>Feature sequence001 355 1116 gene locus_tag LOCUS_00010 355 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1157 3391 gene locus_tag LOCUS_00020 1157 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4601 3741 gene locus_tag LOCUS_00030 4601 3741 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807247.1 protein_id gnl|my_center|LOCUS_00030 4703 5134 gene locus_tag LOCUS_00040 4703 5134 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_00040 5157 5600 gene locus_tag LOCUS_00050 5157 5600 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 protein_id gnl|my_center|LOCUS_00050 5660 6031 gene locus_tag LOCUS_00060 5660 6031 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298602.1 protein_id gnl|my_center|LOCUS_00060 6132 7820 gene locus_tag LOCUS_00070 6132 7820 CDS product bifunctional protein tyrosine phosphatase family protein/NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527135.1 protein_id gnl|my_center|LOCUS_00070 7790 8647 gene locus_tag LOCUS_00080 7790 8647 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102992.1 protein_id gnl|my_center|LOCUS_00080 11816 8781 gene locus_tag LOCUS_00090 11816 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13333 11927 gene locus_tag LOCUS_00100 gene glpK 13333 11927 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669730.1 protein_id gnl|my_center|LOCUS_00100 14895 13306 gene locus_tag LOCUS_00110 14895 13306 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_00110 15650 14892 gene locus_tag LOCUS_00120 15650 14892 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963752.1 protein_id gnl|my_center|LOCUS_00120 16842 15679 gene locus_tag LOCUS_00130 16842 15679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17077 17823 gene locus_tag LOCUS_00140 gene pgeF 17077 17823 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 protein_id gnl|my_center|LOCUS_00140 17895 18692 gene locus_tag LOCUS_00150 17895 18692 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_00150 18740 19156 gene locus_tag LOCUS_00160 18740 19156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20913 19318 gene locus_tag LOCUS_00170 20913 19318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 22364 21534 gene locus_tag LOCUS_00180 22364 21534 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947257.1 protein_id gnl|my_center|LOCUS_00180 24742 22364 gene locus_tag LOCUS_00190 gene ppsA 24742 22364 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098065.1 protein_id gnl|my_center|LOCUS_00190 26286 24928 gene locus_tag LOCUS_00200 26286 24928 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922914.1 protein_id gnl|my_center|LOCUS_00200 26713 27132 gene locus_tag LOCUS_00210 26713 27132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 28552 27203 gene locus_tag LOCUS_00220 28552 27203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 29334 28948 gene locus_tag LOCUS_00230 29334 28948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 30032 29652 gene locus_tag LOCUS_00240 30032 29652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 31126 30302 gene locus_tag LOCUS_00250 gene lgt 31126 30302 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814606.1 protein_id gnl|my_center|LOCUS_00250 31227 32900 gene locus_tag LOCUS_00260 gene ilvD 31227 32900 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056900.1 protein_id gnl|my_center|LOCUS_00260 32915 35011 gene locus_tag LOCUS_00270 32915 35011 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_00270 35033 35353 gene locus_tag LOCUS_00280 gene nirM 35033 35353 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_00280 35451 35867 gene locus_tag LOCUS_00290 35451 35867 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401957.1 protein_id gnl|my_center|LOCUS_00290 37933 36416 gene locus_tag LOCUS_00300 37933 36416 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193193.1 protein_id gnl|my_center|LOCUS_00300 38172 42011 gene locus_tag LOCUS_00310 gene purL 38172 42011 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 protein_id gnl|my_center|LOCUS_00310 42093 43277 gene locus_tag LOCUS_00320 42093 43277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 43376 45337 gene locus_tag LOCUS_00330 43376 45337 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943762.1 protein_id gnl|my_center|LOCUS_00330 45449 45823 gene locus_tag LOCUS_00340 45449 45823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 47137 45839 gene locus_tag LOCUS_00350 47137 45839 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036840.1 protein_id gnl|my_center|LOCUS_00350 47882 47172 gene locus_tag LOCUS_00360 47882 47172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 48498 47887 gene locus_tag LOCUS_00370 48498 47887 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036842.1 protein_id gnl|my_center|LOCUS_00370 49308 48586 gene locus_tag LOCUS_00380 49308 48586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 49915 50697 gene locus_tag LOCUS_00390 49915 50697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 51719 50700 gene locus_tag LOCUS_00400 gene lpxK 51719 50700 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555967.1 protein_id gnl|my_center|LOCUS_00400 51927 52817 gene locus_tag LOCUS_00410 51927 52817 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389591.1 protein_id gnl|my_center|LOCUS_00410 53146 53220 gene locus_tag LOCUS_t00010 53146 53220 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 53331 53404 gene locus_tag LOCUS_t00020 53331 53404 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 53835 55256 gene locus_tag LOCUS_00420 53835 55256 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401293.1 protein_id gnl|my_center|LOCUS_00420 55285 57108 gene locus_tag LOCUS_00430 gene oadA 55285 57108 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105555.1 protein_id gnl|my_center|LOCUS_00430 57665 57225 gene locus_tag LOCUS_00440 57665 57225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 58117 57668 gene locus_tag LOCUS_00450 gene dut 58117 57668 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816756.1 protein_id gnl|my_center|LOCUS_00450 59340 58132 gene locus_tag LOCUS_00460 gene coaBC 59340 58132 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928305.1 protein_id gnl|my_center|LOCUS_00460 59550 60224 gene locus_tag LOCUS_00470 gene radC 59550 60224 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114357.1 protein_id gnl|my_center|LOCUS_00470 60349 60585 gene locus_tag LOCUS_00480 gene rpmB 60349 60585 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186391.1 protein_id gnl|my_center|LOCUS_00480 60633 60788 gene locus_tag LOCUS_00490 gene rpmG 60633 60788 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002922510.1 protein_id gnl|my_center|LOCUS_00490 62062 60866 gene locus_tag LOCUS_00500 62062 60866 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 protein_id gnl|my_center|LOCUS_00500 62975 62523 gene locus_tag LOCUS_00510 gene sixA 62975 62523 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197673.1 protein_id gnl|my_center|LOCUS_00510 63307 63011 gene locus_tag LOCUS_00520 gene yggU 63307 63011 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073225.1 protein_id gnl|my_center|LOCUS_00520 63894 63319 gene locus_tag LOCUS_00530 63894 63319 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194943.1 protein_id gnl|my_center|LOCUS_00530 64770 63958 gene locus_tag LOCUS_00540 gene proC 64770 63958 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522133.1 protein_id gnl|my_center|LOCUS_00540 65670 64840 gene locus_tag LOCUS_00550 gene mutM 65670 64840 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225172.1 protein_id gnl|my_center|LOCUS_00550 66530 65670 gene locus_tag LOCUS_00560 66530 65670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 67896 66538 gene locus_tag LOCUS_00570 67896 66538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 68652 67909 gene locus_tag LOCUS_00580 gene gldF 68652 67909 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_00580 69403 68684 gene locus_tag LOCUS_00590 69403 68684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 69698 70363 gene locus_tag LOCUS_00600 69698 70363 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189892.1 protein_id gnl|my_center|LOCUS_00600 70442 71776 gene locus_tag LOCUS_00610 70442 71776 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957634.1 protein_id gnl|my_center|LOCUS_00610 71798 72505 gene locus_tag LOCUS_00620 gene ubiG 71798 72505 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448326.1 protein_id gnl|my_center|LOCUS_00620 72530 73177 gene locus_tag LOCUS_00630 gene gph 72530 73177 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550108.1 protein_id gnl|my_center|LOCUS_00630 73272 73631 gene locus_tag LOCUS_tm00010 73272 73631 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence002 2064 358 gene locus_tag LOCUS_00640 2064 358 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193654.1 protein_id gnl|my_center|LOCUS_00640 2258 2743 gene locus_tag LOCUS_00650 gene rplM 2258 2743 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 protein_id gnl|my_center|LOCUS_00650 2747 3139 gene locus_tag LOCUS_00660 gene rpsI 2747 3139 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 protein_id gnl|my_center|LOCUS_00660 3237 4265 gene locus_tag LOCUS_00670 gene argC 3237 4265 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767875.1 protein_id gnl|my_center|LOCUS_00670 4711 5193 gene locus_tag LOCUS_00680 4711 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 5204 5668 gene locus_tag LOCUS_00690 5204 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 5727 6071 gene locus_tag LOCUS_00700 gene erpA 5727 6071 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 protein_id gnl|my_center|LOCUS_00700 7210 6110 gene locus_tag LOCUS_00710 7210 6110 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269098.1 protein_id gnl|my_center|LOCUS_00710 8607 7276 gene locus_tag LOCUS_00720 8607 7276 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931221.1 protein_id gnl|my_center|LOCUS_00720 8766 9968 gene locus_tag LOCUS_00730 gene tyrS 8766 9968 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957422.1 protein_id gnl|my_center|LOCUS_00730 10258 11628 gene locus_tag LOCUS_00740 10258 11628 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941159.1 protein_id gnl|my_center|LOCUS_00740 14052 11713 gene locus_tag LOCUS_00750 14052 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_00750 14768 14061 gene locus_tag LOCUS_00760 14768 14061 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_00760 15772 14801 gene locus_tag LOCUS_00770 15772 14801 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061282.1 protein_id gnl|my_center|LOCUS_00770 16364 18388 gene locus_tag LOCUS_00780 16364 18388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 18416 19540 gene locus_tag LOCUS_00790 18416 19540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 19721 21784 gene locus_tag LOCUS_00800 19721 21784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 21826 23100 gene locus_tag LOCUS_00810 21826 23100 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082852.1 protein_id gnl|my_center|LOCUS_00810 23388 23197 gene locus_tag LOCUS_00820 23388 23197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 23521 24258 gene locus_tag LOCUS_00830 23521 24258 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 protein_id gnl|my_center|LOCUS_00830 26748 24754 gene locus_tag LOCUS_00840 26748 24754 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767848.1 protein_id gnl|my_center|LOCUS_00840 26952 27923 gene locus_tag LOCUS_00850 26952 27923 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812034.1 protein_id gnl|my_center|LOCUS_00850 27901 28719 gene locus_tag LOCUS_00860 27901 28719 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325374.1 protein_id gnl|my_center|LOCUS_00860 28719 29534 gene locus_tag LOCUS_00870 28719 29534 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257864.1 protein_id gnl|my_center|LOCUS_00870 29760 31037 gene locus_tag LOCUS_00880 29760 31037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 31401 34718 gene locus_tag LOCUS_00890 gene treS 31401 34718 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389295.1 protein_id gnl|my_center|LOCUS_00890 34884 36719 gene locus_tag LOCUS_00900 gene treZ 34884 36719 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388264.1 protein_id gnl|my_center|LOCUS_00900 36706 41838 gene locus_tag LOCUS_00910 36706 41838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 42883 42005 gene locus_tag LOCUS_00920 gene sucD 42883 42005 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812748.1 protein_id gnl|my_center|LOCUS_00920 44091 42919 gene locus_tag LOCUS_00930 gene sucC 44091 42919 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189251.1 protein_id gnl|my_center|LOCUS_00930 45240 44272 gene locus_tag LOCUS_00940 45240 44272 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105579.1 protein_id gnl|my_center|LOCUS_00940 45556 46617 gene locus_tag LOCUS_00950 45556 46617 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141839.1 protein_id gnl|my_center|LOCUS_00950 46745 48283 gene locus_tag LOCUS_00960 46745 48283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 50151 48478 gene locus_tag LOCUS_00970 50151 48478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 50517 51980 gene locus_tag LOCUS_00980 50517 51980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 52214 52032 gene locus_tag LOCUS_00990 52214 52032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 52217 52486 gene locus_tag LOCUS_01000 gene rpsO 52217 52486 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814002.1 protein_id gnl|my_center|LOCUS_01000 52615 54741 gene locus_tag LOCUS_01010 gene pnp 52615 54741 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526459.1 protein_id gnl|my_center|LOCUS_01010 55264 54839 gene locus_tag LOCUS_01020 gene dksA 55264 54839 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140367.1 protein_id gnl|my_center|LOCUS_01020 55473 55549 gene locus_tag LOCUS_t00030 55473 55549 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 55584 55660 gene locus_tag LOCUS_t00040 55584 55660 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 55736 55811 gene locus_tag LOCUS_t00050 55736 55811 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 55957 58887 gene locus_tag LOCUS_01030 gene acn 55957 58887 CDS product iron-regulated aconitate hydratase Acn inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898889.1 protein_id gnl|my_center|LOCUS_01030 59891 59016 gene locus_tag LOCUS_01040 gene galU 59891 59016 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_01040 61002 59968 gene locus_tag LOCUS_01050 gene galE 61002 59968 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071815.1 protein_id gnl|my_center|LOCUS_01050 62042 61083 gene locus_tag LOCUS_01060 62042 61083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_01060 64004 62094 gene locus_tag LOCUS_01070 gene cysN 64004 62094 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 protein_id gnl|my_center|LOCUS_01070 64900 64004 gene locus_tag LOCUS_01080 gene cysD 64900 64004 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175227789.1 protein_id gnl|my_center|LOCUS_01080 66146 65844 gene locus_tag LOCUS_01090 66146 65844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 66798 66430 gene locus_tag LOCUS_01100 66798 66430 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813393.1 protein_id gnl|my_center|LOCUS_01100 67308 67099 gene locus_tag LOCUS_01110 67308 67099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 >Feature sequence003 340 152 gene locus_tag LOCUS_01120 340 152 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186709.1 protein_id gnl|my_center|LOCUS_01120 393 1229 gene locus_tag LOCUS_01130 393 1229 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_01130 1233 1874 gene locus_tag LOCUS_01140 gene thiE 1233 1874 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368782.1 protein_id gnl|my_center|LOCUS_01140 1904 3184 gene locus_tag LOCUS_01150 gene hemL 1904 3184 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_01150 3933 3265 gene locus_tag LOCUS_01160 3933 3265 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_01160 4098 4673 gene locus_tag LOCUS_01170 4098 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 4755 5561 gene locus_tag LOCUS_01180 gene map 4755 5561 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193235.1 protein_id gnl|my_center|LOCUS_01180 5592 6329 gene locus_tag LOCUS_01190 gene rph 5592 6329 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_01190 6280 6924 gene locus_tag LOCUS_01200 gene rdgB 6280 6924 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222823.1 protein_id gnl|my_center|LOCUS_01200 8157 7030 gene locus_tag LOCUS_01210 8157 7030 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162517810.1 protein_id gnl|my_center|LOCUS_01210 8492 10222 gene locus_tag LOCUS_01220 8492 10222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 10212 10535 gene locus_tag LOCUS_01230 10212 10535 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192342.1 protein_id gnl|my_center|LOCUS_01230 11585 10593 gene locus_tag LOCUS_01240 11585 10593 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_01240 12659 11589 gene locus_tag LOCUS_01250 12659 11589 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144046.1 protein_id gnl|my_center|LOCUS_01250 13982 12729 gene locus_tag LOCUS_01260 gene lysA 13982 12729 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114343.1 protein_id gnl|my_center|LOCUS_01260 14829 14203 gene locus_tag LOCUS_01270 14829 14203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 15725 14826 gene locus_tag LOCUS_01280 15725 14826 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807132.1 protein_id gnl|my_center|LOCUS_01280 16486 15698 gene locus_tag LOCUS_01290 16486 15698 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807131.1 protein_id gnl|my_center|LOCUS_01290 17604 16486 gene locus_tag LOCUS_01300 17604 16486 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449702.1 protein_id gnl|my_center|LOCUS_01300 19295 17853 gene locus_tag LOCUS_01310 19295 17853 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247543.1 protein_id gnl|my_center|LOCUS_01310 19663 19259 gene locus_tag LOCUS_01320 gene tsaE 19663 19259 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070930.1 protein_id gnl|my_center|LOCUS_01320 19760 20860 gene locus_tag LOCUS_01330 gene queG 19760 20860 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_01330 20864 22075 gene locus_tag LOCUS_01340 gene purT 20864 22075 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929968.1 protein_id gnl|my_center|LOCUS_01340 22115 23014 gene locus_tag LOCUS_01350 22115 23014 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365085.1 protein_id gnl|my_center|LOCUS_01350 24069 23203 gene locus_tag LOCUS_01360 24069 23203 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225470.1 protein_id gnl|my_center|LOCUS_01360 25154 24066 gene locus_tag LOCUS_01370 25154 24066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 26768 25155 gene locus_tag LOCUS_01380 26768 25155 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040766.1 protein_id gnl|my_center|LOCUS_01380 28830 26755 gene locus_tag LOCUS_01390 28830 26755 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_01390 30338 28827 gene locus_tag LOCUS_01400 30338 28827 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926305.1 protein_id gnl|my_center|LOCUS_01400 30671 38170 gene locus_tag LOCUS_01410 30671 38170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 38536 38204 gene locus_tag LOCUS_01420 38536 38204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 41264 38892 gene locus_tag LOCUS_01430 gene lon 41264 38892 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088915.1 protein_id gnl|my_center|LOCUS_01430 41853 41404 gene locus_tag LOCUS_01440 41853 41404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 42189 42797 gene locus_tag LOCUS_01450 42189 42797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 43606 42878 gene locus_tag LOCUS_01460 gene phoB 43606 42878 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_01460 43854 44624 gene locus_tag LOCUS_01470 43854 44624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 44621 46111 gene locus_tag LOCUS_01480 44621 46111 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707899.1 protein_id gnl|my_center|LOCUS_01480 46113 46727 gene locus_tag LOCUS_01490 46113 46727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 46734 47138 gene locus_tag LOCUS_01500 46734 47138 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_01500 47143 47778 gene locus_tag LOCUS_01510 47143 47778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 47810 48979 gene locus_tag LOCUS_01520 47810 48979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 49215 52373 gene locus_tag LOCUS_01530 49215 52373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 52676 52948 gene locus_tag LOCUS_01540 52676 52948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 53391 54371 gene locus_tag LOCUS_01550 53391 54371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 54758 56374 gene locus_tag LOCUS_01560 54758 56374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 56669 58012 gene locus_tag LOCUS_01570 56669 58012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 58588 59640 gene locus_tag LOCUS_01580 gene pstS 58588 59640 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809635.1 protein_id gnl|my_center|LOCUS_01580 59680 60702 gene locus_tag LOCUS_01590 gene pstC 59680 60702 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809636.1 protein_id gnl|my_center|LOCUS_01590 60844 61560 gene locus_tag LOCUS_01600 gene pstA 60844 61560 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 protein_id gnl|my_center|LOCUS_01600 61568 62347 gene locus_tag LOCUS_01610 gene pstB 61568 62347 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004713904.1 protein_id gnl|my_center|LOCUS_01610 62709 62479 gene locus_tag LOCUS_01620 62709 62479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 >Feature sequence004 1 159 gene locus_tag LOCUS_01630 1 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 519 427 gene locus_tag LOCUS_t00060 519 427 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1415 570 gene locus_tag LOCUS_01640 gene rpoH 1415 570 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167435401.1 protein_id gnl|my_center|LOCUS_01640 2439 1528 gene locus_tag LOCUS_01650 gene ftsX 2439 1528 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_01650 3089 2436 gene locus_tag LOCUS_01660 gene ftsE 3089 2436 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 protein_id gnl|my_center|LOCUS_01660 4136 3111 gene locus_tag LOCUS_01670 4136 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 4217 5623 gene locus_tag LOCUS_01680 4217 5623 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_01680 6041 5643 gene locus_tag LOCUS_01690 6041 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 6770 6180 gene locus_tag LOCUS_01700 gene orn 6770 6180 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813303.1 protein_id gnl|my_center|LOCUS_01700 10482 6883 gene locus_tag LOCUS_01710 10482 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 11831 10479 gene locus_tag LOCUS_01720 11831 10479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 12602 13870 gene locus_tag LOCUS_01730 12602 13870 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_01730 13867 14208 gene locus_tag LOCUS_01740 13867 14208 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947715.1 protein_id gnl|my_center|LOCUS_01740 14205 15098 gene locus_tag LOCUS_01750 gene rsgA 14205 15098 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550124.1 protein_id gnl|my_center|LOCUS_01750 15937 15197 gene locus_tag LOCUS_01760 15937 15197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 16223 17605 gene