 gene locus_tag LOCUS_02020 1892 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 2538 2137 gene locus_tag LOCUS_02030 2538 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 3108 2800 gene locus_tag LOCUS_02040 3108 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 3614 3105 gene locus_tag LOCUS_02050 3614 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 4724 3810 gene locus_tag LOCUS_02060 4724 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 7873 4721 gene locus_tag LOCUS_02070 7873 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 8394 7870 gene locus_tag LOCUS_02080 8394 7870 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107089.1 protein_id gnl|my_center|LOCUS_02080 10019 8391 gene locus_tag LOCUS_02090 10019 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 10694 10023 gene locus_tag LOCUS_02100 10694 10023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 11246 10785 gene locus_tag LOCUS_02110 11246 10785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 11512 11739 gene locus_tag LOCUS_02120 11512 11739 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_02120 13473 12298 gene locus_tag LOCUS_02130 gene galK 13473 12298 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_02130 13658 16990 gene locus_tag LOCUS_02140 13658 16990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 19627 17036 gene locus_tag LOCUS_02150 19627 17036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 22478 19776 gene locus_tag LOCUS_02160 22478 19776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 24499 22571 gene locus_tag LOCUS_02170 24499 22571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 25995 24511 gene locus_tag LOCUS_02180 25995 24511 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_02180 26763 26002 gene locus_tag LOCUS_02190 26763 26002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 27877 26825 gene locus_tag LOCUS_02200 27877 26825 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_02200 28746 27925 gene locus_tag LOCUS_02210 28746 27925 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_02210 29788 28763 gene locus_tag LOCUS_02220 29788 28763 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230650.1 protein_id gnl|my_center|LOCUS_02220 30982 29891 gene locus_tag LOCUS_02230 30982 29891 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_02230 32785 31328 gene locus_tag LOCUS_02240 32785 31328 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_02240 34323 32794 gene locus_tag LOCUS_02250 34323 32794 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967804.1 protein_id gnl|my_center|LOCUS_02250 36097 34316 gene locus_tag LOCUS_02260 36097 34316 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969263.1 protein_id gnl|my_center|LOCUS_02260 36350 36090 gene locus_tag LOCUS_02270 36350 36090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 37822 36347 gene locus_tag LOCUS_02280 37822 36347 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_02280 38153 37827 gene locus_tag LOCUS_02290 gene nuoK 38153 37827 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140654.1 protein_id gnl|my_center|LOCUS_02290 38680 38150 gene locus_tag LOCUS_02300 38680 38150 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140655.1 protein_id gnl|my_center|LOCUS_02300 39126 38677 gene locus_tag LOCUS_02310 39126 38677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 40118 39129 gene locus_tag LOCUS_02320 gene nuoH 40118 39129 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_02320 41236 40115 gene locus_tag LOCUS_02330 gene nuoD 41236 40115 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_02330 41745 41236 gene locus_tag LOCUS_02340 41745 41236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 42326 41796 gene locus_tag LOCUS_02350 42326 41796 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392493.1 protein_id gnl|my_center|LOCUS_02350 42742 42323 gene locus_tag LOCUS_02360 gene ndhC 42742 42323 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_02360 43825 42893 gene locus_tag LOCUS_02370 43825 42893 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256841.1 protein_id gnl|my_center|LOCUS_02370 45674 43839 gene locus_tag LOCUS_02380 45674 43839 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256840.1 protein_id gnl|my_center|LOCUS_02380 46487 47596 gene locus_tag LOCUS_02390 46487 47596 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_02390 47593 48879 gene locus_tag LOCUS_02400 47593 48879 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919324.1 protein_id gnl|my_center|LOCUS_02400 48879 49451 gene locus_tag LOCUS_02410 48879 49451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 50668 49553 gene locus_tag LOCUS_02420 50668 49553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 51713 51006 gene locus_tag LOCUS_02430 51713 51006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 52602 51883 gene locus_tag LOCUS_02440 52602 51883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02440 52990 53175 gene locus_tag LOCUS_02450 52990 53175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 53293 53865 gene locus_tag LOCUS_02460 53293 53865 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_02460 54054 55280 gene locus_tag LOCUS_02470 gene queG 54054 55280 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397385.1 protein_id gnl|my_center|LOCUS_02470 55430 57031 gene locus_tag LOCUS_02480 55430 57031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 57058 57279 gene locus_tag LOCUS_02490 57058 57279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 57901 57464 gene locus_tag LOCUS_02500 57901 57464 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418942.1 protein_id gnl|my_center|LOCUS_02500 58439 62263 gene locus_tag LOCUS_02510 58439 62263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 64949 62277 gene locus_tag LOCUS_02520 gene alaS 64949 62277 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_02520 66060 64960 gene locus_tag LOCUS_02530 gene leuB 66060 64960 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459506.1 protein_id gnl|my_center|LOCUS_02530 66306 68180 gene locus_tag LOCUS_02540 66306 68180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 68184 69965 gene locus_tag LOCUS_02550 68184 69965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 69929 70774 gene locus_tag LOCUS_02560 69929 70774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 71153 71060 gene locus_tag LOCUS_t00030 71153 71060 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 71392 73110 gene locus_tag LOCUS_02570 71392 73110 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_02570 75009 73360 gene locus_tag LOCUS_02580 75009 73360 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921665.1 protein_id gnl|my_center|LOCUS_02580 76025 75210 gene locus_tag LOCUS_02590 76025 75210 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974782.1 protein_id gnl|my_center|LOCUS_02590 76235 76918 gene locus_tag LOCUS_02600 76235 76918 CDS product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871201.1 protein_id gnl|my_center|LOCUS_02600 78312 77017 gene locus_tag LOCUS_02610 78312 77017 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_02610 78628 79635 gene locus_tag LOCUS_02620 78628 79635 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105506.1 protein_id gnl|my_center|LOCUS_02620 80367 79867 gene locus_tag LOCUS_02630 80367 79867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 80472 80888 gene locus_tag LOCUS_02640 gene ndk 80472 80888 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123449.1 protein_id gnl|my_center|LOCUS_02640 80896 81834 gene locus_tag LOCUS_02650 80896 81834 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942309.1 protein_id gnl|my_center|LOCUS_02650 81895 82824 gene locus_tag LOCUS_02660 81895 82824 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_02660 82919 84082 gene locus_tag LOCUS_02670 gene aroC 82919 84082 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_02670 84152 84898 gene locus_tag LOCUS_02680 84152 84898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 85010 85093 gene locus_tag LOCUS_t00040 85010 85093 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 85309 85127 gene locus_tag LOCUS_02690 85309 85127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 85913 85377 gene locus_tag LOCUS_02700 85913 85377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 86768 86235 gene locus_tag LOCUS_02710 gene azu 86768 86235 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688275.1 protein_id gnl|my_center|LOCUS_02710 87723 86800 gene locus_tag LOCUS_02720 87723 86800 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837921.1 protein_id gnl|my_center|LOCUS_02720 88060 89946 gene locus_tag LOCUS_02730 gene nosZ 88060 89946 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838072.1 protein_id gnl|my_center|LOCUS_02730 90186 90824 gene locus_tag LOCUS_02740 90186 90824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 90857 92212 gene locus_tag LOCUS_02750 90857 92212 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403089.1 protein_id gnl|my_center|LOCUS_02750 92209 92883 gene locus_tag LOCUS_02760 92209 92883 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403090.1 protein_id gnl|my_center|LOCUS_02760 92880 93665 gene locus_tag LOCUS_02770 92880 93665 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808202.1 protein_id gnl|my_center|LOCUS_02770 93918 95339 gene locus_tag LOCUS_02780 93918 95339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 96117 95377 gene locus_tag LOCUS_02790 96117 95377 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633090.1 protein_id gnl|my_center|LOCUS_02790 96256 97212 gene locus_tag LOCUS_02800 gene waaC 96256 97212 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_02800 97306 97872 gene locus_tag LOCUS_02810 gene cysC 97306 97872 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468764.1 protein_id gnl|my_center|LOCUS_02810 97906 98811 gene locus_tag LOCUS_02820 gene cysD 97906 98811 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002735002.1 protein_id gnl|my_center|LOCUS_02820 >Feature sequence004 1043 2242 gene locus_tag LOCUS_02830 1043 2242 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209281.1 protein_id gnl|my_center|LOCUS_02830 4227 2296 gene locus_tag LOCUS_02840 4227 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 5615 4257 gene locus_tag LOCUS_02850 5615 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 6974 5796 gene locus_tag LOCUS_02860 6974 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 7035 7220 gene locus_tag LOCUS_02870 7035 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 9391 7391 gene locus_tag LOCUS_02880 9391 7391 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583112.1 protein_id gnl|my_center|LOCUS_02880 10065 9727 gene locus_tag LOCUS_02890 10065 9727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 11095 10100 gene locus_tag LOCUS_02900 gene galE 11095 10100 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615363.1 protein_id gnl|my_center|LOCUS_02900 11745 12137 gene locus_tag LOCUS_02910 11745 12137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 12357 12557 gene locus_tag LOCUS_02920 12357 12557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 12588 12917 gene locus_tag LOCUS_02930 12588 12917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 13004 13657 gene locus_tag LOCUS_02940 13004 13657 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_02940 13849 13559 gene locus_tag LOCUS_02950 13849 13559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 14132 15397 gene locus_tag LOCUS_02960 14132 15397 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325817.1 protein_id gnl|my_center|LOCUS_02960 15419 15679 gene locus_tag LOCUS_02970 15419 15679 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921431.1 protein_id gnl|my_center|LOCUS_02970 15719 17164 gene locus_tag LOCUS_02980 15719 17164 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118443.1 protein_id gnl|my_center|LOCUS_02980 17190 18101 gene locus_tag LOCUS_02990 17190 18101 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922152.1 protein_id gnl|my_center|LOCUS_02990 18853 18263 gene locus_tag LOCUS_03000 18853 18263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 18987 19754 gene locus_tag LOCUS_03010 18987 19754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 19854 20834 gene locus_tag LOCUS_03020 19854 20834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 21377 20850 gene locus_tag LOCUS_03030 21377 20850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 22038 21586 gene locus_tag LOCUS_03040 gene aroQ 22038 21586 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757082.1 protein_id gnl|my_center|LOCUS_03040 22885 22130 gene locus_tag LOCUS_03050 22885 22130 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_03050 23338 22934 gene locus_tag LOCUS_03060 23338 22934 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925121.1 protein_id gnl|my_center|LOCUS_03060 23802 24455 gene locus_tag LOCUS_03070 23802 24455 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_03070 24452 27739 gene locus_tag LOCUS_03080 24452 27739 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_03080 27736 29163 gene locus_tag LOCUS_03090 gene nrfD 27736 29163 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_03090 29166 29705 gene locus_tag LOCUS_03100 29166 29705 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_03100 29708 30337 gene locus_tag LOCUS_03110 29708 30337 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421545.1 protein_id gnl|my_center|LOCUS_03110 30334 31599 gene locus_tag LOCUS_03120 30334 31599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062436.1 protein_id gnl|my_center|LOCUS_03120 31613 31999 gene locus_tag LOCUS_03130 31613 31999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 32096 33490 gene locus_tag LOCUS_03140 32096 33490 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_03140 33487 34140 gene locus_tag LOCUS_03150 33487 34140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 34133 34795 gene locus_tag LOCUS_03160 34133 34795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 34987 35787 gene locus_tag LOCUS_03170 gene proC 34987 35787 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 protein_id gnl|my_center|LOCUS_03170 35784 36782 gene locus_tag LOCUS_03180 gene rfaD 35784 36782 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932927.1 protein_id gnl|my_center|LOCUS_03180 37048 39015 gene locus_tag LOCUS_03190 37048 39015 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_03190 40049 39129 gene locus_tag LOCUS_03200 40049 39129 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_03200 40052 41281 gene locus_tag LOCUS_03210 40052 41281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 41322 42122 gene locus_tag LOCUS_03220 41322 42122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 42157 43572 gene locus_tag LOCUS_03230 42157 43572 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_03230 43569 44327 gene locus_tag LOCUS_03240 43569 44327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 44342 45340 gene locus_tag LOCUS_03250 44342 45340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 45806 45531 gene locus_tag LOCUS_03260 45806 45531 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 protein_id gnl|my_center|LOCUS_03260 47298 46000 gene locus_tag LOCUS_03270 47298 46000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 47320 47493 gene locus_tag LOCUS_03280 47320 47493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 48474 47737 gene locus_tag LOCUS_03290 gene radC 48474 47737 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360029.1 protein_id gnl|my_center|LOCUS_03290 48968 48624 gene locus_tag LOCUS_03300 48968 48624 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121435.1 protein_id gnl|my_center|LOCUS_03300 50764 49031 gene locus_tag LOCUS_03310 gene msbA 50764 49031 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_03310 51188 51922 gene locus_tag LOCUS_03320 51188 51922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 51919 52497 gene locus_tag LOCUS_03330 51919 52497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 52494 53618 gene locus_tag LOCUS_03340 52494 53618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 53670 54137 gene locus_tag LOCUS_03350 53670 54137 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831274.1 protein_id gnl|my_center|LOCUS_03350 54298 54071 gene locus_tag LOCUS_03360 54298 54071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 54420 54980 gene locus_tag LOCUS_03370 54420 54980 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403273.1 protein_id gnl|my_center|LOCUS_03370 56024 54942 gene locus_tag LOCUS_03380 gene hemA 56024 54942 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938754.1 protein_id gnl|my_center|LOCUS_03380 56910 56026 gene locus_tag LOCUS_03390 gene ccsA 56910 56026 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007721.1 protein_id gnl|my_center|LOCUS_03390 58091 56949 gene locus_tag LOCUS_03400 gene carA 58091 56949 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921837.1 protein_id gnl|my_center|LOCUS_03400 58166 59509 gene locus_tag LOCUS_03410 gene ablA 58166 59509 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_03410 59966 64612 gene locus_tag LOCUS_03420 gene gltB 59966 64612 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_03420 64635 66122 gene locus_tag LOCUS_03430 64635 66122 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_03430 66631 68412 gene locus_tag LOCUS_03440 66631 68412 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119625.1 protein_id gnl|my_center|LOCUS_03440 68684 69631 gene locus_tag LOCUS_03450 68684 69631 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_03450 71279 69777 gene locus_tag LOCUS_03460 71279 69777 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_03460 71508 71789 gene locus_tag LOCUS_03470 71508 71789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 71767 72177 gene locus_tag LOCUS_03480 71767 72177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 72152 72637 gene locus_tag LOCUS_03490 72152 72637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 72997 75447 gene locus_tag LOCUS_03500 72997 75447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 77139 75499 gene locus_tag LOCUS_03510 77139 75499 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_03510 77930 77262 gene locus_tag LOCUS_03520 gene rpe 77930 77262 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392431.1 protein_id gnl|my_center|LOCUS_03520 79281 77938 gene locus_tag LOCUS_03530 gene waaA 79281 77938 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_03530 79497 82385 gene locus_tag LOCUS_03540 79497 82385 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920490.1 protein_id gnl|my_center|LOCUS_03540 82990 82400 gene locus_tag LOCUS_03550 82990 82400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 83079 83993 gene locus_tag LOCUS_03560 83079 83993 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232400.1 protein_id gnl|my_center|LOCUS_03560 85014 84076 gene locus_tag LOCUS_03570 85014 84076 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507354.1 protein_id gnl|my_center|LOCUS_03570 86952 85102 gene locus_tag LOCUS_03580 86952 85102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 87028 88311 gene locus_tag LOCUS_03590 gene rsmB 87028 88311 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838452.1 protein_id gnl|my_center|LOCUS_03590 >Feature sequence005 175 354 gene locus_tag LOCUS_03600 175 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 559 1977 gene locus_tag LOCUS_03610 559 1977 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938336.1 protein_id gnl|my_center|LOCUS_03610 1981 2361 gene locus_tag LOCUS_03620 1981 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 2450 3355 gene locus_tag LOCUS_03630 2450 3355 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_03630 3352 3687 gene locus_tag LOCUS_03640 3352 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 3935 4843 gene locus_tag LOCUS_03650 3935 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 5049 6734 gene locus_tag LOCUS_03660 5049 6734 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_03660 8752 6890 gene locus_tag LOCUS_03670 8752 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 9364 9858 gene locus_tag LOCUS_03680 9364 9858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 10720 11997 gene locus_tag LOCUS_03690 10720 11997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 12231 12767 gene locus_tag LOCUS_03700 12231 12767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 13037 14101 gene locus_tag LOCUS_03710 gene aroF 13037 14101 CDS product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168062.1 protein_id gnl|my_center|LOCUS_03710 15278 14232 gene locus_tag LOCUS_03720 gene hypE 15278 14232 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_03720 16434 15328 gene locus_tag LOCUS_03730 gene hypD 16434 15328 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_03730 16685 16431 gene locus_tag LOCUS_03740 16685 16431 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250951.1 protein_id gnl|my_center|LOCUS_03740 19121 16701 gene locus_tag LOCUS_03750 gene hypF 19121 16701 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_03750 20090 19215 gene locus_tag LOCUS_03760 gene hypB 20090 19215 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388055.1 protein_id gnl|my_center|LOCUS_03760 20437 20093 gene locus_tag LOCUS_03770 gene hypA 20437 20093 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258629.1 protein_id gnl|my_center|LOCUS_03770 20838 21803 gene locus_tag LOCUS_03780 20838 21803 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939508.1 protein_id gnl|my_center|LOCUS_03780 22049 23170 gene locus_tag LOCUS_03790 22049 23170 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 protein_id gnl|my_center|LOCUS_03790 23325 25388 gene locus_tag LOCUS_03800 23325 25388 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_03800 25613 27013 gene locus_tag LOCUS_03810 25613 27013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 27918 26974 gene locus_tag LOCUS_03820 27918 26974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 28332 30212 gene locus_tag LOCUS_03830 28332 30212 CDS product DUF4914 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583124.1 protein_id gnl|my_center|LOCUS_03830 31065 30265 gene locus_tag LOCUS_03840 31065 30265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 31511 31086 gene locus_tag LOCUS_03850 gene tolR 31511 31086 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388847.1 protein_id gnl|my_center|LOCUS_03850 32247 31525 gene locus_tag LOCUS_03860 gene tolQ 32247 31525 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940358.1 protein_id gnl|my_center|LOCUS_03860 32441 33556 gene locus_tag LOCUS_03870 32441 33556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 33575 34207 gene locus_tag LOCUS_03880 gene tmk 33575 34207 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942869.1 protein_id gnl|my_center|LOCUS_03880 34182 35147 gene locus_tag LOCUS_03890 34182 35147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 35169 35696 gene locus_tag LOCUS_03900 35169 35696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 36500 35730 gene locus_tag LOCUS_03910 36500 35730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 36597 38024 gene locus_tag LOCUS_03920 36597 38024 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338202.1 protein_id gnl|my_center|LOCUS_03920 38093 39025 gene locus_tag LOCUS_03930 gene hemF 38093 39025 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097311.1 protein_id gnl|my_center|LOCUS_03930 39116 40147 gene locus_tag LOCUS_03940 gene hemE 39116 40147 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403024.1 protein_id gnl|my_center|LOCUS_03940 40144 41511 gene locus_tag LOCUS_03950 gene hemG 40144 41511 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_03950 42788 42714 gene locus_tag LOCUS_t00050 42788 42714 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 43733 42873 gene locus_tag LOCUS_03960 43733 42873 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 protein_id gnl|my_center|LOCUS_03960 44022 46379 gene locus_tag LOCUS_03970 44022 46379 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113616.1 protein_id gnl|my_center|LOCUS_03970 46552 47100 gene locus_tag LOCUS_03980 gene pyrR 46552 47100 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_03980 47097 48047 gene locus_tag LOCUS_03990 47097 48047 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_03990 48040 49338 gene locus_tag LOCUS_04000 48040 49338 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_04000 49338 50177 gene locus_tag LOCUS_04010 49338 50177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 50432 51466 gene locus_tag LOCUS_04020 50432 51466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 52033 51629 gene locus_tag LOCUS_04030 52033 51629 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207691809.1 protein_id gnl|my_center|LOCUS_04030 52540 52064 gene locus_tag LOCUS_04040 52540 52064 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258972.1 protein_id gnl|my_center|LOCUS_04040 52861 53748 gene locus_tag LOCUS_04050 52861 53748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 54744 53929 gene locus_tag LOCUS_04060 54744 53929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 55879 54839 gene locus_tag LOCUS_04070 55879 54839 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965785.1 protein_id gnl|my_center|LOCUS_04070 57334 56021 gene locus_tag LOCUS_04080 57334 56021 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_04080 57695 57354 gene locus_tag LOCUS_04090 57695 57354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 59177 57861 gene locus_tag LOCUS_04100 59177 57861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 59275 61002 gene locus_tag LOCUS_04110 59275 61002 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933561.1 protein_id gnl|my_center|LOCUS_04110 62636 61245 gene locus_tag LOCUS_04120 62636 61245 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_04120 64609 62633 gene locus_tag LOCUS_04130 64609 62633 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_04130 64737 65309 gene locus_tag LOCUS_04140 64737 65309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 66073 65315 gene locus_tag LOCUS_04150 66073 65315 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364422.1 protein_id gnl|my_center|LOCUS_04150 67988 66075 gene locus_tag LOCUS_04160 67988 66075 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_04160 68655 68017 gene locus_tag LOCUS_04170 68655 68017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_04170 70803 68992 gene locus_tag LOCUS_04180 70803 68992 CDS product TIGR03546 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020340.1 protein_id gnl|my_center|LOCUS_04180 72539 70929 gene locus_tag LOCUS_04190 72539 70929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 72813 74399 gene locus_tag LOCUS_04200 72813 74399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 76056 74503 gene locus_tag LOCUS_04210 76056 74503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 76467 76383 gene locus_tag LOCUS_t00060 76467 76383 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 76666 76754 gene locus_tag LOCUS_t00070 76666 76754 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence006 397 1119 gene locus_tag LOCUS_04220 397 1119 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883079.1 protein_id gnl|my_center|LOCUS_04220 1264 1953 gene locus_tag LOCUS_04230 1264 1953 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_04230 2475 2104 gene locus_tag LOCUS_04240 2475 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 3138 3518 gene locus_tag LOCUS_04250 3138 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3919 5211 gene locus_tag LOCUS_04260 gene murA 3919 5211 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_04260 5208 6248 gene locus_tag LOCUS_04270 gene ruvB 5208 6248 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964224.1 protein_id gnl|my_center|LOCUS_04270 6664 6260 gene locus_tag LOCUS_04280 6664 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 6929 6675 gene locus_tag LOCUS_04290 6929 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 7018 9837 gene locus_tag LOCUS_04300 7018 9837 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943088.1 protein_id gnl|my_center|LOCUS_04300 9841 11109 gene locus_tag LOCUS_04310 gene odhB 9841 11109 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943087.1 protein_id gnl|my_center|LOCUS_04310 11253 12653 gene locus_tag LOCUS_04320 gene lpdA 11253 12653 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083281.1 protein_id gnl|my_center|LOCUS_04320 14412 12751 gene locus_tag LOCUS_04330 14412 12751 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_04330 15609 14581 gene locus_tag LOCUS_04340 15609 14581 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022960.1 protein_id gnl|my_center|LOCUS_04340 16093 17565 gene locus_tag LOCUS_04350 16093 17565 CDS product COG3014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851858.1 protein_id gnl|my_center|LOCUS_04350 17562 18002 gene locus_tag LOCUS_04360 17562 18002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 18103 18732 gene locus_tag LOCUS_04370 18103 18732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 19242 19682 gene locus_tag LOCUS_04380 gene hisI 19242 19682 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088269.1 protein_id gnl|my_center|LOCUS_04380 20010 20561 gene locus_tag LOCUS_04390 20010 20561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 22028 20589 gene locus_tag LOCUS_04400 22028 20589 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_04400 24105 22192 gene locus_tag LOCUS_04410 24105 22192 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_04410 26531 24204 gene locus_tag LOCUS_04420 gene purL 26531 24204 CDS product phosphoribosylformylglycinamidine synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055555.1 protein_id gnl|my_center|LOCUS_04420 27304 26594 gene locus_tag LOCUS_04430 gene purQ 27304 26594 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393545.1 protein_id gnl|my_center|LOCUS_04430 27591 27304 gene locus_tag LOCUS_04440 gene purS 27591 27304 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722248.1 protein_id gnl|my_center|LOCUS_04440 28340 27588 gene locus_tag LOCUS_04450 gene kdsB 28340 27588 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_04450 28520 30052 gene locus_tag LOCUS_04460 gene pabB 28520 30052 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189724.1 protein_id gnl|my_center|LOCUS_04460 30063 30956 gene locus_tag LOCUS_04470 gene pabC 30063 30956 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244544.1 protein_id gnl|my_center|LOCUS_04470 31815 30994 gene locus_tag LOCUS_04480 31815 30994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 33477 32377 gene locus_tag LOCUS_04490 33477 32377 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070593.1 protein_id gnl|my_center|LOCUS_04490 34480 33806 gene locus_tag LOCUS_04500 34480 33806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 35468 34599 gene locus_tag LOCUS_04510 gene purU 35468 34599 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524116.1 protein_id gnl|my_center|LOCUS_04510 38710 35465 gene locus_tag LOCUS_04520 gene carB 38710 35465 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_04520 40135 38855 gene locus_tag LOCUS_04530 40135 38855 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546691.1 protein_id gnl|my_center|LOCUS_04530 41314 40211 gene locus_tag LOCUS_04540 41314 40211 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_04540 41528 41600 gene locus_tag LOCUS_t00080 41528 41600 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 41681 42397 gene locus_tag LOCUS_04550 41681 42397 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266363.1 protein_id gnl|my_center|LOCUS_04550 42444 42704 gene locus_tag LOCUS_04560 42444 42704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 43774 42722 gene locus_tag LOCUS_04570 gene tsaD 43774 42722 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958097.1 protein_id gnl|my_center|LOCUS_04570 45103 43823 gene locus_tag LOCUS_04580 45103 43823 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941636.1 protein_id gnl|my_center|LOCUS_04580 45319 46296 gene locus_tag LOCUS_04590 45319 46296 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140038.1 protein_id gnl|my_center|LOCUS_04590 46510 46316 gene locus_tag LOCUS_04600 46510 46316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 46552 46782 gene locus_tag LOCUS_04610 46552 46782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 48405 46828 gene locus_tag LOCUS_04620 gene murJ 48405 46828 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102622.1 protein_id gnl|my_center|LOCUS_04620 48538 49581 gene locus_tag LOCUS_04630 gene pta 48538 49581 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_04630 49578 50750 gene locus_tag LOCUS_04640 49578 50750 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941549.1 protein_id gnl|my_center|LOCUS_04640 50847 51407 gene locus_tag LOCUS_04650 gene efp 50847 51407 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869789.1 protein_id gnl|my_center|LOCUS_04650 52755 51412 gene locus_tag LOCUS_04660 52755 51412 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583823.1 protein_id gnl|my_center|LOCUS_04660 52960 54711 gene locus_tag LOCUS_04670 gene argS 52960 54711 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951154.1 protein_id gnl|my_center|LOCUS_04670 54839 55870 gene locus_tag LOCUS_04680 54839 55870 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338084.1 protein_id gnl|my_center|LOCUS_04680 57698 56022 gene locus_tag LOCUS_04690 57698 56022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 57822 58487 gene locus_tag LOCUS_04700 57822 58487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 58533 59558 gene locus_tag LOCUS_04710 58533 59558 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_04710 59721 60227 gene locus_tag LOCUS_04720 59721 60227 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990647.1 protein_id gnl|my_center|LOCUS_04720 60764 60438 gene locus_tag LOCUS_04730 60764 60438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 63310 60764 gene locus_tag LOCUS_04740 63310 60764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 63684 63929 gene locus_tag LOCUS_04750 63684 63929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 67186 64103 gene locus_tag LOCUS_04760 67186 64103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 69074 67113 gene locus_tag LOCUS_04770 69074 67113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 72049 69071 gene locus_tag LOCUS_04780 72049 69071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 72421 73734 gene locus_tag LOCUS_04790 72421 73734 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810293.1 protein_id gnl|my_center|LOCUS_04790 73740 74291 gene locus_tag LOCUS_04800 73740 74291 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810294.1 protein_id gnl|my_center|LOCUS_04800 74490 74248 gene locus_tag LOCUS_04810 74490 74248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 >Feature sequence007 1471 923 gene locus_tag LOCUS_04820 1471 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 1941 1561 gene locus_tag LOCUS_04830 1941 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 2467 1922 gene locus_tag LOCUS_04840 2467 1922 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 protein_id gnl|my_center|LOCUS_04840 2822 3535 gene locus_tag LOCUS_04850 2822 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 3647 5548 gene locus_tag LOCUS_04860 3647 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 5616 7127 gene locus_tag LOCUS_04870 5616 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 7176 7907 gene locus_tag LOCUS_04880 7176 7907 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_04880 7924 9189 gene locus_tag LOCUS_04890 7924 9189 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_04890 9293 10585 gene locus_tag LOCUS_04900 gene hemL 9293 10585 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707264.1 protein_id gnl|my_center|LOCUS_04900 12441 10675 gene locus_tag LOCUS_04910 gene ptsP 12441 10675 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_04910 13637 12741 gene locus_tag LOCUS_04920 13637 12741 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889229.1 protein_id gnl|my_center|LOCUS_04920 13792 14484 gene locus_tag LOCUS_04930 gene pyrF 13792 14484 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667227.1 protein_id gnl|my_center|LOCUS_04930 14523 15212 gene locus_tag LOCUS_04940 gene ispD 14523 15212 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_04940 15209 15508 gene locus_tag LOCUS_04950 15209 15508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 16682 15684 gene locus_tag LOCUS_04960 gene galT 16682 15684 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258726.1 protein_id gnl|my_center|LOCUS_04960 17199 19109 gene locus_tag LOCUS_04970 17199 19109 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979843.1 protein_id gnl|my_center|LOCUS_04970 19109 20713 gene locus_tag LOCUS_04980 19109 20713 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074085.1 protein_id gnl|my_center|LOCUS_04980 22159 20894 gene locus_tag LOCUS_04990 22159 20894 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969697.1 protein_id gnl|my_center|LOCUS_04990 23467 22379 gene locus_tag LOCUS_05000 23467 22379 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869891.1 protein_id gnl|my_center|LOCUS_05000 23527 25065 gene locus_tag LOCUS_05010 23527 25065 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_05010 25275 27029 gene locus_tag LOCUS_05020 25275 27029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 27369 27103 gene locus_tag LOCUS_05030 27369 27103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 27768 28406 gene locus_tag LOCUS_05040 27768 28406 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_05040 28739 28491 gene locus_tag LOCUS_05050 28739 28491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 30429 28756 gene locus_tag LOCUS_05060 30429 28756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 32156 30495 gene locus_tag LOCUS_05070 32156 30495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 32101 32301 gene locus_tag LOCUS_05080 32101 32301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 33039 32290 gene locus_tag LOCUS_05090 33039 32290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 34005 33142 gene locus_tag LOCUS_05100 34005 33142 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382947.1 protein_id gnl|my_center|LOCUS_05100 35052 34126 gene locus_tag LOCUS_05110 gene pfkB 35052 34126 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355534.1 protein_id gnl|my_center|LOCUS_05110 35631 35203 gene locus_tag LOCUS_05120 35631 35203 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403203.1 protein_id gnl|my_center|LOCUS_05120 36857 35709 gene locus_tag LOCUS_05130 36857 35709 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393149.1 protein_id gnl|my_center|LOCUS_05130 37162 36881 gene locus_tag LOCUS_05140 37162 36881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 37302 40154 gene locus_tag LOCUS_05150 gene uvrA 37302 40154 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061214.1 protein_id gnl|my_center|LOCUS_05150 40827 40168 gene locus_tag LOCUS_05160 40827 40168 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545876.1 protein_id gnl|my_center|LOCUS_05160 41051 41605 gene locus_tag LOCUS_05170 gene sufT 41051 41605 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_05170 41712 42458 gene locus_tag LOCUS_05180 gene fabG 41712 42458 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938502.1 protein_id gnl|my_center|LOCUS_05180 42497 42763 gene locus_tag LOCUS_05190 gene acpP 42497 42763 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_05190 42821 44107 gene locus_tag LOCUS_05200 gene fabF 42821 44107 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_05200 44320 44592 gene locus_tag LOCUS_05210 44320 44592 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583748.1 protein_id gnl|my_center|LOCUS_05210 44603 45538 gene locus_tag LOCUS_05220 44603 45538 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_05220 45535 46371 gene locus_tag LOCUS_05230 45535 46371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 46449 47231 gene locus_tag LOCUS_05240 46449 47231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 47521 48045 gene locus_tag LOCUS_05250 47521 48045 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121244.1 protein_id gnl|my_center|LOCUS_05250 48070 49032 gene locus_tag LOCUS_05260 48070 49032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 49326 50435 gene locus_tag LOCUS_05270 49326 50435 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_05270 50582 51127 gene locus_tag LOCUS_05280 50582 51127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 51177 52559 gene locus_tag LOCUS_05290 51177 52559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 52578 53291 gene locus_tag LOCUS_05300 52578 53291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 54092 53328 gene locus_tag LOCUS_05310 54092 53328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 54266 55822 gene locus_tag LOCUS_05320 54266 55822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 55902 56768 gene locus_tag LOCUS_05330 55902 56768 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 protein_id gnl|my_center|LOCUS_05330 57017 58630 gene locus_tag LOCUS_05340 57017 