locus_tag LOCUS_01770 16223 17605 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119251.1 protein_id gnl|my_center|LOCUS_01770 17691 19763 gene locus_tag LOCUS_01780 17691 19763 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529393.1 protein_id gnl|my_center|LOCUS_01780 19781 19981 gene locus_tag LOCUS_01790 19781 19981 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094856.1 protein_id gnl|my_center|LOCUS_01790 20550 19996 gene locus_tag LOCUS_01800 20550 19996 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707093.1 protein_id gnl|my_center|LOCUS_01800 21499 20525 gene locus_tag LOCUS_01810 gene thiL 21499 20525 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_01810 22010 21519 gene locus_tag LOCUS_01820 gene nusB 22010 21519 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808599.1 protein_id gnl|my_center|LOCUS_01820 22489 22007 gene locus_tag LOCUS_01830 gene ribH 22489 22007 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 protein_id gnl|my_center|LOCUS_01830 23654 22554 gene locus_tag LOCUS_01840 gene ribBA 23654 22554 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808597.1 protein_id gnl|my_center|LOCUS_01840 24273 23635 gene locus_tag LOCUS_01850 24273 23635 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_01850 27409 24509 gene locus_tag LOCUS_01860 gene rapA 27409 24509 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070913.1 protein_id gnl|my_center|LOCUS_01860 28412 27660 gene locus_tag LOCUS_01870 28412 27660 CDS product DUF2490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945798.1 protein_id gnl|my_center|LOCUS_01870 29041 28841 gene locus_tag LOCUS_01880 29041 28841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 29016 29216 gene locus_tag LOCUS_01890 29016 29216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 29201 29521 gene locus_tag LOCUS_01900 29201 29521 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038658.1 protein_id gnl|my_center|LOCUS_01900 29573 31477 gene locus_tag LOCUS_01910 gene dsbD 29573 31477 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931570.1 protein_id gnl|my_center|LOCUS_01910 31488 32084 gene locus_tag LOCUS_01920 31488 32084 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527768.1 protein_id gnl|my_center|LOCUS_01920 33134 33955 gene locus_tag LOCUS_01930 33134 33955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 33968 35554 gene locus_tag LOCUS_01940 gene ctaD 33968 35554 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197996.1 protein_id gnl|my_center|LOCUS_01940 35668 36219 gene locus_tag LOCUS_01950 35668 36219 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185071.1 protein_id gnl|my_center|LOCUS_01950 36239 36439 gene locus_tag LOCUS_01960 36239 36439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 36478 37335 gene locus_tag LOCUS_01970 36478 37335 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815738.1 protein_id gnl|my_center|LOCUS_01970 37517 38239 gene locus_tag LOCUS_01980 37517 38239 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946158.1 protein_id gnl|my_center|LOCUS_01980 38340 38786 gene locus_tag LOCUS_01990 38340 38786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 38886 39779 gene locus_tag LOCUS_02000 gene cyoE 38886 39779 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522902.1 protein_id gnl|my_center|LOCUS_02000 41243 39870 gene locus_tag LOCUS_02010 41243 39870 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_02010 41838 41260 gene locus_tag LOCUS_02020 41838 41260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 41955 42449 gene locus_tag LOCUS_02030 41955 42449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 42497 43387 gene locus_tag LOCUS_02040 gene argB 42497 43387 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 protein_id gnl|my_center|LOCUS_02040 44043 43399 gene locus_tag LOCUS_02050 gene trmJ 44043 43399 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370313.1 protein_id gnl|my_center|LOCUS_02050 44400 44966 gene locus_tag LOCUS_02060 44400 44966 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599821.1 protein_id gnl|my_center|LOCUS_02060 45085 45405 gene locus_tag LOCUS_02070 45085 45405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 45530 46099 gene locus_tag LOCUS_02080 45530 46099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 46918 47604 gene locus_tag LOCUS_02090 46918 47604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 47792 48376 gene locus_tag LOCUS_02100 47792 48376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 49142 48441 gene locus_tag LOCUS_02110 49142 48441 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193573.1 protein_id gnl|my_center|LOCUS_02110 50711 49359 gene locus_tag LOCUS_02120 gene mnmE 50711 49359 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225859.1 protein_id gnl|my_center|LOCUS_02120 >Feature sequence005 2014 533 gene locus_tag LOCUS_02130 gene glgA 2014 533 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089199.1 protein_id gnl|my_center|LOCUS_02130 3512 2019 gene locus_tag LOCUS_02140 gene pgi 3512 2019 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916643.1 protein_id gnl|my_center|LOCUS_02140 5769 3760 gene locus_tag LOCUS_02150 5769 3760 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250760.1 protein_id gnl|my_center|LOCUS_02150 7487 5847 gene locus_tag LOCUS_02160 7487 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 8901 7591 gene locus_tag LOCUS_02170 gene glgC 8901 7591 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_02170 9048 11237 gene locus_tag LOCUS_02180 gene glgB 9048 11237 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_02180 11810 11376 gene locus_tag LOCUS_02190 11810 11376 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084037.1 protein_id gnl|my_center|LOCUS_02190 13060 11873 gene locus_tag LOCUS_02200 13060 11873 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338895.1 protein_id gnl|my_center|LOCUS_02200 14346 13891 gene locus_tag LOCUS_02210 14346 13891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 14885 15058 gene locus_tag LOCUS_02220 14885 15058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 15093 17249 gene locus_tag LOCUS_02230 gene glgX 15093 17249 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258959.1 protein_id gnl|my_center|LOCUS_02230 19337 17538 gene locus_tag LOCUS_02240 19337 17538 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234887077.1 protein_id gnl|my_center|LOCUS_02240 20279 19677 gene locus_tag LOCUS_02250 20279 19677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 21252 20740 gene locus_tag LOCUS_02260 21252 20740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 23237 21249 gene locus_tag LOCUS_02270 23237 21249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 23748 23329 gene locus_tag LOCUS_02280 23748 23329 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_02280 25776 24043 gene locus_tag LOCUS_02290 25776 24043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 27474 25873 gene locus_tag LOCUS_02300 gene nadB 27474 25873 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_02300 27767 28366 gene locus_tag LOCUS_02310 gene rpoE 27767 28366 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_02310 28368 28925 gene locus_tag LOCUS_02320 28368 28925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 28922 29908 gene locus_tag LOCUS_02330 28922 29908 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524615.1 protein_id gnl|my_center|LOCUS_02330 30198 31556 gene locus_tag LOCUS_02340 30198 31556 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363717.1 protein_id gnl|my_center|LOCUS_02340 31540 31830 gene locus_tag LOCUS_02350 31540 31830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 31933 33726 gene locus_tag LOCUS_02360 gene lepA 31933 33726 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 protein_id gnl|my_center|LOCUS_02360 33830 34633 gene locus_tag LOCUS_02370 gene lepB 33830 34633 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065098.1 protein_id gnl|my_center|LOCUS_02370 34663 35034 gene locus_tag LOCUS_02380 34663 35034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 35047 35754 gene locus_tag LOCUS_02390 35047 35754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 35799 36692 gene locus_tag LOCUS_02400 gene era 35799 36692 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 protein_id gnl|my_center|LOCUS_02400 36731 37459 gene locus_tag LOCUS_02410 gene pdxJ 36731 37459 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192885.1 protein_id gnl|my_center|LOCUS_02410 37456 37833 gene locus_tag LOCUS_02420 gene acpS 37456 37833 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212541.1 protein_id gnl|my_center|LOCUS_02420 37836 38885 gene locus_tag LOCUS_02430 gene nagZ 37836 38885 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040152.1 protein_id gnl|my_center|LOCUS_02430 38982 40445 gene locus_tag LOCUS_02440 gene lpdA 38982 40445 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225317.1 protein_id gnl|my_center|LOCUS_02440 40957 40514 gene locus_tag LOCUS_02450 40957 40514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 42287 43039 gene locus_tag LOCUS_02460 42287 43039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 43024 43719 gene locus_tag LOCUS_02470 43024 43719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 43927 44541 gene locus_tag LOCUS_02480 gene ccmA 43927 44541 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705297.1 protein_id gnl|my_center|LOCUS_02480 44547 45200 gene locus_tag LOCUS_02490 gene ccmB 44547 45200 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_02490 45454 46140 gene locus_tag LOCUS_02500 gene ccmC 45454 46140 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_02500 46137 46322 gene locus_tag LOCUS_02510 46137 46322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 46319 46768 gene locus_tag LOCUS_02520 gene ccmE 46319 46768 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_02520 46845 48899 gene locus_tag LOCUS_02530 46845 48899 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926646.1 protein_id gnl|my_center|LOCUS_02530 48896 49426 gene locus_tag LOCUS_02540 48896 49426 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811410.1 protein_id gnl|my_center|LOCUS_02540 >Feature sequence006 1759 584 gene locus_tag LOCUS_02550 1759 584 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_02550 2444 2259 gene locus_tag LOCUS_02560 2444 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02560 2865 2569 gene locus_tag LOCUS_02570 2865 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02570 4569 3103 gene locus_tag LOCUS_02580 gene htrA 4569 3103 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873435.1 protein_id gnl|my_center|LOCUS_02580 4716 5498 gene locus_tag LOCUS_02590 gene yaaA 4716 5498 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420750.1 protein_id gnl|my_center|LOCUS_02590 5535 5912 gene locus_tag LOCUS_02600 5535 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 5939 6631 gene locus_tag LOCUS_02610 gene rpiA 5939 6631 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247432.1 protein_id gnl|my_center|LOCUS_02610 6657 7400 gene locus_tag LOCUS_02620 gene phoU 6657 7400 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813242.1 protein_id gnl|my_center|LOCUS_02620 7838 7425 gene locus_tag LOCUS_02630 7838 7425 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103296.1 protein_id gnl|my_center|LOCUS_02630 11376 7861 gene locus_tag LOCUS_02640 11376 7861 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704651.1 protein_id gnl|my_center|LOCUS_02640 11974 11408 gene locus_tag LOCUS_02650 11974 11408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 12774 11971 gene locus_tag LOCUS_02660 12774 11971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 13280 12774 gene locus_tag LOCUS_02670 13280 12774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 13819 13277 gene locus_tag LOCUS_02680 gene tppE 13819 13277 CDS product type IVa pilus pseudopilin TppE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704647.1 protein_id gnl|my_center|LOCUS_02680 14051 15160 gene locus_tag LOCUS_02690 gene thiO 14051 15160 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103297.1 protein_id gnl|my_center|LOCUS_02690 16112 15168 gene locus_tag LOCUS_02700 gene ispH 16112 15168 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446429.1 protein_id gnl|my_center|LOCUS_02700 17251 16133 gene locus_tag LOCUS_02710 gene aroF 17251 16133 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363948.1 protein_id gnl|my_center|LOCUS_02710 17669 18793 gene locus_tag LOCUS_02720 17669 18793 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_02720 18798 19358 gene locus_tag LOCUS_02730 18798 19358 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395104.1 protein_id gnl|my_center|LOCUS_02730 20458 19370 gene locus_tag LOCUS_02740 gene ribD 20458 19370 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527563.1 protein_id gnl|my_center|LOCUS_02740 20993 20514 gene locus_tag LOCUS_02750 gene nrdR 20993 20514 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185666.1 protein_id gnl|my_center|LOCUS_02750 22287 21040 gene locus_tag LOCUS_02760 22287 21040 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951137.1 protein_id gnl|my_center|LOCUS_02760 22708 22878 gene locus_tag LOCUS_02770 22708 22878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 23087 23719 gene locus_tag LOCUS_02780 gene coq7 23087 23719 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527787.1 protein_id gnl|my_center|LOCUS_02780 23798 24367 gene locus_tag LOCUS_02790 23798 24367 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 protein_id gnl|my_center|LOCUS_02790 24380 24865 gene locus_tag LOCUS_02800 gene ruvX 24380 24865 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213272.1 protein_id gnl|my_center|LOCUS_02800 24846 25352 gene locus_tag LOCUS_02810 gene pyrR 24846 25352 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185915.1 protein_id gnl|my_center|LOCUS_02810 25349 26302 gene locus_tag LOCUS_02820 25349 26302 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_02820 26318 27592 gene locus_tag LOCUS_02830 26318 27592 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_02830 27661 29751 gene locus_tag LOCUS_02840 27661 29751 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191126.1 protein_id gnl|my_center|LOCUS_02840 30074 30850 gene locus_tag LOCUS_02850 30074 30850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 31189 32340 gene locus_tag LOCUS_02860 gene alkT 31189 32340 CDS product rubredoxin-NAD(+) reductase AlkT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114369.1 protein_id gnl|my_center|LOCUS_02860 32412 33002 gene locus_tag LOCUS_02870 32412 33002 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 protein_id gnl|my_center|LOCUS_02870 33002 33307 gene locus_tag LOCUS_02880 33002 33307 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096279.1 protein_id gnl|my_center|LOCUS_02880 33446 34240 gene locus_tag LOCUS_02890 33446 34240 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527206.1 protein_id gnl|my_center|LOCUS_02890 35363 34290 gene locus_tag LOCUS_02900 gene dadX 35363 34290 CDS product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705840.1 protein_id gnl|my_center|LOCUS_02900 35583 36857 gene locus_tag LOCUS_02910 gene lplT 35583 36857 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 protein_id gnl|my_center|LOCUS_02910 37625 36894 gene locus_tag LOCUS_02920 37625 36894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 38083 37622 gene locus_tag LOCUS_02930 gene rimI 38083 37622 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_02930 38754 38080 gene locus_tag LOCUS_02940 gene tsaB 38754 38080 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262263.1 protein_id gnl|my_center|LOCUS_02940 39384 38830 gene locus_tag LOCUS_02950 gene thpR 39384 38830 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294690.1 protein_id gnl|my_center|LOCUS_02950 39869 39381 gene locus_tag LOCUS_02960 gene ispF 39869 39381 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947931.1 protein_id gnl|my_center|LOCUS_02960 40522 39866 gene locus_tag LOCUS_02970 gene ispD 40522 39866 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191584.1 protein_id gnl|my_center|LOCUS_02970 41017 41907 gene locus_tag LOCUS_02980 gene prfB 41017 41907 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199566.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02980 44608 41927 gene locus_tag LOCUS_02990 44608 41927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 46305 44770 gene locus_tag LOCUS_03000 46305 44770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 >Feature sequence007 1802 1185 gene locus_tag LOCUS_03010 1802 1185 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272442.1 protein_id gnl|my_center|LOCUS_03010 1910 2665 gene locus_tag LOCUS_03020 1910 2665 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011945636.1 protein_id gnl|my_center|LOCUS_03020 5013 2911 gene locus_tag LOCUS_03030 5013 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 5304 5915 gene locus_tag LOCUS_03040 gene slmA 5304 5915 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927138.1 protein_id gnl|my_center|LOCUS_03040 6705 5932 gene locus_tag LOCUS_03050 gene moeB 6705 5932 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807436.1 protein_id gnl|my_center|LOCUS_03050 8156 6717 gene locus_tag LOCUS_03060 gene cptA 8156 6717 CDS product protease CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929911.1 protein_id gnl|my_center|LOCUS_03060 9439 8201 gene locus_tag LOCUS_03070 9439 8201 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_03070 10219 9470 gene locus_tag LOCUS_03080 gene gpmA 10219 9470 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_03080 10519 10950 gene locus_tag LOCUS_03090 10519 10950 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026029413.1 protein_id gnl|my_center|LOCUS_03090 10959 11216 gene locus_tag LOCUS_03100 gene grxC 10959 11216 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 protein_id gnl|my_center|LOCUS_03100 11294 11734 gene locus_tag LOCUS_03110 gene secB 11294 11734 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687381.1 protein_id gnl|my_center|LOCUS_03110 11897 12376 gene locus_tag LOCUS_03120 11897 12376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 12373 13362 gene locus_tag LOCUS_03130 12373 13362 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_03130 13605 13877 gene locus_tag LOCUS_03140 13605 13877 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 protein_id gnl|my_center|LOCUS_03140 13892 13967 gene locus_tag LOCUS_t00070 13892 13967 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13984 14060 gene locus_tag LOCUS_t00080 13984 14060 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 14144 16021 gene locus_tag LOCUS_03150 14144 16021 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527215.1 protein_id gnl|my_center|LOCUS_03150 16827 16168 gene locus_tag LOCUS_03160 16827 16168 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088064.1 protein_id gnl|my_center|LOCUS_03160 18838 17996 gene locus_tag LOCUS_03170 18838 17996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 18951 19799 gene locus_tag LOCUS_03180 18951 19799 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192869.1 protein_id gnl|my_center|LOCUS_03180 21177 20002 gene locus_tag LOCUS_03190 21177 20002 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532210.1 protein_id gnl|my_center|LOCUS_03190 22604 22963 gene locus_tag LOCUS_03200 22604 22963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 24147 23473 gene locus_tag LOCUS_03210 24147 23473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 24957 24226 gene locus_tag LOCUS_03220 24957 24226 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968527.1 protein_id gnl|my_center|LOCUS_03220 25249 26445 gene locus_tag LOCUS_03230 gene ubiH 25249 26445 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052899460.1 protein_id gnl|my_center|LOCUS_03230 26582 27616 gene locus_tag LOCUS_03240 gene dusB 26582 27616 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_03240 27594 27836 gene locus_tag LOCUS_03250 27594 27836 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 protein_id gnl|my_center|LOCUS_03250 27833 29392 gene locus_tag LOCUS_03260 gene purH 27833 29392 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194285.1 protein_id gnl|my_center|LOCUS_03260 29409 30725 gene locus_tag LOCUS_03270 gene purD 29409 30725 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930862.1 protein_id gnl|my_center|LOCUS_03270 31947 30739 gene locus_tag LOCUS_03280 gene flgL 31947 30739 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946958.1 protein_id gnl|my_center|LOCUS_03280 33886 31970 gene locus_tag LOCUS_03290 gene flgK 33886 31970 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203463.1 protein_id gnl|my_center|LOCUS_03290 34977 33970 gene locus_tag LOCUS_03300 gene flgJ 34977 33970 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704936.1 protein_id gnl|my_center|LOCUS_03300 36106 34997 gene locus_tag LOCUS_03310 36106 34997 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550967.1 protein_id gnl|my_center|LOCUS_03310 36872 36156 gene locus_tag LOCUS_03320 gene flgH 36872 36156 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160434.1 protein_id gnl|my_center|LOCUS_03320 37682 36900 gene locus_tag LOCUS_03330 gene flgG 37682 36900 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625851.1 protein_id gnl|my_center|LOCUS_03330 38454 37711 gene locus_tag LOCUS_03340 gene flgF 38454 37711 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 protein_id gnl|my_center|LOCUS_03340 39739 38477 gene locus_tag LOCUS_03350 gene flgE 39739 38477 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197255.1 protein_id gnl|my_center|LOCUS_03350 40421 39753 gene locus_tag LOCUS_03360 40421 39753 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930324.1 protein_id gnl|my_center|LOCUS_03360 40837 40433 gene locus_tag LOCUS_03370 gene flgC 40837 40433 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367329.1 protein_id gnl|my_center|LOCUS_03370 41249 40839 gene locus_tag LOCUS_03380 gene flgB 41249 40839 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211110.1 protein_id gnl|my_center|LOCUS_03380 41458 42177 gene locus_tag LOCUS_03390 gene flgA 41458 42177 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197247.1 protein_id gnl|my_center|LOCUS_03390 42602 42396 gene locus_tag LOCUS_03400 42602 42396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 >Feature sequence008 668 267 gene locus_tag LOCUS_03410 668 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03410 899 684 gene locus_tag LOCUS_03420 899 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03420 1122 784 gene locus_tag LOCUS_03430 1122 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03430 1226 1504 gene locus_tag LOCUS_03440 1226 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 2279 1623 gene locus_tag LOCUS_03450 2279 1623 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_03450 5170 2282 gene locus_tag LOCUS_03460 5170 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 6392 5280 gene locus_tag LOCUS_03470 gene corA 6392 5280 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081315.1 protein_id gnl|my_center|LOCUS_03470 6728 6558 gene locus_tag LOCUS_03480 6728 6558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 6913 7470 gene locus_tag LOCUS_03490 6913 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 8688 7690 gene locus_tag LOCUS_03500 8688 7690 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055856.1 protein_id gnl|my_center|LOCUS_03500 8911 9414 gene locus_tag LOCUS_03510 8911 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 10195 10548 gene locus_tag LOCUS_03520 10195 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 10645 11097 gene locus_tag LOCUS_03530 10645 11097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 11085 11894 gene locus_tag LOCUS_03540 11085 11894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 12299 14770 gene locus_tag LOCUS_03550 12299 14770 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205538.1 protein_id gnl|my_center|LOCUS_03550 15989 14991 gene locus_tag LOCUS_03560 15989 14991 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506955.1 protein_id gnl|my_center|LOCUS_03560 17517 15970 gene locus_tag LOCUS_03570 17517 15970 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261592.1 protein_id gnl|my_center|LOCUS_03570 18278 17517 gene locus_tag LOCUS_03580 18278 17517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 18827 18423 gene locus_tag LOCUS_03590 18827 18423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 20660 18891 gene locus_tag LOCUS_03600 gene lpdA 20660 18891 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459591.1 protein_id gnl|my_center|LOCUS_03600 21974 20709 gene locus_tag LOCUS_03610 21974 20709 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_03610 22235 23095 gene locus_tag LOCUS_03620 22235 23095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 23722 23360 gene locus_tag LOCUS_03630 23722 23360 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082839.1 protein_id gnl|my_center|LOCUS_03630 24883 23873 gene locus_tag LOCUS_03640 gene holA 24883 23873 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 protein_id gnl|my_center|LOCUS_03640 25426 24926 gene locus_tag LOCUS_03650 gene lptE 25426 24926 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194132.1 protein_id gnl|my_center|LOCUS_03650 26827 25472 gene locus_tag LOCUS_03660 26827 25472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03660 28072 26894 gene locus_tag LOCUS_03670 28072 26894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03670 28507 28301 gene locus_tag LOCUS_03680 28507 28301 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809966.1 protein_id gnl|my_center|LOCUS_03680 28671 29453 gene locus_tag LOCUS_03690 28671 29453 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 protein_id gnl|my_center|LOCUS_03690 29847 29458 gene locus_tag LOCUS_03700 29847 29458 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086522.1 protein_id gnl|my_center|LOCUS_03700 30435 30887 gene locus_tag LOCUS_03710 gene cheW 30435 30887 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199265.1 protein_id gnl|my_center|LOCUS_03710 30931 32655 gene locus_tag LOCUS_03720 30931 32655 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535875.1 protein_id gnl|my_center|LOCUS_03720 32919 33716 gene locus_tag LOCUS_03730 32919 33716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 34327 33800 gene locus_tag LOCUS_03740 34327 33800 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033534649.1 protein_id gnl|my_center|LOCUS_03740 35086 34349 gene locus_tag LOCUS_03750 gene gpmA 35086 34349 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_03750 36159 35086 gene locus_tag LOCUS_03760 36159 35086 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639906.1 protein_id gnl|my_center|LOCUS_03760 36638 36171 gene locus_tag LOCUS_03770 36638 36171 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919041.1 protein_id gnl|my_center|LOCUS_03770 37406 36645 gene locus_tag LOCUS_03780 37406 36645 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919036.1 protein_id gnl|my_center|LOCUS_03780 38580 37423 gene locus_tag LOCUS_03790 38580 37423 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943206.1 protein_id gnl|my_center|LOCUS_03790 39327 38686 gene locus_tag LOCUS_03800 39327 38686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 39651 39412 gene locus_tag LOCUS_03810 39651 39412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 41714 39648 gene locus_tag LOCUS_03820 41714 39648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 42655 41711 gene locus_tag LOCUS_03830 42655 41711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 43650 43108 gene locus_tag LOCUS_03840 43650 43108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 >Feature sequence009 <1 713 gene locus_tag LOCUS_03850 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_087144570.1:site-specific integrase 803 727 gene locus_tag LOCUS_t00090 803 727 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3005 819 gene locus_tag LOCUS_03860 gene rpoD 3005 819 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930783.1 protein_id gnl|my_center|LOCUS_03860 4895 3093 gene locus_tag LOCUS_03870 gene dnaG 4895 3093 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190679.1 protein_id gnl|my_center|LOCUS_03870 5414 4998 gene locus_tag LOCUS_03880 5414 4998 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_03880 5744 5532 gene locus_tag LOCUS_03890 gene rpsU 5744 5532 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190342.1 protein_id gnl|my_center|LOCUS_03890 5914 6945 gene locus_tag LOCUS_03900 gene tsaD 5914 6945 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811013.1 protein_id gnl|my_center|LOCUS_03900 7560 6946 gene locus_tag LOCUS_03910 gene plsY 7560 6946 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522633.1 protein_id gnl|my_center|LOCUS_03910 7672 8031 gene locus_tag LOCUS_03920 gene folB 7672 8031 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361952.1 protein_id gnl|my_center|LOCUS_03920 8144 8845 gene locus_tag LOCUS_03930 8144 8845 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066494930.1 protein_id gnl|my_center|LOCUS_03930 9087 9917 gene locus_tag LOCUS_03940 9087 9917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 11623 10025 gene locus_tag LOCUS_03950 11623 10025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 17042 11847 gene locus_tag LOCUS_03960 17042 11847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 18066 17392 gene locus_tag LOCUS_03970 gene queC 18066 17392 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390955.1 protein_id gnl|my_center|LOCUS_03970 18754 18098 gene locus_tag LOCUS_03980 gene queE 18754 18098 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947757.1 protein_id gnl|my_center|LOCUS_03980 19736 18846 gene locus_tag LOCUS_03990 gene ybgF 19736 18846 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186614.1 protein_id gnl|my_center|LOCUS_03990 20257 19739 gene locus_tag LOCUS_04000 20257 19739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 21590 20295 gene locus_tag LOCUS_04010 gene tolB 21590 20295 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931417.1 protein_id gnl|my_center|LOCUS_04010 22587 21640 gene locus_tag LOCUS_04020 22587 21640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 23014 22601 gene locus_tag LOCUS_04030 gene tolR 23014 22601 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 protein_id gnl|my_center|LOCUS_04030 23714 23034 gene locus_tag LOCUS_04040 gene tolQ 23714 23034 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_04040 24121 23711 gene locus_tag LOCUS_04050 gene ybgC 24121 23711 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201529.1 protein_id gnl|my_center|LOCUS_04050 25184 24297 gene locus_tag LOCUS_04060 gene cysM 25184 24297 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532363.1 protein_id gnl|my_center|LOCUS_04060 25609 25322 gene locus_tag LOCUS_04070 25609 25322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 27510 25858 gene locus_tag LOCUS_04080 27510 25858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 28699 27551 gene locus_tag LOCUS_04090 28699 27551 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_04090 28777 29523 gene locus_tag LOCUS_04100 28777 29523 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202811.1 protein_id gnl|my_center|LOCUS_04100 29751 30941 gene locus_tag LOCUS_04110 29751 30941 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_04110 34113 31054 gene locus_tag LOCUS_04120 34113 31054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 34817 34110 gene locus_tag LOCUS_04130 34817 34110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04130 39093 34891 gene locus_tag LOCUS_04140 39093 34891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 39417 39956 gene locus_tag LOCUS_04150 39417 39956 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036687.1 protein_id gnl|my_center|LOCUS_04150 39962 40588 gene locus_tag LOCUS_04160 39962 40588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 41177 40611 gene locus_tag LOCUS_04170 41177 40611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 >Feature sequence010 224 149 gene locus_tag LOCUS_t00100 224 149 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 675 253 gene locus_tag LOCUS_04180 675 253 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958412.1 protein_id gnl|my_center|LOCUS_04180 1199 672 gene locus_tag LOCUS_04190 1199 672 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 protein_id gnl|my_center|LOCUS_04190 2039 1317 gene locus_tag LOCUS_04200 2039 1317 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181874519.1 protein_id gnl|my_center|LOCUS_04200 3291 2044 gene locus_tag LOCUS_04210 3291 2044 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_04210 3900 3292 gene locus_tag LOCUS_04220 gene petA 3900 3292 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 protein_id gnl|my_center|LOCUS_04220 6861 4129 gene locus_tag LOCUS_04230 gene secA 6861 4129 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814564.1 protein_id gnl|my_center|LOCUS_04230 8012 7095 gene locus_tag LOCUS_04240 8012 7095 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707577.1 protein_id gnl|my_center|LOCUS_04240 8051 8515 gene locus_tag LOCUS_04250 8051 8515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 8995 8579 gene locus_tag LOCUS_04260 8995 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 9858 9061 gene locus_tag LOCUS_04270 9858 9061 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 protein_id gnl|my_center|LOCUS_04270 10996 9947 gene locus_tag LOCUS_04280 gene hemW 10996 9947 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 protein_id gnl|my_center|LOCUS_04280 13740 11164 gene locus_tag LOCUS_04290 13740 11164 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813269.1 protein_id gnl|my_center|LOCUS_04290 14453 13767 gene locus_tag LOCUS_04300 14453 13767 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707237.1 protein_id gnl|my_center|LOCUS_04300 14452 15108 gene locus_tag LOCUS_04310 14452 15108 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447512.1 protein_id gnl|my_center|LOCUS_04310 16167 15175 gene locus_tag LOCUS_04320 16167 15175 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193798.1 protein_id gnl|my_center|LOCUS_04320 16605 19163 gene locus_tag LOCUS_04330 16605 19163 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980758.1 protein_id gnl|my_center|LOCUS_04330 22080 19336 gene locus_tag LOCUS_04340 gene polA 22080 19336 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190446.1 protein_id gnl|my_center|LOCUS_04340 22079 22813 gene locus_tag LOCUS_04350 22079 22813 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_04350 22944 23333 gene locus_tag LOCUS_04360 22944 23333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 23411 24361 gene locus_tag LOCUS_04370 23411 24361 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190439.1 protein_id gnl|my_center|LOCUS_04370 24403 25380 gene locus_tag LOCUS_04380 24403 25380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 27582 25537 gene locus_tag LOCUS_04390 27582 25537 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257258.1 protein_id gnl|my_center|LOCUS_04390 29953 27752 gene locus_tag LOCUS_04400 gene uvrD 29953 27752 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003698962.1 protein_id gnl|my_center|LOCUS_04400 30975 30100 gene locus_tag LOCUS_04410 30975 30100 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_04410 31287 31790 gene locus_tag LOCUS_04420 31287 31790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 31807 32352 gene locus_tag LOCUS_04430 31807 32352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 32626 33150 gene locus_tag LOCUS_04440 32626 33150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 33191 33553 gene locus_tag LOCUS_04450 33191 33553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 34033 34236 gene locus_tag LOCUS_04460 gene thiS 34033 34236 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_04460 34281 35078 gene locus_tag LOCUS_04470 34281 35078 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931559.1 protein_id gnl|my_center|LOCUS_04470 35090 35755 gene locus_tag LOCUS_04480 gene trmB 35090 35755 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527577.1 protein_id gnl|my_center|LOCUS_04480 35816 36337 gene locus_tag LOCUS_04490 35816 36337 CDS product DUF3617 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401328.1 protein_id gnl|my_center|LOCUS_04490 36429 37721 gene locus_tag LOCUS_04500 gene oprP 36429 37721 CDS product outer membrane porin OprP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119678.1 protein_id gnl|my_center|LOCUS_04500 40630 37865 gene locus_tag LOCUS_04510 40630 37865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 41306 40620 gene locus_tag LOCUS_04520 41306 40620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 >Feature sequence011 383 2254 gene locus_tag LOCUS_04530 383 2254 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967201.1 protein_id gnl|my_center|LOCUS_04530 3821 2472 gene locus_tag LOCUS_04540 gene ffh 3821 2472 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194338.1 protein_id gnl|my_center|LOCUS_04540 3997 4794 gene locus_tag LOCUS_04550 gene ccsA 3997 4794 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448047.1 protein_id gnl|my_center|LOCUS_04550 4849 5637 gene locus_tag LOCUS_04560 4849 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 7303 5645 gene locus_tag LOCUS_04570 7303 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 7889 7464 gene locus_tag LOCUS_04580 7889 7464 CDS product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812026.1 protein_id gnl|my_center|LOCUS_04580 8074 9684 gene locus_tag LOCUS_04590 8074 9684 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 protein_id gnl|my_center|LOCUS_04590 10068 9993 gene locus_tag LOCUS_t00110 10068 9993 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10202 10127 gene locus_tag LOCUS_t00120 10202 10127 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11648 10257 gene locus_tag LOCUS_04600 gene gltX 11648 10257 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197094.1 protein_id gnl|my_center|LOCUS_04600 11841 13448 gene locus_tag LOCUS_04610 11841 13448 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_04610 13501 14676 gene locus_tag LOCUS_04620 13501 14676 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_04620 15117 15899 gene locus_tag LOCUS_04630 15117 15899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 16121 16402 gene locus_tag LOCUS_04640 16121 16402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 16500 17777 gene locus_tag LOCUS_04650 16500 17777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943169.1 protein_id gnl|my_center|LOCUS_04650 17828 20725 gene locus_tag LOCUS_04660 17828 20725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 21933 20734 gene locus_tag LOCUS_04670 21933 20734 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_04670 23132 21930 gene locus_tag LOCUS_04680 23132 21930 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393833.1 protein_id gnl|my_center|LOCUS_04680 23802 23119 gene locus_tag LOCUS_04690 23802 23119 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210674.1 protein_id gnl|my_center|LOCUS_04690 24872 23805 gene locus_tag LOCUS_04700 24872 23805 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932152.1 protein_id gnl|my_center|LOCUS_04700 25083 26714 gene locus_tag LOCUS_04710 25083 26714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 28517 27120 gene locus_tag LOCUS_04720 gene der 28517 27120 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192452.1 protein_id gnl|my_center|LOCUS_04720 29736 28633 gene locus_tag LOCUS_04730 gene bamB 29736 28633 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193323.1 protein_id gnl|my_center|LOCUS_04730 30506 29868 gene locus_tag LOCUS_04740 30506 29868 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810700.1 protein_id gnl|my_center|LOCUS_04740 31855 30596 gene locus_tag LOCUS_04750 gene hisS 31855 30596 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191559.1 protein_id gnl|my_center|LOCUS_04750 33030 31855 gene locus_tag LOCUS_04760 gene ispG 33030 31855 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527159.1 protein_id gnl|my_center|LOCUS_04760 34371 33130 gene locus_tag LOCUS_04770 34371 33130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 35126 34371 gene locus_tag LOCUS_04780 gene pilW 35126 34371 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227268.1 protein_id gnl|my_center|LOCUS_04780 36253 35153 gene locus_tag LOCUS_04790 gene rlmN 36253 35153 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219171.1 protein_id gnl|my_center|LOCUS_04790 36700 36275 gene locus_tag LOCUS_04800 gene ndk 36700 36275 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_04800 37278 36826 gene locus_tag LOCUS_04810 37278 36826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 38157 37324 gene locus_tag LOCUS_04820 38157 37324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 38991 38254 gene locus_tag LOCUS_04830 38991 38254 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193555.1 protein_id gnl|my_center|LOCUS_04830 39785 40288 gene locus_tag LOCUS_04840 39785 40288 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193764.1 protein_id gnl|my_center|LOCUS_04840 41158 40373 gene locus_tag LOCUS_04850 gene fabI 41158 40373 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191586.1 protein_id gnl|my_center|LOCUS_04850 >Feature sequence012 2725 551 gene locus_tag LOCUS_04860 gene esaS 2725 551 CDS product sensor histidine kinase EsaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189034.1 protein_id gnl|my_center|LOCUS_04860 3309 2725 gene locus_tag LOCUS_04870 3309 2725 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188929.1 protein_id gnl|my_center|LOCUS_04870 4609 3332 gene locus_tag LOCUS_04880 gene rsmB 4609 3332 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951361.1 protein_id gnl|my_center|LOCUS_04880 5558 4602 gene locus_tag LOCUS_04890 gene fmt 5558 4602 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549892.1 protein_id gnl|my_center|LOCUS_04890 6183 5680 gene locus_tag LOCUS_04900 gene def 6183 5680 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201745.1 protein_id gnl|my_center|LOCUS_04900 6278 7312 gene locus_tag LOCUS_04910 6278 7312 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_04910 7335 8429 gene locus_tag LOCUS_04920 gene dprA 7335 8429 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935893.1 protein_id gnl|my_center|LOCUS_04920 8497 8955 gene locus_tag LOCUS_04930 8497 8955 CDS product DUF494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040781.1 protein_id gnl|my_center|LOCUS_04930 9043 11556 gene locus_tag LOCUS_04940 9043 11556 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_04940 11905 11660 gene locus_tag LOCUS_04950 11905 11660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 12141 13454 gene locus_tag LOCUS_04960 12141 13454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 13507 14187 gene locus_tag LOCUS_04970 gene cmK 13507 14187 CDS product cytidylate kinase CmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189396.1 protein_id gnl|my_center|LOCUS_04970 14319 16028 gene locus_tag LOCUS_04980 gene rpsA 14319 16028 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189285.1 protein_id gnl|my_center|LOCUS_04980 16040 16330 gene locus_tag LOCUS_04990 16040 16330 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_04990 16440 16655 gene locus_tag LOCUS_05000 16440 16655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 16676 17368 gene locus_tag LOCUS_05010 gene pyrF 16676 17368 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027957.1 protein_id gnl|my_center|LOCUS_05010 19771 17486 gene locus_tag LOCUS_05020 19771 17486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 20340 21020 gene locus_tag LOCUS_05030 20340 21020 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244130.1 protein_id gnl|my_center|LOCUS_05030 21010 22293 gene locus_tag LOCUS_05040 21010 22293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 22277 24100 gene locus_tag LOCUS_05050 22277 24100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 24761 28513 gene locus_tag LOCUS_05060 24761 28513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 28641 29555 gene locus_tag LOCUS_05070 28641 29555 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592106.1 protein_id gnl|my_center|LOCUS_05070 29575 30492 gene locus_tag LOCUS_05080 29575 30492 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946515.1 protein_id gnl|my_center|LOCUS_05080 30485 31369 gene locus_tag LOCUS_05090 30485 31369 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921254.1 protein_id gnl|my_center|LOCUS_05090 31465 33258 gene locus_tag LOCUS_05100 gene aprD 31465 33258 CDS product alkaline protease secretion ATP-binding protein AprD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082539.1 protein_id gnl|my_center|LOCUS_05100 33300 34652 gene locus_tag LOCUS_05110 33300 34652 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 protein_id gnl|my_center|LOCUS_05110 34655 36001 gene locus_tag LOCUS_05120 34655 36001 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767364.1 protein_id gnl|my_center|LOCUS_05120 36521 36030 gene locus_tag LOCUS_05130 36521 36030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 37900 39828 gene locus_tag LOCUS_05140 gene yidC 37900 39828 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169144818.