58630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 58714 59214 gene locus_tag LOCUS_05350 58714 59214 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483573.1 protein_id gnl|my_center|LOCUS_05350 59177 60688 gene locus_tag LOCUS_05360 59177 60688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05360 61991 60930 gene locus_tag LOCUS_05370 61991 60930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 63070 61988 gene locus_tag LOCUS_05380 63070 61988 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_05380 64176 63109 gene locus_tag LOCUS_05390 gene plsX 64176 63109 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_05390 64428 64249 gene locus_tag LOCUS_05400 64428 64249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 64657 65706 gene locus_tag LOCUS_05410 gene trpD 64657 65706 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence008 925 116 gene locus_tag LOCUS_05420 925 116 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941333.1 protein_id gnl|my_center|LOCUS_05420 1107 1589 gene locus_tag LOCUS_05430 1107 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 1727 3649 gene locus_tag LOCUS_05440 1727 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 3741 9509 gene locus_tag LOCUS_05450 gene uvrA 3741 9509 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939035.1 protein_id gnl|my_center|LOCUS_05450 11341 9815 gene locus_tag LOCUS_05460 11341 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 12504 11503 gene locus_tag LOCUS_05470 12504 11503 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039181.1 protein_id gnl|my_center|LOCUS_05470 12786 14021 gene locus_tag LOCUS_05480 12786 14021 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037244312.1 protein_id gnl|my_center|LOCUS_05480 16087 14285 gene locus_tag LOCUS_05490 16087 14285 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459981.1 protein_id gnl|my_center|LOCUS_05490 17957 16482 gene locus_tag LOCUS_05500 17957 16482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 18073 19638 gene locus_tag LOCUS_05510 18073 19638 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_05510 19978 19745 gene locus_tag LOCUS_05520 19978 19745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 20156 21046 gene locus_tag LOCUS_05530 20156 21046 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048451.1 protein_id gnl|my_center|LOCUS_05530 21067 22101 gene locus_tag LOCUS_05540 21067 22101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 22147 22785 gene locus_tag LOCUS_05550 22147 22785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 23232 22789 gene locus_tag LOCUS_05560 gene rpiB 23232 22789 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_05560 23767 26130 gene locus_tag LOCUS_05570 gene fadJ 23767 26130 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706183.1 protein_id gnl|my_center|LOCUS_05570 27477 26212 gene locus_tag LOCUS_05580 27477 26212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 28832 27777 gene locus_tag LOCUS_05590 28832 27777 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_05590 30104 28836 gene locus_tag LOCUS_05600 30104 28836 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173990.1 protein_id gnl|my_center|LOCUS_05600 30306 30512 gene locus_tag LOCUS_05610 30306 30512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 30824 30567 gene locus_tag LOCUS_05620 30824 30567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 30880 34641 gene locus_tag LOCUS_05630 30880 34641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 35710 34871 gene locus_tag LOCUS_05640 gene phnE 35710 34871 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193500.1 protein_id gnl|my_center|LOCUS_05640 36643 35858 gene locus_tag LOCUS_05650 gene phnC 36643 35858 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808589.1 protein_id gnl|my_center|LOCUS_05650 37602 36688 gene locus_tag LOCUS_05660 37602 36688 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254057.1 protein_id gnl|my_center|LOCUS_05660 37744 39054 gene locus_tag LOCUS_05670 gene eno 37744 39054 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103955.1 protein_id gnl|my_center|LOCUS_05670 39130 39852 gene locus_tag LOCUS_05680 39130 39852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 39900 40706 gene locus_tag LOCUS_05690 39900 40706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 42193 40913 gene locus_tag LOCUS_05700 42193 40913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 43631 42264 gene locus_tag LOCUS_05710 43631 42264 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_05710 45005 43638 gene locus_tag LOCUS_05720 45005 43638 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 protein_id gnl|my_center|LOCUS_05720 45617 47245 gene locus_tag LOCUS_05730 45617 47245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 47357 49321 gene locus_tag LOCUS_05740 47357 49321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 49328 50971 gene locus_tag LOCUS_05750 49328 50971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 50971 54582 gene locus_tag LOCUS_05760 50971 54582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 56169 54667 gene locus_tag LOCUS_05770 56169 54667 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368539.1 protein_id gnl|my_center|LOCUS_05770 56652 56170 gene locus_tag LOCUS_05780 56652 56170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 57701 56670 gene locus_tag LOCUS_05790 57701 56670 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807825.1 protein_id gnl|my_center|LOCUS_05790 57897 59915 gene locus_tag LOCUS_05800 57897 59915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045679460.1 protein_id gnl|my_center|LOCUS_05800 60425 61288 gene locus_tag LOCUS_05810 60425 61288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 61307 61759 gene locus_tag LOCUS_05820 gene rpiB 61307 61759 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209402.1 protein_id gnl|my_center|LOCUS_05820 61906 62913 gene locus_tag LOCUS_05830 61906 62913 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389095.1 protein_id gnl|my_center|LOCUS_05830 62920 63588 gene locus_tag LOCUS_05840 gene dhaL 62920 63588 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267780.1 protein_id gnl|my_center|LOCUS_05840 63646 64632 gene locus_tag LOCUS_05850 63646 64632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 65019 64627 gene locus_tag LOCUS_05860 65019 64627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 65083 65493 gene locus_tag LOCUS_05870 65083 65493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence009 335 604 gene locus_tag LOCUS_05880 335 604 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665928.1 protein_id gnl|my_center|LOCUS_05880 1011 1283 gene locus_tag LOCUS_05890 1011 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 1653 1204 gene locus_tag LOCUS_05900 1653 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 2012 2245 gene locus_tag LOCUS_05910 2012 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 2226 2672 gene locus_tag LOCUS_05920 2226 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 4432 2714 gene locus_tag LOCUS_05930 4432 2714 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396787.1 protein_id gnl|my_center|LOCUS_05930 4616 4419 gene locus_tag LOCUS_05940 4616 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 6134 4644 gene locus_tag LOCUS_05950 6134 4644 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902375.1 protein_id gnl|my_center|LOCUS_05950 7693 6185 gene locus_tag LOCUS_05960 7693 6185 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 protein_id gnl|my_center|LOCUS_05960 8067 7693 gene locus_tag LOCUS_05970 8067 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 8611 8123 gene locus_tag LOCUS_05980 8611 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 8885 8604 gene locus_tag LOCUS_05990 8885 8604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 9147 8902 gene locus_tag LOCUS_06000 9147 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 9473 9144 gene locus_tag LOCUS_06010 9473 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 9742 9470 gene locus_tag LOCUS_06020 9742 9470 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_06020 10287 9745 gene locus_tag LOCUS_06030 10287 9745 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_06030 13661 10539 gene locus_tag LOCUS_06040 13661 10539 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403935.1 protein_id gnl|my_center|LOCUS_06040 14875 13658 gene locus_tag LOCUS_06050 14875 13658 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337795.1 protein_id gnl|my_center|LOCUS_06050 15283 15882 gene locus_tag LOCUS_06060 15283 15882 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_06060 15967 17970 gene locus_tag LOCUS_06070 15967 17970 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198677105.1 protein_id gnl|my_center|LOCUS_06070 18180 18845 gene locus_tag LOCUS_06080 18180 18845 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583790.1 protein_id gnl|my_center|LOCUS_06080 21024 18904 gene locus_tag LOCUS_06090 21024 18904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 24860 21003 gene locus_tag LOCUS_06100 24860 21003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 27109 25001 gene locus_tag LOCUS_06110 27109 25001 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888294.1 protein_id gnl|my_center|LOCUS_06110 27979 27176 gene locus_tag LOCUS_06120 27979 27176 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940460.1 protein_id gnl|my_center|LOCUS_06120 28139 28549 gene locus_tag LOCUS_06130 28139 28549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 29545 28598 gene locus_tag LOCUS_06140 29545 28598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 30487 29567 gene locus_tag LOCUS_06150 30487 29567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 30723 31472 gene locus_tag LOCUS_06160 30723 31472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 31619 32419 gene locus_tag LOCUS_06170 31619 32419 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399111.1 protein_id gnl|my_center|LOCUS_06170 33654 32470 gene locus_tag LOCUS_06180 33654 32470 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918720.1 protein_id gnl|my_center|LOCUS_06180 34107 33715 gene locus_tag LOCUS_06190 34107 33715 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037272.1 protein_id gnl|my_center|LOCUS_06190 34667 34107 gene locus_tag LOCUS_06200 34667 34107 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017058.1 protein_id gnl|my_center|LOCUS_06200 35353 34757 gene locus_tag LOCUS_06210 gene leuD 35353 34757 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228533.1 protein_id gnl|my_center|LOCUS_06210 36758 35367 gene locus_tag LOCUS_06220 gene leuC 36758 35367 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173294.1 protein_id gnl|my_center|LOCUS_06220 37280 37029 gene locus_tag LOCUS_06230 37280 37029 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_06230 38313 37468 gene locus_tag LOCUS_06240 gene tatC 38313 37468 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015780.1 protein_id gnl|my_center|LOCUS_06240 38574 41342 gene locus_tag LOCUS_06250 gene ppdK 38574 41342 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_06250 42325 41552 gene locus_tag LOCUS_06260 42325 41552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 42780 42322 gene locus_tag LOCUS_06270 42780 42322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 43457 42819 gene locus_tag LOCUS_06280 43457 42819 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_06280 46088 43491 gene locus_tag LOCUS_06290 46088 43491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 46294 47808 gene locus_tag LOCUS_06300 46294 47808 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910561.1 protein_id gnl|my_center|LOCUS_06300 47926 48840 gene locus_tag LOCUS_06310 47926 48840 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_06310 50234 48867 gene locus_tag LOCUS_06320 50234 48867 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224577.1 protein_id gnl|my_center|LOCUS_06320 51095 50304 gene locus_tag LOCUS_06330 51095 50304 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933911.1 protein_id gnl|my_center|LOCUS_06330 52106 51102 gene locus_tag LOCUS_06340 gene rnhC 52106 51102 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872309.1 protein_id gnl|my_center|LOCUS_06340 52481 54052 gene locus_tag LOCUS_06350 52481 54052 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119512.1 protein_id gnl|my_center|LOCUS_06350 54238 55077 gene locus_tag LOCUS_06360 54238 55077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 57355 55169 gene locus_tag LOCUS_06370 57355 55169 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943858.1 protein_id gnl|my_center|LOCUS_06370 57453 57911 gene locus_tag LOCUS_06380 57453 57911 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882790.1 protein_id gnl|my_center|LOCUS_06380 57985 59049 gene locus_tag LOCUS_06390 gene dusB 57985 59049 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256119.1 protein_id gnl|my_center|LOCUS_06390 59661 59095 gene locus_tag LOCUS_06400 59661 59095 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973797.1 protein_id gnl|my_center|LOCUS_06400 60052 60705 gene locus_tag LOCUS_06410 60052 60705 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944031.1 protein_id gnl|my_center|LOCUS_06410 60856 61584 gene locus_tag LOCUS_06420 60856 61584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 62104 61718 gene locus_tag LOCUS_06430 62104 61718 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_06430 62439 62101 gene locus_tag LOCUS_06440 62439 62101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 >Feature sequence010 168 93 gene locus_tag LOCUS_t00090 168 93 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 964 269 gene locus_tag LOCUS_06450 964 269 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367886.1 protein_id gnl|my_center|LOCUS_06450 2192 957 gene locus_tag LOCUS_06460 2192 957 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930193.1 protein_id gnl|my_center|LOCUS_06460 3708 2203 gene locus_tag LOCUS_06470 gene lysS 3708 2203 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 protein_id gnl|my_center|LOCUS_06470 4779 3709 gene locus_tag LOCUS_06480 4779 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 5078 5773 gene locus_tag LOCUS_06490 gene lipB 5078 5773 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144397.1 protein_id gnl|my_center|LOCUS_06490 6006 7241 gene locus_tag LOCUS_06500 6006 7241 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_06500 7326 8486 gene locus_tag LOCUS_06510 7326 8486 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803816.1 protein_id gnl|my_center|LOCUS_06510 9553 8603 gene locus_tag LOCUS_06520 gene argF 9553 8603 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584136.1 protein_id gnl|my_center|LOCUS_06520 11993 9735 gene locus_tag LOCUS_06530 11993 9735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 12149 12523 gene locus_tag LOCUS_06540 12149 12523 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157153.1 protein_id gnl|my_center|LOCUS_06540 13197 12610 gene locus_tag LOCUS_06550 13197 12610 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963489.1 protein_id gnl|my_center|LOCUS_06550 13392 14195 gene locus_tag LOCUS_06560 13392 14195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 14795 14202 gene locus_tag LOCUS_06570 gene ruvC 14795 14202 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111361.1 protein_id gnl|my_center|LOCUS_06570 16748 14847 gene locus_tag LOCUS_06580 16748 14847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 17837 16953 gene locus_tag LOCUS_06590 17837 16953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 17751 17951 gene locus_tag LOCUS_06600 17751 17951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 20226 17971 gene locus_tag LOCUS_06610 20226 17971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 20400 21353 gene locus_tag LOCUS_06620 20400 21353 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_06620 21346 22113 gene locus_tag LOCUS_06630 21346 22113 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392394.1 protein_id gnl|my_center|LOCUS_06630 22209 23021 gene locus_tag LOCUS_06640 22209 23021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 23298 23077 gene locus_tag LOCUS_06650 23298 23077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 23699 23322 gene locus_tag LOCUS_06660 23699 23322 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813571.1 protein_id gnl|my_center|LOCUS_06660 25113 23743 gene locus_tag LOCUS_06670 gene thrC 25113 23743 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_06670 26335 25115 gene locus_tag LOCUS_06680 26335 25115 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545682.1 protein_id gnl|my_center|LOCUS_06680 27666 26335 gene locus_tag LOCUS_06690 27666 26335 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_06690 28312 27659 gene locus_tag LOCUS_06700 gene plsY 28312 27659 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_06700 29911 28322 gene locus_tag LOCUS_06710 gene serA 29911 28322 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_06710 31454 30138 gene locus_tag LOCUS_06720 gene hisS 31454 30138 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_06720 31781 31467 gene locus_tag LOCUS_06730 31781 31467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 31883 33511 gene locus_tag LOCUS_06740 31883 33511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 33529 34266 gene locus_tag LOCUS_06750 gene ubiE 33529 34266 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_06750 35525 34320 gene locus_tag LOCUS_06760 35525 34320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 36043 35567 gene locus_tag LOCUS_06770 36043 35567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 37870 36209 gene locus_tag LOCUS_06780 37870 36209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 38203 39663 gene locus_tag LOCUS_06790 gene cls 38203 39663 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943983.1 protein_id gnl|my_center|LOCUS_06790 39871 40323 gene locus_tag LOCUS_06800 39871 40323 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_06800 40530 43346 gene locus_tag LOCUS_06810 gene ileS 40530 43346 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081557.1 protein_id gnl|my_center|LOCUS_06810 43610 44476 gene locus_tag LOCUS_06820 43610 44476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 44797 44480 gene locus_tag LOCUS_06830 44797 44480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 44690 45139 gene locus_tag LOCUS_06840 gene lspA 44690 45139 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157006.1 protein_id gnl|my_center|LOCUS_06840 47517 45328 gene locus_tag LOCUS_06850 47517 45328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 48479 47514 gene locus_tag LOCUS_06860 48479 47514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 50386 48599 gene locus_tag LOCUS_06870 50386 48599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 50923 50399 gene locus_tag LOCUS_06880 gene cbaB 50923 50399 CDS product ba3-type cytochrome C oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173203.1 protein_id gnl|my_center|LOCUS_06880 51086 50937 gene locus_tag LOCUS_06890 51086 50937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 52609 51107 gene locus_tag LOCUS_06900 52609 51107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 53679 55232 gene locus_tag LOCUS_06910 53679 55232 CDS product DUF4173 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528782.1 protein_id gnl|my_center|LOCUS_06910 55252 55911 gene locus_tag LOCUS_06920 55252 55911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 55892 56284 gene locus_tag LOCUS_06930 55892 56284 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965183.1 protein_id gnl|my_center|LOCUS_06930 57449 56835 gene locus_tag LOCUS_06940 57449 56835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 58226 57891 gene locus_tag LOCUS_06950 58226 57891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence011 1514 768 gene locus_tag LOCUS_06960 1514 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 2222 1527 gene locus_tag LOCUS_06970 2222 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 3062 2232 gene locus_tag LOCUS_06980 3062 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 11229 3232 gene locus_tag LOCUS_06990 11229 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 12674 11277 gene locus_tag LOCUS_07000 12674 11277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 14467 12713 gene locus_tag LOCUS_07010 14467 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 14910 15218 gene locus_tag LOCUS_07020 14910 15218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 16506 15496 gene locus_tag LOCUS_07030 16506 15496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 18160 16709 gene locus_tag LOCUS_07040 18160 16709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 21303 18592 gene locus_tag LOCUS_07050 21303 18592 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880620.1 protein_id gnl|my_center|LOCUS_07050 21665 27412 gene locus_tag LOCUS_07060 21665 27412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 27409 30813 gene locus_tag LOCUS_07070 27409 30813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 30942 34343 gene locus_tag LOCUS_07080 30942 34343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 35170 34274 gene locus_tag LOCUS_07090 35170 34274 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873338.1 protein_id gnl|my_center|LOCUS_07090 35318 35782 gene locus_tag LOCUS_07100 35318 35782 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_07100 35797 36783 gene locus_tag LOCUS_07110 gene folE2 35797 36783 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722743.1 protein_id gnl|my_center|LOCUS_07110 38749 36833 gene locus_tag LOCUS_07120 38749 36833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 39928 38774 gene locus_tag LOCUS_07130 39928 38774 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040295.1 protein_id gnl|my_center|LOCUS_07130 40425 39925 gene locus_tag LOCUS_07140 gene purE 40425 39925 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037636.1 protein_id gnl|my_center|LOCUS_07140 40653 41435 gene locus_tag LOCUS_07150 40653 41435 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_07150 41836 41462 gene locus_tag LOCUS_07160 41836 41462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 42126 41896 gene locus_tag LOCUS_07170 42126 41896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 42130 42681 gene locus_tag LOCUS_07180 42130 42681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 43560 42988 gene locus_tag LOCUS_07190 gene def 43560 42988 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974268.1 protein_id gnl|my_center|LOCUS_07190 44455 43649 gene locus_tag LOCUS_07200 44455 43649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 44689 45294 gene locus_tag LOCUS_07210 44689 45294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 45407 46000 gene locus_tag LOCUS_07220 45407 46000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 46418 46056 gene locus_tag LOCUS_07230 46418 46056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626856.1 protein_id gnl|my_center|LOCUS_07230 47050 46460 gene locus_tag LOCUS_07240 47050 46460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 48474 47425 gene locus_tag LOCUS_07250 gene dinB 48474 47425 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946300.1 protein_id gnl|my_center|LOCUS_07250 48911 49675 gene locus_tag LOCUS_07260 48911 49675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 51018 49732 gene locus_tag LOCUS_07270 51018 49732 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_07270 51407 52777 gene locus_tag LOCUS_07280 51407 52777 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_07280 52985 52912 gene locus_tag LOCUS_t00100 52985 52912 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 55709 53217 gene locus_tag LOCUS_07290 gene nrdJ 55709 53217 CDS product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674848.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence012 4081 6633 gene locus_tag LOCUS_07300 4081 6633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 8552 6684 gene locus_tag LOCUS_07310 8552 6684 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937411.1 protein_id gnl|my_center|LOCUS_07310 8910 9860 gene locus_tag LOCUS_07320 8910 9860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 10375 9908 gene locus_tag LOCUS_07330 10375 9908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 10929 10381 gene locus_tag LOCUS_07340 10929 10381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 11895 11473 gene locus_tag LOCUS_07350 11895 11473 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_07350 12363 13370 gene locus_tag LOCUS_07360 12363 13370 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_07360 13385 13939 gene locus_tag LOCUS_07370 13385 13939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 14020 14835 gene locus_tag LOCUS_07380 14020 14835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890599.1 protein_id gnl|my_center|LOCUS_07380 14937 15839 gene locus_tag LOCUS_07390 14937 15839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 16556 15885 gene locus_tag LOCUS_07400 16556 15885 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444207.1 protein_id gnl|my_center|LOCUS_07400 16653 16578 gene locus_tag LOCUS_t00110 16653 16578 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 16792 17406 gene locus_tag LOCUS_07410 16792 17406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 17483 18064 gene locus_tag LOCUS_07420 17483 18064 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_07420 18225 19259 gene locus_tag LOCUS_07430 gene serC 18225 19259 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_07430 20131 19277 gene locus_tag LOCUS_07440 gene fabD 20131 19277 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231821.1 protein_id gnl|my_center|LOCUS_07440 20285 20977 gene locus_tag LOCUS_07450 20285 20977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 21275 23593 gene locus_tag LOCUS_07460 21275 23593 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_07460 23665 24042 gene locus_tag LOCUS_07470 23665 24042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 24195 25961 gene locus_tag LOCUS_07480 24195 25961 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804193.1 protein_id gnl|my_center|LOCUS_07480 27625 26063 gene locus_tag LOCUS_07490 27625 26063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 28196 27612 gene locus_tag LOCUS_07500 28196 27612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 28591 29742 gene locus_tag LOCUS_07510 28591 29742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 29781 30221 gene locus_tag LOCUS_07520 29781 30221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 30208 30783 gene locus_tag LOCUS_07530 30208 30783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 30892 31719 gene locus_tag LOCUS_07540 30892 31719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 34946 31740 gene locus_tag LOCUS_07550 34946 31740 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_07550 36026 34947 gene locus_tag LOCUS_07560 gene vmeP 36026 34947 CDS product efflux RND transporter periplasmic adaptor subunit VmeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005391278.1 protein_id gnl|my_center|LOCUS_07560 36541 36023 gene locus_tag LOCUS_07570 36541 36023 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023176053.1 protein_id gnl|my_center|LOCUS_07570 38226 36703 gene locus_tag LOCUS_07580 38226 36703 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869758.1 protein_id gnl|my_center|LOCUS_07580 38283 39551 gene locus_tag LOCUS_07590 38283 39551 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_07590 39886 42120 gene locus_tag LOCUS_07600 39886 42120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 42228 43334 gene locus_tag LOCUS_07610 42228 43334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 43491 44909 gene locus_tag LOCUS_07620 gene purB 43491 44909 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_07620 45687 44920 gene locus_tag LOCUS_07630 45687 44920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 46869 45991 gene locus_tag LOCUS_07640 46869 45991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 48061 46937 gene locus_tag LOCUS_07650 gene dnaN 48061 46937 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725022.1 protein_id gnl|my_center|LOCUS_07650 49195 48290 gene locus_tag LOCUS_07660 gene pssA 49195 48290 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770492.1 protein_id gnl|my_center|LOCUS_07660 49563 49213 gene locus_tag LOCUS_07670 49563 49213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 49771 50130 gene locus_tag LOCUS_07680 49771 50130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 50708 50277 gene locus_tag LOCUS_07690 50708 50277 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090087.1 protein_id gnl|my_center|LOCUS_07690 51606 50947 gene locus_tag LOCUS_07700 gene thiE 51606 50947 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727194.1 protein_id gnl|my_center|LOCUS_07700 52109 51636 gene locus_tag LOCUS_07710 52109 51636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 52559 52125 gene locus_tag LOCUS_07720 52559 52125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 53938 52571 gene locus_tag LOCUS_07730 gene accC 53938 52571 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_07730 54444 54007 gene locus_tag LOCUS_07740 gene accB 54444 54007 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545496.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence013 378 2228 gene locus_tag LOCUS_07750 378 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 2260 4803 gene locus_tag LOCUS_07760 2260 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 5114 6127 gene locus_tag LOCUS_07770 5114 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 6234 6647 gene locus_tag LOCUS_07780 6234 6647 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_07780 6762 7208 gene locus_tag LOCUS_07790 6762 7208 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_07790 7459 9321 gene locus_tag LOCUS_07800 7459 9321 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931857.1 protein_id gnl|my_center|LOCUS_07800 9348 10397 gene locus_tag LOCUS_07810 9348 10397 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838141.1 protein_id gnl|my_center|LOCUS_07810 10581 11858 gene locus_tag LOCUS_07820 gene mtaB 10581 11858 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_07820 13351 11996 gene locus_tag LOCUS_07830 13351 11996 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098062761.1 protein_id gnl|my_center|LOCUS_07830 13611 14486 gene locus_tag LOCUS_07840 13611 14486 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444002.1 protein_id gnl|my_center|LOCUS_07840 15476 14589 gene locus_tag LOCUS_07850 15476 14589 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_07850 15676 16224 gene locus_tag LOCUS_07860 gene coaE 15676 16224 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172233.1 protein_id gnl|my_center|LOCUS_07860 16835 18127 gene locus_tag LOCUS_07870 gene rho 16835 18127 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871853.1 protein_id gnl|my_center|LOCUS_07870 18164 19894 gene locus_tag LOCUS_07880 18164 19894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 19923 21005 gene locus_tag LOCUS_07890 19923 21005 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_07890 21034 22722 gene locus_tag LOCUS_07900 21034 22722 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_07900 22742 24025 gene locus_tag LOCUS_07910 22742 24025 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_07910 25090 24080 gene locus_tag LOCUS_07920 gene yhaM 25090 24080 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726638.1 protein_id gnl|my_center|LOCUS_07920 25671 25087 gene locus_tag LOCUS_07930 25671 25087 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706500.1 protein_id gnl|my_center|LOCUS_07930 25845 26342 gene locus_tag LOCUS_07940 25845 26342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 27801 26347 gene locus_tag LOCUS_07950 gene rpoN 27801 26347 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_07950 28806 27844 gene locus_tag LOCUS_07960 28806 27844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 28983 29300 gene locus_tag LOCUS_07970 gene erpA 28983 29300 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551953.1 protein_id gnl|my_center|LOCUS_07970 29482 30741 gene locus_tag LOCUS_07980 gene nusA 29482 30741 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_07980 30817 33216 gene locus_tag LOCUS_07990 30817 33216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 33218 33568 gene locus_tag LOCUS_08000 gene rbfA 33218 33568 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475824.1 protein_id gnl|my_center|LOCUS_08000 33576 34604 gene locus_tag LOCUS_08010 33576 34604 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_08010 34582 35304 gene locus_tag LOCUS_08020 34582 35304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 35301 36293 gene locus_tag LOCUS_08030 35301 36293 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258807.1 protein_id gnl|my_center|LOCUS_08030 36817 36356 gene locus_tag LOCUS_08040 36817 36356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 37172 37603 gene locus_tag LOCUS_08050 37172 37603 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 protein_id gnl|my_center|LOCUS_08050 38806 37733 gene locus_tag LOCUS_08060 38806 37733 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_08060 38974 39312 gene locus_tag LOCUS_08070 38974 39312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 39309 39755 gene locus_tag LOCUS_08080 39309 39755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 39872 40465 gene locus_tag LOCUS_08090 39872 40465 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133795409.1 protein_id gnl|my_center|LOCUS_08090 42587 40599 gene locus_tag LOCUS_08100 42587 40599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 42807 44774 gene locus_tag LOCUS_08110 42807 44774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 44898 45422 gene locus_tag LOCUS_08120 44898 45422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 45560 46420 gene locus_tag LOCUS_08130 45560 46420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 46538 46613 gene locus_tag LOCUS_t00120 46538 46613 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 46680 48362 gene locus_tag LOCUS_08140 gene recN 46680 48362 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393016.1 protein_id gnl|my_center|LOCUS_08140 48742 48533 gene locus_tag LOCUS_08150 48742 48533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 50126 49023 gene locus_tag LOCUS_08160 gene ychF 50126 49023 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524669.1 protein_id gnl|my_center|LOCUS_08160 50270 50563 gene locus_tag LOCUS_08170 gene rpsP 50270 50563 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268750.1 protein_id gnl|my_center|LOCUS_08170 50622 51308 gene locus_tag LOCUS_08180 gene trmD 50622 51308 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404373.1 protein_id gnl|my_center|LOCUS_08180 51305 51670 gene locus_tag LOCUS_08190 gene rplS 51305 51670 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_08190 51842 53827 gene locus_tag LOCUS_08200 gene tkt 51842 53827 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193030.1 protein_id gnl|my_center|LOCUS_08200 >Feature sequence014 4192 1571 gene locus_tag LOCUS_08210 4192 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 4940 4515 gene locus_tag LOCUS_08220 4940 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 5343 5092 gene locus_tag LOCUS_08230 gene rpmA 5343 5092 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_08230 5700 5356 gene locus_tag LOCUS_08240 gene rplU 5700 5356 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_08240 5730 6467 gene locus_tag LOCUS_08250 5730 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 6434 6634 gene locus_tag LOCUS_08260 6434 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 6648 7613 gene locus_tag LOCUS_08270 6648 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 7763 8419 gene locus_tag LOCUS_08280 7763 8419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 10359 8626 gene locus_tag LOCUS_08290 10359 8626 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048118.1 protein_id gnl|my_center|LOCUS_08290 10276 10485 gene locus_tag LOCUS_08300 10276 10485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 10711 11166 gene locus_tag LOCUS_08310 gene dtd 10711 11166 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962422.1 protein_id gnl|my_center|LOCUS_08310 11173 13281 gene locus_tag LOCUS_08320 11173 13281 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 protein_id gnl|my_center|LOCUS_08320 13364 13888 gene locus_tag LOCUS_08330 13364 13888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 14084 15256 gene locus_tag LOCUS_08340 14084 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 15340 15558 gene locus_tag LOCUS_08350 15340 15558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 15787 16236 gene locus_tag LOCUS_08360 15787 16236 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_08360 16452 19301 gene locus_tag LOCUS_08370 16452 19301 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120395.1 protein_id gnl|my_center|LOCUS_08370 19298 22495 gene locus_tag LOCUS_08380 19298 22495 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120396.1 protein_id gnl|my_center|LOCUS_08380 23316 22828 gene locus_tag LOCUS_08390 23316 22828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 24880 23468 gene locus_tag LOCUS_08400 gene dnaA 24880 23468 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963330.1 protein_id gnl|my_center|LOCUS_08400 26353 25394 gene locus_tag LOCUS_08410 gene hprK 26353 25394 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_08410 27126 26350 gene locus_tag LOCUS_08420 gene lptB 27126 26350 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047473.1 protein_id gnl|my_center|LOCUS_08420 27842 27123 gene locus_tag LOCUS_08430 27842 27123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 28302 27925 gene locus_tag LOCUS_08440 28302 27925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 28984 28454 gene locus_tag LOCUS_08450 28984 28454 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224883.1 protein_id gnl|my_center|LOCUS_08450 31020 28984 gene locus_tag LOCUS_08460 31020 28984 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839420.1 protein_id gnl|my_center|LOCUS_08460 31866 31183 gene locus_tag LOCUS_08470 31866 31183 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245964.1 protein_id gnl|my_center|LOCUS_08470 32562 32020 gene locus_tag LOCUS_08480 32562 32020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 32874 34415 gene locus_tag LOCUS_08490 32874 34415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 34758 37112 gene locus_tag LOCUS_08500 34758 37112 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244418.1 protein_id gnl|my_center|LOCUS_08500 37415 37218 gene locus_tag LOCUS_08510 37415 37218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 38336 37533 gene locus_tag LOCUS_08520 38336 37533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 41706 39091 gene locus_tag LOCUS_08530 41706 39091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 43001 41916 gene locus_tag LOCUS_08540 43001 41916 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_08540 44071 43724 gene locus_tag LOCUS_08550 44071 43724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 44926 45165 gene locus_tag LOCUS_08560 44926 45165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 45152 46576 gene locus_tag LOCUS_08570 45152 46576 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_08570 46573 47148 gene locus_tag LOCUS_08580 46573 47148 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403102.1 protein_id gnl|my_center|LOCUS_08580 47148 47894 gene locus_tag LOCUS_08590 47148 47894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 48091 50559 gene locus_tag LOCUS_08600 48091 50559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 50579 51268 gene locus_tag LOCUS_08610 50579 51268 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_08610 52422 51637 gene locus_tag LOCUS_08620 52422 51637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 52909 53460 gene locus_tag LOCUS_08630 52909 53460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 53846 53511 gene locus_tag LOCUS_08640 53846 53511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence015 <1 968 gene locus_tag LOCUS_08650 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227864.1:histidinol-phosphatase HisJ 1177 971 gene locus_tag LOCUS_08660 1177 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 1061 1462 gene locus_tag LOCUS_08670 1061 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 1820 1464 gene locus_tag LOCUS_08680 1820 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 2046 1975 gene locus_tag LOCUS_t00130 2046 1975 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2216 3706 gene locus_tag LOCUS_08690 gene glpK 2216 3706 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556718.1 protein_id gnl|my_center|LOCUS_08690 3816 5387 gene locus_tag LOCUS_08700 3816 5387 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_08700 5384 5938 gene locus_tag LOCUS_08710 5384 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 7509 5998 gene locus_tag LOCUS_08720 7509 5998 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_08720 8464 7934 gene locus_tag LOCUS_08730 8464 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 8381 8620 gene locus_tag LOCUS_08740 8381 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 9490 8786 gene locus_tag LOCUS_08750 9490 8786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 10697 9654 gene locus_tag LOCUS_08760 10697 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 12150 11059 gene locus_tag LOCUS_08770 12150 11059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 13071 12280 gene locus_tag LOCUS_08780 13071 12280 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331969.1 protein_id gnl|my_center|LOCUS_08780 14677 13172 gene locus_tag LOCUS_08790 14677 13172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 15900 14755 gene locus_tag LOCUS_08800 15900 14755 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094900.1 protein_id gnl|my_center|LOCUS_08800 17217 16000 gene locus_tag LOCUS_08810 17217 16000 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_08810 17975 17214 gene locus_tag LOCUS_08820 17975 17214 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_08820 19132 17981 gene locus_tag LOCUS_08830 19132 17981 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_08830 21007 19334 gene locus_tag LOCUS_08840 21007 19334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 21219 21752 gene locus_tag LOCUS_08850 21219 21752 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815991.1 protein_id gnl|my_center|LOCUS_08850 21820 22821 gene locus_tag LOCUS_08860 21820 22821 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 protein_id gnl|my_center|LOCUS_08860 24577 22868 gene locus_tag LOCUS_08870 gene pilB 24577 22868 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_08870 25054 24584 gene locus_tag LOCUS_08880 25054 24584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 26257 25211 gene locus_tag LOCUS_08890 26257 25211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 28703 26427 gene locus_tag LOCUS_08900 gene glgB 28703 26427 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_08900 29004 29306 gene locus_tag LOCUS_08910 29004 29306 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332230.1 protein_id gnl|my_center|LOCUS_08910 29420 31504 gene locus_tag LOCUS_08920 29420 31504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 31529 32314 gene locus_tag LOCUS_08930 31529 32314 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_08930 32311 32556 gene locus_tag LOCUS_08940 32311 32556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 32638 33285 gene locus_tag LOCUS_08950 32638 33285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 33295 33621 gene locus_tag LOCUS_08960 gene trxA 33295 33621 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_08960 33686 34915 gene locus_tag LOCUS_08970 33686 34915 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_08970 35005 35907 gene locus_tag LOCUS_08980 35005 35907 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762883.1 protein_id gnl|my_center|LOCUS_08980 36101 37975 gene locus_tag LOCUS_08990 36101 37975 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048118.1 protein_id gnl|my_center|LOCUS_08990 37990 38289 gene locus_tag LOCUS_09000 37990 38289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 38367 39083 gene locus_tag LOCUS_09010 38367 39083 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325942.1 protein_id gnl|my_center|LOCUS_09010 39247 39663 gene locus_tag LOCUS_09020 39247 39663 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872160.1 protein_id gnl|my_center|LOCUS_09020 39829 40179 gene locus_tag LOCUS_09030 39829 40179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 40263 41285 gene locus_tag LOCUS_09040 40263 41285 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_09040 41429 43231 gene locus_tag LOCUS_09050 41429 43231 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_09050 44511 43228 gene locus_tag LOCUS_09060 gene chrA 44511 43228 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969287.1 protein_id gnl|my_center|LOCUS_09060 45586 44807 gene locus_tag LOCUS_09070 45586 44807 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257270.1 protein_id gnl|my_center|LOCUS_09070 47288 45666 gene locus_tag LOCUS_09080 gene nadB 47288 45666 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_09080 48234 47392 gene locus_tag LOCUS_09090 gene panC 48234 47392 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_09090 48422 49666 gene locus_tag LOCUS_09100 48422 49666 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870908.