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence013 1208 1489 gene locus_tag LOCUS_05150 1208 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 1512 2321 gene locus_tag LOCUS_05160 gene atpB 1512 2321 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035796.1 protein_id gnl|my_center|LOCUS_05160 2380 2652 gene locus_tag LOCUS_05170 gene atpE 2380 2652 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195828.1 protein_id gnl|my_center|LOCUS_05170 2693 3166 gene locus_tag LOCUS_05180 2693 3166 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214796.1 protein_id gnl|my_center|LOCUS_05180 3166 3702 gene locus_tag LOCUS_05190 3166 3702 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524508.1 protein_id gnl|my_center|LOCUS_05190 3715 5256 gene locus_tag LOCUS_05200 gene atpA 3715 5256 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 protein_id gnl|my_center|LOCUS_05200 5259 6143 gene locus_tag LOCUS_05210 gene atpG 5259 6143 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_05210 6167 7546 gene locus_tag LOCUS_05220 gene atpD 6167 7546 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185243.1 protein_id gnl|my_center|LOCUS_05220 7564 7986 gene locus_tag LOCUS_05230 7564 7986 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024912932.1 protein_id gnl|my_center|LOCUS_05230 8300 9673 gene locus_tag LOCUS_05240 gene glmU 8300 9673 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190034.1 protein_id gnl|my_center|LOCUS_05240 9715 11562 gene locus_tag LOCUS_05250 gene glmS 9715 11562 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064828.1 protein_id gnl|my_center|LOCUS_05250 11712 12449 gene locus_tag LOCUS_05260 11712 12449 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689207.1 protein_id gnl|my_center|LOCUS_05260 12509 12979 gene locus_tag LOCUS_05270 gene ruvC 12509 12979 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_05270 12976 13560 gene locus_tag LOCUS_05280 gene ruvA 12976 13560 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194029.1 protein_id gnl|my_center|LOCUS_05280 13581 14627 gene locus_tag LOCUS_05290 gene ruvB 13581 14627 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_05290 14644 15084 gene locus_tag LOCUS_05300 14644 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 15294 15965 gene locus_tag LOCUS_05310 15294 15965 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_05310 16043 16231 gene locus_tag LOCUS_05320 16043 16231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 17586 16363 gene locus_tag LOCUS_05330 17586 16363 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_05330 17717 18559 gene locus_tag LOCUS_05340 17717 18559 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_05340 18621 19253 gene locus_tag LOCUS_05350 18621 19253 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229052.1 protein_id gnl|my_center|LOCUS_05350 19246 19911 gene locus_tag LOCUS_05360 19246 19911 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_05360 19936 21138 gene locus_tag LOCUS_05370 19936 21138 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_05370 21257 22003 gene locus_tag LOCUS_05380 21257 22003 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_05380 21969 22598 gene locus_tag LOCUS_05390 21969 22598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 23453 22620 gene locus_tag LOCUS_05400 23453 22620 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_05400 24694 23759 gene locus_tag LOCUS_05410 24694 23759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 24836 25534 gene locus_tag LOCUS_05420 gene aat 24836 25534 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 protein_id gnl|my_center|LOCUS_05420 25547 26248 gene locus_tag LOCUS_05430 25547 26248 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521637.1 protein_id gnl|my_center|LOCUS_05430 26313 27347 gene locus_tag LOCUS_05440 26313 27347 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207200.1 protein_id gnl|my_center|LOCUS_05440 27349 28008 gene locus_tag LOCUS_05450 27349 28008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 28015 28647 gene locus_tag LOCUS_05460 gene nth 28015 28647 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813856.1 protein_id gnl|my_center|LOCUS_05460 28650 29102 gene locus_tag LOCUS_05470 28650 29102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 29486 29157 gene locus_tag LOCUS_05480 29486 29157 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707788.1 protein_id gnl|my_center|LOCUS_05480 29836 29510 gene locus_tag LOCUS_05490 29836 29510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 31868 29943 gene locus_tag LOCUS_05500 31868 29943 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222546.1 protein_id gnl|my_center|LOCUS_05500 32469 32044 gene locus_tag LOCUS_05510 32469 32044 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_05510 33329 32682 gene locus_tag LOCUS_05520 33329 32682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 33993 33517 gene locus_tag LOCUS_05530 33993 33517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 34231 34307 gene locus_tag LOCUS_t00130 34231 34307 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 34293 35231 gene locus_tag LOCUS_05540 34293 35231 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789633.1 protein_id gnl|my_center|LOCUS_05540 36030 35344 gene locus_tag LOCUS_05550 36030 35344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 39832 36098 gene locus_tag LOCUS_05560 39832 36098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 >Feature sequence014 306 31 gene locus_tag LOCUS_05570 306 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 1486 512 gene locus_tag LOCUS_05580 1486 512 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032622187.1 protein_id gnl|my_center|LOCUS_05580 2789 1788 gene locus_tag LOCUS_05590 2789 1788 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 protein_id gnl|my_center|LOCUS_05590 4082 3438 gene locus_tag LOCUS_05600 gene uvrY 4082 3438 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216518.1 protein_id gnl|my_center|LOCUS_05600 5241 4087 gene locus_tag LOCUS_05610 5241 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 5454 7883 gene locus_tag LOCUS_05620 5454 7883 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039712.1 protein_id gnl|my_center|LOCUS_05620 9361 7937 gene locus_tag LOCUS_05630 9361 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 9769 9377 gene locus_tag LOCUS_05640 9769 9377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 10856 10002 gene locus_tag LOCUS_05650 gene hslO 10856 10002 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443930.1 protein_id gnl|my_center|LOCUS_05650 12017 10896 gene locus_tag LOCUS_05660 12017 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 12915 12037 gene locus_tag LOCUS_05670 12915 12037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 13269 12928 gene locus_tag LOCUS_05680 gene hypA 13269 12928 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338274.1 protein_id gnl|my_center|LOCUS_05680 13750 13298 gene locus_tag LOCUS_05690 13750 13298 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582503.1 protein_id gnl|my_center|LOCUS_05690 13826 14011 gene locus_tag LOCUS_05700 13826 14011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 14406 14708 gene locus_tag LOCUS_05710 gene lsrG 14406 14708 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175221.1 protein_id gnl|my_center|LOCUS_05710 14708 15892 gene locus_tag LOCUS_05720 14708 15892 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926962.1 protein_id gnl|my_center|LOCUS_05720 17657 15975 gene locus_tag LOCUS_05730 17657 15975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 18558 17713 gene locus_tag LOCUS_05740 18558 17713 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_05740 19132 19920 gene locus_tag LOCUS_05750 19132 19920 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009348805.1 protein_id gnl|my_center|LOCUS_05750 20912 21556 gene locus_tag LOCUS_05760 20912 21556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 23118 21604 gene locus_tag LOCUS_05770 23118 21604 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697442.1 protein_id gnl|my_center|LOCUS_05770 23493 23188 gene locus_tag LOCUS_05780 23493 23188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 23723 24727 gene locus_tag LOCUS_05790 23723 24727 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931410.1 protein_id gnl|my_center|LOCUS_05790 24747 25454 gene locus_tag LOCUS_05800 24747 25454 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463963.1 protein_id gnl|my_center|LOCUS_05800 25457 26770 gene locus_tag LOCUS_05810 25457 26770 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065042.1 protein_id gnl|my_center|LOCUS_05810 26767 27132 gene locus_tag LOCUS_05820 26767 27132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 27249 28616 gene locus_tag LOCUS_05830 27249 28616 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253941.1 protein_id gnl|my_center|LOCUS_05830 28742 29269 gene locus_tag LOCUS_05840 28742 29269 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931985.1 protein_id gnl|my_center|LOCUS_05840 31045 29306 gene locus_tag LOCUS_05850 31045 29306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 33776 31047 gene locus_tag LOCUS_05860 33776 31047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 36329 34221 gene locus_tag LOCUS_05870 36329 34221 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_05870 36937 36332 gene locus_tag LOCUS_05880 36937 36332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 39006 36952 gene locus_tag LOCUS_05890 39006 36952 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_05890 >Feature sequence015 3203 3814 gene locus_tag LOCUS_05900 3203 3814 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090002.1 protein_id gnl|my_center|LOCUS_05900 3832 4722 gene locus_tag LOCUS_05910 3832 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 4716 5225 gene locus_tag LOCUS_05920 4716 5225 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 protein_id gnl|my_center|LOCUS_05920 6497 5310 gene locus_tag LOCUS_05930 gene dinB 6497 5310 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172312.1 protein_id gnl|my_center|LOCUS_05930 6707 7888 gene locus_tag LOCUS_05940 6707 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 9558 8590 gene locus_tag LOCUS_05950 9558 8590 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_05950 11580 9610 gene locus_tag LOCUS_05960 gene acs 11580 9610 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188376.1 protein_id gnl|my_center|LOCUS_05960 11821 12249 gene locus_tag LOCUS_05970 gene rimP 11821 12249 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216731.1 protein_id gnl|my_center|LOCUS_05970 12273 13745 gene locus_tag LOCUS_05980 gene nusA 12273 13745 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193517.1 protein_id gnl|my_center|LOCUS_05980 13837 16449 gene locus_tag LOCUS_05990 gene infB 13837 16449 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025871401.1 protein_id gnl|my_center|LOCUS_05990 16475 16858 gene locus_tag LOCUS_06000 gene rbfA 16475 16858 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095188.1 protein_id gnl|my_center|LOCUS_06000 17029 17814 gene locus_tag LOCUS_06010 gene truB 17029 17814 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06010 18160 17816 gene locus_tag LOCUS_06020 18160 17816 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302630.1 protein_id gnl|my_center|LOCUS_06020 19659 18196 gene locus_tag LOCUS_06030 gene ubiD 19659 18196 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768425.1 protein_id gnl|my_center|LOCUS_06030 20540 19671 gene locus_tag LOCUS_06040 gene ubiA 20540 19671 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_06040 21614 23188 gene locus_tag LOCUS_06050 21614 23188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 23925 25493 gene locus_tag LOCUS_06060 23925 25493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 27225 25771 gene locus_tag LOCUS_06070 gene rng 27225 25771 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 protein_id gnl|my_center|LOCUS_06070 27922 27299 gene locus_tag LOCUS_06080 27922 27299 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261173.1 protein_id gnl|my_center|LOCUS_06080 28454 28017 gene locus_tag LOCUS_06090 gene rlmH 28454 28017 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 protein_id gnl|my_center|LOCUS_06090 28853 28533 gene locus_tag LOCUS_06100 28853 28533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 29527 28850 gene locus_tag LOCUS_06110 gene nadD 29527 28850 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210330.1 protein_id gnl|my_center|LOCUS_06110 30868 29558 gene locus_tag LOCUS_06120 gene aceF 30868 29558 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205154.1 protein_id gnl|my_center|LOCUS_06120 31550 30954 gene locus_tag LOCUS_06130 31550 30954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06130 33613 31550 gene locus_tag LOCUS_06140 gene aceE 33613 31550 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199569.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06140 34512 33637 gene locus_tag LOCUS_06150 gene folD 34512 33637 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524717.1 protein_id gnl|my_center|LOCUS_06150 35285 34596 gene locus_tag LOCUS_06160 35285 34596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 36283 35423 gene locus_tag LOCUS_06170 gene metF 36283 35423 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_06170 37865 36432 gene locus_tag LOCUS_06180 gene ahcY 37865 36432 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942520.1 protein_id gnl|my_center|LOCUS_06180 <38859 38011 gene locus_tag LOCUS_06190 <38859 38011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199069.1:methionine adenosyltransferase >Feature sequence016 244 1803 gene locus_tag LOCUS_06200 244 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 3050 1905 gene locus_tag LOCUS_06210 3050 1905 CDS product DUF1207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892004.1 protein_id gnl|my_center|LOCUS_06210 3527 3054 gene locus_tag LOCUS_06220 3527 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 4273 5319 gene locus_tag LOCUS_06230 4273 5319 CDS product catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516666.1 protein_id gnl|my_center|LOCUS_06230 5868 5380 gene locus_tag LOCUS_06240 gene yjgA 5868 5380 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189393.1 protein_id gnl|my_center|LOCUS_06240 6029 7387 gene locus_tag LOCUS_06250 gene pmbA 6029 7387 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188997.1 protein_id gnl|my_center|LOCUS_06250 7857 7630 gene locus_tag LOCUS_06260 7857 7630 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810665.1 protein_id gnl|my_center|LOCUS_06260 9186 7927 gene locus_tag LOCUS_06270 9186 7927 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626309.1 protein_id gnl|my_center|LOCUS_06270 9518 9721 gene locus_tag LOCUS_06280 9518 9721 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217533.1 protein_id gnl|my_center|LOCUS_06280 9986 11215 gene locus_tag LOCUS_06290 gene argJ 9986 11215 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202972.1 protein_id gnl|my_center|LOCUS_06290 11231 12100 gene locus_tag LOCUS_06300 11231 12100 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_06300 12113 13090 gene locus_tag LOCUS_06310 12113 13090 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064924.1 protein_id gnl|my_center|LOCUS_06310 13445 13260 gene locus_tag LOCUS_06320 13445 13260 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195120.1 protein_id gnl|my_center|LOCUS_06320 13682 14269 gene locus_tag LOCUS_06330 13682 14269 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 protein_id gnl|my_center|LOCUS_06330 14266 14880 gene locus_tag LOCUS_06340 14266 14880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 15197 17404 gene locus_tag LOCUS_06350 15197 17404 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_06350 17401 17874 gene locus_tag LOCUS_06360 17401 17874 CDS product DUF1854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928936.1 protein_id gnl|my_center|LOCUS_06360 17969 20296 gene locus_tag LOCUS_06370 gene cphA 17969 20296 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447960.1 protein_id gnl|my_center|LOCUS_06370 20293 22863 gene locus_tag LOCUS_06380 gene cphA 20293 22863 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928938.1 protein_id gnl|my_center|LOCUS_06380 23660 22905 gene locus_tag LOCUS_06390 gene zapD 23660 22905 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_06390 24388 23786 gene locus_tag LOCUS_06400 gene coaE 24388 23786 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194322.1 protein_id gnl|my_center|LOCUS_06400 25183 24392 gene locus_tag LOCUS_06410 25183 24392 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266634.1 protein_id gnl|my_center|LOCUS_06410 26518 25295 gene locus_tag LOCUS_06420 26518 25295 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947252.1 protein_id gnl|my_center|LOCUS_06420 27562 26660 gene locus_tag LOCUS_06430 27562 26660 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194782.1 protein_id gnl|my_center|LOCUS_06430 27610 28647 gene locus_tag LOCUS_06440 27610 28647 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_06440 29849 28674 gene locus_tag LOCUS_06450 29849 28674 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526333.1 protein_id gnl|my_center|LOCUS_06450 30800 29970 gene locus_tag LOCUS_06460 gene hemD 30800 29970 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026069.1 protein_id gnl|my_center|LOCUS_06460 31696 30803 gene locus_tag LOCUS_06470 gene hemC 31696 30803 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217854.1 protein_id gnl|my_center|LOCUS_06470 31881 34676 gene locus_tag LOCUS_06480 gene ppc 31881 34676 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085739.1 protein_id gnl|my_center|LOCUS_06480 34735 36039 gene locus_tag LOCUS_06490 34735 36039 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 protein_id gnl|my_center|LOCUS_06490 36055 36606 gene locus_tag LOCUS_06500 gene rsmD 36055 36606 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522861.1 protein_id gnl|my_center|LOCUS_06500 36606 37085 gene locus_tag LOCUS_06510 gene coaD 36606 37085 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808574.1 protein_id gnl|my_center|LOCUS_06510 37103 37354 gene locus_tag LOCUS_06520 37103 37354 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316325.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence017 203 1570 gene locus_tag LOCUS_06530 203 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 3254 1758 gene locus_tag LOCUS_06540 gene ppx 3254 1758 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005731673.1 protein_id gnl|my_center|LOCUS_06540 3297 3815 gene locus_tag LOCUS_06550 3297 3815 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035432.1 protein_id gnl|my_center|LOCUS_06550 4296 3871 gene locus_tag LOCUS_06560 4296 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 4843 4484 gene locus_tag LOCUS_06570 4843 4484 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_06570 6723 4894 gene locus_tag LOCUS_06580 6723 4894 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_06580 9173 6774 gene locus_tag LOCUS_06590 9173 6774 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039380.1 protein_id gnl|my_center|LOCUS_06590 9408 10601 gene locus_tag LOCUS_06600 gene dapE 9408 10601 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812538.1 protein_id gnl|my_center|LOCUS_06600 10749 11552 gene locus_tag LOCUS_06610 10749 11552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 12207 11566 gene locus_tag LOCUS_06620 12207 11566 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 protein_id gnl|my_center|LOCUS_06620 12954 12232 gene locus_tag LOCUS_06630 12954 12232 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946126.1 protein_id gnl|my_center|LOCUS_06630 14204 12951 gene locus_tag LOCUS_06640 14204 12951 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444859.1 protein_id gnl|my_center|LOCUS_06640 15673 14201 gene locus_tag LOCUS_06650 15673 14201 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 protein_id gnl|my_center|LOCUS_06650 16401 15670 gene locus_tag LOCUS_06660 16401 15670 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444858.1 protein_id gnl|my_center|LOCUS_06660 16569 18092 gene locus_tag LOCUS_06670 16569 18092 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764544.1 protein_id gnl|my_center|LOCUS_06670 18552 18253 gene locus_tag LOCUS_06680 18552 18253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 19747 18668 gene locus_tag LOCUS_06690 gene mnmA 19747 18668 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544237.1 protein_id gnl|my_center|LOCUS_06690 20225 19752 gene locus_tag LOCUS_06700 20225 19752 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 protein_id gnl|my_center|LOCUS_06700 20617 21282 gene locus_tag LOCUS_06710 20617 21282 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931872.1 protein_id gnl|my_center|LOCUS_06710 21370 24015 gene locus_tag LOCUS_06720 21370 24015 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_06720 25611 24046 gene locus_tag LOCUS_06730 25611 24046 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039281.1 protein_id gnl|my_center|LOCUS_06730 26191 25832 gene locus_tag LOCUS_06740 26191 25832 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141229.1 protein_id gnl|my_center|LOCUS_06740 26343 27044 gene locus_tag LOCUS_06750 26343 27044 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092922.1 protein_id gnl|my_center|LOCUS_06750 27456 28064 gene locus_tag LOCUS_06760 27456 28064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 28705 28136 gene locus_tag LOCUS_06770 28705 28136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 29768 28695 gene locus_tag LOCUS_06780 29768 28695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 31212 30070 gene locus_tag LOCUS_06790 31212 30070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 33614 31461 gene locus_tag LOCUS_06800 33614 31461 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_06800 33875 35551 gene locus_tag LOCUS_06810 33875 35551 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939410.1 protein_id gnl|my_center|LOCUS_06810 <36226 35621 gene locus_tag LOCUS_06820 <36226 35621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193614.1:phosphate ABC transporter ATP-binding protein PstB >Feature sequence018 2494 947 gene locus_tag LOCUS_06830 2494 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 2658 3320 gene locus_tag LOCUS_06840 2658 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 4925 3471 gene locus_tag LOCUS_06850 4925 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 7444 5183 gene locus_tag LOCUS_06860 7444 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 9965 7548 gene locus_tag LOCUS_06870 9965 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 10483 10259 gene locus_tag LOCUS_06880 10483 10259 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092075.1 protein_id gnl|my_center|LOCUS_06880 11084 10668 gene locus_tag LOCUS_06890 11084 10668 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064111.1 protein_id gnl|my_center|LOCUS_06890 11851 11084 gene locus_tag LOCUS_06900 11851 11084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 12424 11855 gene locus_tag LOCUS_06910 12424 11855 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530728.1 protein_id gnl|my_center|LOCUS_06910 12852 13223 gene locus_tag LOCUS_06920 12852 13223 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533619.1 protein_id gnl|my_center|LOCUS_06920 13418 14347 gene locus_tag LOCUS_06930 13418 14347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 14548 16848 gene locus_tag LOCUS_06940 14548 16848 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186104.1 protein_id gnl|my_center|LOCUS_06940 16864 17532 gene locus_tag LOCUS_06950 gene lolA 16864 17532 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185701.1 protein_id gnl|my_center|LOCUS_06950 17564 18844 gene locus_tag LOCUS_06960 17564 18844 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 protein_id gnl|my_center|LOCUS_06960 18878 20185 gene locus_tag LOCUS_06970 gene serS 18878 20185 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 protein_id gnl|my_center|LOCUS_06970 20225 20908 gene locus_tag LOCUS_06980 20225 20908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 21805 20918 gene locus_tag LOCUS_06990 21805 20918 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_06990 21852 22181 gene locus_tag LOCUS_07000 21852 22181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 22521 22841 gene locus_tag LOCUS_07010 22521 22841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 22918 23421 gene locus_tag LOCUS_07020 22918 23421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 23685 23939 gene locus_tag LOCUS_07030 23685 23939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 23996 25054 gene locus_tag LOCUS_07040 gene mutY 23996 25054 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522857.1 protein_id gnl|my_center|LOCUS_07040 25056 25640 gene locus_tag LOCUS_07050 25056 25640 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531468.1 protein_id gnl|my_center|LOCUS_07050 26366 25803 gene locus_tag LOCUS_07060 gene ubiX 26366 25803 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266526.1 protein_id gnl|my_center|LOCUS_07060 27484 26525 gene locus_tag LOCUS_07070 gene hprK 27484 26525 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687702.1 protein_id gnl|my_center|LOCUS_07070 27938 27471 gene locus_tag LOCUS_07080 gene ptsN 27938 27471 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 protein_id gnl|my_center|LOCUS_07080 28361 28035 gene locus_tag LOCUS_07090 gene hpf 28361 28035 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_07090 29833 28379 gene locus_tag LOCUS_07100 29833 28379 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_07100 30606 29884 gene locus_tag LOCUS_07110 gene lptB 30606 29884 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195214.1 protein_id gnl|my_center|LOCUS_07110 31132 30656 gene locus_tag LOCUS_07120 31132 30656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 31762 31196 gene locus_tag LOCUS_07130 31762 31196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 31966 33063 gene locus_tag LOCUS_07140 gene nadA 31966 33063 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_07140 33179 34351 gene locus_tag LOCUS_07150 gene clsB 33179 34351 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807044.1 protein_id gnl|my_center|LOCUS_07150 34383 35420 gene locus_tag LOCUS_07160 34383 35420 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188980.