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence016 1 3033 gene locus_tag LOCUS_09110 1 3033 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943656.1 protein_id gnl|my_center|LOCUS_09110 3048 3824 gene locus_tag LOCUS_09120 3048 3824 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_09120 4307 3831 gene locus_tag LOCUS_09130 4307 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 4631 4993 gene locus_tag LOCUS_09140 4631 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 7492 5099 gene locus_tag LOCUS_09150 7492 5099 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971692.1 protein_id gnl|my_center|LOCUS_09150 8181 7477 gene locus_tag LOCUS_09160 8181 7477 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615371.1 protein_id gnl|my_center|LOCUS_09160 8330 8172 gene locus_tag LOCUS_09170 8330 8172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 9757 8381 gene locus_tag LOCUS_09180 gene ccoG 9757 8381 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_09180 10327 9761 gene locus_tag LOCUS_09190 10327 9761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 10514 10311 gene locus_tag LOCUS_09200 10514 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 12872 10542 gene locus_tag LOCUS_09210 gene ccoN 12872 10542 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_09210 13214 12978 gene locus_tag LOCUS_09220 13214 12978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 13565 13879 gene locus_tag LOCUS_09230 13565 13879 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812598.1 protein_id gnl|my_center|LOCUS_09230 14221 16821 gene locus_tag LOCUS_09240 14221 16821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 16940 17299 gene locus_tag LOCUS_09250 16940 17299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 17617 18801 gene locus_tag LOCUS_09260 17617 18801 CDS product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922349.1 protein_id gnl|my_center|LOCUS_09260 18853 19212 gene locus_tag LOCUS_09270 18853 19212 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_09270 20215 19463 gene locus_tag LOCUS_09280 gene hisN 20215 19463 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090456.1 protein_id gnl|my_center|LOCUS_09280 20393 21049 gene locus_tag LOCUS_09290 20393 21049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 23494 21071 gene locus_tag LOCUS_09300 gene gyrA 23494 21071 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931835.1 protein_id gnl|my_center|LOCUS_09300 26043 23521 gene locus_tag LOCUS_09310 26043 23521 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247075.1 protein_id gnl|my_center|LOCUS_09310 26169 26585 gene locus_tag LOCUS_09320 26169 26585 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730224.1 protein_id gnl|my_center|LOCUS_09320 26660 27367 gene locus_tag LOCUS_09330 26660 27367 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_09330 27767 28066 gene locus_tag LOCUS_09340 27767 28066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 28221 29018 gene locus_tag LOCUS_09350 28221 29018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 28993 29235 gene locus_tag LOCUS_09360 28993 29235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 30211 29345 gene locus_tag LOCUS_09370 30211 29345 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970375.1 protein_id gnl|my_center|LOCUS_09370 30351 31391 gene locus_tag LOCUS_09380 30351 31391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 31447 31989 gene locus_tag LOCUS_09390 31447 31989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 32004 32570 gene locus_tag LOCUS_09400 32004 32570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 32567 33007 gene locus_tag LOCUS_09410 32567 33007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 33024 35297 gene locus_tag LOCUS_09420 33024 35297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 35308 36990 gene locus_tag LOCUS_09430 35308 36990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 37714 37076 gene locus_tag LOCUS_09440 37714 37076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 37823 38863 gene locus_tag LOCUS_09450 37823 38863 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615392.1 protein_id gnl|my_center|LOCUS_09450 38947 40311 gene locus_tag LOCUS_09460 38947 40311 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902984.1 protein_id gnl|my_center|LOCUS_09460 41404 40469 gene locus_tag LOCUS_09470 41404 40469 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559357.1 protein_id gnl|my_center|LOCUS_09470 41618 42037 gene locus_tag LOCUS_09480 41618 42037 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972106.1 protein_id gnl|my_center|LOCUS_09480 42185 43705 gene locus_tag LOCUS_09490 42185 43705 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230024.1 protein_id gnl|my_center|LOCUS_09490 43747 44214 gene locus_tag LOCUS_09500 43747 44214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 44211 45266 gene locus_tag LOCUS_09510 gene floA 44211 45266 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_09510 45281 45955 gene locus_tag LOCUS_09520 45281 45955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 46322 46693 gene locus_tag LOCUS_09530 46322 46693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 46728 47105 gene locus_tag LOCUS_09540 46728 47105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence017 752 117 gene locus_tag LOCUS_09550 gene pdxH 752 117 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403320.1 protein_id gnl|my_center|LOCUS_09550 1343 945 gene locus_tag LOCUS_09560 1343 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1548 2909 gene locus_tag LOCUS_09570 gene miaB 1548 2909 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_09570 2931 3467 gene locus_tag LOCUS_09580 2931 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 3467 4093 gene locus_tag LOCUS_09590 gene gmk 3467 4093 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869533.1 protein_id gnl|my_center|LOCUS_09590 4244 4741 gene locus_tag LOCUS_09600 4244 4741 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259748.1 protein_id gnl|my_center|LOCUS_09600 4975 7653 gene locus_tag LOCUS_09610 4975 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 8798 7773 gene locus_tag LOCUS_09620 8798 7773 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141002.1 protein_id gnl|my_center|LOCUS_09620 11545 9146 gene locus_tag LOCUS_09630 11545 9146 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140999.1 protein_id gnl|my_center|LOCUS_09630 12002 11805 gene locus_tag LOCUS_09640 12002 11805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 12195 13685 gene locus_tag LOCUS_09650 12195 13685 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920960.1 protein_id gnl|my_center|LOCUS_09650 13785 14123 gene locus_tag LOCUS_09660 13785 14123 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_09660 14663 15460 gene locus_tag LOCUS_09670 14663 15460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 15588 18158 gene locus_tag LOCUS_09680 15588 18158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 19391 18279 gene locus_tag LOCUS_09690 19391 18279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 20226 19513 gene locus_tag LOCUS_09700 20226 19513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 22561 20531 gene locus_tag LOCUS_09710 22561 20531 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 protein_id gnl|my_center|LOCUS_09710 22982 24265 gene locus_tag LOCUS_09720 22982 24265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478317.1 protein_id gnl|my_center|LOCUS_09720 24365 25300 gene locus_tag LOCUS_09730 24365 25300 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_09730 25297 26010 gene locus_tag LOCUS_09740 25297 26010 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797003.1 protein_id gnl|my_center|LOCUS_09740 26019 26915 gene locus_tag LOCUS_09750 26019 26915 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385380.1 protein_id gnl|my_center|LOCUS_09750 27480 26902 gene locus_tag LOCUS_09760 27480 26902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 28011 28310 gene locus_tag LOCUS_09770 28011 28310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 28307 28795 gene locus_tag LOCUS_09780 28307 28795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 28792 32523 gene locus_tag LOCUS_09790 28792 32523 CDS product DUF6079 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870232.1 protein_id gnl|my_center|LOCUS_09790 32520 32729 gene locus_tag LOCUS_09800 32520 32729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 32857 33981 gene locus_tag LOCUS_09810 32857 33981 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870412.1 protein_id gnl|my_center|LOCUS_09810 33968 35371 gene locus_tag LOCUS_09820 33968 35371 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767538.1 protein_id gnl|my_center|LOCUS_09820 35383 35721 gene locus_tag LOCUS_09830 35383 35721 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_09830 35751 38441 gene locus_tag LOCUS_09840 35751 38441 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870411.1 protein_id gnl|my_center|LOCUS_09840 38567 38863 gene locus_tag LOCUS_09850 38567 38863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 39055 39306 gene locus_tag LOCUS_09860 39055 39306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 39541 39999 gene locus_tag LOCUS_09870 39541 39999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 40081 41574 gene locus_tag LOCUS_09880 40081 41574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09880 41592 42092 gene locus_tag LOCUS_09890 41592 42092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09890 42092 42814 gene locus_tag LOCUS_09900 42092 42814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 43204 42956 gene locus_tag LOCUS_09910 43204 42956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 43244 43501 gene locus_tag LOCUS_09920 43244 43501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 43631 43984 gene locus_tag LOCUS_09930 43631 43984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 44782 45279 gene locus_tag LOCUS_09940 44782 45279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 47892 45469 gene locus_tag LOCUS_09950 47892 45469 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210266672.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence018 <1 519 gene locus_tag LOCUS_09960 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681375.1:HsdR family type I site-specific deoxyribonuclease 522 1238 gene locus_tag LOCUS_09970 522 1238 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_09970 2250 1345 gene locus_tag LOCUS_09980 2250 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 3381 2452 gene locus_tag LOCUS_09990 3381 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 3723 3574 gene locus_tag LOCUS_10000 3723 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 4855 3830 gene locus_tag LOCUS_10010 4855 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 5042 5398 gene locus_tag LOCUS_10020 5042 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 5301 7265 gene locus_tag LOCUS_10030 5301 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10030 7559 7326 gene locus_tag LOCUS_10040 7559 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877189.1 protein_id gnl|my_center|LOCUS_10040 7779 8138 gene locus_tag LOCUS_10050 7779 8138 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255995.1 protein_id gnl|my_center|LOCUS_10050 8474 8169 gene locus_tag LOCUS_10060 8474 8169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 16222 8513 gene locus_tag LOCUS_10070 16222 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 17256 16846 gene locus_tag LOCUS_10080 17256 16846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 17872 23814 gene locus_tag LOCUS_10090 17872 23814 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_10090 25335 23878 gene locus_tag LOCUS_10100 25335 23878 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202887107.1 protein_id gnl|my_center|LOCUS_10100 25863 26840 gene locus_tag LOCUS_10110 25863 26840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 27152 28345 gene locus_tag LOCUS_10120 27152 28345 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_10120 28536 29237 gene locus_tag LOCUS_10130 28536 29237 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224948.1 protein_id gnl|my_center|LOCUS_10130 29807 31786 gene locus_tag LOCUS_10140 29807 31786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 32166 33182 gene locus_tag LOCUS_10150 32166 33182 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119735.1 protein_id gnl|my_center|LOCUS_10150 33227 34228 gene locus_tag LOCUS_10160 33227 34228 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_10160 34574 35617 gene locus_tag LOCUS_10170 34574 35617 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338792.1 protein_id gnl|my_center|LOCUS_10170 35720 36994 gene locus_tag LOCUS_10180 35720 36994 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_10180 37776 37195 gene locus_tag LOCUS_10190 gene cobO 37776 37195 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 protein_id gnl|my_center|LOCUS_10190 38020 38892 gene locus_tag LOCUS_10200 38020 38892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 38889 39914 gene locus_tag LOCUS_10210 38889 39914 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 protein_id gnl|my_center|LOCUS_10210 40011 40817 gene locus_tag LOCUS_10220 40011 40817 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218916601.1 protein_id gnl|my_center|LOCUS_10220 41220 41936 gene locus_tag LOCUS_10230 gene fetB 41220 41936 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679254.1 protein_id gnl|my_center|LOCUS_10230 42347 43915 gene locus_tag LOCUS_10240 42347 43915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 44077 44499 gene locus_tag LOCUS_10250 44077 44499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 44517 45470 gene locus_tag LOCUS_10260 44517 45470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence019 660 908 gene locus_tag LOCUS_10270 660 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1315 1632 gene locus_tag LOCUS_10280 1315 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 2987 1800 gene locus_tag LOCUS_10290 2987 1800 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089188.1 protein_id gnl|my_center|LOCUS_10290 3836 3168 gene locus_tag LOCUS_10300 3836 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 4596 4045 gene locus_tag LOCUS_10310 gene hpt 4596 4045 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705261.1 protein_id gnl|my_center|LOCUS_10310 5264 4611 gene locus_tag LOCUS_10320 5264 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 5389 6732 gene locus_tag LOCUS_10330 5389 6732 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926801.1 protein_id gnl|my_center|LOCUS_10330 7546 6755 gene locus_tag LOCUS_10340 7546 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 8719 7613 gene locus_tag LOCUS_10350 8719 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 9309 8716 gene locus_tag LOCUS_10360 9309 8716 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_10360 9525 9815 gene locus_tag LOCUS_10370 9525 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087848.1 protein_id gnl|my_center|LOCUS_10370 9949 11019 gene locus_tag LOCUS_10380 gene aroF 9949 11019 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545770.1 protein_id gnl|my_center|LOCUS_10380 11043 11585 gene locus_tag LOCUS_10390 11043 11585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 13542 11593 gene locus_tag LOCUS_10400 13542 11593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 15813 13753 gene locus_tag LOCUS_10410 gene ispG 15813 13753 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011576.1 protein_id gnl|my_center|LOCUS_10410 17351 15903 gene locus_tag LOCUS_10420 gene rseP 17351 15903 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949016.1 protein_id gnl|my_center|LOCUS_10420 18493 17333 gene locus_tag LOCUS_10430 18493 17333 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_10430 19365 18523 gene locus_tag LOCUS_10440 19365 18523 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521189.1 protein_id gnl|my_center|LOCUS_10440 20156 19362 gene locus_tag LOCUS_10450 20156 19362 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081614.1 protein_id gnl|my_center|LOCUS_10450 20258 20542 gene locus_tag LOCUS_10460 20258 20542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 20552 21238 gene locus_tag LOCUS_10470 gene mtnP 20552 21238 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869552.1 protein_id gnl|my_center|LOCUS_10470 21400 22371 gene locus_tag LOCUS_10480 21400 22371 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_10480 22418 23551 gene locus_tag LOCUS_10490 22418 23551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 23538 25817 gene locus_tag LOCUS_10500 23538 25817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 25947 27521 gene locus_tag LOCUS_10510 25947 27521 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245514.1 protein_id gnl|my_center|LOCUS_10510 27559 28860 gene locus_tag LOCUS_10520 gene serS 27559 28860 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404592.1 protein_id gnl|my_center|LOCUS_10520 29111 30364 gene locus_tag LOCUS_10530 29111 30364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10530 30399 32432 gene locus_tag LOCUS_10540 gene ftsH 30399 32432 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443940.1 protein_id gnl|my_center|LOCUS_10540 33755 32451 gene locus_tag LOCUS_10550 gene argA 33755 32451 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925787.1 protein_id gnl|my_center|LOCUS_10550 34399 33752 gene locus_tag LOCUS_10560 34399 33752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 34501 34980 gene locus_tag LOCUS_10570 34501 34980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 35180 35107 gene locus_tag LOCUS_t00140 35180 35107 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 36700 35516 gene locus_tag LOCUS_10580 36700 35516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 37912 36830 gene locus_tag LOCUS_10590 37912 36830 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298414.1 protein_id gnl|my_center|LOCUS_10590 38904 41606 gene locus_tag LOCUS_10600 38904 41606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 41670 42938 gene locus_tag LOCUS_10610 41670 42938 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_10610 45241 43121 gene locus_tag LOCUS_10620 45241 43121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 47099 45651 gene locus_tag LOCUS_10630 47099 45651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 47605 47530 gene locus_tag LOCUS_t00150 47605 47530 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence020 686 102 gene locus_tag LOCUS_10640 686 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1275 670 gene locus_tag LOCUS_10650 1275 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 2670 1414 gene locus_tag LOCUS_10660 2670 1414 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221317.1 protein_id gnl|my_center|LOCUS_10660 2847 2773 gene locus_tag LOCUS_t00160 2847 2773 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4161 2935 gene locus_tag LOCUS_10670 4161 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 5558 4359 gene locus_tag LOCUS_10680 5558 4359 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071895.1 protein_id gnl|my_center|LOCUS_10680 6334 5558 gene locus_tag LOCUS_10690 6334 5558 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461598.1 protein_id gnl|my_center|LOCUS_10690 8027 6579 gene locus_tag LOCUS_10700 gene gatB 8027 6579 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880264.1 protein_id gnl|my_center|LOCUS_10700 9584 8118 gene locus_tag LOCUS_10710 gene gatA 9584 8118 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_10710 9971 9684 gene locus_tag LOCUS_10720 gene gatC 9971 9684 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393506.1 protein_id gnl|my_center|LOCUS_10720 12431 9975 gene locus_tag LOCUS_10730 gene pheT 12431 9975 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458979.1 protein_id gnl|my_center|LOCUS_10730 13471 12428 gene locus_tag LOCUS_10740 gene pheS 13471 12428 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_10740 13925 13491 gene locus_tag LOCUS_10750 gene rplT 13925 13491 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004727974.1 protein_id gnl|my_center|LOCUS_10750 14204 14010 gene locus_tag LOCUS_10760 14204 14010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 15611 14325 gene locus_tag LOCUS_10770 gene ftsZ 15611 14325 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023065873.1 protein_id gnl|my_center|LOCUS_10770 16831 15611 gene locus_tag LOCUS_10780 gene ftsA 16831 15611 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939770.1 protein_id gnl|my_center|LOCUS_10780 17626 16862 gene locus_tag LOCUS_10790 17626 16862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 18699 17746 gene locus_tag LOCUS_10800 18699 17746 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880304.1 protein_id gnl|my_center|LOCUS_10800 19652 18681 gene locus_tag LOCUS_10810 gene murB 19652 18681 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_10810 20803 19649 gene locus_tag LOCUS_10820 gene murG 20803 19649 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939774.1 protein_id gnl|my_center|LOCUS_10820 21906 20800 gene locus_tag LOCUS_10830 gene spoVE 21906 20800 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_10830 23085 21982 gene locus_tag LOCUS_10840 23085 21982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 24452 23352 gene locus_tag LOCUS_10850 gene mraY 24452 23352 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_10850 25915 24446 gene locus_tag LOCUS_10860 25915 24446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 27405 25921 gene locus_tag LOCUS_10870 27405 25921 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_10870 29282 27498 gene locus_tag LOCUS_10880 29282 27498 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_10880 29674 29279 gene locus_tag LOCUS_10890 29674 29279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 30707 29661 gene locus_tag LOCUS_10900 gene rsmH 30707 29661 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_10900 31550 31098 gene locus_tag LOCUS_10910 gene mraZ 31550 31098 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565149.1 protein_id gnl|my_center|LOCUS_10910 31762 32532 gene locus_tag LOCUS_10920 31762 32532 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_10920 35006 32754 gene locus_tag LOCUS_10930 gene priA 35006 32754 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989822.1 protein_id gnl|my_center|LOCUS_10930 35381 35842 gene locus_tag LOCUS_10940 35381 35842 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078417.1 protein_id gnl|my_center|LOCUS_10940 35850 36212 gene locus_tag LOCUS_10950 35850 36212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 36217 37200 gene locus_tag LOCUS_10960 gene nadA 36217 37200 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_10960 37244 38434 gene locus_tag LOCUS_10970 37244 38434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 39025 38684 gene locus_tag LOCUS_10980 39025 38684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 39717 39022 gene locus_tag LOCUS_10990 39717 39022 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404773.1 protein_id gnl|my_center|LOCUS_10990 39923 40867 gene locus_tag LOCUS_11000 gene trxB 39923 40867 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257932.1 protein_id gnl|my_center|LOCUS_11000 41319 41107 gene locus_tag LOCUS_11010 41319 41107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 41411 41605 gene locus_tag LOCUS_11020 41411 41605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 41626 41817 gene locus_tag LOCUS_11030 41626 41817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 41792 42325 gene locus_tag LOCUS_11040 41792 42325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 42487 42870 gene locus_tag LOCUS_11050 gene crcB 42487 42870 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085425.1 protein_id gnl|my_center|LOCUS_11050 42947 43351 gene locus_tag LOCUS_11060 gene crcB 42947 43351 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253076.1 protein_id gnl|my_center|LOCUS_11060 44217 43387 gene locus_tag LOCUS_11070 44217 43387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 44941 44357 gene locus_tag LOCUS_11080 44941 44357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 45767 45114 gene locus_tag LOCUS_11090 45767 45114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence021 422 844 gene locus_tag LOCUS_11100 422 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 907 1362 gene locus_tag LOCUS_11110 gene trmL 907 1362 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356826.1 protein_id gnl|my_center|LOCUS_11110 1678 2646 gene locus_tag LOCUS_11120 gene cysK 1678 2646 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_11120 3215 3715 gene locus_tag LOCUS_11130 3215 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 4202 5107 gene locus_tag LOCUS_11140 4202 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 6099 5104 gene locus_tag LOCUS_11150 6099 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 7520 6102 gene locus_tag LOCUS_11160 gene hemN 7520 6102 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881391.1 protein_id gnl|my_center|LOCUS_11160 7785 8543 gene locus_tag LOCUS_11170 gene pdxJ 7785 8543 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482574.1 protein_id gnl|my_center|LOCUS_11170 8639 9046 gene locus_tag LOCUS_11180 gene acpS 8639 9046 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873555.1 protein_id gnl|my_center|LOCUS_11180 9389 9120 gene locus_tag LOCUS_11190 9389 9120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 9499 11127 gene locus_tag LOCUS_11200 9499 11127 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_11200 12108 11206 gene locus_tag LOCUS_11210 12108 11206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 13451 12258 gene locus_tag LOCUS_11220 gene moeB 13451 12258 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_11220 13713 14690 gene locus_tag LOCUS_11230 13713 14690 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_11230 14817 15299 gene locus_tag LOCUS_11240 gene ruvX 14817 15299 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058162.1 protein_id gnl|my_center|LOCUS_11240 15487 16269 gene locus_tag LOCUS_11250 gene truA 15487 16269 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727720.1 protein_id gnl|my_center|LOCUS_11250 16314 17057 gene locus_tag LOCUS_11260 16314 17057 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_11260 17074 17931 gene locus_tag LOCUS_11270 gene accD 17074 17931 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_11270 17948 19231 gene locus_tag LOCUS_11280 17948 19231 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_11280 19454 20032 gene locus_tag LOCUS_11290 19454 20032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 21756 20167 gene locus_tag LOCUS_11300 21756 20167 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288375.1 protein_id gnl|my_center|LOCUS_11300 23637 22042 gene locus_tag LOCUS_11310 gene guaB 23637 22042 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081543.1 protein_id gnl|my_center|LOCUS_11310 24475 23702 gene locus_tag LOCUS_11320 24475 23702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 25544 24495 gene locus_tag LOCUS_11330 25544 24495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 28459 25541 gene locus_tag LOCUS_11340 28459 25541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 28669 28742 gene locus_tag LOCUS_t00170 28669 28742 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 30290 28842 gene locus_tag LOCUS_11350 30290 28842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 30615 31709 gene locus_tag LOCUS_11360 gene hisC 30615 31709 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_11360 31804 33108 gene locus_tag LOCUS_11370 31804 33108 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439596.1 protein_id gnl|my_center|LOCUS_11370 33182 33391 gene locus_tag LOCUS_11380 33182 33391 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933882.1 protein_id gnl|my_center|LOCUS_11380 33582 35174 gene locus_tag LOCUS_11390 gene gpmI 33582 35174 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435040.1 protein_id gnl|my_center|LOCUS_11390 35330 37159 gene locus_tag LOCUS_11400 35330 37159 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_11400 37222 39423 gene locus_tag LOCUS_11410 37222 39423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 39558 40376 gene locus_tag LOCUS_11420 39558 40376 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333956.1 protein_id gnl|my_center|LOCUS_11420 41095 40514 gene locus_tag LOCUS_11430 41095 40514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 41481 42674 gene locus_tag LOCUS_11440 41481 42674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 43362 42793 gene locus_tag LOCUS_11450 43362 42793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 43575 44345 gene locus_tag LOCUS_11460 gene hisA 43575 44345 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_11460 45761 44376 gene locus_tag LOCUS_11470 gene merA 45761 44376 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193219.1 protein_id gnl|my_center|LOCUS_11470 46025 46888 gene locus_tag LOCUS_11480 46025 46888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence022 301 1026 gene locus_tag LOCUS_11490 301 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1416 1255 gene locus_tag LOCUS_11500 1416 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 2765 2388 gene locus_tag LOCUS_11510 2765 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 3476 6364 gene locus_tag LOCUS_11520 3476 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 7021 6647 gene locus_tag LOCUS_11530 7021 6647 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113117.1 protein_id gnl|my_center|LOCUS_11530 8678 7041 gene locus_tag LOCUS_11540 8678 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 9376 13137 gene locus_tag LOCUS_11550 gene metH 9376 13137 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262613.1 protein_id gnl|my_center|LOCUS_11550 13334 13807 gene locus_tag LOCUS_11560 13334 13807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 13797 14051 gene locus_tag LOCUS_11570 13797 14051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 14058 16133 gene locus_tag LOCUS_11580 14058 16133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 16917 16189 gene locus_tag LOCUS_11590 16917 16189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 17672 17079 gene locus_tag LOCUS_11600 gene recR 17672 17079 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_11600 18201 17893 gene locus_tag LOCUS_11610 18201 17893 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546807.1 protein_id gnl|my_center|LOCUS_11610 19265 18351 gene locus_tag LOCUS_11620 19265 18351 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 protein_id gnl|my_center|LOCUS_11620 19317 19862 gene locus_tag LOCUS_11630 19317 19862 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_11630 20073 21944 gene locus_tag LOCUS_11640 20073 21944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 23177 22011 gene locus_tag LOCUS_11650 23177 22011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 23411 24160 gene locus_tag LOCUS_11660 23411 24160 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227785.1 protein_id gnl|my_center|LOCUS_11660 24344 25216 gene locus_tag LOCUS_11670 gene folD 24344 25216 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_11670 25394 25693 gene locus_tag LOCUS_11680 25394 25693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 27729 25702 gene locus_tag LOCUS_11690 gene uvrB 27729 25702 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_11690 27795 28370 gene locus_tag LOCUS_11700 27795 28370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 28422 29390 gene locus_tag LOCUS_11710 28422 29390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 30666 29704 gene locus_tag LOCUS_11720 30666 29704 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066627.1 protein_id gnl|my_center|LOCUS_11720 30855 30679 gene locus_tag LOCUS_11730 30855 30679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 31098 31976 gene locus_tag LOCUS_11740 31098 31976 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 protein_id gnl|my_center|LOCUS_11740 32044 33219 gene locus_tag LOCUS_11750 32044 33219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_11750 34399 33239 gene locus_tag LOCUS_11760 34399 33239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 35912 34419 gene locus_tag LOCUS_11770 35912 34419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 36459 35914 gene locus_tag LOCUS_11780 36459 35914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 38642 36558 gene locus_tag LOCUS_11790 38642 36558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 39964 38906 gene locus_tag LOCUS_11800 39964 38906 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921780.1 protein_id gnl|my_center|LOCUS_11800 40118 41854 gene locus_tag LOCUS_11810 40118 41854 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582481.1 protein_id gnl|my_center|LOCUS_11810 43581 41851 gene locus_tag LOCUS_11820 43581 41851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 43885 43643 gene locus_tag LOCUS_11830 43885 43643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 43902 45227 gene locus_tag LOCUS_11840 43902 45227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence023 149 58 gene locus_tag LOCUS_t00180 149 58 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 844 419 gene locus_tag LOCUS_11850 844 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1784 852 gene locus_tag LOCUS_11860 gene cyoE 1784 852 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_11860 2836 1781 gene locus_tag LOCUS_11870 2836 1781 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405086.1 protein_id gnl|my_center|LOCUS_11870 2906 3898 gene locus_tag LOCUS_11880 2906 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 3966 4898 gene locus_tag LOCUS_11890 3966 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 5239 4949 gene locus_tag LOCUS_11900 5239 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 6324 5449 gene locus_tag LOCUS_11910 6324 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 9257 6588 gene locus_tag LOCUS_11920 9257 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229026.1 protein_id gnl|my_center|LOCUS_11920 10878 9523 gene locus_tag LOCUS_11930 gene ffh 10878 9523 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938141.1 protein_id gnl|my_center|LOCUS_11930 11175 11657 gene locus_tag LOCUS_11940 11175 11657 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_11940 11751 12935 gene locus_tag LOCUS_11950 11751 12935 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_11950 12932 14326 gene locus_tag LOCUS_11960 gene der 12932 14326 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_11960 14578 15549 gene locus_tag LOCUS_11970 gene fmt 14578 15549 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_11970 15659 16426 gene locus_tag LOCUS_11980 15659 16426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 16430 17446 gene locus_tag LOCUS_11990 16430 17446 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_11990 17571 17972 gene locus_tag LOCUS_12000 17571 17972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 18031 18915 gene locus_tag LOCUS_12010 18031 18915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 18951 19646 gene locus_tag LOCUS_12020 18951 19646 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818863.1 protein_id gnl|my_center|LOCUS_12020 20851 19721 gene locus_tag LOCUS_12030 gene ugpC 20851 19721 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_12030 21194 21796 gene locus_tag LOCUS_12040 21194 21796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 21804 21998 gene locus_tag LOCUS_12050 21804 21998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 22107 23303 gene locus_tag LOCUS_12060 22107 23303 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_12060 23360 24604 gene locus_tag LOCUS_12070 gene icd 23360 24604 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479852.1 protein_id gnl|my_center|LOCUS_12070 24846 24920 gene locus_tag LOCUS_t00190 24846 24920 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 24977 26167 gene locus_tag LOCUS_12080 gene tuf 24977 26167 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943488.1 protein_id gnl|my_center|LOCUS_12080 26230 26305 gene locus_tag LOCUS_t00200 26230 26305 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 26320 26523 gene locus_tag LOCUS_12090 26320 26523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 26528 27103 gene locus_tag LOCUS_12100 gene nusG 26528 27103 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_12100 27116 27541 gene locus_tag LOCUS_12110 gene rplK 27116 27541 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966425.1 protein_id gnl|my_center|LOCUS_12110 27603 28295 gene locus_tag LOCUS_12120 gene rplA 27603 28295 