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence019 369 1865 gene locus_tag LOCUS_07170 gene istA 369 1865 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128955176.1 protein_id gnl|my_center|LOCUS_07170 1855 2091 gene locus_tag LOCUS_07180 1855 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 2000 2605 gene locus_tag LOCUS_07190 gene istB 2000 2605 CDS product IS21-like element IS1326 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163403.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07190 2657 2899 gene locus_tag LOCUS_07200 2657 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07200 4589 3210 gene locus_tag LOCUS_07210 4589 3210 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229161.1 protein_id gnl|my_center|LOCUS_07210 5313 4582 gene locus_tag LOCUS_07220 5313 4582 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427759.1 protein_id gnl|my_center|LOCUS_07220 6376 5384 gene locus_tag LOCUS_07230 6376 5384 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229150.1 protein_id gnl|my_center|LOCUS_07230 7536 6373 gene locus_tag LOCUS_07240 gene wecB 7536 6373 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829933.1 protein_id gnl|my_center|LOCUS_07240 8534 7554 gene locus_tag LOCUS_07250 8534 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 9455 9009 gene locus_tag LOCUS_07260 9455 9009 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958512.1 protein_id gnl|my_center|LOCUS_07260 9554 11071 gene locus_tag LOCUS_07270 gene ypwA 9554 11071 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398513.1 protein_id gnl|my_center|LOCUS_07270 11905 11081 gene locus_tag LOCUS_07280 gene pbpG 11905 11081 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706303.1 protein_id gnl|my_center|LOCUS_07280 12214 13008 gene locus_tag LOCUS_07290 12214 13008 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 protein_id gnl|my_center|LOCUS_07290 13762 12959 gene locus_tag LOCUS_07300 13762 12959 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687564.1 protein_id gnl|my_center|LOCUS_07300 14606 13800 gene locus_tag LOCUS_07310 gene dapB 14606 13800 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557251.1 protein_id gnl|my_center|LOCUS_07310 15064 14663 gene locus_tag LOCUS_07320 15064 14663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 15142 15582 gene locus_tag LOCUS_07330 gene fur 15142 15582 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_07330 15586 16869 gene locus_tag LOCUS_07340 15586 16869 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925859.1 protein_id gnl|my_center|LOCUS_07340 17955 16966 gene locus_tag LOCUS_07350 17955 16966 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 protein_id gnl|my_center|LOCUS_07350 18815 18318 gene locus_tag LOCUS_07360 18815 18318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 19102 19461 gene locus_tag LOCUS_07370 19102 19461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 20377 19472 gene locus_tag LOCUS_07380 gene ttcA 20377 19472 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692918.1 protein_id gnl|my_center|LOCUS_07380 20539 21000 gene locus_tag LOCUS_07390 20539 21000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 20997 21542 gene locus_tag LOCUS_07400 20997 21542 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552138.1 protein_id gnl|my_center|LOCUS_07400 21560 22030 gene locus_tag LOCUS_07410 21560 22030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 22096 23328 gene locus_tag LOCUS_07420 22096 23328 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525896.1 protein_id gnl|my_center|LOCUS_07420 23904 25577 gene locus_tag LOCUS_07430 23904 25577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 25608 26603 gene locus_tag LOCUS_07440 25608 26603 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 protein_id gnl|my_center|LOCUS_07440 28348 26639 gene locus_tag LOCUS_07450 28348 26639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140176.1 protein_id gnl|my_center|LOCUS_07450 29484 28435 gene locus_tag LOCUS_07460 gene fbaB 29484 28435 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500869.1 protein_id gnl|my_center|LOCUS_07460 30266 29574 gene locus_tag LOCUS_07470 gene lolD 30266 29574 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947993.1 protein_id gnl|my_center|LOCUS_07470 31506 30259 gene locus_tag LOCUS_07480 31506 30259 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_07480 34038 32194 gene locus_tag LOCUS_07490 34038 32194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 35066 34266 gene locus_tag LOCUS_07500 gene fliR 35066 34266 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 protein_id gnl|my_center|LOCUS_07500 35391 35119 gene locus_tag LOCUS_07510 gene fliQ 35391 35119 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211131.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence020 513 752 gene locus_tag LOCUS_07520 513 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 1133 1453 gene locus_tag LOCUS_07530 1133 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 2877 1516 gene locus_tag LOCUS_07540 gene hemN 2877 1516 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_07540 3200 3865 gene locus_tag LOCUS_07550 gene fnr 3200 3865 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 protein_id gnl|my_center|LOCUS_07550 4194 4919 gene locus_tag LOCUS_07560 gene rpsB 4194 4919 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193246.1 protein_id gnl|my_center|LOCUS_07560 5098 5979 gene locus_tag LOCUS_07570 gene tsf 5098 5979 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197087.1 protein_id gnl|my_center|LOCUS_07570 6017 6733 gene locus_tag LOCUS_07580 gene pyrH 6017 6733 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926571.1 protein_id gnl|my_center|LOCUS_07580 6783 7340 gene locus_tag LOCUS_07590 gene frr 6783 7340 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192143.1 protein_id gnl|my_center|LOCUS_07590 7450 8109 gene locus_tag LOCUS_07600 gene uppS 7450 8109 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527291.1 protein_id gnl|my_center|LOCUS_07600 8124 8942 gene locus_tag LOCUS_07610 8124 8942 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690029.1 protein_id gnl|my_center|LOCUS_07610 8945 10132 gene locus_tag LOCUS_07620 gene ispC 8945 10132 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765988.1 protein_id gnl|my_center|LOCUS_07620 10280 11647 gene locus_tag LOCUS_07630 gene rseP 10280 11647 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098594.1 protein_id gnl|my_center|LOCUS_07630 11651 13966 gene locus_tag LOCUS_07640 gene bamA 11651 13966 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535505.1 protein_id gnl|my_center|LOCUS_07640 13986 14522 gene locus_tag LOCUS_07650 13986 14522 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 protein_id gnl|my_center|LOCUS_07650 14579 15022 gene locus_tag LOCUS_07660 gene fabZ 14579 15022 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 protein_id gnl|my_center|LOCUS_07660 15038 15646 gene locus_tag LOCUS_07670 gene rnhB 15038 15646 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063751.1 protein_id gnl|my_center|LOCUS_07670 18646 15758 gene locus_tag LOCUS_07680 18646 15758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 20135 18672 gene locus_tag LOCUS_07690 20135 18672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 21977 20382 gene locus_tag LOCUS_07700 21977 20382 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963143.1 protein_id gnl|my_center|LOCUS_07700 22325 22774 gene locus_tag LOCUS_07710 22325 22774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 22950 25970 gene locus_tag LOCUS_07720 22950 25970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 26054 26890 gene locus_tag LOCUS_07730 26054 26890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 26969 27445 gene locus_tag LOCUS_07740 26969 27445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 27581 27796 gene locus_tag LOCUS_07750 27581 27796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 27828 29306 gene locus_tag LOCUS_07760 27828 29306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 30498 29401 gene locus_tag LOCUS_07770 30498 29401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 30801 32297 gene locus_tag LOCUS_07780 30801 32297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 32301 32948 gene locus_tag LOCUS_07790 32301 32948 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 protein_id gnl|my_center|LOCUS_07790 33779 32994 gene locus_tag LOCUS_07800 33779 32994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 34297 33947 gene locus_tag LOCUS_07810 34297 33947 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986793.1 protein_id gnl|my_center|LOCUS_07810 34542 34324 gene locus_tag LOCUS_07820 34542 34324 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927077.1 protein_id gnl|my_center|LOCUS_07820 >Feature sequence021 380 1495 gene locus_tag LOCUS_07830 gene ald 380 1495 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946659.1 protein_id gnl|my_center|LOCUS_07830 1614 2783 gene locus_tag LOCUS_07840 gene aroC 1614 2783 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534774.1 protein_id gnl|my_center|LOCUS_07840 3022 3098 gene locus_tag LOCUS_t00140 3022 3098 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3165 3240 gene locus_tag LOCUS_t00150 3165 3240 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4111 3917 gene locus_tag LOCUS_07850 4111 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 4303 4139 gene locus_tag LOCUS_07860 4303 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 4440 5048 gene locus_tag LOCUS_07870 4440 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 5045 6196 gene locus_tag LOCUS_07880 gene macA 5045 6196 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746442.1 protein_id gnl|my_center|LOCUS_07880 6193 7395 gene locus_tag LOCUS_07890 6193 7395 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_07890 7398 8108 gene locus_tag LOCUS_07900 7398 8108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_07900 9283 8549 gene locus_tag LOCUS_07910 gene ubiE 9283 8549 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217627.1 protein_id gnl|my_center|LOCUS_07910 9744 9337 gene locus_tag LOCUS_07920 9744 9337 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_07920 9837 10559 gene locus_tag LOCUS_07930 gene phoB 9837 10559 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_07930 10670 11902 gene locus_tag LOCUS_07940 gene phoR 10670 11902 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197666.1 protein_id gnl|my_center|LOCUS_07940 14500 12083 gene locus_tag LOCUS_07950 gene lon 14500 12083 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_07950 15930 14653 gene locus_tag LOCUS_07960 gene clpX 15930 14653 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521258.1 protein_id gnl|my_center|LOCUS_07960 16625 15987 gene locus_tag LOCUS_07970 gene clpP 16625 15987 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095857.1 protein_id gnl|my_center|LOCUS_07970 17931 16630 gene locus_tag LOCUS_07980 gene tig 17931 16630 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193941.1 protein_id gnl|my_center|LOCUS_07980 18096 18012 gene locus_tag LOCUS_t00160 18096 18012 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18926 18168 gene locus_tag LOCUS_07990 18926 18168 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 protein_id gnl|my_center|LOCUS_07990 20739 19090 gene locus_tag LOCUS_08000 gene groL 20739 19090 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185913.1 protein_id gnl|my_center|LOCUS_08000 21087 20797 gene locus_tag LOCUS_08010 gene groES 21087 20797 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808621.1 protein_id gnl|my_center|LOCUS_08010 21896 21621 gene locus_tag LOCUS_08020 21896 21621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 22829 22185 gene locus_tag LOCUS_08030 22829 22185 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695789.1 protein_id gnl|my_center|LOCUS_08030 23343 22813 gene locus_tag LOCUS_08040 23343 22813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 25377 23527 gene locus_tag LOCUS_08050 25377 23527 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192700.1 protein_id gnl|my_center|LOCUS_08050 25892 25698 gene locus_tag LOCUS_08060 25892 25698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 25965 28148 gene locus_tag LOCUS_08070 25965 28148 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189876.1 protein_id gnl|my_center|LOCUS_08070 28183 29523 gene locus_tag LOCUS_08080 28183 29523 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079997984.1 protein_id gnl|my_center|LOCUS_08080 29513 30526 gene locus_tag LOCUS_08090 gene pdxA 29513 30526 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103187.1 protein_id gnl|my_center|LOCUS_08090 30516 31298 gene locus_tag LOCUS_08100 gene rsmA 30516 31298 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225484.1 protein_id gnl|my_center|LOCUS_08100 31417 32646 gene locus_tag LOCUS_08110 31417 32646 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688344.1 protein_id gnl|my_center|LOCUS_08110 32691 32783 gene locus_tag LOCUS_t00170 32691 32783 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 33108 33338 gene locus_tag LOCUS_08120 33108 33338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 33445 33888 gene locus_tag LOCUS_08130 33445 33888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08130 >Feature sequence022 559 251 gene locus_tag LOCUS_08140 559 251 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_08140 2088 574 gene locus_tag LOCUS_08150 gene ubiB 2088 574 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 protein_id gnl|my_center|LOCUS_08150 2814 2227 gene locus_tag LOCUS_08160 2814 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 4259 3288 gene locus_tag LOCUS_08170 4259 3288 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929963.1 protein_id gnl|my_center|LOCUS_08170 5356 4256 gene locus_tag LOCUS_08180 gene rodA 5356 4256 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_08180 7110 5404 gene locus_tag LOCUS_08190 7110 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08190 7318 7037 gene locus_tag LOCUS_08200 7318 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 7866 7315 gene locus_tag LOCUS_08210 gene mreD 7866 7315 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523092.1 protein_id gnl|my_center|LOCUS_08210 8740 7841 gene locus_tag LOCUS_08220 gene mreC 8740 7841 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 protein_id gnl|my_center|LOCUS_08220 9872 8814 gene locus_tag LOCUS_08230 9872 8814 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_08230 10012 10299 gene locus_tag LOCUS_08240 gene gatC 10012 10299 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_08240 10411 11865 gene locus_tag LOCUS_08250 gene gatA 10411 11865 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_08250 11906 13345 gene locus_tag LOCUS_08260 gene gatB 11906 13345 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190092.1 protein_id gnl|my_center|LOCUS_08260 14404 13391 gene locus_tag LOCUS_08270 14404 13391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 14839 14552 gene locus_tag LOCUS_08280 14839 14552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 15119 15979 gene locus_tag LOCUS_08290 15119 15979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 16389 16192 gene locus_tag LOCUS_08300 16389 16192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 16901 17596 gene locus_tag LOCUS_08310 16901 17596 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065157.1 protein_id gnl|my_center|LOCUS_08310 17593 17826 gene locus_tag LOCUS_08320 17593 17826 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363729.1 protein_id gnl|my_center|LOCUS_08320 17907 19208 gene locus_tag LOCUS_08330 17907 19208 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065159.1 protein_id gnl|my_center|LOCUS_08330 19246 22080 gene locus_tag LOCUS_08340 19246 22080 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191889.1 protein_id gnl|my_center|LOCUS_08340 22094 23353 gene locus_tag LOCUS_08350 gene odhB 22094 23353 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930204.1 protein_id gnl|my_center|LOCUS_08350 23598 23673 gene locus_tag LOCUS_t00180 23598 23673 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 24162 24875 gene locus_tag LOCUS_08360 24162 24875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 27160 25784 gene locus_tag LOCUS_08370 27160 25784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 28296 28433 gene locus_tag LOCUS_08380 28296 28433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 28541 28996 gene locus_tag LOCUS_08390 gene aroQ 28541 28996 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814953.1 protein_id gnl|my_center|LOCUS_08390 29128 29610 gene locus_tag LOCUS_08400 gene accB 29128 29610 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707112.1 protein_id gnl|my_center|LOCUS_08400 29635 30990 gene locus_tag LOCUS_08410 gene accC 29635 30990 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814951.1 protein_id gnl|my_center|LOCUS_08410 31044 31961 gene locus_tag LOCUS_08420 gene prmA 31044 31961 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223022.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence023 741 1253 gene locus_tag LOCUS_08430 gene cheW 741 1253 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811919.1 protein_id gnl|my_center|LOCUS_08430 1301 3028 gene locus_tag LOCUS_08440 1301 3028 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535875.1 protein_id gnl|my_center|LOCUS_08440 3232 4545 gene locus_tag LOCUS_08450 3232 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 4840 5208 gene locus_tag LOCUS_08460 4840 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 5395 5547 gene locus_tag LOCUS_08470 5395 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 7100 5601 gene locus_tag LOCUS_08480 7100 5601 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011342568.1 protein_id gnl|my_center|LOCUS_08480 7233 7322 gene locus_tag LOCUS_t00190 7233 7322 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8059 8622 gene locus_tag LOCUS_08490 8059 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 8619 9674 gene locus_tag LOCUS_08500 gene wecB 8619 9674 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_08500 11528 9693 gene locus_tag LOCUS_08510 11528 9693 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089039.1 protein_id gnl|my_center|LOCUS_08510 13175 11925 gene locus_tag LOCUS_08520 13175 11925 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_08520 14906 13386 gene locus_tag LOCUS_08530 14906 13386 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727782.1 protein_id gnl|my_center|LOCUS_08530 15159 15539 gene locus_tag LOCUS_08540 15159 15539 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140042.1 protein_id gnl|my_center|LOCUS_08540 15888 16484 gene locus_tag LOCUS_08550 15888 16484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 17161 16751 gene locus_tag LOCUS_08560 17161 16751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 18116 17343 gene locus_tag LOCUS_08570 gene gloB 18116 17343 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456739.1 protein_id gnl|my_center|LOCUS_08570 18191 18961 gene locus_tag LOCUS_08580 18191 18961 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 protein_id gnl|my_center|LOCUS_08580 18958 19428 gene locus_tag LOCUS_08590 gene rnhA 18958 19428 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_08590 19437 20156 gene locus_tag LOCUS_08600 gene dnaQ 19437 20156 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 protein_id gnl|my_center|LOCUS_08600 20171 20452 gene locus_tag LOCUS_08610 20171 20452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 21103 21960 gene locus_tag LOCUS_08620 21103 21960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 24526 22001 gene locus_tag LOCUS_08630 24526 22001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 24830 26197 gene locus_tag LOCUS_08640 24830 26197 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_08640 27451 26798 gene locus_tag LOCUS_08650 27451 26798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 27712 29277 gene locus_tag LOCUS_08660 27712 29277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 29652 31478 gene locus_tag LOCUS_08670 gene ftsH 29652 31478 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_08670 <32361 31492 gene locus_tag LOCUS_08680 <32361 31492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941539.1:diacylglycerol kinase family protein >Feature sequence024 1643 1816 gene locus_tag LOCUS_08690 1643 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 1853 2845 gene locus_tag LOCUS_08700 1853 2845 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_08700 3028 3357 gene locus_tag LOCUS_08710 3028 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 5545 3419 gene locus_tag LOCUS_08720 5545 3419 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265858.1 protein_id gnl|my_center|LOCUS_08720 5899 7386 gene locus_tag LOCUS_08730 5899 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 7484 9985 gene locus_tag LOCUS_08740 gene mgtA 7484 9985 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948085.1 protein_id gnl|my_center|LOCUS_08740 10189 11643 gene locus_tag LOCUS_08750 10189 11643 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262914.1 protein_id gnl|my_center|LOCUS_08750 11760 12410 gene locus_tag LOCUS_08760 11760 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 13355 12444 gene locus_tag LOCUS_08770 13355 12444 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_08770 16915 13421 gene locus_tag LOCUS_08780 gene dnaE 16915 13421 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522462.1 protein_id gnl|my_center|LOCUS_08780 16889 18343 gene locus_tag LOCUS_08790 gene yegQ 16889 18343 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 protein_id gnl|my_center|LOCUS_08790 19366 18359 gene locus_tag LOCUS_08800 19366 18359 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189905.1 protein_id gnl|my_center|LOCUS_08800 19734 21884 gene locus_tag LOCUS_08810 19734 21884 CDS product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113604.1 protein_id gnl|my_center|LOCUS_08810 22017 22853 gene locus_tag LOCUS_08820 22017 22853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 23294 22950 gene locus_tag LOCUS_08830 23294 22950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 24040 23510 gene locus_tag LOCUS_08840 24040 23510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 25244 24180 gene locus_tag LOCUS_08850 25244 24180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 25773 26555 gene locus_tag LOCUS_08860 25773 26555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08860 26571 27164 gene locus_tag LOCUS_08870 26571 27164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 27157 28254 gene locus_tag LOCUS_08880 gene amrS 27157 28254 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 protein_id gnl|my_center|LOCUS_08880 28254 28880 gene locus_tag LOCUS_08890 28254 28880 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522757.1 