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235040.1 protein_id gnl|my_center|LOCUS_12120 28311 28823 gene locus_tag LOCUS_12130 gene rplJ 28311 28823 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356426.1 protein_id gnl|my_center|LOCUS_12130 28961 29347 gene locus_tag LOCUS_12140 gene rplL 28961 29347 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_12140 29698 33480 gene locus_tag LOCUS_12150 gene rpoB 29698 33480 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012263639.1 protein_id gnl|my_center|LOCUS_12150 33496 37608 gene locus_tag LOCUS_12160 gene rpoC 33496 37608 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895278.1 protein_id gnl|my_center|LOCUS_12160 37739 39058 gene locus_tag LOCUS_12170 gene xylA 37739 39058 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 protein_id gnl|my_center|LOCUS_12170 39055 40593 gene locus_tag LOCUS_12180 gene xylB 39055 40593 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_12180 40700 41101 gene locus_tag LOCUS_12190 40700 41101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 42714 41443 gene locus_tag LOCUS_12200 42714 41443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 43238 42768 gene locus_tag LOCUS_12210 43238 42768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 43559 44932 gene locus_tag LOCUS_12220 43559 44932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence024 1610 63 gene locus_tag LOCUS_12230 1610 63 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 protein_id gnl|my_center|LOCUS_12230 2163 1663 gene locus_tag LOCUS_12240 2163 1663 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_12240 3084 2182 gene locus_tag LOCUS_12250 3084 2182 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_12250 3425 4330 gene locus_tag LOCUS_12260 3425 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 4880 4659 gene locus_tag LOCUS_12270 4880 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 4770 5084 gene locus_tag LOCUS_12280 4770 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 5133 5357 gene locus_tag LOCUS_12290 5133 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 8424 5377 gene locus_tag LOCUS_12300 8424 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 10242 9628 gene locus_tag LOCUS_12310 10242 9628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 10759 10193 gene locus_tag LOCUS_12320 10759 10193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 12137 11943 gene locus_tag LOCUS_12330 12137 11943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 12220 12408 gene locus_tag LOCUS_12340 12220 12408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 12849 14246 gene locus_tag LOCUS_12350 12849 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 14343 15509 gene locus_tag LOCUS_12360 14343 15509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 15862 16113 gene locus_tag LOCUS_12370 15862 16113 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887863.1 protein_id gnl|my_center|LOCUS_12370 16110 18239 gene locus_tag LOCUS_12380 gene feoB 16110 18239 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249665.1 protein_id gnl|my_center|LOCUS_12380 19917 18442 gene locus_tag LOCUS_12390 gene cls 19917 18442 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937731.1 protein_id gnl|my_center|LOCUS_12390 21895 20063 gene locus_tag LOCUS_12400 21895 20063 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232362.1 protein_id gnl|my_center|LOCUS_12400 21889 22353 gene locus_tag LOCUS_12410 21889 22353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 22350 23342 gene locus_tag LOCUS_12420 gene ilvE 22350 23342 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_12420 23421 26870 gene locus_tag LOCUS_12430 23421 26870 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943065.1 protein_id gnl|my_center|LOCUS_12430 27027 27710 gene locus_tag LOCUS_12440 27027 27710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 29317 27878 gene locus_tag LOCUS_12450 29317 27878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 31786 29477 gene locus_tag LOCUS_12460 31786 29477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 32089 32739 gene locus_tag LOCUS_12470 32089 32739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 32870 33997 gene locus_tag LOCUS_12480 gene dprA 32870 33997 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_12480 34127 34582 gene locus_tag LOCUS_12490 34127 34582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 34614 36080 gene locus_tag LOCUS_12500 gene lpdA 34614 36080 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919599.1 protein_id gnl|my_center|LOCUS_12500 36340 36071 gene locus_tag LOCUS_12510 36340 36071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 36355 40023 gene locus_tag LOCUS_12520 36355 40023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 40277 40350 gene locus_tag LOCUS_t00210 40277 40350 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 41172 42170 gene locus_tag LOCUS_12530 41172 42170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence025 1110 196 gene locus_tag LOCUS_12540 gene thrB 1110 196 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_12540 1656 1141 gene locus_tag LOCUS_12550 1656 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1901 1698 gene locus_tag LOCUS_12560 1901 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 2080 2421 gene locus_tag LOCUS_12570 2080 2421 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122616.1 protein_id gnl|my_center|LOCUS_12570 2451 2612 gene locus_tag LOCUS_12580 2451 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 3855 2734 gene locus_tag LOCUS_12590 3855 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 4091 4567 gene locus_tag LOCUS_12600 4091 4567 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_12600 4592 5566 gene locus_tag LOCUS_12610 4592 5566 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392130.1 protein_id gnl|my_center|LOCUS_12610 5758 8211 gene locus_tag LOCUS_12620 5758 8211 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047997.1 protein_id gnl|my_center|LOCUS_12620 8135 8614 gene locus_tag LOCUS_12630 8135 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 8617 9339 gene locus_tag LOCUS_12640 8617 9339 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392134.1 protein_id gnl|my_center|LOCUS_12640 9363 9974 gene locus_tag LOCUS_12650 9363 9974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 10467 9994 gene locus_tag LOCUS_12660 10467 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582786.1 protein_id gnl|my_center|LOCUS_12660 11412 10651 gene locus_tag LOCUS_12670 11412 10651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 12724 11564 gene locus_tag LOCUS_12680 12724 11564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 14480 13239 gene locus_tag LOCUS_12690 14480 13239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 14913 15182 gene locus_tag LOCUS_12700 14913 15182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 15407 15637 gene locus_tag LOCUS_12710 15407 15637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 15787 15713 gene locus_tag LOCUS_t00220 15787 15713 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16429 16022 gene locus_tag LOCUS_12720 16429 16022 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258892.1 protein_id gnl|my_center|LOCUS_12720 17935 16508 gene locus_tag LOCUS_12730 gene atpD 17935 16508 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056375.1 protein_id gnl|my_center|LOCUS_12730 18865 17969 gene locus_tag LOCUS_12740 gene atpG 18865 17969 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815344.1 protein_id gnl|my_center|LOCUS_12740 20445 18907 gene locus_tag LOCUS_12750 gene atpA 20445 18907 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 protein_id gnl|my_center|LOCUS_12750 20961 20566 gene locus_tag LOCUS_12760 20961 20566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 21519 20968 gene locus_tag LOCUS_12770 21519 20968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 21817 21596 gene locus_tag LOCUS_12780 21817 21596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 22792 21920 gene locus_tag LOCUS_12790 gene atpB 22792 21920 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582552.1 protein_id gnl|my_center|LOCUS_12790 22942 23637 gene locus_tag LOCUS_12800 22942 23637 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_12800 24401 23745 gene locus_tag LOCUS_12810 24401 23745 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298548.1 protein_id gnl|my_center|LOCUS_12810 26029 24638 gene locus_tag LOCUS_12820 26029 24638 CDS product 2-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920832.1 protein_id gnl|my_center|LOCUS_12820 26946 26026 gene locus_tag LOCUS_12830 26946 26026 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057016.1 protein_id gnl|my_center|LOCUS_12830 27886 27041 gene locus_tag LOCUS_12840 27886 27041 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974523.1 protein_id gnl|my_center|LOCUS_12840 28821 27883 gene locus_tag LOCUS_12850 28821 27883 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180942201.1 protein_id gnl|my_center|LOCUS_12850 30149 28818 gene locus_tag LOCUS_12860 30149 28818 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396358.1 protein_id gnl|my_center|LOCUS_12860 31356 30442 gene locus_tag LOCUS_12870 31356 30442 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020996787.1 protein_id gnl|my_center|LOCUS_12870 31544 31621 gene locus_tag LOCUS_t00230 31544 31621 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 31684 32730 gene locus_tag LOCUS_12880 gene thiL 31684 32730 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_12880 32727 33161 gene locus_tag LOCUS_12890 32727 33161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 34887 33172 gene locus_tag LOCUS_12900 34887 33172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 35068 35151 gene locus_tag LOCUS_t00240 35068 35151 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35375 36271 gene locus_tag LOCUS_12910 35375 36271 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_12910 36299 37114 gene locus_tag LOCUS_12920 gene dapF 36299 37114 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927135.1 protein_id gnl|my_center|LOCUS_12920 38368 37310 gene locus_tag LOCUS_12930 38368 37310 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228062.1 protein_id gnl|my_center|LOCUS_12930 38607 39398 gene locus_tag LOCUS_12940 38607 39398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 40355 39417 gene locus_tag LOCUS_12950 gene hemB 40355 39417 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966342.1 protein_id gnl|my_center|LOCUS_12950 40515 41954 gene locus_tag LOCUS_12960 gene cysS 40515 41954 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020794.1 protein_id gnl|my_center|LOCUS_12960 42151 42417 gene locus_tag LOCUS_12970 42151 42417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence026 116 592 gene locus_tag LOCUS_12980 116 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1727 960 gene locus_tag LOCUS_12990 1727 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 2688 3167 gene locus_tag LOCUS_13000 2688 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 7753 3443 gene locus_tag LOCUS_13010 7753 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 10399 9464 gene locus_tag LOCUS_13020 10399 9464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13020 12029 10743 gene locus_tag LOCUS_13030 12029 10743 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731063.1 protein_id gnl|my_center|LOCUS_13030 13035 12154 gene locus_tag LOCUS_13040 13035 12154 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970417.1 protein_id gnl|my_center|LOCUS_13040 13848 13066 gene locus_tag LOCUS_13050 gene hpaI 13848 13066 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211075.1 protein_id gnl|my_center|LOCUS_13050 14319 14711 gene locus_tag LOCUS_13060 14319 14711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 14708 15229 gene locus_tag LOCUS_13070 14708 15229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 15619 15695 gene locus_tag LOCUS_t00250 15619 15695 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15958 16272 gene locus_tag LOCUS_13080 15958 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 16185 16406 gene locus_tag LOCUS_13090 16185 16406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 17842 17120 gene locus_tag LOCUS_13100 17842 17120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 19999 19844 gene locus_tag LOCUS_13110 19999 19844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 20069 20503 gene locus_tag LOCUS_13120 20069 20503 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177028.1 protein_id gnl|my_center|LOCUS_13120 20614 21519 gene locus_tag LOCUS_13130 20614 21519 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_13130 21722 23128 gene locus_tag LOCUS_13140 21722 23128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 23176 24024 gene locus_tag LOCUS_13150 23176 24024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 24512 24132 gene locus_tag LOCUS_13160 gene gcvH 24512 24132 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_13160 25675 24509 gene locus_tag LOCUS_13170 gene gcvT 25675 24509 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398598.1 protein_id gnl|my_center|LOCUS_13170 26224 25697 gene locus_tag LOCUS_13180 26224 25697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 27355 26327 gene locus_tag LOCUS_13190 27355 26327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 27896 27369 gene locus_tag LOCUS_13200 27896 27369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 28056 28943 gene locus_tag LOCUS_13210 gene lipA 28056 28943 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_13210 31774 29015 gene locus_tag LOCUS_13220 31774 29015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 33502 31799 gene locus_tag LOCUS_13230 33502 31799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 33719 33489 gene locus_tag LOCUS_13240 33719 33489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 34114 33716 gene locus_tag LOCUS_13250 34114 33716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 35216 34131 gene locus_tag LOCUS_13260 35216 34131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 36286 35432 gene locus_tag LOCUS_13270 36286 35432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 36606 36328 gene locus_tag LOCUS_13280 36606 36328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 36487 36927 gene locus_tag LOCUS_13290 36487 36927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 37031 38500 gene locus_tag LOCUS_13300 37031 38500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 38504 41053 gene locus_tag LOCUS_13310 gene hrpB 38504 41053 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_13310 42336 41068 gene locus_tag LOCUS_13320 42336 41068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence027 406 2103 gene locus_tag LOCUS_13330 406 2103 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_13330 2223 3641 gene locus_tag LOCUS_13340 2223 3641 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295834.1 protein_id gnl|my_center|LOCUS_13340 5182 3839 gene locus_tag LOCUS_13350 gene aroA 5182 3839 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457254.1 protein_id gnl|my_center|LOCUS_13350 6046 5201 gene locus_tag LOCUS_13360 6046 5201 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391011.1 protein_id gnl|my_center|LOCUS_13360 6296 8113 gene locus_tag LOCUS_13370 6296 8113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 8341 8604 gene locus_tag LOCUS_13380 8341 8604 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083634.1 protein_id gnl|my_center|LOCUS_13380 9947 8703 gene locus_tag LOCUS_13390 9947 8703 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202697.1 protein_id gnl|my_center|LOCUS_13390 10191 10778 gene locus_tag LOCUS_13400 10191 10778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 10834 12201 gene locus_tag LOCUS_13410 10834 12201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 12254 12823 gene locus_tag LOCUS_13420 12254 12823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 13155 12856 gene locus_tag LOCUS_13430 13155 12856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 14726 13161 gene locus_tag LOCUS_13440 14726 13161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 15955 15047 gene locus_tag LOCUS_13450 gene thiD 15955 15047 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368307.1 protein_id gnl|my_center|LOCUS_13450 16168 16857 gene locus_tag LOCUS_13460 16168 16857 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_13460 17017 17352 gene locus_tag LOCUS_13470 17017 17352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 17469 22016 gene locus_tag LOCUS_13480 gene gltB 17469 22016 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259099.1 protein_id gnl|my_center|LOCUS_13480 22309 23742 gene locus_tag LOCUS_13490 22309 23742 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_13490 23908 24228 gene locus_tag LOCUS_13500 23908 24228 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258148.1 protein_id gnl|my_center|LOCUS_13500 24422 24679 gene locus_tag LOCUS_13510 24422 24679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 25065 26606 gene locus_tag LOCUS_13520 25065 26606 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_13520 26770 27801 gene locus_tag LOCUS_13530 26770 27801 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218938748.1 protein_id gnl|my_center|LOCUS_13530 28102 28590 gene locus_tag LOCUS_13540 28102 28590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831025.1 protein_id gnl|my_center|LOCUS_13540 28690 29106 gene locus_tag LOCUS_13550 28690 29106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974119.1 protein_id gnl|my_center|LOCUS_13550 29103 29900 gene locus_tag LOCUS_13560 29103 29900 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033982.1 protein_id gnl|my_center|LOCUS_13560 30144 30560 gene locus_tag LOCUS_13570 30144 30560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 32346 30853 gene locus_tag LOCUS_13580 32346 30853 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258343.1 protein_id gnl|my_center|LOCUS_13580 33178 32489 gene locus_tag LOCUS_13590 gene pdxH 33178 32489 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210959.1 protein_id gnl|my_center|LOCUS_13590 34547 33297 gene locus_tag LOCUS_13600 34547 33297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 35102 34626 gene locus_tag LOCUS_13610 gene azu 35102 34626 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463034.1 protein_id gnl|my_center|LOCUS_13610 35582 35136 gene locus_tag LOCUS_13620 35582 35136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 36550 35675 gene locus_tag LOCUS_13630 36550 35675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 37119 36589 gene locus_tag LOCUS_13640 37119 36589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 37611 37342 gene locus_tag LOCUS_13650 37611 37342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 38973 37792 gene locus_tag LOCUS_13660 38973 37792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 39271 39969 gene locus_tag LOCUS_13670 39271 39969 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932340.1 protein_id gnl|my_center|LOCUS_13670 40248 41567 gene locus_tag LOCUS_13680 40248 41567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence028 318 3524 gene locus_tag LOCUS_13690 318 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3804 6494 gene locus_tag LOCUS_13700 3804 6494 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272644.1 protein_id gnl|my_center|LOCUS_13700 7877 6528 gene locus_tag LOCUS_13710 gene gdhA 7877 6528 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941959.1 protein_id gnl|my_center|LOCUS_13710 9147 8167 gene locus_tag LOCUS_13720 9147 8167 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817430.1 protein_id gnl|my_center|LOCUS_13720 10089 9169 gene locus_tag LOCUS_13730 10089 9169 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393753.1 protein_id gnl|my_center|LOCUS_13730 10689 11324 gene locus_tag LOCUS_13740 gene lexA 10689 11324 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554100.1 protein_id gnl|my_center|LOCUS_13740 11714 11565 gene locus_tag LOCUS_13750 11714 11565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 11659 11829 gene locus_tag LOCUS_13760 11659 11829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 12023 12367 gene locus_tag LOCUS_13770 12023 12367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 12393 12764 gene locus_tag LOCUS_13780 12393 12764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 12841 13359 gene locus_tag LOCUS_13790 gene nuoE 12841 13359 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583281.1 protein_id gnl|my_center|LOCUS_13790 13349 15322 gene locus_tag LOCUS_13800 13349 15322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 15342 17108 gene locus_tag LOCUS_13810 15342 17108 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_13810 17331 19310 gene locus_tag LOCUS_13820 17331 19310 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973814.1 protein_id gnl|my_center|LOCUS_13820 19317 20228 gene locus_tag LOCUS_13830 19317 20228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 20443 20658 gene locus_tag LOCUS_13840 20443 20658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 20619 20954 gene locus_tag LOCUS_13850 20619 20954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 22162 21317 gene locus_tag LOCUS_13860 22162 21317 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942953.1 protein_id gnl|my_center|LOCUS_13860 22572 22213 gene locus_tag LOCUS_13870 22572 22213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 22596 22808 gene locus_tag LOCUS_13880 22596 22808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 22805 23146 gene locus_tag LOCUS_13890 22805 23146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 23143 23940 gene locus_tag LOCUS_13900 23143 23940 CDS product DUF899 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976836.1 protein_id gnl|my_center|LOCUS_13900 23947 24318 gene locus_tag LOCUS_13910 23947 24318 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205987.1 protein_id gnl|my_center|LOCUS_13910 24319 24711 gene locus_tag LOCUS_13920 24319 24711 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816964.1 protein_id gnl|my_center|LOCUS_13920 24779 25330 gene locus_tag LOCUS_13930 24779 25330 CDS product DUF1579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123632.1 protein_id gnl|my_center|LOCUS_13930 25404 25562 gene locus_tag LOCUS_13940 25404 25562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 25714 26175 gene locus_tag LOCUS_13950 25714 26175 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_13950 26728 26141 gene locus_tag LOCUS_13960 26728 26141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 27719 26820 gene locus_tag LOCUS_13970 27719 26820 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351059.1 protein_id gnl|my_center|LOCUS_13970 28065 27829 gene locus_tag LOCUS_13980 28065 27829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 28052 28318 gene locus_tag LOCUS_13990 28052 28318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 28499 28975 gene locus_tag LOCUS_14000 28499 28975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 29779 29057 gene locus_tag LOCUS_14010 29779 29057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 30229 30540 gene locus_tag LOCUS_14020 30229 30540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 30591 31244 gene locus_tag LOCUS_14030 30591 31244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275369.1 protein_id gnl|my_center|LOCUS_14030 32055 31648 gene locus_tag LOCUS_14040 32055 31648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 32330 32052 gene locus_tag LOCUS_14050 32330 32052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 32607 33062 gene locus_tag LOCUS_14060 32607 33062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831025.1 protein_id gnl|my_center|LOCUS_14060 33161 33577 gene locus_tag LOCUS_14070 33161 33577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974119.1 protein_id gnl|my_center|LOCUS_14070 33574 34068 gene locus_tag LOCUS_14080 33574 34068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 34065 35102 gene locus_tag LOCUS_14090 34065 35102 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_14090 35371 35171 gene locus_tag LOCUS_14100 35371 35171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 36258 35821 gene locus_tag LOCUS_14110 36258 35821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 36512 36255 gene locus_tag LOCUS_14120 36512 36255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 36588 36791 gene locus_tag LOCUS_14130 36588 36791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 36983 38230 gene locus_tag LOCUS_14140 36983 38230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 38256 38825 gene locus_tag LOCUS_14150 38256 38825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 38865 39014 gene locus_tag LOCUS_14160 38865 39014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 39084 40079 gene locus_tag LOCUS_14170 39084 40079 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153087.1 protein_id gnl|my_center|LOCUS_14170 40228 40016 gene locus_tag LOCUS_14180 40228 40016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence029 231 1190 gene locus_tag LOCUS_14190 231 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 2268 1408 gene locus_tag LOCUS_14200 2268 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 4955 2634 gene locus_tag LOCUS_14210 gene galB 4955 2634 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039185.1 protein_id gnl|my_center|LOCUS_14210 6559 5318 gene locus_tag LOCUS_14220 6559 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 11222 7086 gene locus_tag LOCUS_14230 11222 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 14736 11503 gene locus_tag LOCUS_14240 14736 11503 CDS product family 78 glycoside hydrolase catalytic domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226935.1 protein_id gnl|my_center|LOCUS_14240 15084 17975 gene locus_tag LOCUS_14250 15084 17975 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671005.1 protein_id gnl|my_center|LOCUS_14250 19431 18157 gene locus_tag LOCUS_14260 19431 18157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 19416 19667 gene locus_tag LOCUS_14270 19416 19667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 21044 19725 gene locus_tag LOCUS_14280 21044 19725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 21439 22914 gene locus_tag LOCUS_14290 21439 22914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921337.1 protein_id gnl|my_center|LOCUS_14290 22946 23128 gene locus_tag LOCUS_14300 22946 23128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 23777 23166 gene locus_tag LOCUS_14310 23777 23166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 25174 23774 gene locus_tag LOCUS_14320 25174 23774 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023927.1 protein_id gnl|my_center|LOCUS_14320 25941 25171 gene locus_tag LOCUS_14330 25941 25171 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_14330 26578 29076 gene locus_tag LOCUS_14340 26578 29076 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107129.1 protein_id gnl|my_center|LOCUS_14340 29120 30166 gene locus_tag LOCUS_14350 29120 30166 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967740.1 protein_id gnl|my_center|LOCUS_14350 30166 31092 gene locus_tag LOCUS_14360 30166 31092 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092846703.1 protein_id gnl|my_center|LOCUS_14360 31094 32206 gene locus_tag LOCUS_14370 31094 32206 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965830.1 protein_id gnl|my_center|LOCUS_14370 32203 33474 gene locus_tag LOCUS_14380 32203 33474 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765391.1 protein_id gnl|my_center|LOCUS_14380 33471 34106 gene locus_tag LOCUS_14390 33471 34106 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965772.1 protein_id gnl|my_center|LOCUS_14390 34227 36419 gene locus_tag LOCUS_14400 34227 36419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 36730 38076 gene locus_tag LOCUS_14410 36730 38076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 39100 38267 gene locus_tag LOCUS_14420 39100 38267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 39252 39177 gene locus_tag LOCUS_t00260 39252 39177 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 39733 39464 gene locus_tag LOCUS_14430 39733 39464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 40310 40780 gene locus_tag LOCUS_14440 40310 40780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence030 508 1656 gene locus_tag LOCUS_14450 508 1656 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_14450 1659 3107 gene locus_tag LOCUS_14460 1659 3107 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227986.1 protein_id gnl|my_center|LOCUS_14460 3314 4393 gene locus_tag LOCUS_14470 3314 4393 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227985.1 protein_id gnl|my_center|LOCUS_14470 4469 5770 gene locus_tag LOCUS_14480 gene glcF 4469 5770 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227984.1 protein_id gnl|my_center|LOCUS_14480 8050 5807 gene locus_tag LOCUS_14490 8050 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 8302 9459 gene locus_tag LOCUS_14500 gene mnmA 8302 9459 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268273.1 protein_id gnl|my_center|LOCUS_14500 9489 9926 gene locus_tag LOCUS_14510 9489 9926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 10517 9984 gene locus_tag LOCUS_14520 10517 9984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 10704 11792 gene locus_tag LOCUS_14530 10704 11792 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262781.1 protein_id gnl|my_center|LOCUS_14530 11825 12646 gene locus_tag LOCUS_14540 gene lgt 11825 12646 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704636.1 protein_id gnl|my_center|LOCUS_14540 13662 12814 gene locus_tag LOCUS_14550 13662 12814 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_14550 14956 13673 gene locus_tag LOCUS_14560 14956 13673 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920845.1 protein_id gnl|my_center|LOCUS_14560 15080 16567 gene locus_tag LOCUS_14570 gene trpE 15080 16567 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_14570 16673 16855 gene locus_tag LOCUS_14580 16673 16855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 16785 17906 gene locus_tag LOCUS_14590 16785 17906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 19670 18018 gene locus_tag LOCUS_14600 gene rpsA 19670 18018 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872374.1 protein_id gnl|my_center|LOCUS_14600 20431 19925 gene locus_tag LOCUS_14610 20431 19925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 21483 20449 gene locus_tag LOCUS_14620 21483 20449 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_14620 22855 21494 gene locus_tag LOCUS_14630 gene mgtE 22855 21494 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259555.1 protein_id gnl|my_center|LOCUS_14630 23881 23048 gene locus_tag LOCUS_14640 23881 23048 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434794.1 protein_id gnl|my_center|LOCUS_14640 23880 24203 gene locus_tag LOCUS_14650 23880 24203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 25900 24212 gene locus_tag LOCUS_14660 25900 24212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 27276 26071 gene locus_tag LOCUS_14670 27276 26071 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_14670 27493 27873 gene locus_tag LOCUS_14680 27493 27873 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552785.1 protein_id gnl|my_center|LOCUS_14680 28035 28793 gene locus_tag LOCUS_14690 28035 28793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 30749 28962 gene locus_tag LOCUS_14700 gene aspS 30749 28962 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_14700 31737 30862 gene locus_tag LOCUS_14710 31737 30862 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625866.1 protein_id gnl|my_center|LOCUS_14710 32983 31760 gene locus_tag LOCUS_14720 gene trpB 32983 31760 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173169.1 protein_id gnl|my_center|LOCUS_14720 34409 33072 gene locus_tag LOCUS_14730 34409 33072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 34308 34514 gene locus_tag LOCUS_14740 34308 34514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 35062 34556 gene locus_tag LOCUS_14750 35062 34556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 37983 35119 gene locus_tag LOCUS_14760 gene acnA 37983 35119 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268414.1 protein_id gnl|my_center|LOCUS_14760 38511 38035 gene locus_tag LOCUS_14770 38511 38035 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_14770 38733 39923 gene locus_tag LOCUS_14780 gene tyrS 38733 39923 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence031 1137 733 gene locus_tag LOCUS_14790 1137 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1361 1128 gene locus_tag LOCUS_14800 1361 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 2916 1900 gene locus_tag LOCUS_14810 2916 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 4147 3188 gene locus_tag LOCUS_14820 4147 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 5382 4297 gene locus_tag LOCUS_14830 5382 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 6173 5709 gene locus_tag LOCUS_14840 6173 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 7482 6181 gene locus_tag LOCUS_14850 gene hflX 7482 6181 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_14850 8885 7644 gene locus_tag LOCUS_14860 8885 7644 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444859.1 protein_id gnl|my_center|LOCUS_14860 10382 8889 gene locus_tag LOCUS_14870 10382 8889 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 protein_id gnl|my_center|LOCUS_14870 11077 10379 gene locus_tag LOCUS_14880 11077 10379 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444858.1 protein_id gnl|my_center|LOCUS_14880 11185 11985 gene locus_tag LOCUS_14890 gene apaH 11185 11985 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257211.1 protein_id gnl|my_center|LOCUS_14890 14414 12174 gene locus_tag LOCUS_14900 gene rnr 14414 12174 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081010.1 protein_id gnl|my_center|LOCUS_14900 14413 14667 gene locus_tag LOCUS_14910 14413 14667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 14664 16109 gene locus_tag LOCUS_14920 gene glgA 14664 16109 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_14920 16206 16925 gene locus_tag LOCUS_14930 gene cysH 16206 16925 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369976.1 protein_id gnl|my_center|LOCUS_14930 18323 16965 gene locus_tag LOCUS_14940 18323 16965 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404676.1 protein_id gnl|my_center|LOCUS_14940 18683 18465 gene locus_tag LOCUS_14950 18683 18465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 19867 18707 gene locus_tag LOCUS_14960 gene thiH 19867 18707 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_14960 20004 21032 gene locus_tag LOCUS_14970 20004 21032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 22526 21177 gene locus_tag LOCUS_14980 22526 21177 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403127.1 protein_id gnl|my_center|LOCUS_14980 22592 23524 gene locus_tag LOCUS_14990 gene rfaP 22592 23524 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114553.1 protein_id gnl|my_center|LOCUS_14990 24675 23542 gene locus_tag LOCUS_15000 gene nspC 24675 23542 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_15000 25868 24672 gene locus_tag LOCUS_15010 25868 24672 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461406.1 protein_id gnl|my_center|LOCUS_15010 26564 25926 gene locus_tag LOCUS_15020 26564 25926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 28045 26570 gene locus_tag LOCUS_15030 28045 26570 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_15030 29391 28042 gene locus_tag LOCUS_15040 gene trkA 29391 28042 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327001.1 protein_id gnl|my_center|LOCUS_15040 30088 29513 gene locus_tag LOCUS_15050 30088 29513 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256187.1 protein_id gnl|my_center|LOCUS_15050 30748 30119 gene locus_tag LOCUS_15060 30748 30119 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869529.1 protein_id gnl|my_center|LOCUS_15060 31413 30745 gene locus_tag LOCUS_15070 gene cmk 31413 30745 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931978.1 protein_id gnl|my_center|LOCUS_15070 33812 31593 gene locus_tag LOCUS_15080 gene pnp 33812 31593 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_15080 34159 33899 gene locus_tag LOCUS_15090 gene rpsO 34159 33899 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018328.1 protein_id gnl|my_center|LOCUS_15090 35801 34503 gene locus_tag LOCUS_15100 gene clpX 35801 34503 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_15100 36459 35818 gene locus_tag LOCUS_15110 gene clpP 36459 35818 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_15110 37766 36456 gene locus_tag LOCUS_15120 gene tig 37766 36456 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245213.1 protein_id gnl|my_center|LOCUS_15120 37906 38595 gene locus_tag LOCUS_15130 37906 38595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 39310 38555 gene locus_tag LOCUS_15140 39310 38555 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence032 1658 312 gene locus_tag LOCUS_15150 1658 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 2196 1768 gene locus_tag LOCUS_15160 2196 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 2350 2712 gene locus_tag LOCUS_15170 2350 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2934 2862 gene locus_tag LOCUS_t00270 2934 2862 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3256 4095 gene locus_tag LOCUS_15180 3256 4095 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_15180 4513 4641 gene locus_tag LOCUS_15190 4513 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 4706 4852 gene locus_tag LOCUS_15200 4706 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 6512 5010 gene locus_tag LOCUS_15210 6512 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_15210 6704 8485 gene locus_tag LOCUS_15220 gene sppA 6704 8485 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_15220 8722 9828 gene locus_tag LOCUS_15230 gene prfB 8722 9828 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096807630.1 protein_id gnl|my_center|LOCUS_15230 9843 11243 gene locus_tag LOCUS_15240 9843 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 11811 11275 gene locus_tag LOCUS_15250 11811 11275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 12384 11935 gene locus_tag LOCUS_15260 12384 11935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 12827 12363 gene locus_tag LOCUS_15270 12827 12363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 13489 12941 gene locus_tag LOCUS_15280 13489 12941 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257075.1 protein_id gnl|my_center|LOCUS_15280 14906 13470 gene locus_tag LOCUS_15290 14906 13470 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_15290 15496 14903 gene locus_tag LOCUS_15300 15496 14903 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_15300 16209 15493 gene locus_tag LOCUS_15310 gene hoxU 16209 15493 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_15310 17837 16206 gene locus_tag LOCUS_15320 17837 16206 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257071.1 protein_id gnl|my_center|LOCUS_15320 18366 17824 gene locus_tag LOCUS_15330 gene hoxE 18366 17824 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257070.1 protein_id gnl|my_center|LOCUS_15330 19034 18420 gene locus_tag LOCUS_15340 19034 18420 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066513.1 protein_id gnl|my_center|LOCUS_15340 20870 19293 gene locus_tag LOCUS_15350 20870 19293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 21063 21758 gene locus_tag LOCUS_15360 21063 21758 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337438.1 protein_id gnl|my_center|LOCUS_15360 22460 22023 gene locus_tag LOCUS_15370 22460 22023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 24811 22565 gene locus_tag LOCUS_15380 24811 22565 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039076.1 protein_id gnl|my_center|LOCUS_15380 25497 24808 gene locus_tag LOCUS_15390 25497 24808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 26398 25559 gene locus_tag LOCUS_15400 26398 25559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 27303 26395 gene locus_tag LOCUS_15410 27303 26395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 28045 27362 gene locus_tag LOCUS_15420 28045 27362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 29162 28038 gene locus_tag LOCUS_15430 29162 28038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 29456 29193 gene locus_tag LOCUS_15440 29456 29193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 31749 29503 gene locus_tag LOCUS_15450 31749 29503 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_15450 31985 32152 gene locus_tag LOCUS_15460 31985 32152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 32815 32138 gene locus_tag LOCUS_15470 32815 32138 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837716.1 protein_id gnl|my_center|LOCUS_15470 32873 34105 gene locus_tag LOCUS_15480 32873 34105 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_15480 34122 34922 gene locus_tag LOCUS_15490 34122 34922 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_15490 34948 35955 gene locus_tag LOCUS_15500 34948 35955 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_15500 35952 36608 gene locus_tag LOCUS_15510 35952 36608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence033 189 449 gene locus_tag LOCUS_15520 189 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 704 513 gene locus_tag LOCUS_15530 704 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1847 789 gene locus_tag LOCUS_15540 1847 789 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 protein_id gnl|my_center|LOCUS_15540 2850 2077 gene locus_tag LOCUS_15550 2850 2077 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_15550 4255 3140 gene locus_tag LOCUS_15560 4255 3140 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_15560 5230 4436 gene locus_tag LOCUS_15570 5230 4436 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139219.1 protein_id gnl|my_center|LOCUS_15570 5404 6339 gene locus_tag LOCUS_15580 gene miaA 5404 6339 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804679.1 protein_id gnl|my_center|LOCUS_15580 6611 6393 gene locus_tag LOCUS_15590 6611 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 6637 7011 gene locus_tag LOCUS_15600 gene rpsL 6637 7011 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_15600 7018 7491 gene locus_tag LOCUS_15610 gene rpsG 7018 7491 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943490.1 protein_id gnl|my_center|LOCUS_15610 7566 9668 gene locus_tag LOCUS_15620 gene fusA 7566 9668 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_15620 9687 9995 gene locus_tag LOCUS_15630 gene rpsJ 9687 9995 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_15630 10163 10780 gene locus_tag LOCUS_15640 gene rplC 10163 10780 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886956.1 protein_id gnl|my_center|LOCUS_15640 10798 11436 gene locus_tag LOCUS_15650 gene rplD 10798 11436 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_15650 11433 11720 gene locus_tag LOCUS_15660 gene rplW 11433 11720 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393935.1 protein_id gnl|my_center|LOCUS_15660 11756 12601 gene locus_tag LOCUS_15670 gene rplB 11756 12601 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938601.1 protein_id gnl|my_center|LOCUS_15670 12607 12876 gene locus_tag LOCUS_15680 gene rpsS 12607 12876 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_15680 12933 13394 gene locus_tag LOCUS_15690 12933 13394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 13434 13745 gene locus_tag LOCUS_15700 gene rplV 13434 13745 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288657.1 protein_id gnl|my_center|LOCUS_15700 13752 14393 gene locus_tag LOCUS_15710 gene rpsC 13752 14393 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_15710 14435 14848 gene locus_tag LOCUS_15720 gene rplP 14435 14848 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421160.1 protein_id gnl|my_center|LOCUS_15720 14873 15076 gene locus_tag LOCUS_15730 gene rpmC 14873 15076 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_15730 15109 15429 gene locus_tag LOCUS_15740 15109 15429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 15454 15819 gene locus_tag LOCUS_15750 gene rplN 15454 15819 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869919.1 protein_id gnl|my_center|LOCUS_15750 15819 16079 gene locus_tag LOCUS_15760 15819 16079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 16207 16779 gene locus_tag LOCUS_15770 gene rplE 16207 16779 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081811.1 protein_id gnl|my_center|LOCUS_15770 16807 17112 gene locus_tag LOCUS_15780 gene rpsN 16807 17112 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722514.1 protein_id gnl|my_center|LOCUS_15780 17168 17560 gene locus_tag LOCUS_15790 gene rpsH 17168 17560 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258245.1 protein_id gnl|my_center|LOCUS_15790 17579 18115 gene locus_tag LOCUS_15800 gene rplF 17579 18115 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088138.1 protein_id gnl|my_center|LOCUS_15800 18140 18502 gene locus_tag LOCUS_15810 gene rplR 18140 18502 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143899.1 protein_id gnl|my_center|LOCUS_15810 18511 19032 gene locus_tag LOCUS_15820 gene rpsE 18511 19032 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_15820 19045 19488 gene locus_tag LOCUS_15830 gene rplO 19045 19488 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_15830 19539 21035 gene locus_tag LOCUS_15840 gene secY 19539 21035 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_15840 21176 21817 gene locus_tag LOCUS_15850 21176 21817 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393916.1 protein_id gnl|my_center|LOCUS_15850 21814 22581 gene locus_tag LOCUS_15860 gene map 21814 22581 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_15860 22651 23025 gene locus_tag LOCUS_15870 gene rpsM 22651 23025 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_15870 23048 23602 gene locus_tag LOCUS_15880 23048 23602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 23713 24264 gene locus_tag LOCUS_15890 gene rpsD 23713 24264 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 protein_id gnl|my_center|LOCUS_15890 24331 25332 gene locus_tag LOCUS_15900 24331 25332 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_15900 25353 25943 gene locus_tag LOCUS_15910 25353 25943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 26317 26550 gene locus_tag LOCUS_15920 26317 26550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 26557 28095 gene locus_tag LOCUS_15930 gene guaA 26557 28095 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_15930 28111 28968 gene locus_tag LOCUS_15940 28111 28968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 28965 30284 gene locus_tag LOCUS_15950 gene hisD 28965 30284 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393531.1 protein_id gnl|my_center|LOCUS_15950 30300 31409 gene locus_tag LOCUS_15960 gene hisC 30300 31409 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943720.1 protein_id gnl|my_center|LOCUS_15960 31382 31981 gene locus_tag LOCUS_15970 gene hisB 31382 31981 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_15970 32132 32743 gene locus_tag LOCUS_15980 gene hisH 32132 32743 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333911.1 protein_id gnl|my_center|LOCUS_15980 32789 34078 gene locus_tag LOCUS_15990 32789 34078 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_15990 34824 34105 gene locus_tag LOCUS_16000 34824 34105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477491.1 protein_id gnl|my_center|LOCUS_16000 34891 35535 gene locus_tag LOCUS_16010 34891 35535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 >Feature sequence034 528 118 gene locus_tag LOCUS_16020 528 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1289 609 gene locus_tag LOCUS_16030 1289 609 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_16030 2159 1494 gene locus_tag LOCUS_16040 2159 1494 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_16040 3257 2199 gene locus_tag LOCUS_16050 3257 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 3957 4559 gene locus_tag LOCUS_16060 3957 4559 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_16060 4559 5191 gene locus_tag LOCUS_16070 4559 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 5833 5228 gene locus_tag LOCUS_16080 gene ruvA 5833 5228 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406125.1 protein_id gnl|my_center|LOCUS_16080 6551 5856 gene locus_tag LOCUS_16090 gene dapB 6551 5856 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 protein_id gnl|my_center|LOCUS_16090 7578 6679 gene locus_tag LOCUS_16100 gene dapA 7578 6679 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869742.1 protein_id gnl|my_center|LOCUS_16100 7692 8795 gene locus_tag LOCUS_16110 7692 8795 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_16110 8792 10588 gene locus_tag LOCUS_16120 gene lepA 8792 10588 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871412.1 protein_id gnl|my_center|LOCUS_16120 10625 11899 gene locus_tag LOCUS_16130 10625 11899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 12009 13562 gene locus_tag LOCUS_16140 gene malQ 12009 13562 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259030.1 protein_id gnl|my_center|LOCUS_16140 14583 13642 gene locus_tag LOCUS_16150 14583 13642 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_16150 15631 14573 gene locus_tag LOCUS_16160 15631 14573 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922567.1 protein_id gnl|my_center|LOCUS_16160 16589 15762 gene locus_tag LOCUS_16170 16589 15762 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121724.1 protein_id gnl|my_center|LOCUS_16170 17024 16596 gene locus_tag LOCUS_16180 gene fabZ 17024 16596 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919778.1 protein_id gnl|my_center|LOCUS_16180 18633 17158 gene locus_tag LOCUS_16190 18633 17158 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921402.1 protein_id gnl|my_center|LOCUS_16190 20209 18701 gene locus_tag LOCUS_16200 20209 18701 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_16200 20424 22403 gene locus_tag LOCUS_16210 20424 22403 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277633.1 protein_id gnl|my_center|LOCUS_16210 22476 23492 gene locus_tag LOCUS_16220 22476 23492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 23767 24546 gene locus_tag LOCUS_16230 23767 24546 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_16230 25297 24632 gene locus_tag LOCUS_16240 gene pgmB 25297 24632 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387394.1 protein_id gnl|my_center|LOCUS_16240 25447 25974 gene locus_tag LOCUS_16250 25447 25974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 26020 27459 gene locus_tag LOCUS_16260 26020 27459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 30056 27816 gene locus_tag LOCUS_16270 30056 27816 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006742214.1 protein_id gnl|my_center|LOCUS_16270 30694 30053 gene locus_tag LOCUS_16280 30694 30053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 32007 30835 gene locus_tag LOCUS_16290 32007 30835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 32152 33384 gene locus_tag LOCUS_16300 32152 33384 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403786.1 protein_id gnl|my_center|LOCUS_16300 35912 34065 gene locus_tag LOCUS_16310 gene glmS 35912 34065 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328387.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence035 595 831 gene locus_tag LOCUS_16320 595 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1474 1076 gene locus_tag LOCUS_16330 1474 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1813 1478 gene locus_tag LOCUS_16340 1813 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2129 2204 gene locus_tag LOCUS_t00280 2129 2204 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2265 2621 gene locus_tag LOCUS_16350 2265 2621 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001971937.1 protein_id gnl|my_center|LOCUS_16350 3039 2632 gene locus_tag LOCUS_16360 3039 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 3251 3036 gene locus_tag LOCUS_16370 3251 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 4574 3435 gene locus_tag LOCUS_16380 4574 3435 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259168.1 protein_id gnl|my_center|LOCUS_16380 5937 4561 gene locus_tag LOCUS_16390 5937 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 7390 5954 gene locus_tag LOCUS_16400 7390 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 8069 7398 gene locus_tag LOCUS_16410 8069 7398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 8536 8132 gene locus_tag LOCUS_16420 8536 8132 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_16420 9150 8533 gene locus_tag LOCUS_16430 9150 8533 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_16430 10549 9143 gene locus_tag LOCUS_16440 10549 9143 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707200.1 protein_id gnl|my_center|LOCUS_16440 11323 10553 gene locus_tag LOCUS_16450 11323 10553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 11704 12279 gene locus_tag LOCUS_16460 11704 12279 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642616.1 protein_id gnl|my_center|LOCUS_16460 12868 12514 gene locus_tag LOCUS_tm00010 12868 12514 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 14434 13448 gene locus_tag LOCUS_16470 14434 13448 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_16470 14537 15949 gene locus_tag LOCUS_16480 gene argH 14537 15949 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_16480 16096 16533 gene locus_tag LOCUS_16490 16096 16533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 17897 16623 gene locus_tag LOCUS_16500 17897 16623 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932712.1 protein_id gnl|my_center|LOCUS_16500 20011 18125 gene locus_tag LOCUS_16510 20011 18125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 20166 20465 gene locus_tag LOCUS_16520 20166 20465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 20476 21633 gene locus_tag LOCUS_16530 20476 21633 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838133.1 protein_id gnl|my_center|LOCUS_16530 21633 23087 gene locus_tag LOCUS_16540 21633 23087 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971478.1 protein_id gnl|my_center|LOCUS_16540 23427 24521 gene locus_tag LOCUS_16550 23427 24521 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_16550 24527 25348 gene locus_tag LOCUS_16560 24527 25348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 25703 28795 gene locus_tag LOCUS_16570 25703 28795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 29208 28957 gene locus_tag LOCUS_16580 29208 28957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 29492 31288 gene locus_tag LOCUS_16590 29492 31288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 31557 34277 gene locus_tag LOCUS_16600 31557 34277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229026.1 protein_id gnl|my_center|LOCUS_16600 35929 34412 gene locus_tag LOCUS_16610 35929 34412 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_16610 35907 36086 gene locus_tag LOCUS_16620 35907 36086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence036 325 2283 gene locus_tag LOCUS_16630 325 2283 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405513.1 protein_id gnl|my_center|LOCUS_16630 5056 2348 gene locus_tag LOCUS_16640 5056 2348 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933216.1 protein_id gnl|my_center|LOCUS_16640 5311 8103 gene locus_tag LOCUS_16650 gene glnD 5311 8103 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_16650 8229 9971 gene locus_tag LOCUS_16660 8229 9971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 10408 10983 gene locus_tag LOCUS_16670 10408 10983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 10987 11466 gene locus_tag LOCUS_16680 gene guaD 10987 11466 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245084.1 protein_id gnl|my_center|LOCUS_16680 11737 13011 gene locus_tag LOCUS_16690 11737 13011 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_16690 13053 15251 gene locus_tag LOCUS_16700 13053 15251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 15846 15226 gene locus_tag LOCUS_16710 15846 15226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 16180 17151 gene locus_tag LOCUS_16720 gene coxB 16180 17151 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745271.1 protein_id gnl|my_center|LOCUS_16720 17161 19152 gene locus_tag LOCUS_16730 gene ctaD 17161 19152 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011371630.1 protein_id gnl|my_center|LOCUS_16730 19149 19778 gene locus_tag LOCUS_16740 gene ctaE 19149 19778 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557860.1 protein_id gnl|my_center|LOCUS_16740 19792 20160 gene locus_tag LOCUS_16750 19792 20160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 20195 21022 gene locus_tag LOCUS_16760 20195 21022 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533219.1 protein_id gnl|my_center|LOCUS_16760 21888 21118 gene locus_tag LOCUS_16770 21888 21118 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221095.1 protein_id gnl|my_center|LOCUS_16770 22030 23805 gene locus_tag LOCUS_16780 gene ilvB 22030 23805 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327661.1 protein_id gnl|my_center|LOCUS_16780 24312 23809 gene locus_tag LOCUS_16790 24312 23809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 25336 24407 gene locus_tag LOCUS_16800 gene xerC 25336 24407 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_16800 26172 25384 gene locus_tag LOCUS_16810 26172 25384 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 protein_id gnl|my_center|LOCUS_16810 26336 26995 gene locus_tag LOCUS_16820 26336 26995 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333582.1 protein_id gnl|my_center|LOCUS_16820 27040 27309 gene locus_tag LOCUS_16830 27040 27309 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868831.1 protein_id gnl|my_center|LOCUS_16830 27367 27615 gene locus_tag LOCUS_16840 27367 27615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 27744 28958 gene locus_tag LOCUS_16850 27744 28958 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118936.1 protein_id gnl|my_center|LOCUS_16850 29034 29324 gene locus_tag LOCUS_16860 gene eutM 29034 29324 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423991.1 protein_id gnl|my_center|LOCUS_16860 29331 29648 gene locus_tag LOCUS_16870 29331 29648 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324359.1 protein_id gnl|my_center|LOCUS_16870 29645 31144 gene locus_tag LOCUS_16880 29645 31144 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333579.1 protein_id gnl|my_center|LOCUS_16880 31149 31442 gene locus_tag LOCUS_16890 31149 31442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 31445 31750 gene locus_tag LOCUS_16900 31445 31750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 31747 32820 gene locus_tag LOCUS_16910 31747 32820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 33163 33978 gene locus_tag LOCUS_16920 33163 33978 CDS product lactate/malate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118931.1 protein_id gnl|my_center|LOCUS_16920 34885 34235 gene locus_tag LOCUS_16930 34885 34235 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144228759.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence037 4041 4202 gene locus_tag LOCUS_16940 4041 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 4885 4451 gene locus_tag LOCUS_16950 4885 4451 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141695.1 protein_id gnl|my_center|LOCUS_16950 5190 4885 gene locus_tag LOCUS_16960 5190 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 5450 6964 gene locus_tag LOCUS_16970 5450 6964 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098999755.1 protein_id gnl|my_center|LOCUS_16970 7502 6915 gene locus_tag LOCUS_16980 7502 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 7929 8684 gene locus_tag LOCUS_16990 7929 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 8871 9758 gene locus_tag LOCUS_17000 8871 9758 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145885.1 protein_id gnl|my_center|LOCUS_17000 9755 12595 gene locus_tag LOCUS_17010 gene glnE 9755 12595 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324258.1 protein_id gnl|my_center|LOCUS_17010 12732 15143 gene locus_tag LOCUS_17020 12732 15143 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_17020 15569 15156 gene locus_tag LOCUS_17030 15569 15156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 16022 15588 gene locus_tag LOCUS_17040 16022 15588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 16796 16113 gene locus_tag LOCUS_17050 16796 16113 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928712.1 protein_id gnl|my_center|LOCUS_17050 16893 20558 gene locus_tag LOCUS_17060 16893 20558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 21431 20721 gene locus_tag LOCUS_17070 21431 20721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 23293 21659 gene locus_tag LOCUS_17080 23293 21659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 27355 23624 gene locus_tag LOCUS_17090 27355 23624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 28601 27444 gene locus_tag LOCUS_17100 28601 27444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 29266 28601 gene locus_tag LOCUS_17110 29266 28601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 29465 29277 gene locus_tag LOCUS_17120 29465 29277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 30137 29598 gene locus_tag LOCUS_17130 30137 29598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 30254 31135 gene locus_tag LOCUS_17140 30254 31135 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_17140 32001 31267 gene locus_tag LOCUS_17150 gene tpiA 32001 31267 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902187.1 protein_id gnl|my_center|LOCUS_17150 33463 32231 gene locus_tag LOCUS_17160 33463 32231 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258675.1 protein_id gnl|my_center|LOCUS_17160 34605 33583 gene locus_tag LOCUS_17170 gene gap 34605 33583 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196721.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence038 125 370 gene locus_tag LOCUS_17180 125 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1091 672 gene locus_tag LOCUS_17190 1091 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17190 2216 1113 gene locus_tag LOCUS_17200 2216 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17200 2979 2281 gene locus_tag LOCUS_17210 2979 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 3508 3798 gene locus_tag LOCUS_17220 3508 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 4525 4806 gene locus_tag LOCUS_17230 4525 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 4763 6364 gene locus_tag LOCUS_17240 4763 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 6756 7148 gene locus_tag LOCUS_17250 6756 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 7543 7932 gene locus_tag LOCUS_17260 7543 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 8207 7995 gene locus_tag LOCUS_17270 8207 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 11040 8218 gene locus_tag LOCUS_17280 11040 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 12236 11316 gene locus_tag LOCUS_17290 12236 11316 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_17290 12375 13367 gene locus_tag LOCUS_17300 12375 13367 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_17300 13401 14633 gene locus_tag LOCUS_17310 gene lpxB 13401 14633 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_17310 14699 16312 gene locus_tag LOCUS_17320 gene cimA 14699 16312 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880180.1 protein_id gnl|my_center|LOCUS_17320 16495 17325 gene locus_tag LOCUS_17330 16495 17325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 17420 18031 gene locus_tag LOCUS_17340 17420 18031 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405414.1 protein_id gnl|my_center|LOCUS_17340 18303 19460 gene locus_tag LOCUS_17350 gene metK 18303 19460 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_17350 19640 21064 gene locus_tag LOCUS_17360 gene ahcY 19640 21064 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035988.1 protein_id gnl|my_center|LOCUS_17360 21244 22110 gene locus_tag LOCUS_17370 gene ilvE 21244 22110 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_17370 22386 22889 gene locus_tag LOCUS_17380 22386 22889 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357604.1 protein_id gnl|my_center|LOCUS_17380 22897 23973 gene locus_tag LOCUS_17390 22897 23973 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 protein_id gnl|my_center|LOCUS_17390 24003 26489 gene locus_tag LOCUS_17400 24003 26489 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_17400 26911 28107 gene locus_tag LOCUS_17410 26911 28107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 28181 28354 gene locus_tag LOCUS_17420 28181 28354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17420 29613 28657 gene locus_tag LOCUS_17430 29613 28657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 30895 30320 gene locus_tag LOCUS_17440 30895 30320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 32755 31070 gene locus_tag LOCUS_17450 32755 31070 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089418476.1 protein_id gnl|my_center|LOCUS_17450 33470 32703 gene locus_tag LOCUS_17460 33470 32703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 34228 33992 gene locus_tag LOCUS_17470 34228 33992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 34559 34218 gene locus_tag LOCUS_17480 34559 34218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence039 189 566 gene locus_tag LOCUS_17490 189 566 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144365.1 protein_id gnl|my_center|LOCUS_17490 643 1230 gene locus_tag LOCUS_17500 gene infC 643 1230 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583670.1 protein_id gnl|my_center|LOCUS_17500 1509 2426 gene locus_tag LOCUS_17510 1509 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2623 4227 gene locus_tag LOCUS_17520 2623 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 4324 5931 gene locus_tag LOCUS_17530 4324 5931 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143151.1 protein_id gnl|my_center|LOCUS_17530 6193 5915 gene locus_tag LOCUS_17540 6193 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 7237 6302 gene locus_tag LOCUS_17550 7237 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526695.1 protein_id gnl|my_center|LOCUS_17550 8115 7471 gene locus_tag LOCUS_17560 8115 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 8430 9290 gene locus_tag LOCUS_17570 8430 9290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 9350 9550 gene locus_tag LOCUS_17580 9350 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 9744 11360 gene locus_tag LOCUS_17590 9744 11360 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403891.1 protein_id gnl|my_center|LOCUS_17590 11773 11372 gene locus_tag LOCUS_17600 11773 11372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 12773 11790 gene locus_tag LOCUS_17610 12773 11790 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246287.1 protein_id gnl|my_center|LOCUS_17610 13233 12778 gene locus_tag LOCUS_17620 13233 12778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 14910 13288 gene locus_tag LOCUS_17630 14910 13288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 15084 15578 gene locus_tag LOCUS_17640 15084 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 15679 16845 gene locus_tag LOCUS_17650 15679 16845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 16932 17540 gene locus_tag LOCUS_17660 gene vpsN 16932 17540 CDS product exopolysaccharide export protein VpsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 protein_id gnl|my_center|LOCUS_17660 17562 19796 gene locus_tag LOCUS_17670 gene vpsO 17562 19796 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_17670 20122 19922 gene locus_tag LOCUS_17680 20122 19922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 20756 20361 gene locus_tag LOCUS_17690 20756 20361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 21556 21044 gene locus_tag LOCUS_17700 21556 21044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 22346 21534 gene locus_tag LOCUS_17710 22346 21534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 23721 22627 gene locus_tag LOCUS_17720 23721 22627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 24413 23727 gene locus_tag LOCUS_17730 24413 23727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 25273 24410 gene locus_tag LOCUS_17740 25273 24410 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065332.1 protein_id gnl|my_center|LOCUS_17740 25623 27455 gene locus_tag LOCUS_17750 25623 27455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 27579 28025 gene locus_tag LOCUS_17760 27579 28025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 28448 29734 gene locus_tag LOCUS_17770 28448 29734 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_17770 30301 30059 gene locus_tag LOCUS_17780 30301 30059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 30296 31162 gene locus_tag LOCUS_17790 30296 31162 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176676.1 protein_id gnl|my_center|LOCUS_17790 31657 31571 gene locus_tag LOCUS_t00290 31657 31571 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 31969 32757 gene locus_tag LOCUS_17800 31969 32757 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106127.1 protein_id gnl|my_center|LOCUS_17800 32916 34388 gene locus_tag LOCUS_17810 32916 34388 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107715.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence040 483 2477 gene locus_tag LOCUS_17820 gene acs 483 2477 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_17820 3580 2972 gene locus_tag LOCUS_17830 gene can 3580 2972 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_17830 5387 3675 gene locus_tag LOCUS_17840 gene recJ 5387 3675 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_17840 8284 5729 gene locus_tag LOCUS_17850 gene secD 8284 5729 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172795.1 protein_id gnl|my_center|LOCUS_17850 8638 8306 gene locus_tag LOCUS_17860 8638 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 8994 10958 gene locus_tag LOCUS_17870 gene speA 8994 10958 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144058.1 protein_id gnl|my_center|LOCUS_17870 11208 12215 gene locus_tag LOCUS_17880 11208 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 16070 12315 gene locus_tag LOCUS_17890 gene smc 16070 12315 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287897.1 protein_id gnl|my_center|LOCUS_17890 17105 16095 gene locus_tag LOCUS_17900 17105 16095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 18725 17133 gene locus_tag LOCUS_17910 gene zwf 18725 17133 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_17910 19191 18781 gene locus_tag LOCUS_17920 19191 18781 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_17920 20084 20159 gene locus_tag LOCUS_t00300 20084 20159 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20464 21756 gene locus_tag LOCUS_17930 20464 21756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 22394 21795 gene locus_tag LOCUS_17940 22394 21795 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867614.1 protein_id gnl|my_center|LOCUS_17940 23535 22525 gene locus_tag LOCUS_17950 23535 22525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 23671 23746 gene locus_tag LOCUS_t00310 23671 23746 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 24752 23805 gene locus_tag LOCUS_17960 24752 23805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 25384 24773 gene locus_tag LOCUS_17970 gene ribE 25384 24773 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015638.1 protein_id gnl|my_center|LOCUS_17970 25462 28431 gene locus_tag LOCUS_17980 gene leuS 25462 28431 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976232.1 protein_id gnl|my_center|LOCUS_17980 28484 29539 gene locus_tag LOCUS_17990 gene mutY 28484 29539 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888913.1 protein_id gnl|my_center|LOCUS_17990 29624 30172 gene locus_tag LOCUS_18000 gene msrA 29624 30172 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_18000 30226 30537 gene locus_tag LOCUS_18010 30226 30537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 31555 30629 gene locus_tag LOCUS_18020 31555 30629 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404319.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence041 498 965 gene locus_tag LOCUS_18030 498 965 CDS product DUF456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943276.1 protein_id gnl|my_center|LOCUS_18030 981 1655 gene locus_tag LOCUS_18040 981 1655 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812379.1 protein_id gnl|my_center|LOCUS_18040 1674 2492 gene locus_tag LOCUS_18050 1674 2492 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390203.1 protein_id gnl|my_center|LOCUS_18050 2563 3951 gene locus_tag LOCUS_18060 2563 3951 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227990.1 protein_id gnl|my_center|LOCUS_18060 3964 4161 gene locus_tag LOCUS_18070 3964 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 5308 4205 gene locus_tag LOCUS_18080 5308 4205 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_18080 8720 5313 gene locus_tag LOCUS_18090 8720 5313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 9634 8846 gene locus_tag LOCUS_18100 gene rnc 9634 8846 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460498.1 protein_id gnl|my_center|LOCUS_18100 11529 9631 gene locus_tag LOCUS_18110 gene mrdA 11529 9631 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_18110 12204 11674 gene locus_tag LOCUS_18120 12204 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 13028 12201 gene locus_tag LOCUS_18130 13028 12201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 14090 13056 gene locus_tag LOCUS_18140 14090 13056 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_18140 14840 14538 gene locus_tag LOCUS_18150 14840 14538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 15301 14933 gene locus_tag LOCUS_18160 15301 14933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 17033 15303 gene locus_tag LOCUS_18170 17033 15303 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883393.1 protein_id gnl|my_center|LOCUS_18170 18897 17044 gene locus_tag LOCUS_18180 gene dnaG 18897 17044 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_18180 19275 20303 gene locus_tag LOCUS_18190 19275 20303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 20424 20804 gene locus_tag LOCUS_18200 20424 20804 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389430.1 protein_id gnl|my_center|LOCUS_18200 20853 22238 gene locus_tag LOCUS_18210 20853 22238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 22350 23402 gene locus_tag LOCUS_18220 22350 23402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 23561 25006 gene locus_tag LOCUS_18230 gene mpl 23561 25006 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770120.1 protein_id gnl|my_center|LOCUS_18230 26441 25044 gene locus_tag LOCUS_18240 26441 25044 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118525.1 protein_id gnl|my_center|LOCUS_18240 28130 26544 gene locus_tag LOCUS_18250 28130 26544 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_18250 28631 28188 gene locus_tag LOCUS_18260 28631 28188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 29563 28838 gene locus_tag LOCUS_18270 29563 28838 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946126.1 protein_id gnl|my_center|LOCUS_18270 31384 30146 gene locus_tag LOCUS_18280 31384 30146 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence042 1730 741 gene locus_tag LOCUS_18290 1730 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 1833 1988 gene locus_tag LOCUS_18300 1833 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 1970 5755 gene locus_tag LOCUS_18310 1970 5755 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922114.1 protein_id gnl|my_center|LOCUS_18310 5724 6395 gene locus_tag LOCUS_18320 5724 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 7785 6418 gene locus_tag LOCUS_18330 7785 6418 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229519.1 protein_id gnl|my_center|LOCUS_18330 9188 7782 gene locus_tag LOCUS_18340 9188 7782 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393791.1 protein_id gnl|my_center|LOCUS_18340 9584 12946 gene locus_tag LOCUS_18350 9584 12946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 14202 13012 gene locus_tag LOCUS_18360 14202 13012 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037373.1 protein_id gnl|my_center|LOCUS_18360 14357 14433 gene locus_tag LOCUS_t00320 14357 14433 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17053 14513 gene locus_tag LOCUS_18370 gene mutS 17053 14513 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404353.1 protein_id gnl|my_center|LOCUS_18370 17225 18025 gene locus_tag LOCUS_18380 17225 18025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 18876 18202 gene locus_tag LOCUS_18390 18876 18202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 20581 19121 gene locus_tag LOCUS_18400 20581 19121 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_18400 22057 20585 gene locus_tag LOCUS_18410 22057 20585 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943547.1 protein_id gnl|my_center|LOCUS_18410 22550 25153 gene locus_tag LOCUS_18420 gene clpB 22550 25153 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365367.1 protein_id gnl|my_center|LOCUS_18420 25254 26951 gene locus_tag LOCUS_18430 gene cysI 25254 26951 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243849.1 protein_id gnl|my_center|LOCUS_18430 27166 28992 gene locus_tag LOCUS_18440 27166 28992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 29672 29031 gene locus_tag LOCUS_18450 29672 29031 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_18450 31369 30056 gene locus_tag LOCUS_18460 31369 30056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence043 1247 222 gene locus_tag LOCUS_18470 1247 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 4834 1244 gene locus_tag LOCUS_18480 4834 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 8302 4844 gene locus_tag LOCUS_18490 8302 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 9960 8350 gene locus_tag LOCUS_18500 9960 8350 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393354.1 protein_id gnl|my_center|LOCUS_18500 11087 9990 gene locus_tag LOCUS_18510 11087 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 12761 11304 gene locus_tag LOCUS_18520 gene glgA 12761 11304 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393434.1 protein_id gnl|my_center|LOCUS_18520 13486 14247 gene locus_tag LOCUS_18530 13486 14247 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_18530 15328 14252 gene locus_tag LOCUS_18540 15328 14252 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719999.1 protein_id gnl|my_center|LOCUS_18540 16006 15479 gene locus_tag LOCUS_18550 16006 15479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 17952 16165 gene locus_tag LOCUS_18560 17952 16165 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968009.1 protein_id gnl|my_center|LOCUS_18560 18234 18404 gene locus_tag LOCUS_18570 gene rpmG 18234 18404 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933041.1 protein_id gnl|my_center|LOCUS_18570 18668 18474 gene locus_tag LOCUS_18580 18668 18474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 19962 18901 gene locus_tag LOCUS_18590 19962 18901 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528006.1 protein_id gnl|my_center|LOCUS_18590 21470 20118 gene locus_tag LOCUS_18600 21470 20118 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259174.1 protein_id gnl|my_center|LOCUS_18600 22079 21483 gene locus_tag LOCUS_18610 22079 21483 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887842.1 protein_id gnl|my_center|LOCUS_18610 22541 24442 gene locus_tag LOCUS_18620 22541 24442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 24460 26568 gene locus_tag LOCUS_18630 24460 26568 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_18630 26571 27599 gene locus_tag LOCUS_18640 26571 27599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 28692 27700 gene locus_tag LOCUS_18650 28692 27700 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_18650 29332 28805 gene locus_tag LOCUS_18660 29332 28805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 <31312 29487 gene locus_tag LOCUS_18670 <31312 29487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112435.1:cation-transporting P-type ATPase >Feature sequence044 1251 544 gene locus_tag LOCUS_18680 1251 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 4360 1259 gene locus_tag LOCUS_18690 4360 1259 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_18690 5754 4357 gene locus_tag LOCUS_18700 5754 4357 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120479.1 protein_id gnl|my_center|LOCUS_18700 6368 5751 gene locus_tag LOCUS_18710 gene slmA 6368 5751 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417043.1 protein_id gnl|my_center|LOCUS_18710 7007 6489 gene locus_tag LOCUS_18720 7007 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 7725 7270 gene locus_tag LOCUS_18730 7725 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 8788 7727 gene locus_tag LOCUS_18740 8788 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 8922 9662 gene locus_tag LOCUS_18750 8922 9662 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931967.1 protein_id gnl|my_center|LOCUS_18750 9802 10068 gene locus_tag LOCUS_18760 9802 10068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 10161 10586 gene locus_tag LOCUS_18770 10161 10586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 11089 10658 gene locus_tag LOCUS_18780 11089 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 11654 11262 gene locus_tag LOCUS_18790 11654 11262 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444234.1 protein_id gnl|my_center|LOCUS_18790 12281 12120 gene locus_tag LOCUS_18800 12281 12120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 12615 12433 gene locus_tag LOCUS_18810 12615 12433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 12992 13438 gene locus_tag LOCUS_18820 12992 13438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 14082 13882 gene locus_tag LOCUS_18830 14082 13882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 14323 13979 gene locus_tag LOCUS_18840 14323 13979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 15398 14544 gene locus_tag LOCUS_18850 gene pstB 15398 14544 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352282.1 protein_id gnl|my_center|LOCUS_18850 16236 15385 gene locus_tag LOCUS_18860 16236 15385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18860 17177 16233 gene locus_tag LOCUS_18870 17177 16233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18870 18031 17174 gene locus_tag LOCUS_18880 18031 17174 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031203.1 protein_id gnl|my_center|LOCUS_18880 18509 18057 gene locus_tag LOCUS_18890 18509 18057 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_18890 18772 18509 gene locus_tag LOCUS_18900 18772 18509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 18931 19161 gene locus_tag LOCUS_18910 18931 19161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 19148 19570 gene locus_tag LOCUS_18920 19148 19570 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653660.1 protein_id gnl|my_center|LOCUS_18920 19611 20828 gene locus_tag LOCUS_18930 19611 20828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 21198 20875 gene locus_tag LOCUS_18940 21198 20875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 21544 21296 gene locus_tag LOCUS_18950 21544 21296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 22295 21798 gene locus_tag LOCUS_18960 22295 21798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 23824 22637 gene locus_tag LOCUS_18970 23824 22637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 24147 24380 gene locus_tag LOCUS_18980 24147 24380 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244189.1 protein_id gnl|my_center|LOCUS_18980 24380 24781 gene locus_tag LOCUS_18990 24380 24781 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972683.1 protein_id gnl|my_center|LOCUS_18990 25404 24991 gene locus_tag LOCUS_19000 25404 24991 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037032.1 protein_id gnl|my_center|LOCUS_19000 25621 25388 gene locus_tag LOCUS_19010 25621 25388 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037031.1 protein_id gnl|my_center|LOCUS_19010 26002 26556 gene locus_tag LOCUS_19020 26002 26556 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 protein_id gnl|my_center|LOCUS_19020 30317 27030 gene locus_tag LOCUS_19030 30317 27030 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162445741.