protein_id gnl|my_center|LOCUS_08890 29211 28909 gene locus_tag LOCUS_08900 29211 28909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 29559 29239 gene locus_tag LOCUS_08910 29559 29239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence025 <1 893 gene locus_tag LOCUS_08920 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203446.1:dipeptidase 893 1684 gene locus_tag LOCUS_08930 893 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 3107 1710 gene locus_tag LOCUS_08940 3107 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 3818 4072 gene locus_tag LOCUS_08950 3818 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 4062 4955 gene locus_tag LOCUS_08960 4062 4955 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691917.1 protein_id gnl|my_center|LOCUS_08960 4991 6835 gene locus_tag LOCUS_08970 gene dxs 4991 6835 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266656.1 protein_id gnl|my_center|LOCUS_08970 6949 7752 gene locus_tag LOCUS_08980 gene folE2 6949 7752 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_08980 7868 8965 gene locus_tag LOCUS_08990 7868 8965 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940869.1 protein_id gnl|my_center|LOCUS_08990 10545 9043 gene locus_tag LOCUS_09000 gene murJ 10545 9043 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211214.1 protein_id gnl|my_center|LOCUS_09000 11399 10677 gene locus_tag LOCUS_09010 11399 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 11894 12103 gene locus_tag LOCUS_09020 11894 12103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 12578 12129 gene locus_tag LOCUS_09030 gene ssb 12578 12129 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_09030 13963 12578 gene locus_tag LOCUS_09040 13963 12578 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951164.1 protein_id gnl|my_center|LOCUS_09040 14030 16849 gene locus_tag LOCUS_09050 gene uvrA 14030 16849 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526066.1 protein_id gnl|my_center|LOCUS_09050 16846 18111 gene locus_tag LOCUS_09060 16846 18111 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 protein_id gnl|my_center|LOCUS_09060 18643 18104 gene locus_tag LOCUS_09070 18643 18104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 19088 18651 gene locus_tag LOCUS_09080 19088 18651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 20417 19221 gene locus_tag LOCUS_09090 20417 19221 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188361.1 protein_id gnl|my_center|LOCUS_09090 21059 20865 gene locus_tag LOCUS_09100 21059 20865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 22654 21563 gene locus_tag LOCUS_09110 22654 21563 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535743.1 protein_id gnl|my_center|LOCUS_09110 23339 22683 gene locus_tag LOCUS_09120 gene msrA 23339 22683 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945865.1 protein_id gnl|my_center|LOCUS_09120 23870 23343 gene locus_tag LOCUS_09130 gene msrB 23870 23343 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404837.1 protein_id gnl|my_center|LOCUS_09130 24055 25023 gene locus_tag LOCUS_09140 24055 25023 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193249.1 protein_id gnl|my_center|LOCUS_09140 25028 26350 gene locus_tag LOCUS_09150 gene tilS 25028 26350 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772040.1 protein_id gnl|my_center|LOCUS_09150 26431 27489 gene locus_tag LOCUS_09160 gene rfbB 26431 27489 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_09160 27486 28388 gene locus_tag LOCUS_09170 gene rfbD 27486 28388 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771401.1 protein_id gnl|my_center|LOCUS_09170 28654 29361 gene locus_tag LOCUS_09180 28654 29361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence026 110 601 gene locus_tag LOCUS_09190 110 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1507 623 gene locus_tag LOCUS_09200 gene nadC 1507 623 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_09200 1589 3085 gene locus_tag LOCUS_09210 1589 3085 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_09210 3333 6419 gene locus_tag LOCUS_09220 3333 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 6486 9095 gene locus_tag LOCUS_09230 gene clpB 6486 9095 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521310.1 protein_id gnl|my_center|LOCUS_09230 9195 10082 gene locus_tag LOCUS_09240 gene dapA 9195 10082 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809954.1 protein_id gnl|my_center|LOCUS_09240 10084 11244 gene locus_tag LOCUS_09250 gene bamC 10084 11244 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524737.1 protein_id gnl|my_center|LOCUS_09250 11558 11337 gene locus_tag LOCUS_09260 11558 11337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 12953 11706 gene locus_tag LOCUS_09270 gene glcF 12953 11706 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268367.1 protein_id gnl|my_center|LOCUS_09270 14027 12954 gene locus_tag LOCUS_09280 gene glcE 14027 12954 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_09280 15487 14033 gene locus_tag LOCUS_09290 gene glcD 15487 14033 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765139.1 protein_id gnl|my_center|LOCUS_09290 16397 15492 gene locus_tag LOCUS_09300 16397 15492 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085952.1 protein_id gnl|my_center|LOCUS_09300 21164 16641 gene locus_tag LOCUS_09310 21164 16641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 21900 21664 gene locus_tag LOCUS_09320 21900 21664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 22866 22267 gene locus_tag LOCUS_09330 22866 22267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 23277 22915 gene locus_tag LOCUS_09340 23277 22915 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816964.1 protein_id gnl|my_center|LOCUS_09340 23790 23326 gene locus_tag LOCUS_09350 23790 23326 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_09350 24270 23854 gene locus_tag LOCUS_09360 24270 23854 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529094.1 protein_id gnl|my_center|LOCUS_09360 24778 24416 gene locus_tag LOCUS_09370 24778 24416 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_09370 25189 24815 gene locus_tag LOCUS_09380 25189 24815 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_09380 26534 25272 gene locus_tag LOCUS_09390 26534 25272 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 protein_id gnl|my_center|LOCUS_09390 26926 27915 gene locus_tag LOCUS_09400 gene mpr 26926 27915 CDS product extracellular metalloprotease Mpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246370.1 protein_id gnl|my_center|LOCUS_09400 28012 28410 gene locus_tag LOCUS_09410 28012 28410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 >Feature sequence027 373 116 gene locus_tag LOCUS_09420 373 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 559 470 gene locus_tag LOCUS_t00200 559 470 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4330 659 gene locus_tag LOCUS_09430 4330 659 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204931.1 protein_id gnl|my_center|LOCUS_09430 6355 4520 gene locus_tag LOCUS_09440 6355 4520 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204930.1 protein_id gnl|my_center|LOCUS_09440 6398 7072 gene locus_tag LOCUS_09450 6398 7072 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_09450 7102 7290 gene locus_tag LOCUS_09460 7102 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 7296 9113 gene locus_tag LOCUS_09470 gene uvrC 7296 9113 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930726.1 protein_id gnl|my_center|LOCUS_09470 9197 9781 gene locus_tag LOCUS_09480 gene pgsA 9197 9781 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192722.1 protein_id gnl|my_center|LOCUS_09480 10063 10434 gene locus_tag LOCUS_09490 10063 10434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 11752 12156 gene locus_tag LOCUS_09500 11752 12156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 12175 12729 gene locus_tag LOCUS_09510 12175 12729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 12919 14022 gene locus_tag LOCUS_09520 12919 14022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 14225 15658 gene locus_tag LOCUS_09530 14225 15658 CDS product M10 family metallopeptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392401.1 protein_id gnl|my_center|LOCUS_09530 15775 16161 gene locus_tag LOCUS_09540 15775 16161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 17885 16965 gene locus_tag LOCUS_09550 gene motB 17885 16965 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938926.1 protein_id gnl|my_center|LOCUS_09550 18787 17927 gene locus_tag LOCUS_09560 gene motA 18787 17927 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 protein_id gnl|my_center|LOCUS_09560 21393 19657 gene locus_tag LOCUS_09570 21393 19657 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225606.1 protein_id gnl|my_center|LOCUS_09570 22470 21751 gene locus_tag LOCUS_09580 22470 21751 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268013.1 protein_id gnl|my_center|LOCUS_09580 23061 22573 gene locus_tag LOCUS_09590 23061 22573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 23347 23141 gene locus_tag LOCUS_09600 23347 23141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 23671 23366 gene locus_tag LOCUS_09610 23671 23366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 23925 23674 gene locus_tag LOCUS_09620 23925 23674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 25425 24010 gene locus_tag LOCUS_09630 gene thrC 25425 24010 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192708.1 protein_id gnl|my_center|LOCUS_09630 26817 25504 gene locus_tag LOCUS_09640 26817 25504 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 protein_id gnl|my_center|LOCUS_09640 27127 27579 gene locus_tag LOCUS_09650 27127 27579 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973802.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence028 1929 19 gene locus_tag LOCUS_09660 1929 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 2727 2026 gene locus_tag LOCUS_09670 2727 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 3718 3158 gene locus_tag LOCUS_09680 3718 3158 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391278.1 protein_id gnl|my_center|LOCUS_09680 4321 3833 gene locus_tag LOCUS_09690 4321 3833 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_09690 5577 4318 gene locus_tag LOCUS_09700 5577 4318 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_09700 6881 5574 gene locus_tag LOCUS_09710 gene sufD 6881 5574 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946340.1 protein_id gnl|my_center|LOCUS_09710 7672 6878 gene locus_tag LOCUS_09720 gene sufC 7672 6878 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_09720 9105 7669 gene locus_tag LOCUS_09730 gene sufB 9105 7669 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_09730 9567 9226 gene locus_tag LOCUS_09740 gene iscA 9567 9226 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_09740 10172 9690 gene locus_tag LOCUS_09750 gene iscR 10172 9690 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_09750 10595 11743 gene locus_tag LOCUS_09760 10595 11743 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013491.1 protein_id gnl|my_center|LOCUS_09760 13982 11778 gene locus_tag LOCUS_09770 13982 11778 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195838.1 protein_id gnl|my_center|LOCUS_09770 15357 14092 gene locus_tag LOCUS_09780 15357 14092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 15720 16832 gene locus_tag LOCUS_09790 15720 16832 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 protein_id gnl|my_center|LOCUS_09790 16871 17737 gene locus_tag LOCUS_09800 16871 17737 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229732.1 protein_id gnl|my_center|LOCUS_09800 17820 18176 gene locus_tag LOCUS_09810 17820 18176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 18251 18730 gene locus_tag LOCUS_09820 18251 18730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 18741 19124 gene locus_tag LOCUS_09830 18741 19124 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 protein_id gnl|my_center|LOCUS_09830 19141 19671 gene locus_tag LOCUS_09840 19141 19671 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037898.1 protein_id gnl|my_center|LOCUS_09840 19887 20138 gene locus_tag LOCUS_09850 19887 20138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 20236 21030 gene locus_tag LOCUS_09860 20236 21030 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094853.1 protein_id gnl|my_center|LOCUS_09860 22584 21172 gene locus_tag LOCUS_09870 gene argH 22584 21172 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812010.1 protein_id gnl|my_center|LOCUS_09870 22857 23468 gene locus_tag LOCUS_09880 22857 23468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 24789 23539 gene locus_tag LOCUS_09890 gene murA 24789 23539 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185050.1 protein_id gnl|my_center|LOCUS_09890 24945 25328 gene locus_tag LOCUS_09900 24945 25328 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_09900 25347 27416 gene locus_tag LOCUS_09910 gene recG 25347 27416 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917883.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence029 1868 324 gene locus_tag LOCUS_09920 1868 324 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227986.1 protein_id gnl|my_center|LOCUS_09920 2795 1881 gene locus_tag LOCUS_09930 2795 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3138 2809 gene locus_tag LOCUS_09940 3138 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 3982 3164 gene locus_tag LOCUS_09950 3982 3164 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 protein_id gnl|my_center|LOCUS_09950 4638 4036 gene locus_tag LOCUS_09960 gene wrbA 4638 4036 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975540.1 protein_id gnl|my_center|LOCUS_09960 6714 4897 gene locus_tag LOCUS_09970 6714 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 6862 7134 gene locus_tag LOCUS_09980 6862 7134 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_09980 7121 7375 gene locus_tag LOCUS_09990 7121 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 8863 7523 gene locus_tag LOCUS_10000 8863 7523 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_10000 8987 9814 gene locus_tag LOCUS_10010 8987 9814 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_10010 9872 11362 gene locus_tag LOCUS_10020 9872 11362 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921351.1 protein_id gnl|my_center|LOCUS_10020 12314 11385 gene locus_tag LOCUS_10030 12314 11385 CDS product GIDE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_10030 12901 12329 gene locus_tag LOCUS_10040 12901 12329 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_10040 13141 13512 gene locus_tag LOCUS_10050 13141 13512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 13773 14129 gene locus_tag LOCUS_10060 13773 14129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 14562 15905 gene locus_tag LOCUS_10070 gene gdhA 14562 15905 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206092.1 protein_id gnl|my_center|LOCUS_10070 16055 17965 gene locus_tag LOCUS_10080 16055 17965 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197235.1 protein_id gnl|my_center|LOCUS_10080 17990 19168 gene locus_tag LOCUS_10090 17990 19168 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527148.1 protein_id gnl|my_center|LOCUS_10090 19215 19619 gene locus_tag LOCUS_10100 19215 19619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 20149 19679 gene locus_tag LOCUS_10110 20149 19679 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_10110 20536 21642 gene locus_tag LOCUS_10120 20536 21642 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_10120 21669 22316 gene locus_tag LOCUS_10130 21669 22316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 23160 22336 gene locus_tag LOCUS_10140 23160 22336 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_10140 23627 23163 gene locus_tag LOCUS_10150 23627 23163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 23840 24325 gene locus_tag LOCUS_10160 23840 24325 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039582.1 protein_id gnl|my_center|LOCUS_10160 25681 24362 gene locus_tag LOCUS_10170 25681 24362 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_10170 25889 27037 gene locus_tag LOCUS_10180 25889 27037 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535007.1 protein_id gnl|my_center|LOCUS_10180 27378 27049 gene locus_tag LOCUS_10190 27378 27049 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_10190 27630 27391 gene locus_tag LOCUS_10200 27630 27391 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976578.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence030 1618 1271 gene locus_tag LOCUS_10210 1618 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 2508 4742 gene locus_tag LOCUS_10220 2508 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 5746 4805 gene locus_tag LOCUS_10230 5746 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 7266 5902 gene locus_tag LOCUS_10240 7266 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10240 8127 7393 gene locus_tag LOCUS_10250 8127 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10250 8948 8127 gene locus_tag LOCUS_10260 8948 8127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 10837 9746 gene locus_tag LOCUS_10270 gene ychF 10837 9746 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225667.1 protein_id gnl|my_center|LOCUS_10270 11465 10896 gene locus_tag LOCUS_10280 gene pth 11465 10896 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687802.1 protein_id gnl|my_center|LOCUS_10280 12308 11691 gene locus_tag LOCUS_10290 12308 11691 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200150.1 protein_id gnl|my_center|LOCUS_10290 13328 12378 gene locus_tag LOCUS_10300 13328 12378 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_10300 13551 13477 gene locus_tag LOCUS_t00210 13551 13477 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 14398 13559 gene locus_tag LOCUS_10310 gene ispE 14398 13559 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195241.1 protein_id gnl|my_center|LOCUS_10310 14992 14435 gene locus_tag LOCUS_10320 14992 14435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 15446 15168 gene locus_tag LOCUS_10330 gene minE 15446 15168 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091581.1 protein_id gnl|my_center|LOCUS_10330 16255 15443 gene locus_tag LOCUS_10340 gene minD 16255 15443 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091579.1 protein_id gnl|my_center|LOCUS_10340 17049 16282 gene locus_tag LOCUS_10350 gene minC 17049 16282 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114802.1 protein_id gnl|my_center|LOCUS_10350 18934 17195 gene locus_tag LOCUS_10360 18934 17195 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_10360 19614 20960 gene locus_tag LOCUS_10370 gene lnt 19614 20960 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089648.1 protein_id gnl|my_center|LOCUS_10370 21009 21935 gene locus_tag LOCUS_10380 gene glyQ 21009 21935 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189444.1 protein_id gnl|my_center|LOCUS_10380 21932 24055 gene locus_tag LOCUS_10390 gene glyS 21932 24055 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189008.1 protein_id gnl|my_center|LOCUS_10390 24052 24591 gene locus_tag LOCUS_10400 gene gmhB 24052 24591 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 protein_id gnl|my_center|LOCUS_10400 24588 25319 gene locus_tag LOCUS_10410 24588 25319 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814405.1 protein_id gnl|my_center|LOCUS_10410 25286 26023 gene locus_tag LOCUS_10420 25286 26023 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 protein_id gnl|my_center|LOCUS_10420 27228 26197 gene locus_tag LOCUS_10430 27228 26197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence031 899 306 gene locus_tag LOCUS_10440 899 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 2056 1004 gene locus_tag LOCUS_10450 2056 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 2770 2060 gene locus_tag LOCUS_10460 2770 2060 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946869.1 protein_id gnl|my_center|LOCUS_10460 4136 2862 gene locus_tag LOCUS_10470 4136 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 4382 4711 gene locus_tag LOCUS_10480 4382 4711 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 protein_id gnl|my_center|LOCUS_10480 4750 5172 gene locus_tag LOCUS_10490 4750 5172 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 protein_id gnl|my_center|LOCUS_10490 5175 5663 gene locus_tag LOCUS_10500 5175 5663 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095198.1 protein_id gnl|my_center|LOCUS_10500 5692 6990 gene locus_tag LOCUS_10510 5692 6990 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095195.1 protein_id gnl|my_center|LOCUS_10510 7557 7216 gene locus_tag LOCUS_10520 7557 7216 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948678.1 protein_id gnl|my_center|LOCUS_10520 8575 7544 gene locus_tag LOCUS_10530 8575 7544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 8604 9518 gene locus_tag LOCUS_10540 gene rsmI 8604 9518 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210149.1 protein_id gnl|my_center|LOCUS_10540 9587 10627 gene locus_tag LOCUS_10550 gene pyrC 9587 10627 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_10550 11074 13614 gene locus_tag LOCUS_10560 11074 13614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 14423 13785 gene locus_tag LOCUS_10570 14423 13785 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920979.1 protein_id gnl|my_center|LOCUS_10570 15703 14480 gene locus_tag LOCUS_10580 15703 14480 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_10580 16523 15789 gene locus_tag LOCUS_10590 16523 15789 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_10590 17668 16523 gene locus_tag LOCUS_10600 17668 16523 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_10600 19290 17764 gene locus_tag LOCUS_10610 19290 17764 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189765.1 protein_id gnl|my_center|LOCUS_10610 19505 20944 gene locus_tag LOCUS_10620 19505 20944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 20941 22101 gene locus_tag LOCUS_10630 20941 22101 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814066.1 protein_id gnl|my_center|LOCUS_10630 22117 25230 gene locus_tag LOCUS_10640 22117 25230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 25239 26357 gene locus_tag LOCUS_10650 25239 26357 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121674.