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence045 192 1958 gene locus_tag LOCUS_19040 gene polX 192 1958 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_19040 2531 2677 gene locus_tag LOCUS_19050 2531 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 3218 2775 gene locus_tag LOCUS_19060 3218 2775 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195485.1 protein_id gnl|my_center|LOCUS_19060 4775 3306 gene locus_tag LOCUS_19070 gene nuoN 4775 3306 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705656.1 protein_id gnl|my_center|LOCUS_19070 6457 4772 gene locus_tag LOCUS_19080 gene nuoM 6457 4772 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210269.1 protein_id gnl|my_center|LOCUS_19080 8346 6454 gene locus_tag LOCUS_19090 gene nuoL 8346 6454 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246027.1 protein_id gnl|my_center|LOCUS_19090 8659 8351 gene locus_tag LOCUS_19100 gene nuoK 8659 8351 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090475.1 protein_id gnl|my_center|LOCUS_19100 9231 8659 gene locus_tag LOCUS_19110 gene nuoJ 9231 8659 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365591.1 protein_id gnl|my_center|LOCUS_19110 9748 9236 gene locus_tag LOCUS_19120 gene nuoI 9748 9236 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210273.1 protein_id gnl|my_center|LOCUS_19120 10770 9814 gene locus_tag LOCUS_19130 gene nuoH 10770 9814 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705661.1 protein_id gnl|my_center|LOCUS_19130 13487 10767 gene locus_tag LOCUS_19140 gene nuoG 13487 10767 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246028.1 protein_id gnl|my_center|LOCUS_19140 14813 13518 gene locus_tag LOCUS_19150 gene nuoF 14813 13518 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365587.1 protein_id gnl|my_center|LOCUS_19150 15283 14819 gene locus_tag LOCUS_19160 gene nuoE 15283 14819 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371730.1 protein_id gnl|my_center|LOCUS_19160 17308 15509 gene locus_tag LOCUS_19170 gene nuoC 17308 15509 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090458.1 protein_id gnl|my_center|LOCUS_19170 18016 17387 gene locus_tag LOCUS_19180 18016 17387 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405105.1 protein_id gnl|my_center|LOCUS_19180 18447 18013 gene locus_tag LOCUS_19190 18447 18013 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090452.1 protein_id gnl|my_center|LOCUS_19190 18588 18821 gene locus_tag LOCUS_19200 18588 18821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 18831 19823 gene locus_tag LOCUS_19210 18831 19823 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893529.1 protein_id gnl|my_center|LOCUS_19210 22014 20041 gene locus_tag LOCUS_19220 gene asnB 22014 20041 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124141.1 protein_id gnl|my_center|LOCUS_19220 23194 22070 gene locus_tag LOCUS_19230 23194 22070 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329097.1 protein_id gnl|my_center|LOCUS_19230 23484 23359 gene locus_tag LOCUS_19240 23484 23359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 24947 23481 gene locus_tag LOCUS_19250 24947 23481 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124139.1 protein_id gnl|my_center|LOCUS_19250 25534 24944 gene locus_tag LOCUS_19260 25534 24944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 25896 27164 gene locus_tag LOCUS_19270 25896 27164 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922632.1 protein_id gnl|my_center|LOCUS_19270 29127 27262 gene locus_tag LOCUS_19280 29127 27262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 29933 29181 gene locus_tag LOCUS_19290 29933 29181 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence046 1632 688 gene locus_tag LOCUS_19300 1632 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2702 1821 gene locus_tag LOCUS_19310 2702 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 3481 2834 gene locus_tag LOCUS_19320 3481 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 3993 3478 gene locus_tag LOCUS_19330 3993 3478 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531188.1 protein_id gnl|my_center|LOCUS_19330 5618 4212 gene locus_tag LOCUS_19340 5618 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 9651 5680 gene locus_tag LOCUS_19350 9651 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 9681 10697 gene locus_tag LOCUS_19360 9681 10697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 11770 10586 gene locus_tag LOCUS_19370 11770 10586 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941553.1 protein_id gnl|my_center|LOCUS_19370 12548 12006 gene locus_tag LOCUS_19380 12548 12006 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269179.1 protein_id gnl|my_center|LOCUS_19380 13465 12650 gene locus_tag LOCUS_19390 13465 12650 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_19390 14515 13610 gene locus_tag LOCUS_19400 14515 13610 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_19400 15570 14530 gene locus_tag LOCUS_19410 15570 14530 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880981.1 protein_id gnl|my_center|LOCUS_19410 16558 15581 gene locus_tag LOCUS_19420 16558 15581 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081376.1 protein_id gnl|my_center|LOCUS_19420 18347 16560 gene locus_tag LOCUS_19430 18347 16560 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_19430 18533 19510 gene locus_tag LOCUS_19440 18533 19510 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267627.1 protein_id gnl|my_center|LOCUS_19440 19696 20436 gene locus_tag LOCUS_19450 19696 20436 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 protein_id gnl|my_center|LOCUS_19450 20440 21270 gene locus_tag LOCUS_19460 20440 21270 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257864.1 protein_id gnl|my_center|LOCUS_19460 21320 22468 gene locus_tag LOCUS_19470 21320 22468 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257518.1 protein_id gnl|my_center|LOCUS_19470 23046 22594 gene locus_tag LOCUS_19480 23046 22594 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111846.1 protein_id gnl|my_center|LOCUS_19480 23717 23112 gene locus_tag LOCUS_19490 23717 23112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 24043 23735 gene locus_tag LOCUS_19500 24043 23735 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807389.1 protein_id gnl|my_center|LOCUS_19500 24313 26163 gene locus_tag LOCUS_19510 24313 26163 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939265.1 protein_id gnl|my_center|LOCUS_19510 27102 26365 gene locus_tag LOCUS_19520 gene pgl 27102 26365 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_19520 27934 27329 gene locus_tag LOCUS_19530 gene metW 27934 27329 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391015.1 protein_id gnl|my_center|LOCUS_19530 29082 27937 gene locus_tag LOCUS_19540 29082 27937 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 protein_id gnl|my_center|LOCUS_19540 29868 29119 gene locus_tag LOCUS_19550 29868 29119 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583963.1 protein_id gnl|my_center|LOCUS_19550 30135 29872 gene locus_tag LOCUS_19560 30135 29872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 >Feature sequence047 346 2163 gene locus_tag LOCUS_19570 gene thrS 346 2163 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228977.1 protein_id gnl|my_center|LOCUS_19570 2997 2509 gene locus_tag LOCUS_19580 2997 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 3621 3139 gene locus_tag LOCUS_19590 3621 3139 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457571.1 protein_id gnl|my_center|LOCUS_19590 3701 4051 gene locus_tag LOCUS_19600 3701 4051 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056015.1 protein_id gnl|my_center|LOCUS_19600 4161 5060 gene locus_tag LOCUS_19610 gene argB 4161 5060 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335411.1 protein_id gnl|my_center|LOCUS_19610 5067 6275 gene locus_tag LOCUS_19620 5067 6275 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_19620 6309 7028 gene locus_tag LOCUS_19630 6309 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 7304 8011 gene locus_tag LOCUS_19640 7304 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 8921 8064 gene locus_tag LOCUS_19650 8921 8064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 9219 10097 gene locus_tag LOCUS_19660 9219 10097 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030985.1 protein_id gnl|my_center|LOCUS_19660 10178 11776 gene locus_tag LOCUS_19670 10178 11776 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615419.1 protein_id gnl|my_center|LOCUS_19670 11906 12079 gene locus_tag LOCUS_19680 11906 12079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 12605 12066 gene locus_tag LOCUS_19690 12605 12066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 13452 12838 gene locus_tag LOCUS_19700 13452 12838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 14600 13449 gene locus_tag LOCUS_19710 14600 13449 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530160.1 protein_id gnl|my_center|LOCUS_19710 15248 14709 gene locus_tag LOCUS_19720 15248 14709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 16991 15270 gene locus_tag LOCUS_19730 16991 15270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 18487 16991 gene locus_tag LOCUS_19740 18487 16991 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967807.1 protein_id gnl|my_center|LOCUS_19740 20004 18484 gene locus_tag LOCUS_19750 20004 18484 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090055.1 protein_id gnl|my_center|LOCUS_19750 20315 20001 gene locus_tag LOCUS_19760 20315 20001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 21358 20312 gene locus_tag LOCUS_19770 21358 20312 CDS product MnhB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090053.1 protein_id gnl|my_center|LOCUS_19770 21666 21355 gene locus_tag LOCUS_19780 21666 21355 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090052.1 protein_id gnl|my_center|LOCUS_19780 21944 21663 gene locus_tag LOCUS_19790 21944 21663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 22627 22046 gene locus_tag LOCUS_19800 22627 22046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 23015 23944 gene locus_tag LOCUS_19810 23015 23944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 24095 24910 gene locus_tag LOCUS_19820 24095 24910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 25249 25055 gene locus_tag LOCUS_19830 25249 25055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 26579 25659 gene locus_tag LOCUS_19840 26579 25659 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_19840 27355 26600 gene locus_tag LOCUS_19850 27355 26600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 27354 27524 gene locus_tag LOCUS_19860 27354 27524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 27549 28133 gene locus_tag LOCUS_19870 27549 28133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 28187 28423 gene locus_tag LOCUS_19880 28187 28423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 28414 29022 gene locus_tag LOCUS_19890 28414 29022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence048 536 1225 gene locus_tag LOCUS_19900 536 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2029 1250 gene locus_tag LOCUS_19910 2029 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2363 2776 gene locus_tag LOCUS_19920 2363 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 3582 2800 gene locus_tag LOCUS_19930 3582 2800 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_19930 4588 3593 gene locus_tag LOCUS_19940 gene arsS 4588 3593 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_19940 5443 4787 gene locus_tag LOCUS_19950 5443 4787 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071590.1 protein_id gnl|my_center|LOCUS_19950 6669 5920 gene locus_tag LOCUS_19960 6669 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 7205 6666 gene locus_tag LOCUS_19970 7205 6666 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809255.1 protein_id gnl|my_center|LOCUS_19970 7345 8529 gene locus_tag LOCUS_19980 7345 8529 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462412.1 protein_id gnl|my_center|LOCUS_19980 9923 8541 gene locus_tag LOCUS_19990 gene dop 9923 8541 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080108.1 protein_id gnl|my_center|LOCUS_19990 10728 10009 gene locus_tag LOCUS_20000 10728 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 11479 10721 gene locus_tag LOCUS_20010 11479 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 13457 11922 gene locus_tag LOCUS_20020 gene dop 13457 11922 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_20020 15211 13508 gene locus_tag LOCUS_20030 gene arc 15211 13508 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_20030 16576 15275 gene locus_tag LOCUS_20040 16576 15275 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123336.1 protein_id gnl|my_center|LOCUS_20040 18243 16576 gene locus_tag LOCUS_20050 18243 16576 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_20050 18837 18256 gene locus_tag LOCUS_20060 18837 18256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 20975 18843 gene locus_tag LOCUS_20070 20975 18843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 21556 21029 gene locus_tag LOCUS_20080 21556 21029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 22812 21553 gene locus_tag LOCUS_20090 22812 21553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 23816 22809 gene locus_tag LOCUS_20100 23816 22809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 24841 24011 gene locus_tag LOCUS_20110 24841 24011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 25374 24841 gene locus_tag LOCUS_20120 25374 24841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 27158 25560 gene locus_tag LOCUS_20130 27158 25560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence049 1393 1469 gene locus_tag LOCUS_t00330 1393 1469 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2061 1546 gene locus_tag LOCUS_20140 2061 1546 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932028.1 protein_id gnl|my_center|LOCUS_20140 2672 2058 gene locus_tag LOCUS_20150 gene pgsA 2672 2058 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869392.1 protein_id gnl|my_center|LOCUS_20150 2779 3267 gene locus_tag LOCUS_20160 gene coaD 2779 3267 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084466.1 protein_id gnl|my_center|LOCUS_20160 3288 4199 gene locus_tag LOCUS_20170 3288 4199 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943321.1 protein_id gnl|my_center|LOCUS_20170 6090 4306 gene locus_tag LOCUS_20180 6090 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 7003 6137 gene locus_tag LOCUS_20190 7003 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 7944 7000 gene locus_tag LOCUS_20200 7944 7000 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_20200 8115 7954 gene locus_tag LOCUS_20210 8115 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 8711 8115 gene locus_tag LOCUS_20220 8711 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 9203 8724 gene locus_tag LOCUS_20230 9203 8724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 9910 9221 gene locus_tag LOCUS_20240 gene sigM 9910 9221 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029295.1 protein_id gnl|my_center|LOCUS_20240 10792 9932 gene locus_tag LOCUS_20250 10792 9932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 11320 11490 gene locus_tag LOCUS_20260 11320 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 11762 11433 gene locus_tag LOCUS_20270 11762 11433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 12944 12150 gene locus_tag LOCUS_20280 12944 12150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 13812 12973 gene locus_tag LOCUS_20290 13812 12973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 15060 13870 gene locus_tag LOCUS_20300 gene hemW 15060 13870 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_20300 16015 15092 gene locus_tag LOCUS_20310 16015 15092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 17309 16059 gene locus_tag LOCUS_20320 17309 16059 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_20320 17970 17392 gene locus_tag LOCUS_20330 17970 17392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 18053 18328 gene locus_tag LOCUS_20340 18053 18328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 18361 20301 gene locus_tag LOCUS_20350 gene dxs 18361 20301 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_20350 20612 21958 gene locus_tag LOCUS_20360 20612 21958 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226360.1 protein_id gnl|my_center|LOCUS_20360 22169 23074 gene locus_tag LOCUS_20370 22169 23074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 23258 23500 gene locus_tag LOCUS_20380 23258 23500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 23497 23808 gene locus_tag LOCUS_20390 23497 23808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20390 25871 24045 gene locus_tag LOCUS_20400 gene typA 25871 24045 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933091.1 protein_id gnl|my_center|LOCUS_20400 27014 25992 gene locus_tag LOCUS_20410 27014 25992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 27363 27438 gene locus_tag LOCUS_t00340 27363 27438 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence050 77 4 gene locus_tag LOCUS_t00350 77 4 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 484 1137 gene locus_tag LOCUS_20420 484 1137 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_20420 1186 1869 gene locus_tag LOCUS_20430 gene pth 1186 1869 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140541.1 protein_id gnl|my_center|LOCUS_20430 1871 2128 gene locus_tag LOCUS_20440 1871 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 2158 2634 gene locus_tag LOCUS_20450 2158 2634 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339883.1 protein_id gnl|my_center|LOCUS_20450 2656 3147 gene locus_tag LOCUS_20460 gene rplI 2656 3147 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881335.1 protein_id gnl|my_center|LOCUS_20460 3174 4610 gene locus_tag LOCUS_20470 gene dnaB 3174 4610 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938258.1 protein_id gnl|my_center|LOCUS_20470 4672 7014 gene locus_tag LOCUS_20480 gene bamA 4672 7014 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880828.1 protein_id gnl|my_center|LOCUS_20480 7064 7648 gene locus_tag LOCUS_20490 7064 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 7762 8823 gene locus_tag LOCUS_20500 gene lpxD 7762 8823 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055887.1 protein_id gnl|my_center|LOCUS_20500 8837 9784 gene locus_tag LOCUS_20510 8837 9784 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_20510 9823 11346 gene locus_tag LOCUS_20520 9823 11346 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545685.1 protein_id gnl|my_center|LOCUS_20520 11440 12276 gene locus_tag LOCUS_20530 gene gluQRS 11440 12276 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_20530 12506 14137 gene locus_tag LOCUS_20540 12506 14137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 15007 14150 gene locus_tag LOCUS_20550 15007 14150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 15251 16837 gene locus_tag LOCUS_20560 15251 16837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 17238 16852 gene locus_tag LOCUS_20570 17238 16852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 18212 17187 gene locus_tag LOCUS_20580 18212 17187 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_20580 19630 18338 gene locus_tag LOCUS_20590 19630 18338 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880955.1 protein_id gnl|my_center|LOCUS_20590 20807 19938 gene locus_tag LOCUS_20600 20807 19938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 21098 20820 gene locus_tag LOCUS_20610 21098 20820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 20979 22028 gene locus_tag LOCUS_20620 20979 22028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 22386 24158 gene locus_tag LOCUS_20630 22386 24158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 25589 24243 gene locus_tag LOCUS_20640 25589 24243 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313130.1 protein_id gnl|my_center|LOCUS_20640 26216 25629 gene locus_tag LOCUS_20650 26216 25629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 26471 26815 gene locus_tag LOCUS_20660 26471 26815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence051 896 378 gene locus_tag LOCUS_20670 896 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 1266 856 gene locus_tag LOCUS_20680 1266 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 1837 1259 gene locus_tag LOCUS_20690 1837 1259 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133795409.1 protein_id gnl|my_center|LOCUS_20690 2048 1896 gene locus_tag LOCUS_20700 2048 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 3257 2643 gene locus_tag LOCUS_20710 3257 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 3775 4467 gene locus_tag LOCUS_20720 3775 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 5935 4709 gene locus_tag LOCUS_20730 gene argJ 5935 4709 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082329.1 protein_id gnl|my_center|LOCUS_20730 6967 5939 gene locus_tag LOCUS_20740 gene argC 6967 5939 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546077.1 protein_id gnl|my_center|LOCUS_20740 7429 7031 gene locus_tag LOCUS_20750 gene rpsI 7429 7031 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939789.1 protein_id gnl|my_center|LOCUS_20750 7866 7435 gene locus_tag LOCUS_20760 gene rplM 7866 7435 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_20760 8283 8041 gene locus_tag LOCUS_20770 8283 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 8676 9539 gene locus_tag LOCUS_20780 8676 9539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 9631 11145 gene locus_tag LOCUS_20790 9631 11145 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044917.1 protein_id gnl|my_center|LOCUS_20790 12258 11326 gene locus_tag LOCUS_20800 12258 11326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 12627 12788 gene locus_tag LOCUS_20810 12627 12788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 13370 13071 gene locus_tag LOCUS_20820 13370 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 13743 13468 gene locus_tag LOCUS_20830 13743 13468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 13893 14909 gene locus_tag LOCUS_20840 13893 14909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 15529 16014 gene locus_tag LOCUS_20850 15529 16014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 16583 18556 gene locus_tag LOCUS_20860 16583 18556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 18785 20329 gene locus_tag LOCUS_20870 18785 20329 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331455.1 protein_id gnl|my_center|LOCUS_20870 20350 21198 gene locus_tag LOCUS_20880 20350 21198 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_20880 21738 21298 gene locus_tag LOCUS_20890 21738 21298 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036969.1 protein_id gnl|my_center|LOCUS_20890 22192 22371 gene locus_tag LOCUS_20900 22192 22371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 22372 23337 gene locus_tag LOCUS_20910 22372 23337 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119887.1 protein_id gnl|my_center|LOCUS_20910 24022 23468 gene locus_tag LOCUS_20920 24022 23468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 24336 24028 gene locus_tag LOCUS_20930 24336 24028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence052 1364 201 gene locus_tag LOCUS_20940 gene arsB 1364 201 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876533.1 protein_id gnl|my_center|LOCUS_20940 2648 1815 gene locus_tag LOCUS_20950 2648 1815 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_20950 2907 2692 gene locus_tag LOCUS_20960 2907 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 4925 3093 gene locus_tag LOCUS_20970 gene arsA 4925 3093 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122358.1 protein_id gnl|my_center|LOCUS_20970 5238 4939 gene locus_tag LOCUS_20980 5238 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 5766 5335 gene locus_tag LOCUS_20990 5766 5335 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_20990 6170 5784 gene locus_tag LOCUS_21000 6170 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 6326 6817 gene locus_tag LOCUS_21010 6326 6817 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395796.1 protein_id gnl|my_center|LOCUS_21010 7774 6896 gene locus_tag LOCUS_21020 7774 6896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 8081 7875 gene locus_tag LOCUS_21030 8081 7875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 11304 8233 gene locus_tag LOCUS_21040 11304 8233 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_21040 12554 11355 gene locus_tag LOCUS_21050 12554 11355 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_21050 13352 12678 gene locus_tag LOCUS_21060 13352 12678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 13744 13550 gene locus_tag LOCUS_21070 13744 13550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 14276 14698 gene locus_tag LOCUS_21080 gene rnk 14276 14698 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941393.1 protein_id gnl|my_center|LOCUS_21080 15250 14792 gene locus_tag LOCUS_21090 15250 14792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21090 15523 15335 gene locus_tag LOCUS_21100 15523 15335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21100 17097 16237 gene locus_tag LOCUS_21110 17097 16237 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_21110 17939 17484 gene locus_tag LOCUS_21120 17939 17484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 18138 17929 gene locus_tag LOCUS_21130 18138 17929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 18127 18306 gene locus_tag LOCUS_21140 18127 18306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 18307 18759 gene locus_tag LOCUS_21150 18307 18759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21150 18875 21802 gene locus_tag LOCUS_21160 18875 21802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 22106 23092 gene locus_tag LOCUS_21170 22106 23092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 23073 23549 gene locus_tag LOCUS_21180 23073 23549 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_21180 23800 23606 gene locus_tag LOCUS_21190 23800 23606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 >Feature sequence053 3 258 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtatccgcgctcctcggagcgcggccccattgaagc 1134 331 gene locus_tag LOCUS_21200 1134 331 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393736.1 protein_id gnl|my_center|LOCUS_21200 1190 2374 gene locus_tag LOCUS_21210 1190 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 2374 3150 gene locus_tag LOCUS_21220 gene surE 2374 3150 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889023.1 protein_id gnl|my_center|LOCUS_21220 3303 5279 gene locus_tag LOCUS_21230 3303 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 5276 6499 gene locus_tag LOCUS_21240 5276 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 6610 6930 gene locus_tag LOCUS_21250 6610 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 7881 6940 gene locus_tag LOCUS_21260 7881 6940 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140077.1 protein_id gnl|my_center|LOCUS_21260 8402 7959 gene locus_tag LOCUS_21270 8402 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 9731 8466 gene locus_tag LOCUS_21280 9731 8466 CDS product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198176.1 protein_id gnl|my_center|LOCUS_21280 10869 9775 gene locus_tag LOCUS_21290 gene hflC 10869 9775 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_21290 11823 10870 gene locus_tag LOCUS_21300 11823 10870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 13220 11952 gene locus_tag LOCUS_21310 gene purH 13220 11952 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909162.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21310 13502 13242 gene locus_tag LOCUS_21320 13502 13242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21320 13778 14719 gene locus_tag LOCUS_21330 gene nadC 13778 14719 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068020.1 protein_id gnl|my_center|LOCUS_21330 15280 14720 gene locus_tag LOCUS_21340 gene rsmD 15280 14720 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_21340 15742 17205 gene locus_tag LOCUS_21350 15742 17205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942546.1 protein_id gnl|my_center|LOCUS_21350 17209 17967 gene locus_tag LOCUS_21360 17209 17967 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942545.1 protein_id gnl|my_center|LOCUS_21360 18000 18782 gene locus_tag LOCUS_21370 18000 18782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_21370 18779 19777 gene locus_tag LOCUS_21380 18779 19777 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941594.1 protein_id gnl|my_center|LOCUS_21380 19840 22188 gene locus_tag LOCUS_21390 19840 22188 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_21390 23198 22674 gene locus_tag LOCUS_21400 23198 22674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence054 487 2142 gene locus_tag LOCUS_21410 487 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2854 2165 gene locus_tag LOCUS_21420 2854 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 4466 3015 gene locus_tag LOCUS_21430 4466 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 5629 4472 gene locus_tag LOCUS_21440 5629 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 7240 5702 gene locus_tag LOCUS_21450 7240 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 8043 7420 gene locus_tag LOCUS_21460 8043 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 9062 8403 gene locus_tag LOCUS_21470 9062 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 9515 10465 gene locus_tag LOCUS_21480 9515 10465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 11890 10487 gene locus_tag LOCUS_21490 11890 10487 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_21490 12487 12101 gene locus_tag LOCUS_21500 12487 12101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 12746 12480 gene locus_tag LOCUS_21510 12746 12480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 13627 12929 gene locus_tag LOCUS_21520 gene pspA 13627 12929 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081428804.1 protein_id gnl|my_center|LOCUS_21520 13800 14963 gene locus_tag LOCUS_21530 gene pspF 13800 14963 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940248.1 protein_id gnl|my_center|LOCUS_21530 16239 15220 gene locus_tag LOCUS_21540 16239 15220 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658378.1 protein_id gnl|my_center|LOCUS_21540 17190 16294 gene locus_tag LOCUS_21550 17190 16294 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389600.1 protein_id gnl|my_center|LOCUS_21550 18866 17193 gene locus_tag LOCUS_21560 gene leuA 18866 17193 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_21560 19330 19037 gene locus_tag LOCUS_21570 19330 19037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 19439 20080 gene locus_tag LOCUS_21580 19439 20080 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967732.1 protein_id gnl|my_center|LOCUS_21580 20130 21293 gene locus_tag LOCUS_21590 gene ribD 20130 21293 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_21590 21265 21873 gene locus_tag LOCUS_21600 21265 21873 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_21600 22261 22662 gene locus_tag LOCUS_21610 22261 22662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 22637 23215 gene locus_tag LOCUS_21620 22637 23215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 >Feature sequence055 6545 6156 gene locus_tag LOCUS_21630 6545 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 7187 6570 gene locus_tag LOCUS_21640 7187 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 8341 7295 gene locus_tag LOCUS_21650 8341 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 9358 8435 gene locus_tag LOCUS_21660 9358 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 11312 10452 gene locus_tag LOCUS_21670 gene rnz 11312 10452 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080741.1 protein_id gnl|my_center|LOCUS_21670 13330 11315 gene locus_tag LOCUS_21680 13330 11315 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454107.1 protein_id gnl|my_center|LOCUS_21680 13570 13495 gene locus_tag LOCUS_t00360 13570 13495 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14435 13785 gene locus_tag LOCUS_21690 gene nth 14435 13785 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_21690 14518 17457 gene locus_tag LOCUS_21700 gene gcvP 14518 17457 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140250.1 protein_id gnl|my_center|LOCUS_21700 18082 17540 gene locus_tag LOCUS_21710 gene msrB 18082 17540 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327110.1 protein_id gnl|my_center|LOCUS_21710 19580 18450 gene locus_tag LOCUS_21720 19580 18450 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_21720 19815 21014 gene locus_tag LOCUS_21730 19815 21014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 22053 21085 gene locus_tag LOCUS_21740 22053 21085 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066930.1 protein_id gnl|my_center|LOCUS_21740 >Feature sequence056 2841 274 gene locus_tag LOCUS_21750 2841 274 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_21750 3315 2866 gene locus_tag LOCUS_21760 3315 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_21760 3477 3941 gene locus_tag LOCUS_21770 gene perR 3477 3941 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223285.1 protein_id gnl|my_center|LOCUS_21770 4025 5329 gene locus_tag LOCUS_21780 4025 5329 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137848.1 protein_id gnl|my_center|LOCUS_21780 5326 6180 gene locus_tag LOCUS_21790 gene lpxI 5326 6180 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922990.1 protein_id gnl|my_center|LOCUS_21790 6405 7361 gene locus_tag LOCUS_21800 6405 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 18426 7474 gene locus_tag LOCUS_21810 18426 7474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 19137 20285 gene locus_tag LOCUS_21820 19137 20285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence057 867 193 gene locus_tag LOCUS_21830 867 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 1467 877 gene locus_tag LOCUS_21840 1467 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 2224 1670 gene locus_tag LOCUS_21850 2224 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 3267 2266 gene locus_tag LOCUS_21860 3267 2266 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460199.1 protein_id gnl|my_center|LOCUS_21860 4061 3282 gene locus_tag LOCUS_21870 gene panB 4061 3282 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227914.1 protein_id gnl|my_center|LOCUS_21870 5410 4109 gene locus_tag LOCUS_21880 gene lysA 5410 4109 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970101.1 protein_id gnl|my_center|LOCUS_21880 5722 5922 gene locus_tag LOCUS_21890 5722 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 8545 6026 gene locus_tag LOCUS_21900 8545 6026 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798121.1 protein_id gnl|my_center|LOCUS_21900 8814 12548 gene locus_tag LOCUS_21910 8814 12548 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_21910 13140 12604 gene locus_tag LOCUS_21920 13140 12604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 14246 13152 gene locus_tag LOCUS_21930 gene nuoH 14246 13152 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_21930 15982 14276 gene locus_tag LOCUS_21940 15982 14276 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_21940 17420 16053 gene locus_tag LOCUS_21950 gene nuoF 17420 16053 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964317.1 protein_id gnl|my_center|LOCUS_21950 17938 17441 gene locus_tag LOCUS_21960 17938 17441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 19196 17955 gene locus_tag LOCUS_21970 gene nuoD 19196 17955 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_21970 19814 19200 gene locus_tag LOCUS_21980 19814 19200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 20368 19829 gene locus_tag LOCUS_21990 20368 19829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 >Feature sequence058 296 1531 gene locus_tag LOCUS_22000 296 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 1570 3246 gene locus_tag LOCUS_22010 1570 3246 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383518.1 protein_id gnl|my_center|LOCUS_22010 3252 4196 gene locus_tag LOCUS_22020 3252 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776583.1 protein_id gnl|my_center|LOCUS_22020 4305 6323 gene locus_tag LOCUS_22030 4305 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 7651 6620 gene locus_tag LOCUS_22040 7651 6620 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941130.1 protein_id gnl|my_center|LOCUS_22040 8724 7672 gene locus_tag LOCUS_22050 8724 7672 CDS product DUF898 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941131.1 protein_id gnl|my_center|LOCUS_22050 9487 11034 gene locus_tag LOCUS_22060 9487 11034 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106349.1 protein_id gnl|my_center|LOCUS_22060 11007 11240 gene locus_tag LOCUS_22070 11007 11240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 11325 12404 gene locus_tag LOCUS_22080 11325 12404 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009956127.1 protein_id gnl|my_center|LOCUS_22080 12552 12797 gene locus_tag LOCUS_22090 12552 12797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 13182 13655 gene locus_tag LOCUS_22100 13182 13655 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085196.1 protein_id gnl|my_center|LOCUS_22100 14035 15609 gene locus_tag LOCUS_22110 14035 15609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 15593 16570 gene locus_tag LOCUS_22120 15593 16570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 16894 16661 gene locus_tag LOCUS_22130 16894 16661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 17256 16870 gene locus_tag LOCUS_22140 17256 16870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 17533 18960 gene locus_tag LOCUS_22150 17533 18960 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence059 738 1286 gene locus_tag LOCUS_22160 738 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 1693 1379 gene locus_tag LOCUS_22170 1693 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 2499 6005 gene locus_tag LOCUS_22180 2499 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 6763 6335 gene locus_tag LOCUS_22190 6763 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 7286 8986 gene locus_tag LOCUS_22200 7286 8986 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_22200 9100 9819 gene locus_tag LOCUS_22210 9100 9819 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818985.1 protein_id gnl|my_center|LOCUS_22210 12901 10112 gene locus_tag LOCUS_22220 12901 10112 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205537.1 protein_id gnl|my_center|LOCUS_22220 14785 12920 gene locus_tag LOCUS_22230 14785 12920 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539133.1 protein_id gnl|my_center|LOCUS_22230 15418 14795 gene locus_tag LOCUS_22240 15418 14795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 15939 16778 gene locus_tag LOCUS_22250 15939 16778 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 protein_id gnl|my_center|LOCUS_22250 17046 17669 gene locus_tag LOCUS_22260 17046 17669 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_22260 <19999 17666 gene locus_tag LOCUS_22270 <19999 17666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895514.1:error-prone DNA polymerase >Feature sequence060 6292 1043 gene locus_tag LOCUS_22280 6292 1043 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235238.1 protein_id gnl|my_center|LOCUS_22280 7660 6401 gene locus_tag LOCUS_22290 7660 6401 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_22290 9342 8311 gene locus_tag LOCUS_22300 9342 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 9502 9278 gene locus_tag LOCUS_22310 9502 9278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 9667 10200 gene locus_tag LOCUS_22320 9667 10200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 10197 10574 gene locus_tag LOCUS_22330 10197 10574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22330 10581 11120 gene locus_tag LOCUS_22340 10581 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22340 11648 12238 gene locus_tag LOCUS_22350 11648 12238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 12782 12324 gene locus_tag LOCUS_22360 12782 12324 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413460.1 protein_id gnl|my_center|LOCUS_22360 13320 12766 gene locus_tag LOCUS_22370 13320 12766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 13435 15369 gene locus_tag LOCUS_22380 13435 15369 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456651.1 protein_id gnl|my_center|LOCUS_22380 16005 15610 gene locus_tag LOCUS_22390 16005 15610 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_22390 16256 16002 gene locus_tag LOCUS_22400 16256 16002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 16761 16375 gene locus_tag LOCUS_22410 16761 16375 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 protein_id gnl|my_center|LOCUS_22410 16988 16758 gene locus_tag LOCUS_22420 16988 16758 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923260.1 protein_id gnl|my_center|LOCUS_22420 17556 18479 gene locus_tag LOCUS_22430 17556 18479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence061 1382 243 gene locus_tag LOCUS_22440 1382 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2460 1651 gene locus_tag LOCUS_22450 2460 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 3351 2593 gene locus_tag LOCUS_22460 3351 2593 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904152.1 protein_id gnl|my_center|LOCUS_22460 4342 3656 gene locus_tag LOCUS_22470 gene queC 4342 3656 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533307.1 protein_id gnl|my_center|LOCUS_22470 4789 5892 gene locus_tag LOCUS_22480 4789 5892 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_22480 5896 6114 gene locus_tag LOCUS_22490 5896 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 6475 6134 gene locus_tag LOCUS_22500 6475 6134 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_22500 6935 7663 gene locus_tag LOCUS_22510 6935 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 8372 7674 gene locus_tag LOCUS_22520 8372 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 10529 8646 gene locus_tag LOCUS_22530 gene mnmG 10529 8646 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873860.1 protein_id gnl|my_center|LOCUS_22530 10732 10526 gene locus_tag LOCUS_22540 10732 10526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 12095 10740 gene locus_tag LOCUS_22550 gene mnmE 12095 10740 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944074.1 protein_id gnl|my_center|LOCUS_22550 13551 12478 gene locus_tag LOCUS_22560 gene recA 13551 12478 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314063.1 protein_id gnl|my_center|LOCUS_22560 13904 14896 gene locus_tag LOCUS_22570 13904 14896 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940234.1 protein_id gnl|my_center|LOCUS_22570 15453 14914 gene locus_tag LOCUS_22580 15453 14914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 16308 15589 gene locus_tag LOCUS_22590 16308 15589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 16307 16549 gene locus_tag LOCUS_22600 16307 16549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 16610 18448 gene locus_tag LOCUS_22610 16610 18448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence062 2158 56 gene locus_tag LOCUS_22620 2158 56 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_22620 3502 2372 gene locus_tag LOCUS_22630 3502 2372 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 protein_id gnl|my_center|LOCUS_22630 4772 3555 gene locus_tag LOCUS_22640 gene lpxK 4772 3555 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_22640 4935 5366 gene locus_tag LOCUS_22650 4935 5366 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880271.1 protein_id gnl|my_center|LOCUS_22650 5465 7972 gene locus_tag LOCUS_22660 5465 7972 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525850.1 protein_id gnl|my_center|LOCUS_22660 8310 9338 gene locus_tag LOCUS_22670 8310 9338 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_22670 9350 10363 gene locus_tag LOCUS_22680 9350 10363 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270038.1 protein_id gnl|my_center|LOCUS_22680 11143 10370 gene locus_tag LOCUS_22690 gene hisF 11143 10370 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067464.1 protein_id gnl|my_center|LOCUS_22690 12917 11154 gene locus_tag LOCUS_22700 12917 11154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 14261 13116 gene locus_tag LOCUS_22710 gene rho 14261 13116 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311067.1 protein_id gnl|my_center|LOCUS_22710 14833 15402 gene locus_tag LOCUS_22720 14833 15402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 15448 16230 gene locus_tag LOCUS_22730 15448 16230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 16291 17907 gene locus_tag LOCUS_22740 16291 17907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence063 644 60 gene locus_tag LOCUS_22750 644 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275369.1 protein_id gnl|my_center|LOCUS_22750 1008 655 gene locus_tag LOCUS_22760 1008 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 1521 3950 gene locus_tag LOCUS_22770 1521 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 4058 12781 gene locus_tag LOCUS_22780 4058 12781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 12940 13419 gene locus_tag LOCUS_22790 12940 13419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 13307 13669 gene locus_tag LOCUS_22800 13307 13669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 13812 14135 gene locus_tag LOCUS_22810 13812 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 14155 14841 gene locus_tag LOCUS_22820 14155 14841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 15497 14910 gene locus_tag LOCUS_22830 15497 14910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 16708 15542 gene locus_tag LOCUS_22840 16708 15542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 17734 17207 gene locus_tag LOCUS_22850 gene ispF 17734 17207 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence064 78 3 gene locus_tag LOCUS_t00370 78 3 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 433 1347 gene locus_tag LOCUS_22860 gene rpsB 433 1347 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546300.1 protein_id gnl|my_center|LOCUS_22860 1424 1993 gene locus_tag LOCUS_22870 gene tsf 1424 1993 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_22870 2314 2586 gene locus_tag LOCUS_22880 2314 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 2696 4540 gene locus_tag LOCUS_22890 2696 4540 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079894.1 protein_id gnl|my_center|LOCUS_22890 4633 4719 gene locus_tag LOCUS_t00380 4633 4719 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5566 5168 gene locus_tag LOCUS_22900 5566 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 5823 5548 gene locus_tag LOCUS_22910 5823 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 6411 6599 gene locus_tag LOCUS_22920 6411 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 7255 7662 gene locus_tag LOCUS_22930 7255 7662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 7738 8640 gene locus_tag LOCUS_22940 7738 8640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 8690 9103 gene locus_tag LOCUS_22950 8690 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 9328 11214 gene locus_tag LOCUS_22960 9328 11214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 11463 12008 gene locus_tag LOCUS_22970 11463 12008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 12005 12778 gene locus_tag LOCUS_22980 12005 12778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 12775 13164 gene locus_tag LOCUS_22990 12775 13164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 13161 13502 gene locus_tag LOCUS_23000 13161 13502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 13502 15925 gene locus_tag LOCUS_23010 13502 15925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 15922 17556 gene locus_tag LOCUS_23020 15922 17556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence065 1079 312 gene locus_tag LOCUS_23030 1079 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 1653 1066 gene locus_tag LOCUS_23040 gene sigR 1653 1066 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_23040 2854 1805 gene locus_tag LOCUS_23050 gene hemH 2854 1805 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962227.1 protein_id gnl|my_center|LOCUS_23050 3160 4158 gene locus_tag LOCUS_23060 3160 4158 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390310.1 protein_id gnl|my_center|LOCUS_23060 4155 5138 gene locus_tag LOCUS_23070 4155 5138 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722599.1 protein_id gnl|my_center|LOCUS_23070 5943 5563 gene locus_tag LOCUS_23080 5943 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 6593 7621 gene locus_tag LOCUS_23090 6593 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 7841 7590 gene locus_tag LOCUS_23100 7841 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 7892 8758 gene locus_tag LOCUS_23110 7892 8758 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_23110 8961 9043 gene locus_tag LOCUS_t00390 8961 9043 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9260 10033 gene locus_tag LOCUS_23120 9260 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 10513 10241 gene locus_tag LOCUS_23130 10513 10241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 10781 11536 gene locus_tag LOCUS_23140 10781 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 13277 11817 gene locus_tag LOCUS_23150 13277 11817 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405167.1 protein_id gnl|my_center|LOCUS_23150 14436 13504 gene locus_tag LOCUS_23160 14436 13504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 14449 14670 gene locus_tag LOCUS_23170 14449 14670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 14811 15569 gene locus_tag LOCUS_23180 14811 15569 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029015.1 protein_id gnl|my_center|LOCUS_23180 <17519 15862 gene locus_tag LOCUS_23190 <17519 15862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021009.1:catalase/peroxidase HPI >Feature sequence066 864 118 gene locus_tag LOCUS_23200 864 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 1807 890 gene locus_tag LOCUS_23210 1807 890 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965209.1 protein_id gnl|my_center|LOCUS_23210 2352 1984 gene locus_tag LOCUS_23220 2352 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 2520 2598 gene locus_tag LOCUS_t00400 2520 2598 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2696 3133 gene locus_tag LOCUS_23230 2696 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 3146 3763 gene locus_tag LOCUS_23240 3146 3763 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966689.1 protein_id gnl|my_center|LOCUS_23240 4094 5419 gene locus_tag LOCUS_23250 gene gdhA 4094 5419 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 protein_id gnl|my_center|LOCUS_23250 5848 5444 gene locus_tag LOCUS_23260 5848 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 7164 5968 gene locus_tag LOCUS_23270 7164 5968 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968001.1 protein_id gnl|my_center|LOCUS_23270 7491 9257 gene locus_tag LOCUS_23280 7491 9257 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967198.1 protein_id gnl|my_center|LOCUS_23280 9902 10609 gene locus_tag LOCUS_23290 9902 10609 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819982.1 protein_id gnl|my_center|LOCUS_23290 10612 11175 gene locus_tag LOCUS_23300 gene sigR 10612 11175 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_23300 11735 12550 gene locus_tag LOCUS_23310 11735 12550 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_23310 12980 12570 gene locus_tag LOCUS_23320 12980 12570 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_23320 13243 12977 gene locus_tag LOCUS_23330 13243 12977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 15279 13495 gene locus_tag LOCUS_23340 15279 13495 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937349.1 protein_id gnl|my_center|LOCUS_23340 16064 15270 gene locus_tag LOCUS_23350 16064 15270 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_23350 16611 16132 gene locus_tag LOCUS_23360 16611 16132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953879.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence067 46 121 gene locus_tag LOCUS_t00410 46 121 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 423 2771 gene locus_tag LOCUS_23370 423 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 4200 2830 gene locus_tag LOCUS_23380 4200 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 4651 4187 gene locus_tag LOCUS_23390 4651 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 4943 4638 gene locus_tag LOCUS_23400 4943 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 6730 4940 gene locus_tag LOCUS_23410 6730 4940 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938640.1 protein_id gnl|my_center|LOCUS_23410 6869 9010 gene locus_tag LOCUS_23420 gene ppk1 6869 9010 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225804.1 protein_id gnl|my_center|LOCUS_23420 9433 9050 gene locus_tag LOCUS_23430 9433 9050 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_23430 9758 10060 gene locus_tag LOCUS_23440 9758 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 10364 11698 gene locus_tag LOCUS_23450 10364 11698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 11863 13044 gene locus_tag LOCUS_23460 gene rhmD 11863 13044 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297916.1 protein_id gnl|my_center|LOCUS_23460 13075 13821 gene locus_tag LOCUS_23470 13075 13821 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313403.1 protein_id gnl|my_center|LOCUS_23470 14002 15399 gene locus_tag LOCUS_23480 14002 15399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 15393 15962 gene locus_tag LOCUS_23490 15393 15962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 16460 16260 gene locus_tag LOCUS_23500 16460 16260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 16587 16659 gene locus_tag LOCUS_t00420 16587 16659 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence068 352 1365 gene locus_tag LOCUS_23510 352 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 1417 1656 gene locus_tag LOCUS_23520 1417 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2899 1916 gene locus_tag LOCUS_23530 2899 1916 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_23530 3092 3877 gene locus_tag LOCUS_23540 3092 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 3970 5133 gene locus_tag LOCUS_23550 3970 5133 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087110.1 protein_id gnl|my_center|LOCUS_23550 5144 6250 gene locus_tag LOCUS_23560 gene recF 5144 6250 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478831.1 protein_id gnl|my_center|LOCUS_23560 6388 6762 gene locus_tag LOCUS_23570 6388 6762 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942008.1 protein_id gnl|my_center|LOCUS_23570 8020 6773 gene locus_tag LOCUS_23580 gene uxaE 8020 6773 CDS product D-tagaturonate epimerase UxaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081526.1 protein_id gnl|my_center|LOCUS_23580 8275 8577 gene locus_tag LOCUS_23590 8275 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 8580 9734 gene locus_tag LOCUS_23600 8580 9734 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483569.1 protein_id gnl|my_center|LOCUS_23600 9887 10828 gene locus_tag LOCUS_23610 9887 10828 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032609198.1 protein_id gnl|my_center|LOCUS_23610 10818 11051 gene locus_tag LOCUS_23620 10818 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 11174 11449 gene locus_tag LOCUS_23630 11174 11449 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 protein_id gnl|my_center|LOCUS_23630 12419 11529 gene locus_tag LOCUS_23640 12419 11529 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_23640 13322 12516 gene locus_tag LOCUS_23650 13322 12516 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_23650 14340 13423 gene locus_tag LOCUS_23660 14340 13423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 15039 14365 gene locus_tag LOCUS_23670 15039 14365 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_23670 15119 16063 gene locus_tag LOCUS_23680 15119 16063 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence069 650 1804 gene locus_tag LOCUS_23690 650 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 2423 3274 gene locus_tag LOCUS_23700 2423 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 3712 4053 gene locus_tag LOCUS_23710 3712 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 4041 4514 gene locus_tag LOCUS_23720 4041 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 4677 4880 gene locus_tag LOCUS_23730 4677 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 5351 5716 gene locus_tag LOCUS_23740 5351 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 5942 6373 gene locus_tag LOCUS_23750 5942 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 6349 7305 gene locus_tag LOCUS_23760 6349 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 8612 9901 gene locus_tag LOCUS_23770 8612 9901 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_23770 10122 11066 gene locus_tag LOCUS_23780 10122 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 11162 12133 gene locus_tag LOCUS_23790 11162 12133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 12761 14992 gene locus_tag LOCUS_23800 12761 14992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence070 662 129 gene locus_tag LOCUS_23810 662 129 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_23810 662 1687 gene locus_tag LOCUS_23820 662 1687 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940307.1 protein_id gnl|my_center|LOCUS_23820 1762 1837 gene locus_tag LOCUS_t00430 1762 1837 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1851 2321 gene locus_tag LOCUS_23830 gene ilvN 1851 2321 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_23830 2355 3386 gene locus_tag LOCUS_23840 gene ilvC 2355 3386 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880791.1 protein_id gnl|my_center|LOCUS_23840 3442 4299 gene locus_tag LOCUS_23850 gene hemC 3442 4299 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761811.1 protein_id gnl|my_center|LOCUS_23850 4393 5934 gene locus_tag LOCUS_23860 gene cobA 4393 5934 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_23860 5894 6073 gene locus_tag LOCUS_23870 5894 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 6083 7414 gene locus_tag LOCUS_23880 6083 7414 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_23880 7596 8354 gene locus_tag LOCUS_23890 gene lpxA 7596 8354 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_23890 9089 8400 gene locus_tag LOCUS_23900 gene phoU 9089 8400 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938384.1 protein_id gnl|my_center|LOCUS_23900 10281 9100 gene locus_tag LOCUS_23910 10281 9100 CDS product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 protein_id gnl|my_center|LOCUS_23910 11428 10541 gene locus_tag LOCUS_23920 11428 10541 CDS product 5,10-methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731390.1 protein_id gnl|my_center|LOCUS_23920 12823 11696 gene locus_tag LOCUS_23930 gene lptF 12823 11696 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_23930 15017 14595 gene locus_tag LOCUS_23940 15017 14595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence071 912 217 gene locus_tag LOCUS_23950 912 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 1801 1136 gene locus_tag LOCUS_23960 1801 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 3172 1898 gene locus_tag LOCUS_23970 3172 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 3713 4000 gene locus_tag LOCUS_23980 3713 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 5011 4004 gene locus_tag LOCUS_23990 5011 4004 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112591.1 protein_id gnl|my_center|LOCUS_23990 5225 5500 gene locus_tag LOCUS_24000 5225 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 6121 5570 gene locus_tag LOCUS_24010 6121 5570 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820399.1 protein_id gnl|my_center|LOCUS_24010 6239 7387 gene locus_tag LOCUS_24020 6239 7387 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902891.1 protein_id gnl|my_center|LOCUS_24020 7557 8528 gene locus_tag LOCUS_24030 7557 8528 CDS product bifunctional ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940616.1 protein_id gnl|my_center|LOCUS_24030 8525 9088 gene locus_tag LOCUS_24040 8525 9088 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870429.1 protein_id gnl|my_center|LOCUS_24040 9193 10335 gene locus_tag LOCUS_24050 gene alr 9193 10335 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_24050 10505 11704 gene locus_tag LOCUS_24060 gene rhaI 10505 11704 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080416.1 protein_id gnl|my_center|LOCUS_24060 13227 11815 gene locus_tag LOCUS_24070 gene rhaB 13227 11815 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703943.1 protein_id gnl|my_center|LOCUS_24070 14541 13360 gene locus_tag LOCUS_24080 gene lhgO 14541 13360 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839995.1 protein_id gnl|my_center|LOCUS_24080 14431 14724 gene locus_tag LOCUS_24090 14431 14724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence072 253 816 gene locus_tag LOCUS_24100 253 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 813 2063 gene locus_tag LOCUS_24110 gene fabF 813 2063 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460499.1 protein_id gnl|my_center|LOCUS_24110 3368 4270 gene locus_tag LOCUS_24120 3368 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 6982 4463 gene locus_tag LOCUS_24130 6982 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 7187 8404 gene locus_tag LOCUS_24140 7187 8404 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403228.1 protein_id gnl|my_center|LOCUS_24140 8559 9836 gene locus_tag LOCUS_24150 8559 9836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 10871 9864 gene locus_tag LOCUS_24160 gene trpS 10871 9864 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817343.1 protein_id gnl|my_center|LOCUS_24160 12514 10982 gene locus_tag LOCUS_24170 gene rny 12514 10982 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965122.1 protein_id gnl|my_center|LOCUS_24170 12886 14016 gene locus_tag LOCUS_24180 gene rodA 12886 14016 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_24180 >Feature sequence073 1293 145 gene locus_tag LOCUS_24190 1293 145 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_24190 1849 3393 gene locus_tag LOCUS_24200 1849 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 3393 5243 gene locus_tag LOCUS_24210 3393 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 5510 6445 gene locus_tag LOCUS_24220 5510 6445 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_24220 6768 7088 gene locus_tag LOCUS_24230 6768 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 7323 8357 gene locus_tag LOCUS_24240 7323 8357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 8420 9328 gene locus_tag LOCUS_24250 gene galU 8420 9328 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890959.1 protein_id gnl|my_center|LOCUS_24250 9868 10062 gene locus_tag LOCUS_24260 9868 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 10144 10332 gene locus_tag LOCUS_24270 10144 10332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 10375 10977 gene locus_tag LOCUS_24280 10375 10977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 10974 11540 gene locus_tag LOCUS_24290 10974 11540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 11753 11571 gene locus_tag LOCUS_24300 11753 11571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 12486 12271 gene locus_tag LOCUS_24310 12486 12271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 12485 12769 gene locus_tag LOCUS_24320 12485 12769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 13141 13422 gene locus_tag LOCUS_24330 13141 13422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence074 327 49 gene locus_tag LOCUS_24340 327 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 633 418 gene locus_tag LOCUS_24350 633 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 1138 626 gene locus_tag LOCUS_24360 1138 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 1344 2339 gene locus_tag LOCUS_24370 1344 2339 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327063.1 protein_id gnl|my_center|LOCUS_24370 2339 3241 gene locus_tag LOCUS_24380 2339 3241 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922127.1 protein_id gnl|my_center|LOCUS_24380 3282 5321 gene locus_tag LOCUS_24390 3282 5321 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839782.1 protein_id gnl|my_center|LOCUS_24390 5318 8425 gene locus_tag LOCUS_24400 5318 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 8422 10599 gene locus_tag LOCUS_24410 8422 10599 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_24410 10622 12217 gene locus_tag LOCUS_24420 10622 12217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence075 327 596 gene locus_tag LOCUS_24430 327 596 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_24430 776 1042 gene locus_tag LOCUS_24440 776 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 1295 1501 gene locus_tag LOCUS_24450 1295 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 1523 2956 gene locus_tag LOCUS_24460 1523 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 3018 3278 gene locus_tag LOCUS_24470 3018 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 3266 3664 gene locus_tag LOCUS_24480 3266 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 3868 4155 gene locus_tag LOCUS_24490 3868 4155 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116400.1 protein_id gnl|my_center|LOCUS_24490 5265 4198 gene locus_tag LOCUS_24500 5265 4198 CDS product trifunctional transcriptional activator/DNA repair protein Ada/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444602.1 protein_id gnl|my_center|LOCUS_24500 5442 7526 gene locus_tag LOCUS_24510 5442 7526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 7703 8788 gene locus_tag LOCUS_24520 7703 8788 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948100.1 protein_id gnl|my_center|LOCUS_24520 9316 8927 gene locus_tag LOCUS_24530 9316 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 10317 9451 gene locus_tag LOCUS_24540 10317 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 10417 10659 gene locus_tag LOCUS_24550 10417 10659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 10708 11286 gene locus_tag LOCUS_24560 10708 11286 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024324738.1 protein_id gnl|my_center|LOCUS_24560 11593 12153 gene locus_tag LOCUS_24570 11593 12153 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336778.1 protein_id gnl|my_center|LOCUS_24570 12505 12320 gene locus_tag LOCUS_24580 12505 12320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 13218 12808 gene locus_tag LOCUS_24590 13218 12808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence076 <1 1275 gene locus_tag LOCUS_24600 <1 1275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010725350.1:Rne/Rng family ribonuclease 1297 2790 gene locus_tag LOCUS_24610 1297 2790 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103018905.1 protein_id gnl|my_center|LOCUS_24610 2813 4723 gene locus_tag LOCUS_24620 gene htpG 2813 4723 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460040.1 protein_id gnl|my_center|LOCUS_24620 4963 5487 gene locus_tag LOCUS_24630 4963 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 6343 5507 gene locus_tag LOCUS_24640 6343 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 6480 7097 gene locus_tag LOCUS_24650 6480 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 7232 8476 gene locus_tag LOCUS_24660 7232 8476 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_24660 9432 8656 gene locus_tag LOCUS_24670 9432 8656 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112385.1 protein_id gnl|my_center|LOCUS_24670 10825 9512 gene locus_tag LOCUS_24680 10825 9512 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038873.1 protein_id gnl|my_center|LOCUS_24680 11278 10871 gene locus_tag LOCUS_24690 11278 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 11426 11890 gene locus_tag LOCUS_24700 11426 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 13574 12048 gene locus_tag LOCUS_24710 13574 12048 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403783.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence077 1028 162 gene locus_tag LOCUS_24720 1028 162 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_24720 1098 1349 gene locus_tag LOCUS_24730 1098 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 1784 2263 gene locus_tag LOCUS_24740 1784 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 2260 3705 gene locus_tag LOCUS_24750 2260 3705 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_24750 3831 5111 gene locus_tag LOCUS_24760 3831 5111 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940915.1 protein_id gnl|my_center|LOCUS_24760 5108 6247 gene locus_tag LOCUS_24770 5108 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 6247 6987 gene locus_tag LOCUS_24780 6247 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762387.1 protein_id gnl|my_center|LOCUS_24780 6984 8621 gene locus_tag LOCUS_24790 6984 8621 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206815.1 protein_id gnl|my_center|LOCUS_24790 8618 9958 gene locus_tag LOCUS_24800 8618 9958 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940915.1 protein_id gnl|my_center|LOCUS_24800 9955 11286 gene locus_tag LOCUS_24810 9955 11286 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_24810 12014 12463 gene locus_tag LOCUS_24820 12014 12463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 12819 12511 gene locus_tag LOCUS_24830 12819 12511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 13279 12800 gene locus_tag LOCUS_24840 13279 12800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 13555 13295 gene locus_tag LOCUS_24850 13555 13295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 >Feature sequence078 677 72 gene locus_tag LOCUS_24860 677 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24860 1785 1054 gene locus_tag LOCUS_24870 1785 1054 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_24870 1986 1795 gene locus_tag LOCUS_24880 1986 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 2693 2427 gene locus_tag LOCUS_24890 2693 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 2958 2671 gene locus_tag LOCUS_24900 2958 2671 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_24900 4161 3775 gene locus_tag LOCUS_24910 4161 3775 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_24910 4452 4171 gene locus_tag LOCUS_24920 4452 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 4836 4660 gene locus_tag LOCUS_24930 4836 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 5023 5262 gene locus_tag LOCUS_24940 5023 5262 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_24940 5259 5612 gene locus_tag LOCUS_24950 5259 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 6387 6079 gene locus_tag LOCUS_24960 6387 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 6607 6398 gene locus_tag LOCUS_24970 6607 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 7506 6931 gene locus_tag LOCUS_24980 7506 6931 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_24980 8543 7518 gene locus_tag LOCUS_24990 8543 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24990 9935 8835 gene locus_tag LOCUS_25000 gene wbpE 9935 8835 CDS product UDP-2-acetamido-2-deoxy-3-oxo-D-glucuronate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113425.1 protein_id gnl|my_center|LOCUS_25000 11262 9946 gene locus_tag LOCUS_25010 11262 9946 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427766.1 protein_id gnl|my_center|LOCUS_25010 12267 11320 gene locus_tag LOCUS_25020 12267 11320 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932009.1 protein_id gnl|my_center|LOCUS_25020 12638 13348 gene locus_tag LOCUS_25030 12638 13348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 >Feature sequence079 <1 794 gene locus_tag LOCUS_25040 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000365065.1:GTP-binding protein 798 1676 gene locus_tag LOCUS_25050 798 1676 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902772.1 protein_id gnl|my_center|LOCUS_25050 2778 1693 gene locus_tag LOCUS_25060 gene queA 2778 1693 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081288.1 protein_id gnl|my_center|LOCUS_25060 3762 2818 gene locus_tag LOCUS_25070 gene xerD 3762 2818 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_25070 3867 4112 gene locus_tag LOCUS_25080 3867 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 4140 5489 gene locus_tag LOCUS_25090 4140 5489 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039084.1 protein_id gnl|my_center|LOCUS_25090 6610 5492 gene locus_tag LOCUS_25100 gene cfa 6610 5492 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816380.1 protein_id gnl|my_center|LOCUS_25100 7008 6787 gene locus_tag LOCUS_25110 7008 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 7105 7698 gene locus_tag LOCUS_25120 7105 7698 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931044.1 protein_id gnl|my_center|LOCUS_25120 7702 8295 gene locus_tag LOCUS_25130 7702 8295 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404273.1 protein_id gnl|my_center|LOCUS_25130 8842 8312 gene locus_tag LOCUS_25140 8842 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 9861 8959 gene locus_tag LOCUS_25150 gene rsmA 9861 8959 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_25150 10689 9892 gene locus_tag LOCUS_25160 gene trpC 10689 9892 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958041.1 protein_id gnl|my_center|LOCUS_25160 10854 11516 gene locus_tag LOCUS_25170 10854 11516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 11887 12660 gene locus_tag LOCUS_25180 11887 12660 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338637.1 protein_id gnl|my_center|LOCUS_25180 >Feature sequence080 167 92 gene locus_tag LOCUS_t00440 167 92 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 413 988 gene locus_tag LOCUS_25190 413 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 1014 1448 gene locus_tag LOCUS_25200 1014 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 1450 2331 gene locus_tag LOCUS_25210 1450 2331 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_25210 3920 2508 gene locus_tag LOCUS_25220 3920 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 4030 5871 gene locus_tag LOCUS_25230 4030 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 6795 5881 gene locus_tag LOCUS_25240 6795 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 6995 7294 gene locus_tag LOCUS_25250 6995 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 7316 7618 gene locus_tag LOCUS_25260 7316 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 7693 8025 gene locus_tag LOCUS_25270 7693 8025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 8299 10284 gene locus_tag LOCUS_25280 gene betT 8299 10284 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096496.1 protein_id gnl|my_center|LOCUS_25280 10861 10556 gene locus_tag LOCUS_25290 10861 10556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 10998 10858 gene locus_tag LOCUS_25300 10998 10858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 11550 11155 gene locus_tag LOCUS_25310 11550 11155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 11838 11566 gene locus_tag LOCUS_25320 11838 11566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 12728 11985 gene locus_tag LOCUS_25330 12728 11985 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence081 104 463 gene locus_tag LOCUS_25340 104 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 643 570 gene locus_tag LOCUS_t00450 643 570 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2189 1242 gene locus_tag LOCUS_25350 gene cysK 2189 1242 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324150.1 protein_id gnl|my_center|LOCUS_25350 2550 2263 gene locus_tag LOCUS_25360 gene infA 2550 2263 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_25360 2651 3229 gene locus_tag LOCUS_25370 gene tadA 2651 3229 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810985.1 protein_id gnl|my_center|LOCUS_25370 3287 3907 gene locus_tag LOCUS_25380 gene sodA 3287 3907 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_25380 5348 4047 gene locus_tag LOCUS_25390 5348 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 5982 6317 gene locus_tag LOCUS_25400 5982 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 6651 8360 gene locus_tag LOCUS_25410 6651 8360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 8336 9082 gene locus_tag LOCUS_25420 8336 9082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 9221 9400 gene locus_tag LOCUS_25430 9221 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 9416 10201 gene locus_tag LOCUS_25440 9416 10201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 10548 10979 gene locus_tag LOCUS_25450 10548 10979 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854931.1 protein_id gnl|my_center|LOCUS_25450 11052 11273 gene locus_tag LOCUS_25460 11052 11273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 11352 11729 gene locus_tag LOCUS_25470 11352 11729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 12057 11857 gene locus_tag LOCUS_25480 12057 11857 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140566.1 protein_id gnl|my_center|LOCUS_25480 12302 12054 gene locus_tag LOCUS_25490 12302 12054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 12554 12336 gene locus_tag LOCUS_25500 12554 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence082 4681 173 gene locus_tag LOCUS_25510 4681 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 5202 10658 gene locus_tag LOCUS_25520 5202 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 10847 11266 gene locus_tag LOCUS_25530 10847 11266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 <12386 11715 gene locus_tag LOCUS_25540 <12386 11715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812827.1:Rpn family recombination-promoting nuclease/putative transposase >Feature sequence083 593 321 gene locus_tag LOCUS_25550 593 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 499 1977 gene locus_tag LOCUS_25560 499 1977 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689325.1 protein_id gnl|my_center|LOCUS_25560 2601 2407 gene locus_tag LOCUS_25570 2601 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 2649 5111 gene locus_tag LOCUS_25580 2649 5111 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_25580 5609 5439 gene locus_tag LOCUS_25590 5609 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 5627 5896 gene locus_tag LOCUS_25600 5627 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 8076 6865 gene locus_tag LOCUS_25610 gene rlmD 8076 6865 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_25610 8197 9003 gene locus_tag LOCUS_25620 8197 9003 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280345.1 protein_id gnl|my_center|LOCUS_25620 10454 9318 gene locus_tag LOCUS_25630 10454 9318 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_25630 10508 10933 gene locus_tag LOCUS_25640 10508 10933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 <11961 10954 gene locus_tag LOCUS_25650 <11961 10954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001982317.1:MFS transporter >Feature sequence084 1078 257 gene locus_tag LOCUS_25660 1078 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2141 1266 gene locus_tag LOCUS_25670 2141 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 3019 2297 gene locus_tag LOCUS_25680 3019 2297 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_25680 3180 4223 gene locus_tag LOCUS_25690 3180 4223 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 protein_id gnl|my_center|LOCUS_25690 4332 4511 gene locus_tag LOCUS_25700 4332 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 4649 6763 gene locus_tag LOCUS_25710 4649 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 6770 8755 gene locus_tag LOCUS_25720 6770 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 10635 8773 gene locus_tag LOCUS_25730 10635 8773 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933713.1 protein_id gnl|my_center|LOCUS_25730 >Feature sequence085 965 3292 gene locus_tag LOCUS_25740 gene metE 965 3292 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404021.1 protein_id gnl|my_center|LOCUS_25740 3583 5418 gene locus_tag LOCUS_25750 3583 5418 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 