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence032 177 851 gene locus_tag LOCUS_10660 177 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1828 983 gene locus_tag LOCUS_10670 1828 983 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942704.1 protein_id gnl|my_center|LOCUS_10670 2820 1972 gene locus_tag LOCUS_10680 gene trpC 2820 1972 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522001.1 protein_id gnl|my_center|LOCUS_10680 3855 2827 gene locus_tag LOCUS_10690 gene trpD 3855 2827 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186823.1 protein_id gnl|my_center|LOCUS_10690 4445 3852 gene locus_tag LOCUS_10700 4445 3852 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767895.1 protein_id gnl|my_center|LOCUS_10700 4703 5116 gene locus_tag LOCUS_10710 gene rpsF 4703 5116 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193673.1 protein_id gnl|my_center|LOCUS_10710 5123 5431 gene locus_tag LOCUS_10720 5123 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 5444 5725 gene locus_tag LOCUS_10730 gene rpsR 5444 5725 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193360.1 protein_id gnl|my_center|LOCUS_10730 5738 6193 gene locus_tag LOCUS_10740 gene rplI 5738 6193 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813092.1 protein_id gnl|my_center|LOCUS_10740 6435 7823 gene locus_tag LOCUS_10750 6435 7823 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192724.1 protein_id gnl|my_center|LOCUS_10750 10120 8318 gene locus_tag LOCUS_10760 10120 8318 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_10760 10274 10678 gene locus_tag LOCUS_10770 10274 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 10977 10675 gene locus_tag LOCUS_10780 10977 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 12733 11015 gene locus_tag LOCUS_10790 12733 11015 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528518.1 protein_id gnl|my_center|LOCUS_10790 14795 12900 gene locus_tag LOCUS_10800 14795 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 17483 15060 gene locus_tag LOCUS_10810 17483 15060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_10810 18463 17753 gene locus_tag LOCUS_10820 18463 17753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 20221 18941 gene locus_tag LOCUS_10830 20221 18941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 20946 20227 gene locus_tag LOCUS_10840 20946 20227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 21392 22294 gene locus_tag LOCUS_10850 21392 22294 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_10850 22386 26144 gene locus_tag LOCUS_10860 22386 26144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence033 2858 63 gene locus_tag LOCUS_10870 2858 63 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030589.1 protein_id gnl|my_center|LOCUS_10870 4162 2954 gene locus_tag LOCUS_10880 4162 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 4396 4163 gene locus_tag LOCUS_10890 4396 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 5632 4409 gene locus_tag LOCUS_10900 5632 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 6840 7718 gene locus_tag LOCUS_10910 gene birA 6840 7718 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262797.1 protein_id gnl|my_center|LOCUS_10910 7725 8489 gene locus_tag LOCUS_10920 7725 8489 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 protein_id gnl|my_center|LOCUS_10920 8502 9095 gene locus_tag LOCUS_10930 gene yihA 8502 9095 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248759.1 protein_id gnl|my_center|LOCUS_10930 9500 10468 gene locus_tag LOCUS_10940 gene hemB 9500 10468 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521908.1 protein_id gnl|my_center|LOCUS_10940 12930 10606 gene locus_tag LOCUS_10950 12930 10606 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110255951.1 protein_id gnl|my_center|LOCUS_10950 13144 14247 gene locus_tag LOCUS_10960 13144 14247 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_10960 14244 14816 gene locus_tag LOCUS_10970 14244 14816 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765503.1 protein_id gnl|my_center|LOCUS_10970 14864 15475 gene locus_tag LOCUS_10980 gene pilO 14864 15475 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_10980 15479 15997 gene locus_tag LOCUS_10990 15479 15997 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692554.1 protein_id gnl|my_center|LOCUS_10990 16024 18126 gene locus_tag LOCUS_11000 16024 18126 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765499.1 protein_id gnl|my_center|LOCUS_11000 18598 18134 gene locus_tag LOCUS_11010 gene trmL 18598 18134 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218664.1 protein_id gnl|my_center|LOCUS_11010 19154 18615 gene locus_tag LOCUS_11020 19154 18615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 19439 20446 gene locus_tag LOCUS_11030 gene bioB 19439 20446 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926132.1 protein_id gnl|my_center|LOCUS_11030 20447 20767 gene locus_tag LOCUS_11040 20447 20767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11040 20768 21610 gene locus_tag LOCUS_11050 20768 21610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11050 21607 22377 gene locus_tag LOCUS_11060 gene bioH 21607 22377 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489494.1 protein_id gnl|my_center|LOCUS_11060 22355 23236 gene locus_tag LOCUS_11070 22355 23236 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065340943.1 protein_id gnl|my_center|LOCUS_11070 23239 23931 gene locus_tag LOCUS_11080 gene bioD 23239 23931 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530983.1 protein_id gnl|my_center|LOCUS_11080 23971 24270 gene locus_tag LOCUS_11090 23971 24270 CDS product DUF3175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957602.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence034 84 1037 gene locus_tag LOCUS_11100 gene cysB 84 1037 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_11100 1213 1776 gene locus_tag LOCUS_11110 1213 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 2379 3233 gene locus_tag LOCUS_11120 2379 3233 CDS product Tim44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073997.1 protein_id gnl|my_center|LOCUS_11120 3336 3797 gene locus_tag LOCUS_11130 3336 3797 CDS product DUF2165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209941.1 protein_id gnl|my_center|LOCUS_11130 4282 3893 gene locus_tag LOCUS_11140 4282 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 5311 4361 gene locus_tag LOCUS_11150 5311 4361 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194474.1 protein_id gnl|my_center|LOCUS_11150 6288 5308 gene locus_tag LOCUS_11160 gene cysK 6288 5308 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706833.1 protein_id gnl|my_center|LOCUS_11160 8797 6413 gene locus_tag LOCUS_11170 8797 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 10060 8798 gene locus_tag LOCUS_11180 10060 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 10243 11004 gene locus_tag LOCUS_11190 10243 11004 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192554.1 protein_id gnl|my_center|LOCUS_11190 11151 12029 gene locus_tag LOCUS_11200 11151 12029 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970816.1 protein_id gnl|my_center|LOCUS_11200 12032 13657 gene locus_tag LOCUS_11210 12032 13657 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123836.1 protein_id gnl|my_center|LOCUS_11210 13647 14741 gene locus_tag LOCUS_11220 13647 14741 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122967.1 protein_id gnl|my_center|LOCUS_11220 15360 17450 gene locus_tag LOCUS_11230 15360 17450 CDS product M10 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970172.1 protein_id gnl|my_center|LOCUS_11230 18795 17959 gene locus_tag LOCUS_11240 18795 17959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 20724 18865 gene locus_tag LOCUS_11250 20724 18865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 21738 20923 gene locus_tag LOCUS_11260 21738 20923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence035 999 220 gene locus_tag LOCUS_11270 999 220 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809774.1 protein_id gnl|my_center|LOCUS_11270 1328 1032 gene locus_tag LOCUS_11280 1328 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2325 1315 gene locus_tag LOCUS_11290 2325 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 2706 2368 gene locus_tag LOCUS_11300 2706 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 3155 2727 gene locus_tag LOCUS_11310 gene fliS 3155 2727 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096007.1 protein_id gnl|my_center|LOCUS_11310 5163 3190 gene locus_tag LOCUS_11320 5163 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 5572 5204 gene locus_tag LOCUS_11330 5572 5204 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943643.1 protein_id gnl|my_center|LOCUS_11330 7132 5672 gene locus_tag LOCUS_11340 7132 5672 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_11340 7434 8966 gene locus_tag LOCUS_11350 7434 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 9016 9648 gene locus_tag LOCUS_11360 gene rqpR 9016 9648 CDS product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 protein_id gnl|my_center|LOCUS_11360 9680 11530 gene locus_tag LOCUS_11370 9680 11530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 11827 12627 gene locus_tag LOCUS_11380 11827 12627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 12934 14172 gene locus_tag LOCUS_11390 12934 14172 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_11390 14361 14936 gene locus_tag LOCUS_11400 14361 14936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 14999 15364 gene locus_tag LOCUS_11410 14999 15364 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083943.1 protein_id gnl|my_center|LOCUS_11410 15486 17669 gene locus_tag LOCUS_11420 gene cheA 15486 17669 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210886.1 protein_id gnl|my_center|LOCUS_11420 17896 18759 gene locus_tag LOCUS_11430 17896 18759 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525698.1 protein_id gnl|my_center|LOCUS_11430 18763 19374 gene locus_tag LOCUS_11440 gene cheD 18763 19374 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_11440 19388 20467 gene locus_tag LOCUS_11450 19388 20467 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200023.1 protein_id gnl|my_center|LOCUS_11450 <22274 21493 gene locus_tag LOCUS_11460 <22274 21493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966253.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence036 2210 1470 gene locus_tag LOCUS_11470 2210 1470 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_11470 2359 3477 gene locus_tag LOCUS_11480 2359 3477 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064710.1 protein_id gnl|my_center|LOCUS_11480 3543 4628 gene locus_tag LOCUS_11490 gene hisC 3543 4628 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_11490 4668 5255 gene locus_tag LOCUS_11500 gene hisB 4668 5255 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199911.1 protein_id gnl|my_center|LOCUS_11500 5281 5925 gene locus_tag LOCUS_11510 gene hisH 5281 5925 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199907.1 protein_id gnl|my_center|LOCUS_11510 5979 6734 gene locus_tag LOCUS_11520 gene hisA 5979 6734 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_11520 6796 7572 gene locus_tag LOCUS_11530 gene hisF 6796 7572 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_11530 7628 8020 gene locus_tag LOCUS_11540 gene hisI 7628 8020 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_11540 8017 8343 gene locus_tag LOCUS_11550 8017 8343 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222845.1 protein_id gnl|my_center|LOCUS_11550 8347 8697 gene locus_tag LOCUS_11560 8347 8697 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687490.1 protein_id gnl|my_center|LOCUS_11560 8730 9119 gene locus_tag LOCUS_11570 8730 9119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 9206 9598 gene locus_tag LOCUS_11580 9206 9598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 9663 10439 gene locus_tag LOCUS_11590 gene tatC 9663 10439 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199900.1 protein_id gnl|my_center|LOCUS_11590 10558 11166 gene locus_tag LOCUS_11600 10558 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 11241 13634 gene locus_tag LOCUS_11610 gene copA 11241 13634 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 protein_id gnl|my_center|LOCUS_11610 13664 13885 gene locus_tag LOCUS_11620 13664 13885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11620 17014 13913 gene locus_tag LOCUS_11630 gene putA 17014 13913 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038915.1 protein_id gnl|my_center|LOCUS_11630 18495 17056 gene locus_tag LOCUS_11640 18495 17056 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387757.1 protein_id gnl|my_center|LOCUS_11640 19954 18845 gene locus_tag LOCUS_11650 19954 18845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 20474 21724 gene locus_tag LOCUS_11660 20474 21724 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266413.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence037 663 908 gene locus_tag LOCUS_11670 663 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1000 1863 gene locus_tag LOCUS_11680 1000 1863 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082021145.1 protein_id gnl|my_center|LOCUS_11680 2041 2976 gene locus_tag LOCUS_11690 2041 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 3657 3124 gene locus_tag LOCUS_11700 3657 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3799 6513 gene locus_tag LOCUS_11710 3799 6513 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_11710 7537 6518 gene locus_tag LOCUS_11720 7537 6518 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162457.1 protein_id gnl|my_center|LOCUS_11720 7764 9068 gene locus_tag LOCUS_11730 7764 9068 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 protein_id gnl|my_center|LOCUS_11730 9834 9109 gene locus_tag LOCUS_11740 9834 9109 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038753.1 protein_id gnl|my_center|LOCUS_11740 10111 12372 gene locus_tag LOCUS_11750 10111 12372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 12525 13601 gene locus_tag LOCUS_11760 12525 13601 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_11760 13821 14252 gene locus_tag LOCUS_11770 13821 14252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 14845 15033 gene locus_tag LOCUS_11780 14845 15033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 15114 15716 gene locus_tag LOCUS_11790 gene nudF 15114 15716 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943166.1 protein_id gnl|my_center|LOCUS_11790 15895 16065 gene locus_tag LOCUS_11800 15895 16065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 17816 16161 gene locus_tag LOCUS_11810 17816 16161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 18068 18862 gene locus_tag LOCUS_11820 18068 18862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 18920 20179 gene locus_tag LOCUS_11830 18920 20179 CDS product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929970.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence038 3938 648 gene locus_tag LOCUS_11840 3938 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 4124 7327 gene locus_tag LOCUS_11850 4124 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 7369 8457 gene locus_tag LOCUS_11860 7369 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 8622 9461 gene locus_tag LOCUS_11870 8622 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 9511 11364 gene locus_tag LOCUS_11880 9511 11364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 11768 12937 gene locus_tag LOCUS_11890 11768 12937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 13626 15590 gene locus_tag LOCUS_11900 13626 15590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 16317 15724 gene locus_tag LOCUS_11910 16317 15724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 16759 17469 gene locus_tag LOCUS_11920 16759 17469 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958017.1 protein_id gnl|my_center|LOCUS_11920 17523 20087 gene locus_tag LOCUS_11930 17523 20087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 20332 21228 gene locus_tag LOCUS_11940 gene hemF 20332 21228 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309639.1 protein_id gnl|my_center|LOCUS_11940 >Feature sequence039 848 1402 gene locus_tag LOCUS_11950 848 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1434 1634 gene locus_tag LOCUS_11960 1434 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1631 1816 gene locus_tag LOCUS_11970 1631 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 2084 2323 gene locus_tag LOCUS_11980 2084 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 2413 3012 gene locus_tag LOCUS_11990 2413 3012 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085842.1 protein_id gnl|my_center|LOCUS_11990 4254 3124 gene locus_tag LOCUS_12000 4254 3124 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027999116.1 protein_id gnl|my_center|LOCUS_12000 4630 4304 gene locus_tag LOCUS_12010 4630 4304 CDS product DUF1840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463615.1 protein_id gnl|my_center|LOCUS_12010 4896 4720 gene locus_tag LOCUS_12020 4896 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 5429 4980 gene locus_tag LOCUS_12030 5429 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 6402 5926 gene locus_tag LOCUS_12040 6402 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 6979 6895 gene locus_tag LOCUS_t00220 6979 6895 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7037 9262 gene locus_tag LOCUS_12050 gene rnr 7037 9262 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695198.1 protein_id gnl|my_center|LOCUS_12050 9379 10119 gene locus_tag LOCUS_12060 gene rlmB 9379 10119 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064116.1 protein_id gnl|my_center|LOCUS_12060 10218 11975 gene locus_tag LOCUS_12070 gene argS 10218 11975 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_12070 11999 12778 gene locus_tag LOCUS_12080 11999 12778 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038937.1 protein_id gnl|my_center|LOCUS_12080 12863 13504 gene locus_tag LOCUS_12090 12863 13504 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804825.1 protein_id gnl|my_center|LOCUS_12090 13526 13990 gene locus_tag LOCUS_12100 gene msrA 13526 13990 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943782.1 protein_id gnl|my_center|LOCUS_12100 14513 15739 gene locus_tag LOCUS_12110 14513 15739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 15758 16390 gene locus_tag LOCUS_12120 gene gmk 15758 16390 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_12120 16478 16684 gene locus_tag LOCUS_12130 gene rpoZ 16478 16684 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_12130 16847 16665 gene locus_tag LOCUS_12140 16847 16665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 16947 19049 gene locus_tag LOCUS_12150 16947 19049 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811115.1 protein_id gnl|my_center|LOCUS_12150 19131 20390 gene locus_tag LOCUS_12160 19131 20390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 <21425 20592 gene locus_tag LOCUS_12170 <21425 20592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928646.1:FG-GAP-like repeat-containing protein >Feature sequence040 164 700 gene locus_tag LOCUS_12180 164 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 980 2401 gene locus_tag LOCUS_12190 980 2401 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526156.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12190 2766 3125 gene locus_tag LOCUS_12200 2766 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 4509 3358 gene locus_tag LOCUS_12210 gene ftsZ 4509 3358 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194380.1 protein_id gnl|my_center|LOCUS_12210 5808 4570 gene locus_tag LOCUS_12220 gene ftsA 5808 4570 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_12220 6607 5831 gene locus_tag LOCUS_12230 6607 5831 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_12230 7514 6597 gene locus_tag LOCUS_12240 7514 6597 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210432.1 protein_id gnl|my_center|LOCUS_12240 8536 7514 gene locus_tag LOCUS_12250 gene murB 8536 7514 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_12250 9953 8526 gene locus_tag LOCUS_12260 gene murC 9953 8526 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814572.1 protein_id gnl|my_center|LOCUS_12260 11035 9950 gene locus_tag LOCUS_12270 gene murG 11035 9950 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194182.1 protein_id gnl|my_center|LOCUS_12270 12192 11032 gene locus_tag LOCUS_12280 gene ftsW 12192 11032 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 protein_id gnl|my_center|LOCUS_12280 13608 12196 gene locus_tag LOCUS_12290 gene murD 13608 12196 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203798.1 protein_id gnl|my_center|LOCUS_12290 14690 13605 gene locus_tag LOCUS_12300 gene mraY 14690 13605 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313553.1 protein_id gnl|my_center|LOCUS_12300 16150 14768 gene locus_tag LOCUS_12310 16150 14768 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957393.1 protein_id gnl|my_center|LOCUS_12310 17709 16150 gene locus_tag LOCUS_12320 17709 16150 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705692.1 protein_id gnl|my_center|LOCUS_12320 19437 17713 gene locus_tag LOCUS_12330 19437 17713 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446492.1 protein_id gnl|my_center|LOCUS_12330 19738 19430 gene locus_tag LOCUS_12340 gene ftsL 19738 19430 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340690.1 protein_id gnl|my_center|LOCUS_12340 20686 19742 gene locus_tag LOCUS_12350 gene rsmH 20686 19742 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707587.1 protein_id gnl|my_center|LOCUS_12350 20844 20704 gene locus_tag LOCUS_12360 20844 20704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence041 3327 949 gene locus_tag LOCUS_12370 3327 949 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 protein_id gnl|my_center|LOCUS_12370 4053 3349 gene locus_tag LOCUS_12380 4053 3349 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_12380 4557 4132 gene locus_tag LOCUS_12390 4557 4132 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811322.1 protein_id gnl|my_center|LOCUS_12390 5313 4591 gene locus_tag LOCUS_12400 5313 4591 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106697.1 protein_id gnl|my_center|LOCUS_12400 6546 5377 gene locus_tag LOCUS_12410 6546 5377 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_12410 6796 6539 gene locus_tag LOCUS_12420 6796 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 6933 7889 gene locus_tag LOCUS_12430 gene pip 6933 7889 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387845.1 protein_id gnl|my_center|LOCUS_12430 8601 7891 gene locus_tag LOCUS_12440 8601 7891 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919005.1 protein_id gnl|my_center|LOCUS_12440 9218 9670 gene locus_tag LOCUS_12450 9218 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 10715 9786 gene locus_tag LOCUS_12460 10715 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 10884 12161 gene locus_tag LOCUS_12470 10884 12161 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_12470 12342 13295 gene locus_tag LOCUS_12480 12342 13295 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168557.1 protein_id gnl|my_center|LOCUS_12480 13812 13426 gene locus_tag LOCUS_12490 13812 13426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 14029 13817 gene locus_tag LOCUS_12500 14029 13817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 15056 14094 gene locus_tag LOCUS_12510 15056 14094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 15818 15135 gene locus_tag LOCUS_12520 15818 15135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 17172 15934 gene locus_tag LOCUS_12530 17172 15934 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807794.1 protein_id gnl|my_center|LOCUS_12530 17780 17226 gene locus_tag LOCUS_12540 17780 17226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 18032 18220 gene locus_tag LOCUS_12550 18032 18220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 18201 18959 gene locus_tag LOCUS_12560 18201 18959 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087633.1 protein_id gnl|my_center|LOCUS_12560 19695 19057 gene locus_tag LOCUS_12570 19695 19057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 20145 19858 gene locus_tag LOCUS_12580 20145 19858 CDS product DUF3175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957602.1 protein_id gnl|my_center|LOCUS_12580 <20881 20150 gene locus_tag LOCUS_12590 <20881 20150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921712.1:FRG domain-containing protein >Feature sequence042 522 746 gene locus_tag LOCUS_12600 522 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 813 2555 gene locus_tag LOCUS_12610 813 2555 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192117.1 protein_id gnl|my_center|LOCUS_12610 2561 3088 gene locus_tag LOCUS_12620 2561 3088 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_12620 3085 3783 gene locus_tag LOCUS_12630 3085 3783 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192841.1 protein_id gnl|my_center|LOCUS_12630 4185 4583 gene locus_tag LOCUS_12640 4185 