protein_id gnl|my_center|LOCUS_25750 5450 6781 gene locus_tag LOCUS_25760 5450 6781 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038851.1 protein_id gnl|my_center|LOCUS_25760 7176 6958 gene locus_tag LOCUS_25770 7176 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 7423 7635 gene locus_tag LOCUS_25780 7423 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 8693 7719 gene locus_tag LOCUS_25790 8693 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 9367 8735 gene locus_tag LOCUS_25800 9367 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 10255 9827 gene locus_tag LOCUS_25810 10255 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence086 161 760 gene locus_tag LOCUS_25820 161 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 825 1622 gene locus_tag LOCUS_25830 gene cysQ 825 1622 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_25830 3991 1649 gene locus_tag LOCUS_25840 3991 1649 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081570352.1 protein_id gnl|my_center|LOCUS_25840 4501 5538 gene locus_tag LOCUS_25850 gene aroB 4501 5538 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174702.1 protein_id gnl|my_center|LOCUS_25850 5545 6171 gene locus_tag LOCUS_25860 5545 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 6241 6858 gene locus_tag LOCUS_25870 6241 6858 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123320.1 protein_id gnl|my_center|LOCUS_25870 7097 7465 gene locus_tag LOCUS_25880 7097 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 7680 8453 gene locus_tag LOCUS_25890 7680 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 8479 9906 gene locus_tag LOCUS_25900 8479 9906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 10230 9982 gene locus_tag LOCUS_25910 10230 9982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 >Feature sequence087 1145 441 gene locus_tag LOCUS_25920 1145 441 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839715.1 protein_id gnl|my_center|LOCUS_25920 2070 1276 gene locus_tag LOCUS_25930 2070 1276 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976046.1 protein_id gnl|my_center|LOCUS_25930 2570 2142 gene locus_tag LOCUS_25940 2570 2142 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704453.1 protein_id gnl|my_center|LOCUS_25940 3553 2603 gene locus_tag LOCUS_25950 3553 2603 CDS product excisionase family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335835.1 protein_id gnl|my_center|LOCUS_25950 3708 4721 gene locus_tag LOCUS_25960 3708 4721 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_25960 4718 6079 gene locus_tag LOCUS_25970 4718 6079 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_25970 6076 6939 gene locus_tag LOCUS_25980 6076 6939 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920453.1 protein_id gnl|my_center|LOCUS_25980 7036 8298 gene locus_tag LOCUS_25990 7036 8298 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266739.1 protein_id gnl|my_center|LOCUS_25990 8295 9119 gene locus_tag LOCUS_26000 8295 9119 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_26000 9112 10284 gene locus_tag LOCUS_26010 9112 10284 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044885.1 protein_id gnl|my_center|LOCUS_26010 >Feature sequence088 114 374 gene locus_tag LOCUS_26020 114 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 355 1254 gene locus_tag LOCUS_26030 355 1254 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_26030 1343 2317 gene locus_tag LOCUS_26040 1343 2317 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071729.1 protein_id gnl|my_center|LOCUS_26040 2447 4765 gene locus_tag LOCUS_26050 2447 4765 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418856.1 protein_id gnl|my_center|LOCUS_26050 4768 6555 gene locus_tag LOCUS_26060 gene pstA 4768 6555 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_26060 6584 7447 gene locus_tag LOCUS_26070 gene pstB 6584 7447 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401255.1 protein_id gnl|my_center|LOCUS_26070 7425 8141 gene locus_tag LOCUS_26080 gene phoU 7425 8141 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_26080 8266 8979 gene locus_tag LOCUS_26090 8266 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 8951 10405 gene locus_tag LOCUS_26100 8951 10405 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187324688.1 protein_id gnl|my_center|LOCUS_26100 >Feature sequence089 626 2713 gene locus_tag LOCUS_26110 626 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 4609 2876 gene locus_tag LOCUS_26120 4609 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 5778 5017 gene locus_tag LOCUS_26130 5778 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 6226 5936 gene locus_tag LOCUS_26140 6226 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 6805 8181 gene locus_tag LOCUS_26150 6805 8181 CDS product IS4-like element IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483772.1 protein_id gnl|my_center|LOCUS_26150 8295 8666 gene locus_tag LOCUS_26160 8295 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 8796 8996 gene locus_tag LOCUS_26170 8796 8996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 9010 9165 gene locus_tag LOCUS_26180 9010 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 9165 9767 gene locus_tag LOCUS_26190 9165 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence090 1479 340 gene locus_tag LOCUS_26200 1479 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 2815 1403 gene locus_tag LOCUS_26210 2815 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26210 3300 2773 gene locus_tag LOCUS_26220 3300 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26220 3636 3310 gene locus_tag LOCUS_26230 3636 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 4211 4032 gene locus_tag LOCUS_26240 4211 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 4272 4745 gene locus_tag LOCUS_26250 4272 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 4931 5137 gene locus_tag LOCUS_26260 4931 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 5200 5376 gene locus_tag LOCUS_26270 5200 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 5388 5954 gene locus_tag LOCUS_26280 5388 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 5987 6130 gene locus_tag LOCUS_26290 5987 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 6266 8680 gene locus_tag LOCUS_26300 6266 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 9464 8856 gene locus_tag LOCUS_26310 9464 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence091 776 1150 gene locus_tag LOCUS_26320 776 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 3038 1242 gene locus_tag LOCUS_26330 3038 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 3366 3566 gene locus_tag LOCUS_26340 3366 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26340 3736 4401 gene locus_tag LOCUS_26350 3736 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 4566 4384 gene locus_tag LOCUS_26360 4566 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 5352 4756 gene locus_tag LOCUS_26370 5352 4756 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948363.1 protein_id gnl|my_center|LOCUS_26370 6301 5339 gene locus_tag LOCUS_26380 6301 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 6687 6355 gene locus_tag LOCUS_26390 6687 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 6959 6684 gene locus_tag LOCUS_26400 6959 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 7157 6963 gene locus_tag LOCUS_26410 7157 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 7643 8818 gene locus_tag LOCUS_26420 7643 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 >Feature sequence092 921 304 gene locus_tag LOCUS_26430 921 304 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393261.1 protein_id gnl|my_center|LOCUS_26430 1123 1341 gene locus_tag LOCUS_26440 1123 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 4472 1548 gene locus_tag LOCUS_26450 4472 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 4861 4664 gene locus_tag LOCUS_26460 4861 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 4831 5301 gene locus_tag LOCUS_26470 4831 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 5360 5788 gene locus_tag LOCUS_26480 5360 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 5781 7103 gene locus_tag LOCUS_26490 5781 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470612.1 protein_id gnl|my_center|LOCUS_26490 7822 7532 gene locus_tag LOCUS_26500 gene cas2 7822 7532 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989044.1 protein_id gnl|my_center|LOCUS_26500 8510 7842 gene locus_tag LOCUS_26510 8510 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26510 8883 8494 gene locus_tag LOCUS_26520 8883 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26520 <9401 8880 gene locus_tag LOCUS_26530 <9401 8880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011176710.1:CRISPR-associated protein Cas4 >Feature sequence093 711 295 gene locus_tag LOCUS_26540 711 295 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_26540 1062 715 gene locus_tag LOCUS_26550 1062 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 1960 1160 gene locus_tag LOCUS_26560 1960 1160 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 protein_id gnl|my_center|LOCUS_26560 6533 2805 gene locus_tag LOCUS_26570 6533 2805 CDS product DUF6079 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870232.1 protein_id gnl|my_center|LOCUS_26570 7018 6530 gene locus_tag LOCUS_26580 gene brxF 7018 6530 CDS product BREX-3 system P-loop-containing protein BrxF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870233.1 protein_id gnl|my_center|LOCUS_26580 7524 7015 gene locus_tag LOCUS_26590 7524 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 7844 8323 gene locus_tag LOCUS_26600 7844 8323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26600 >Feature sequence094 1020 76 gene locus_tag LOCUS_26610 1020 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 2433 1231 gene locus_tag LOCUS_26620 2433 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 2602 2471 gene locus_tag LOCUS_26630 2602 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 2943 4673 gene locus_tag LOCUS_26640 2943 4673 CDS product IS1634-like element ISMac10 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021311.1 protein_id gnl|my_center|LOCUS_26640 6695 4830 gene locus_tag LOCUS_26650 6695 4830 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_26650 8617 6728 gene locus_tag LOCUS_26660 8617 6728 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_26660 >Feature sequence095 702 1907 gene locus_tag LOCUS_26670 702 1907 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921970.1 protein_id gnl|my_center|LOCUS_26670 2544 2002 gene locus_tag LOCUS_26680 2544 2002 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056687.1 protein_id gnl|my_center|LOCUS_26680 3379 2714 gene locus_tag LOCUS_26690 3379 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 4192 3824 gene locus_tag LOCUS_26700 4192 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 4764 4342 gene locus_tag LOCUS_26710 4764 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 5740 5006 gene locus_tag LOCUS_26720 gene ric 5740 5006 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 protein_id gnl|my_center|LOCUS_26720 6597 5854 gene locus_tag LOCUS_26730 6597 5854 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_26730 6832 6563 gene locus_tag LOCUS_26740 6832 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 6956 7372 gene locus_tag LOCUS_26750 6956 7372 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_26750 7715 8071 gene locus_tag LOCUS_26760 7715 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 8068 8376 gene locus_tag LOCUS_26770 8068 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 >Feature sequence096 76 408 gene locus_tag LOCUS_26780 76 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 655 1023 gene locus_tag LOCUS_26790 655 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 1543 1028 gene locus_tag LOCUS_26800 1543 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 2824 2084 gene locus_tag LOCUS_26810 2824 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 3926 2814 gene locus_tag LOCUS_26820 3926 2814 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_26820 5672 3936 gene locus_tag LOCUS_26830 5672 3936 CDS product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113330.1 protein_id gnl|my_center|LOCUS_26830 5671 5877 gene locus_tag LOCUS_26840 5671 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 6817 5870 gene locus_tag LOCUS_26850 6817 5870 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437216.1 protein_id gnl|my_center|LOCUS_26850 7459 6857 gene locus_tag LOCUS_26860 7459 6857 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035754.1 protein_id gnl|my_center|LOCUS_26860 8109 7456 gene locus_tag LOCUS_26870 8109 7456 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760121.1 protein_id gnl|my_center|LOCUS_26870 >Feature sequence097 308 30 gene locus_tag LOCUS_26880 308 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 579 1199 gene locus_tag LOCUS_26890 579 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 1341 2576 gene locus_tag LOCUS_26900 1341 2576 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_26900 2669 3262 gene locus_tag LOCUS_26910 2669 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142945.1 protein_id gnl|my_center|LOCUS_26910 3279 4238 gene locus_tag LOCUS_26920 3279 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 4576 6138 gene locus_tag LOCUS_26930 4576 6138 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_26930 6511 7104 gene locus_tag LOCUS_26940 6511 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 7397 7191 gene locus_tag LOCUS_26950 7397 7191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 7768 7577 gene locus_tag LOCUS_26960 7768 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 8219 7944 gene locus_tag LOCUS_26970 8219 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence098 2747 3115 gene locus_tag LOCUS_26980 2747 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 4813 3368 gene locus_tag LOCUS_26990 4813 3368 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_26990 5489 4890 gene locus_tag LOCUS_27000 5489 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 5754 6653 gene locus_tag LOCUS_27010 5754 6653 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986242.1 protein_id gnl|my_center|LOCUS_27010 6835 6635 gene locus_tag LOCUS_27020 6835 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 8276 6981 gene locus_tag LOCUS_27030 8276 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence099 <1 530 gene locus_tag LOCUS_27040 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947782.1:IS4-like element ISLpn5 family transposase 1515 676 gene locus_tag LOCUS_27050 gene menB 1515 676 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058289.1 protein_id gnl|my_center|LOCUS_27050 3547 1775 gene locus_tag LOCUS_27060 gene menD 3547 1775 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055985.1 protein_id gnl|my_center|LOCUS_27060 5078 3639 gene locus_tag LOCUS_27070 5078 3639 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057055.1 protein_id gnl|my_center|LOCUS_27070 6674 5133 gene locus_tag LOCUS_27080 gene metG 6674 5133 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_27080 >Feature sequence100 649 44 gene locus_tag LOCUS_27090 649 44 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185693707.1 protein_id gnl|my_center|LOCUS_27090 1821 724 gene locus_tag LOCUS_27100 gene purM 1821 724 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_27100 2530 1976 gene locus_tag LOCUS_27110 2530 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 3210 2704 gene locus_tag LOCUS_27120 3210 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 3664 4917 gene locus_tag LOCUS_27130 3664 4917 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706003.1 protein_id gnl|my_center|LOCUS_27130 4977 5540 gene locus_tag LOCUS_27140 4977 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 5537 6796 gene locus_tag LOCUS_27150 gene fabF 5537 6796 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460499.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence101 1664 204 gene locus_tag LOCUS_27160 1664 204 CDS product malate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338924.1 protein_id gnl|my_center|LOCUS_27160 1854 3230 gene locus_tag LOCUS_27170 1854 3230 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_27170 3333 4211 gene locus_tag LOCUS_27180 3333 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 5113 4208 gene locus_tag LOCUS_27190 5113 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 5571 5110 gene locus_tag LOCUS_27200 5571 5110 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_27200 5759 5568 gene locus_tag LOCUS_27210 5759 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 5979 5782 gene locus_tag LOCUS_27220 5979 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 6117 6689 gene locus_tag LOCUS_27230 6117 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 6961 7350 gene locus_tag LOCUS_27240 6961 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 >Feature sequence102 2815 314 gene locus_tag LOCUS_27250 2815 314 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_27250 3606 2836 gene locus_tag LOCUS_27260 3606 2836 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_27260 3605 4330 gene locus_tag LOCUS_27270 3605 4330 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839642.1 protein_id gnl|my_center|LOCUS_27270 4529 5749 gene locus_tag LOCUS_27280 4529 5749 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533642.1 protein_id gnl|my_center|LOCUS_27280 5753 7354 gene locus_tag LOCUS_27290 5753 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 >Feature sequence103 <7339 6369 gene locus_tag LOCUS_27300 <7339 6369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164993978.1:IS66 family transposase >Feature sequence104 109 318 gene locus_tag LOCUS_27310 109 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 1488 529 gene locus_tag LOCUS_27320 1488 529 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039181.1 protein_id gnl|my_center|LOCUS_27320 3505 1565 gene locus_tag LOCUS_27330 3505 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 4358 4032 gene locus_tag LOCUS_27340 4358 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27340 5331 4594 gene locus_tag LOCUS_27350 5331 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 6320 5328 gene locus_tag LOCUS_27360 6320 5328 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_27360 6842 6519 gene locus_tag LOCUS_27370 6842 6519 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933318.1 protein_id gnl|my_center|LOCUS_27370 >Feature sequence105 582 1769 gene locus_tag LOCUS_27380 gene dcm 582 1769 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689650.1 protein_id gnl|my_center|LOCUS_27380 1771 2613 gene locus_tag LOCUS_27390 1771 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 2618 3109 gene locus_tag LOCUS_27400 gene vsr 2618 3109 CDS product DNA mismatch endonuclease Vsr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940109.1 protein_id gnl|my_center|LOCUS_27400 3338 3153 gene locus_tag LOCUS_27410 3338 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 6974 3366 gene locus_tag LOCUS_27420 6974 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 >Feature sequence106 584 1306 gene locus_tag LOCUS_27430 584 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 1360 2280 gene locus_tag LOCUS_27440 1360 2280 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766467.1 protein_id gnl|my_center|LOCUS_27440 3077 2310 gene locus_tag LOCUS_27450 3077 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 3729 3250 gene locus_tag LOCUS_27460 3729 3250 CDS product elongation factor GreAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404212.1 protein_id gnl|my_center|LOCUS_27460 3905 4066 gene locus_tag LOCUS_27470 3905 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 4216 5100 gene locus_tag LOCUS_27480 4216 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 5160 7004 gene locus_tag LOCUS_27490 gene mutL 5160 7004 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_27490 >Feature sequence107 694 897 gene locus_tag LOCUS_27500 694 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 927 1307 gene locus_tag LOCUS_27510 927 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 1365 1925 gene locus_tag LOCUS_27520 1365 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 1932 2717 gene locus_tag LOCUS_27530 1932 2717 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337288.1 protein_id gnl|my_center|LOCUS_27530 2708 4456 gene locus_tag LOCUS_27540 2708 4456 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_27540 5478 4621 gene locus_tag LOCUS_27550 5478 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 6423 5863 gene locus_tag LOCUS_27560 6423 5863 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 protein_id gnl|my_center|LOCUS_27560 >Feature sequence108 <1 885 gene locus_tag LOCUS_27570 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003082250.1:S1 RNA-binding domain-containing protein 980 1246 gene locus_tag LOCUS_27580 980 1246 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144325.1 protein_id gnl|my_center|LOCUS_27580 1243 1668 gene locus_tag LOCUS_27590 1243 1668 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967510.1 protein_id gnl|my_center|LOCUS_27590 3051 1903 gene locus_tag LOCUS_27600 3051 1903 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958509.1 protein_id gnl|my_center|LOCUS_27600 3463 3813 gene locus_tag LOCUS_27610 3463 3813 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482886.1 protein_id gnl|my_center|LOCUS_27610 4243 4064 gene locus_tag LOCUS_27620 4243 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 4326 4700 gene locus_tag LOCUS_27630 4326 4700 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_27630 5023 5232 gene locus_tag LOCUS_27640 5023 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 5217 5516 gene locus_tag LOCUS_27650 5217 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 5551 5808 gene locus_tag LOCUS_27660 5551 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 6065 5853 gene locus_tag LOCUS_27670 6065 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 6524 6207 gene locus_tag LOCUS_27680 6524 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 6447 6770 gene locus_tag LOCUS_27690 6447 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence109 445 1380 gene locus_tag LOCUS_27700 445 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 1380 1988 gene locus_tag LOCUS_27710 1380 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 2167 2754 gene locus_tag LOCUS_27720 2167 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 3539 3114 gene locus_tag LOCUS_27730 3539 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 5004 3760 gene locus_tag LOCUS_27740 5004 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 5811 5119 gene locus_tag LOCUS_27750 5811 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 6424 6248 gene locus_tag LOCUS_27760 6424 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence110 193 894 gene locus_tag LOCUS_27770 193 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 857 1138 gene locus_tag LOCUS_27780 857 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 1376 1780 gene locus_tag LOCUS_27790 1376 1780 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402858.1 protein_id gnl|my_center|LOCUS_27790 2975 2163 gene locus_tag LOCUS_27800 2975 2163 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_27800 3592 2972 gene locus_tag LOCUS_27810 3592 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 3697 3909 gene locus_tag LOCUS_27820 3697 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 3952 5166 gene locus_tag LOCUS_27830 3952 5166 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868579.1 protein_id gnl|my_center|LOCUS_27830 5159 5890 gene locus_tag LOCUS_27840 5159 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 6366 6076 gene locus_tag LOCUS_27850 6366 6076 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099359.1 protein_id gnl|my_center|LOCUS_27850 6698 6363 gene locus_tag LOCUS_27860 6698 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897305.1 protein_id gnl|my_center|LOCUS_27860 >Feature sequence111 651 1157 gene locus_tag LOCUS_27870 651 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 1154 1810 gene locus_tag LOCUS_27880 1154 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 1807 2127 gene locus_tag LOCUS_27890 1807 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 2169 2534 gene locus_tag LOCUS_27900 2169 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 2531 4948 gene locus_tag LOCUS_27910 2531 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 4945 6054 gene locus_tag LOCUS_27920 4945 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 5963 6463 gene locus_tag LOCUS_27930 5963 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 >Feature sequence112 1411 422 gene locus_tag LOCUS_27940 1411 422 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_27940 2724 1729 gene locus_tag LOCUS_27950 2724 1729 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_27950 3074 4702 gene locus_tag LOCUS_27960 3074 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 4841 5620 gene locus_tag LOCUS_27970 gene lpxA 4841 5620 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581103.1 protein_id gnl|my_center|LOCUS_27970 5645 6553 gene locus_tag LOCUS_27980 gene pdxA 5645 6553 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704880.1 protein_id gnl|my_center|LOCUS_27980 >Feature sequence113 760 482 gene locus_tag LOCUS_27990 760 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 978 757 gene locus_tag LOCUS_28000 978 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 1595 1344 gene locus_tag LOCUS_28010 1595 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 1804 1592 gene locus_tag LOCUS_28020 1804 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 2972 1998 gene locus_tag LOCUS_28030 2972 1998 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220240.1 protein_id gnl|my_center|LOCUS_28030 3650 3174 gene locus_tag LOCUS_28040 3650 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 3885 3643 gene locus_tag LOCUS_28050 3885 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 4274 3891 gene locus_tag LOCUS_28060 4274 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 5435 4506 gene locus_tag LOCUS_28070 5435 4506 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_28070 6451 6203 gene locus_tag LOCUS_28080 6451 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 >Feature sequence114 436 230 gene locus_tag LOCUS_28090 436 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 494 1045 gene locus_tag LOCUS_28100 494 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 2044 1130 gene locus_tag LOCUS_28110 2044 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 1940 2482 gene locus_tag LOCUS_28120 1940 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 2769 4523 gene locus_tag LOCUS_28130 2769 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 4520 4909 gene locus_tag LOCUS_28140 4520 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 <6543 5014 gene locus_tag LOCUS_28150 <6543 5014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005170304.1:BsuBI/PstI family type II restriction endonuclease >Feature sequence115 161 2647 gene locus_tag LOCUS_28160 gene pglZ 161 2647 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939302.1 protein_id gnl|my_center|LOCUS_28160 2644 4761 gene locus_tag LOCUS_28170 gene brxL 2644 4761 CDS product BREX system Lon protease-like protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939301.1 protein_id gnl|my_center|LOCUS_28170 4868 5968 gene locus_tag LOCUS_28180 4868 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence116 2656 2297 gene locus_tag LOCUS_28190 2656 2297 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_28190 3972 2818 gene locus_tag LOCUS_28200 3972 2818 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873440.1 protein_id gnl|my_center|LOCUS_28200 4407 4685 gene locus_tag LOCUS_28210 4407 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 5558 5082 gene locus_tag LOCUS_28220 5558 5082 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029031045.1 protein_id gnl|my_center|LOCUS_28220 6317 5631 gene locus_tag LOCUS_28230 6317 5631 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504113.1 protein_id gnl|my_center|LOCUS_28230 >Feature sequence117 503 111 gene locus_tag LOCUS_28240 503 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 861 1016 gene locus_tag LOCUS_28250 861 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 1013 1345 gene locus_tag LOCUS_28260 1013 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 1713 1907 gene locus_tag LOCUS_28270 1713 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 2376 2098 gene locus_tag LOCUS_28280 2376 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 2818 3696 gene locus_tag LOCUS_28290 2818 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 4361 3747 gene locus_tag LOCUS_28300 4361 3747 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_28300 4840 5982 gene locus_tag LOCUS_28310 4840 5982 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615452.1 protein_id gnl|my_center|LOCUS_28310 >Feature sequence118 96 800 gene locus_tag LOCUS_28320 96 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 1595 900 gene locus_tag LOCUS_28330 1595 900 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339011.1 protein_id gnl|my_center|LOCUS_28330 2077 1781 gene locus_tag LOCUS_28340 2077 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259603.1 protein_id gnl|my_center|LOCUS_28340 3298 2144 gene locus_tag LOCUS_28350 3298 2144 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968194.1 protein_id gnl|my_center|LOCUS_28350 3951 3307 gene locus_tag LOCUS_28360 gene vioB 3951 3307 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose acetyltransferase VioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382700.1 protein_id gnl|my_center|LOCUS_28360 4918 4175 gene locus_tag LOCUS_28370 4918 4175 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801362.1 protein_id gnl|my_center|LOCUS_28370 5242 5006 gene locus_tag LOCUS_28380 5242 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 <5926 5232 gene locus_tag LOCUS_28390 <5926 5232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002789842.1:beta-ketoacyl-ACP synthase III >Feature sequence119 842 609 gene locus_tag LOCUS_28400 842 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 1060 5013 gene locus_tag LOCUS_28410 1060 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 >Feature sequence120 <5610 2388 gene locus_tag LOCUS_28420 <5610 2388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069129909.1:GLUG motif-containing protein >Feature sequence121 814 1899 gene locus_tag LOCUS_28430 gene prfA 814 1899 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943725.1 protein_id gnl|my_center|LOCUS_28430 3303 1939 gene locus_tag LOCUS_28440 gene xseA 3303 1939 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705853.1 protein_id gnl|my_center|LOCUS_28440 3302 3529 gene locus_tag LOCUS_28450 3302 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 4411 4028 gene locus_tag LOCUS_28460 4411 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 5567 5175 gene locus_tag LOCUS_28470 5567 5175 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837688.1 protein_id gnl|my_center|LOCUS_28470 >Feature sequence122 504 1985 gene locus_tag LOCUS_28480 504 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 1989 2747 gene locus_tag LOCUS_28490 1989 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 3788 3072 gene locus_tag LOCUS_28500 3788 3072 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838972.1 protein_id gnl|my_center|LOCUS_28500 3915 4175 gene locus_tag LOCUS_28510 3915 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 >Feature sequence123 3684 3890 gene locus_tag LOCUS_28520 3684 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence124 1431 421 gene locus_tag LOCUS_28530 1431 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 3950 1449 gene locus_tag LOCUS_28540 3950 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 4187 4909 gene locus_tag LOCUS_28550 4187 4909 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144228759.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence125 137 862 gene locus_tag LOCUS_28560 137 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 983 2044 gene locus_tag LOCUS_28570 983 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 2176 2820 gene locus_tag LOCUS_28580 2176 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 2886 4712 gene locus_tag LOCUS_28590 2886 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 >Feature sequence126 707 192 gene locus_tag LOCUS_28600 707 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28600 1396 1010 gene locus_tag LOCUS_28610 1396 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 1672 1400 gene locus_tag LOCUS_28620 1672 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 2311 1970 gene locus_tag LOCUS_28630 2311 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28630 2431 3891 gene locus_tag LOCUS_28640 2431 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 4172 5161 gene locus_tag LOCUS_28650 4172 5161 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893529.1 protein_id gnl|my_center|LOCUS_28650 >Feature sequence127 75 1 gene locus_tag LOCUS_t00460 75 1 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 975 289 gene locus_tag LOCUS_28660 975 289 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144228759.1 protein_id gnl|my_center|LOCUS_28660 2167 1433 gene locus_tag LOCUS_28670 2167 1433 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144228759.1 protein_id gnl|my_center|LOCUS_28670 4387 2408 gene locus_tag LOCUS_28680 gene ligA 4387 2408 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_28680 4915 4451 gene locus_tag LOCUS_28690 4915 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 >Feature sequence128 621 193 gene locus_tag LOCUS_28700 621 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 1526 618 gene locus_tag LOCUS_28710 1526 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 4300 2465 gene locus_tag LOCUS_28720 4300 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence129 1515 85 gene locus_tag LOCUS_28730 1515 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 2148 1750 gene locus_tag LOCUS_28740 2148 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 2421 2149 gene locus_tag LOCUS_28750 2421 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 3164 2454 gene locus_tag LOCUS_28760 3164 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 3408 3148 gene locus_tag LOCUS_28770 3408 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 3853 4077 gene locus_tag LOCUS_28780 3853 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 4298 4627 gene locus_tag LOCUS_28790 4298 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 >Feature sequence130 427 74 gene locus_tag LOCUS_28800 427 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 1035 556 gene locus_tag LOCUS_28810 1035 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 2069 1440 gene locus_tag LOCUS_28820 2069 1440 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147798296.1 protein_id gnl|my_center|LOCUS_28820 2653 2862 gene locus_tag LOCUS_28830 2653 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 2847 3146 gene locus_tag LOCUS_28840 2847 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 3243 4076 gene locus_tag LOCUS_28850 3243 4076 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706646.1 protein_id gnl|my_center|LOCUS_28850 4462 4205 gene locus_tag LOCUS_28860 4462 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 4656 4583 gene locus_tag LOCUS_t00470 4656 4583 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence131 1115 210 gene locus_tag LOCUS_28870 1115 210 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_28870 1554 3518 gene locus_tag LOCUS_28880 1554 3518 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 protein_id gnl|my_center|LOCUS_28880 3515 4624 gene locus_tag LOCUS_28890 gene rhuM 3515 4624 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280585.1 protein_id gnl|my_center|LOCUS_28890 >Feature sequence132 54 536 gene locus_tag LOCUS_28900 54 536 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528017.1 protein_id gnl|my_center|LOCUS_28900 727 1788 gene locus_tag LOCUS_28910 727 1788 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919207.1 protein_id gnl|my_center|LOCUS_28910 2778 4004 gene locus_tag LOCUS_28920 2778 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 >Feature sequence133 31 120 gene locus_tag LOCUS_t00480 31 120 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1445 834 gene locus_tag LOCUS_28930 1445 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 2314 2556 gene locus_tag LOCUS_28940 2314 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 2755 3231 gene locus_tag LOCUS_28950 2755 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 3228 3551 gene locus_tag LOCUS_28960 3228 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 3584 4303 gene locus_tag LOCUS_28970 3584 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 >Feature sequence134 <1 1553 gene locus_tag LOCUS_28980 <1 1553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938992.1:HsdR family type I site-specific deoxyribonuclease 1823 2551 gene locus_tag LOCUS_28990 1823 2551 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 protein_id gnl|my_center|LOCUS_28990 3413 2706 gene locus_tag LOCUS_29000 3413 2706 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530032.1 protein_id gnl|my_center|LOCUS_29000 3639 3445 gene locus_tag LOCUS_29010 3639 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 >Feature sequence135 653 357 gene locus_tag LOCUS_29020 653 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 1963 4197 gene locus_tag LOCUS_29030 1963 4197 CDS product GNVR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174309.1 protein_id gnl|my_center|LOCUS_29030 >Feature sequence136 1943 2464 gene locus_tag LOCUS_29040 1943 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 2498 3889 gene locus_tag LOCUS_29050 2498 3889 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887075.1 protein_id gnl|my_center|LOCUS_29050 >Feature sequence137 <1 644 gene locus_tag LOCUS_29060 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_207280509.1:DNA methyltransferase 842 2122 gene locus_tag LOCUS_29070 842 2122 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_29070 2115 2645 gene locus_tag LOCUS_29080 2115 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258560.1 protein_id gnl|my_center|LOCUS_29080 2642 3325 gene locus_tag LOCUS_29090 2642 3325 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964070.1 protein_id gnl|my_center|LOCUS_29090 >Feature sequence138 2468 1485 gene locus_tag LOCUS_29100 2468 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 >Feature sequence139 729 328 gene locus_tag LOCUS_29110 729 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 1146 736 gene locus_tag LOCUS_29120 1146 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 1103 1621 gene locus_tag LOCUS_29130 gene cas4 1103 1621 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930592.1 protein_id gnl|my_center|LOCUS_29130 1697 2743 gene locus_tag LOCUS_29140 gene cas1b 1697 2743 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393228.1 protein_id gnl|my_center|LOCUS_29140 2783 3043 gene locus_tag LOCUS_29150 gene cas2 2783 3043 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496911.1 protein_id gnl|my_center|LOCUS_29150 3189 >3803 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgctatcgaacccaagtggcttggaaac >Feature sequence140 1522 611 gene locus_tag LOCUS_29160 1522 611 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037253110.1 protein_id gnl|my_center|LOCUS_29160 2120 2296 gene locus_tag LOCUS_29170 2120 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence141 296 859 gene locus_tag LOCUS_29180 296 859 CDS product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318810.1 protein_id gnl|my_center|LOCUS_29180 885 1628 gene locus_tag LOCUS_29190 885 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 3145 1976 gene locus_tag LOCUS_29200 3145 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence142 2716 233 gene locus_tag LOCUS_29210 2716 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence143 1512 1820 gene locus_tag LOCUS_29220 1512 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 1820 2236 gene locus_tag LOCUS_29230 1820 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 <3062 2357 gene locus_tag LOCUS_29240 <3062 2357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228075.1:ATP-binding protein >Feature sequence144 244 1518 gene locus_tag LOCUS_29250 244 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 1533 1739 gene locus_tag LOCUS_29260 1533 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 1937 2266 gene locus_tag LOCUS_29270 1937 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 2291 2569 gene locus_tag LOCUS_29280 2291 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 >Feature sequence145 391 1008 gene locus_tag LOCUS_29290 391 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 >Feature sequence146 623 237 gene locus_tag LOCUS_29300 623 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 943 1356 gene locus_tag LOCUS_29310 943 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 2446 1421 gene locus_tag LOCUS_29320 2446 1421 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_29320