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 4651 5865 gene locus_tag LOCUS_12650 4651 5865 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 protein_id gnl|my_center|LOCUS_12650 5930 9490 gene locus_tag LOCUS_12660 5930 9490 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388324.1 protein_id gnl|my_center|LOCUS_12660 9740 10864 gene locus_tag LOCUS_12670 9740 10864 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813035.1 protein_id gnl|my_center|LOCUS_12670 10952 11260 gene locus_tag LOCUS_12680 10952 11260 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926341.1 protein_id gnl|my_center|LOCUS_12680 11261 12643 gene locus_tag LOCUS_12690 11261 12643 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813039.1 protein_id gnl|my_center|LOCUS_12690 13730 12834 gene locus_tag LOCUS_12700 13730 12834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 14146 14379 gene locus_tag LOCUS_12710 14146 14379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 15465 14416 gene locus_tag LOCUS_12720 15465 14416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193226.1 protein_id gnl|my_center|LOCUS_12720 15796 17043 gene locus_tag LOCUS_12730 gene icd 15796 17043 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189552.1 protein_id gnl|my_center|LOCUS_12730 17395 17192 gene locus_tag LOCUS_12740 17395 17192 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_12740 17706 18020 gene locus_tag LOCUS_12750 gene clpS 17706 18020 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023812950.1 protein_id gnl|my_center|LOCUS_12750 18022 20277 gene locus_tag LOCUS_12760 gene clpA 18022 20277 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_12760 20599 20850 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatcctcgcccggctttggggccgggcgctac >Feature sequence043 1094 126 gene locus_tag LOCUS_12770 1094 126 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 protein_id gnl|my_center|LOCUS_12770 3853 1136 gene locus_tag LOCUS_12780 3853 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 4139 3888 gene locus_tag LOCUS_12790 4139 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 4658 4152 gene locus_tag LOCUS_12800 4658 4152 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_12800 5171 4710 gene locus_tag LOCUS_12810 5171 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 6032 5295 gene locus_tag LOCUS_12820 6032 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 6825 6361 gene locus_tag LOCUS_12830 6825 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 7480 6911 gene locus_tag LOCUS_12840 7480 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 8327 7572 gene locus_tag LOCUS_12850 8327 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 8843 10129 gene locus_tag LOCUS_12860 8843 10129 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731610.1 protein_id gnl|my_center|LOCUS_12860 10138 11682 gene locus_tag LOCUS_12870 10138 11682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 12023 13513 gene locus_tag LOCUS_12880 12023 13513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 15245 13536 gene locus_tag LOCUS_12890 gene recN 15245 13536 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550021.1 protein_id gnl|my_center|LOCUS_12890 16140 15268 gene locus_tag LOCUS_12900 16140 15268 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533590.1 protein_id gnl|my_center|LOCUS_12900 16118 16405 gene locus_tag LOCUS_12910 16118 16405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 16415 17434 gene locus_tag LOCUS_12920 gene hrcA 16415 17434 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 protein_id gnl|my_center|LOCUS_12920 17444 18529 gene locus_tag LOCUS_12930 gene hemH 17444 18529 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527679.1 protein_id gnl|my_center|LOCUS_12930 18756 19628 gene locus_tag LOCUS_12940 18756 19628 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318655.1 protein_id gnl|my_center|LOCUS_12940 20286 20002 gene locus_tag LOCUS_12950 20286 20002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence044 243 2219 gene locus_tag LOCUS_12960 243 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 2280 3512 gene locus_tag LOCUS_12970 2280 3512 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 protein_id gnl|my_center|LOCUS_12970 3520 3933 gene locus_tag LOCUS_12980 3520 3933 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194347.1 protein_id gnl|my_center|LOCUS_12980 3968 4753 gene locus_tag LOCUS_12990 3968 4753 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084054.1 protein_id gnl|my_center|LOCUS_12990 4856 4932 gene locus_tag LOCUS_t00230 4856 4932 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5037 6776 gene locus_tag LOCUS_13000 5037 6776 CDS product dihydroxyacetone kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027218.1 protein_id gnl|my_center|LOCUS_13000 8074 6884 gene locus_tag LOCUS_13010 8074 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 9929 8088 gene locus_tag LOCUS_13020 gene btuB 9929 8088 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_13020 10693 11226 gene locus_tag LOCUS_13030 gene ppa 10693 11226 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083378.1 protein_id gnl|my_center|LOCUS_13030 12076 11279 gene locus_tag LOCUS_13040 12076 11279 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_13040 12563 12108 gene locus_tag LOCUS_13050 12563 12108 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193808.1 protein_id gnl|my_center|LOCUS_13050 12677 13330 gene locus_tag LOCUS_13060 12677 13330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 13905 13606 gene locus_tag LOCUS_13070 13905 13606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 14095 13898 gene locus_tag LOCUS_13080 14095 13898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 14480 14178 gene locus_tag LOCUS_13090 14480 14178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 15803 14622 gene locus_tag LOCUS_13100 15803 14622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 19431 15877 gene locus_tag LOCUS_13110 gene smc 19431 15877 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205139.1 protein_id gnl|my_center|LOCUS_13110 19533 19952 gene locus_tag LOCUS_13120 19533 19952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence045 2133 274 gene locus_tag LOCUS_13130 2133 274 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185930.1 protein_id gnl|my_center|LOCUS_13130 3128 2136 gene locus_tag LOCUS_13140 3128 2136 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186499.1 protein_id gnl|my_center|LOCUS_13140 4463 3246 gene locus_tag LOCUS_13150 4463 3246 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_13150 6954 5104 gene locus_tag LOCUS_13160 gene glmS 6954 5104 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035815.1 protein_id gnl|my_center|LOCUS_13160 9530 7500 gene locus_tag LOCUS_13170 gene uvrB 9530 7500 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199587.1 protein_id gnl|my_center|LOCUS_13170 9609 10802 gene locus_tag LOCUS_13180 9609 10802 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_13180 11353 10817 gene locus_tag LOCUS_13190 gene flhC 11353 10817 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198198.1 protein_id gnl|my_center|LOCUS_13190 11702 11385 gene locus_tag LOCUS_13200 gene flhD 11702 11385 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198199.1 protein_id gnl|my_center|LOCUS_13200 13561 12278 gene locus_tag LOCUS_13210 13561 12278 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211409870.1 protein_id gnl|my_center|LOCUS_13210 14243 14046 gene locus_tag LOCUS_13220 14243 14046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 14227 14934 gene locus_tag LOCUS_13230 14227 14934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 15496 16680 gene locus_tag LOCUS_13240 15496 16680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 17699 16764 gene locus_tag LOCUS_13250 17699 16764 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140467.1 protein_id gnl|my_center|LOCUS_13250 18641 17853 gene locus_tag LOCUS_13260 18641 17853 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530227.1 protein_id gnl|my_center|LOCUS_13260 19772 18687 gene locus_tag LOCUS_13270 19772 18687 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922545.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence046 <1 500 gene locus_tag LOCUS_13280 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193779.1:peptidylprolyl isomerase 1812 631 gene locus_tag LOCUS_13290 1812 631 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 protein_id gnl|my_center|LOCUS_13290 3439 1919 gene locus_tag LOCUS_13300 gene purF 3439 1919 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525195.1 protein_id gnl|my_center|LOCUS_13300 4048 3533 gene locus_tag LOCUS_13310 4048 3533 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957874.1 protein_id gnl|my_center|LOCUS_13310 4831 4130 gene locus_tag LOCUS_13320 4831 4130 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198053.1 protein_id gnl|my_center|LOCUS_13320 6151 4856 gene locus_tag LOCUS_13330 gene folC 6151 4856 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528975.1 protein_id gnl|my_center|LOCUS_13330 7080 6211 gene locus_tag LOCUS_13340 gene accD 7080 6211 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_13340 7977 7093 gene locus_tag LOCUS_13350 gene trpA 7977 7093 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_13350 9229 8030 gene locus_tag LOCUS_13360 gene trpB 9229 8030 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_13360 9843 9226 gene locus_tag LOCUS_13370 9843 9226 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_13370 10766 9906 gene locus_tag LOCUS_13380 gene truA 10766 9906 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216995.1 protein_id gnl|my_center|LOCUS_13380 13350 10825 gene locus_tag LOCUS_13390 gene fimV 13350 10825 CDS product motility hub landmark protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_13390 14614 13502 gene locus_tag LOCUS_13400 gene asd 14614 13502 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111187.1 protein_id gnl|my_center|LOCUS_13400 15823 14750 gene locus_tag LOCUS_13410 gene leuB 15823 14750 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213431.1 protein_id gnl|my_center|LOCUS_13410 16484 15846 gene locus_tag LOCUS_13420 gene leuD 16484 15846 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357988.1 protein_id gnl|my_center|LOCUS_13420 17945 16533 gene locus_tag LOCUS_13430 gene leuC 17945 16533 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_13430 19167 18022 gene locus_tag LOCUS_13440 19167 18022 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103817.1 protein_id gnl|my_center|LOCUS_13440 19772 19389 gene locus_tag LOCUS_13450 19772 19389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 >Feature sequence047 760 35 gene locus_tag LOCUS_13460 gene fliP 760 35 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549847.1 protein_id gnl|my_center|LOCUS_13460 1256 819 gene locus_tag LOCUS_13470 1256 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1768 1265 gene locus_tag LOCUS_13480 gene fliN 1768 1265 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184995.1 protein_id gnl|my_center|LOCUS_13480 2762 1785 gene locus_tag LOCUS_13490 gene fliM 2762 1785 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524547.1 protein_id gnl|my_center|LOCUS_13490 3258 2770 gene locus_tag LOCUS_13500 gene fliL 3258 2770 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039846.1 protein_id gnl|my_center|LOCUS_13500 4627 3515 gene locus_tag LOCUS_13510 4627 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 5228 4770 gene locus_tag LOCUS_13520 5228 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 6663 5254 gene locus_tag LOCUS_13530 gene fliI 6663 5254 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197164.1 protein_id gnl|my_center|LOCUS_13530 7300 6653 gene locus_tag LOCUS_13540 7300 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 8429 7434 gene locus_tag LOCUS_13550 gene fliG 8429 7434 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 protein_id gnl|my_center|LOCUS_13550 10137 8422 gene locus_tag LOCUS_13560 gene fliF 10137 8422 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523066.1 protein_id gnl|my_center|LOCUS_13560 10284 11522 gene locus_tag LOCUS_13570 gene fleS 10284 11522 CDS product sensor histidine kinase FleS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_13570 11524 12831 gene locus_tag LOCUS_13580 11524 12831 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073114.1 protein_id gnl|my_center|LOCUS_13580 12904 13227 gene locus_tag LOCUS_13590 gene fliE 12904 13227 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097729.1 protein_id gnl|my_center|LOCUS_13590 15102 13339 gene locus_tag LOCUS_13600 15102 13339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 16632 15496 gene locus_tag LOCUS_13610 16632 15496 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704392.1 protein_id gnl|my_center|LOCUS_13610 17709 16669 gene locus_tag LOCUS_13620 17709 16669 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_13620 19055 18024 gene locus_tag LOCUS_13630 19055 18024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence048 2276 1323 gene locus_tag LOCUS_13640 2276 1323 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206804.1 protein_id gnl|my_center|LOCUS_13640 3080 2349 gene locus_tag LOCUS_13650 3080 2349 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_13650 3531 3854 gene locus_tag LOCUS_13660 3531 3854 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807023.1 protein_id gnl|my_center|LOCUS_13660 3929 5710 gene locus_tag LOCUS_13670 gene aspS 3929 5710 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807038.1 protein_id gnl|my_center|LOCUS_13670 5735 6190 gene locus_tag LOCUS_13680 gene nudB 5735 6190 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189197.1 protein_id gnl|my_center|LOCUS_13680 7479 6187 gene locus_tag LOCUS_13690 7479 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 8830 7850 gene locus_tag LOCUS_13700 8830 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 9334 10989 gene locus_tag LOCUS_13710 9334 10989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 10989 13844 gene locus_tag LOCUS_13720 10989 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 14186 15718 gene locus_tag LOCUS_13730 14186 15718 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_13730 15797 16213 gene locus_tag LOCUS_13740 15797 16213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 16576 17271 gene locus_tag LOCUS_13750 16576 17271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 17779 17462 gene locus_tag LOCUS_13760 17779 17462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 18798 17842 gene locus_tag LOCUS_13770 18798 17842 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence049 3913 2681 gene locus_tag LOCUS_13780 3913 2681 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197872.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13780 4180 3926 gene locus_tag LOCUS_13790 4180 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 5616 4177 gene locus_tag LOCUS_13800 5616 4177 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_13800 6127 5747 gene locus_tag LOCUS_13810 6127 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 6820 6224 gene locus_tag LOCUS_13820 6820 6224 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925884.1 protein_id gnl|my_center|LOCUS_13820 6875 7390 gene locus_tag LOCUS_13830 6875 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 7409 7588 gene locus_tag LOCUS_13840 gene rpmF 7409 7588 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192741.1 protein_id gnl|my_center|LOCUS_13840 7649 8689 gene locus_tag LOCUS_13850 gene plsX 7649 8689 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_13850 8689 9645 gene locus_tag LOCUS_13860 8689 9645 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524613.1 protein_id gnl|my_center|LOCUS_13860 9649 10584 gene locus_tag LOCUS_13870 gene fabD 9649 10584 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193828.1 protein_id gnl|my_center|LOCUS_13870 10634 11377 gene locus_tag LOCUS_13880 gene fabG 10634 11377 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367190.1 protein_id gnl|my_center|LOCUS_13880 11566 11802 gene locus_tag LOCUS_13890 gene acpP 11566 11802 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813816.1 protein_id gnl|my_center|LOCUS_13890 11838 13079 gene locus_tag LOCUS_13900 gene fabF 11838 13079 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_13900 13097 14092 gene locus_tag LOCUS_13910 gene mltG 13097 14092 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930596.1 protein_id gnl|my_center|LOCUS_13910 14141 16753 gene locus_tag LOCUS_13920 14141 16753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 17956 17444 gene locus_tag LOCUS_13930 17956 17444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 <18553 18043 gene locus_tag LOCUS_13940 <18553 18043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194217.1:proline--tRNA ligase >Feature sequence050 712 1989 gene locus_tag LOCUS_13950 712 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 2087 2854 gene locus_tag LOCUS_13960 2087 2854 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202509.1 protein_id gnl|my_center|LOCUS_13960 3746 4555 gene locus_tag LOCUS_13970 3746 4555 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529286.1 protein_id gnl|my_center|LOCUS_13970 4969 5745 gene locus_tag LOCUS_13980 4969 5745 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529286.1 protein_id gnl|my_center|LOCUS_13980 6049 6342 gene locus_tag LOCUS_13990 6049 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 6388 6552 gene locus_tag LOCUS_14000 6388 6552 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856556.1 protein_id gnl|my_center|LOCUS_14000 6618 6881 gene locus_tag LOCUS_14010 6618 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 7052 7888 gene locus_tag LOCUS_14020 7052 7888 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173331.1 protein_id gnl|my_center|LOCUS_14020 8182 7910 gene locus_tag LOCUS_14030 8182 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 8579 8172 gene locus_tag LOCUS_14040 8579 8172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 8998 8678 gene locus_tag LOCUS_14050 8998 8678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 9188 9430 gene locus_tag LOCUS_14060 9188 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092978.1 protein_id gnl|my_center|LOCUS_14060 9767 9588 gene locus_tag LOCUS_14070 9767 9588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 12464 9909 gene locus_tag LOCUS_14080 12464 9909 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_14080 12625 13380 gene locus_tag LOCUS_14090 gene tpiA 12625 13380 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186004.1 protein_id gnl|my_center|LOCUS_14090 13396 13782 gene locus_tag LOCUS_14100 gene secG 13396 13782 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040273.1 protein_id gnl|my_center|LOCUS_14100 13845 13929 gene locus_tag LOCUS_t00240 13845 13929 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13966 14322 gene locus_tag LOCUS_14110 13966 14322 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040258.1 protein_id gnl|my_center|LOCUS_14110 14327 14803 gene locus_tag LOCUS_14120 14327 14803 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_14120 14813 15436 gene locus_tag LOCUS_14130 14813 15436 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 protein_id gnl|my_center|LOCUS_14130 15489 16742 gene locus_tag LOCUS_14140 15489 16742 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_14140 16745 17218 gene locus_tag LOCUS_14150 gene nuoE 16745 17218 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185492.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence051 2278 659 gene locus_tag LOCUS_14160 2278 659 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256867.1 protein_id gnl|my_center|LOCUS_14160 3447 2356 gene locus_tag LOCUS_14170 3447 2356 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266146.1 protein_id gnl|my_center|LOCUS_14170 3812 4159 gene locus_tag LOCUS_14180 3812 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 6236 4161 gene locus_tag LOCUS_14190 6236 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 7135 6233 gene locus_tag LOCUS_14200 7135 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 7510 8847 gene locus_tag LOCUS_14210 7510 8847 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096703.1 protein_id gnl|my_center|LOCUS_14210 8844 10016 gene locus_tag LOCUS_14220 8844 10016 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929017.1 protein_id gnl|my_center|LOCUS_14220 10023 13205 gene locus_tag LOCUS_14230 10023 13205 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_14230 13491 14549 gene locus_tag LOCUS_14240 gene purM 13491 14549 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 protein_id gnl|my_center|LOCUS_14240 14572 15207 gene locus_tag LOCUS_14250 gene purN 14572 15207 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064038.1 protein_id gnl|my_center|LOCUS_14250 15207 15923 gene locus_tag LOCUS_14260 15207 15923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 15960 17231 gene locus_tag LOCUS_14270 15960 17231 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222346.1 protein_id gnl|my_center|LOCUS_14270 17851 17246 gene locus_tag LOCUS_14280 17851 17246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 <18453 17856 gene locus_tag LOCUS_14290 <18453 17856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012165757.1:glycosyltransferase >Feature sequence052 2166 334 gene locus_tag LOCUS_14300 2166 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 4147 2345 gene locus_tag LOCUS_14310 4147 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 4680 5891 gene locus_tag LOCUS_14320 4680 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 6779 5994 gene locus_tag LOCUS_14330 gene pssA 6779 5994 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186682.1 protein_id gnl|my_center|LOCUS_14330 7558 6890 gene locus_tag LOCUS_14340 7558 6890 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196436.1 protein_id gnl|my_center|LOCUS_14340 8641 7625 gene locus_tag LOCUS_14350 gene ilvC 8641 7625 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185539.1 protein_id gnl|my_center|LOCUS_14350 9266 8775 gene locus_tag LOCUS_14360 gene ilvN 9266 8775 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_14360 10974 9271 gene locus_tag LOCUS_14370 10974 9271 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 protein_id gnl|my_center|LOCUS_14370 12516 11047 gene locus_tag LOCUS_14380 gene tldD 12516 11047 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194084.1 protein_id gnl|my_center|LOCUS_14380 13457 12585 gene locus_tag LOCUS_14390 13457 12585 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931197.1 protein_id gnl|my_center|LOCUS_14390 13646 16435 gene locus_tag LOCUS_14400 gene glnE 13646 16435 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224816.1 protein_id gnl|my_center|LOCUS_14400 16669 17085 gene locus_tag LOCUS_14410 16669 17085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence053 118 1236 gene locus_tag LOCUS_14420 gene hisC 118 1236 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_14420 1233 2249 gene locus_tag LOCUS_14430 gene aroF 1233 2249 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_14430 2270 3157 gene locus_tag LOCUS_14440 2270 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 3271 3633 gene locus_tag LOCUS_14450 3271 3633 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003307318.1 protein_id gnl|my_center|LOCUS_14450 6248 7507 gene locus_tag LOCUS_14460 6248 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 9075 7624 gene locus_tag LOCUS_14470 gene nuoN 9075 7624 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_14470 10611 9127 gene locus_tag LOCUS_14480 10611 9127 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_14480 11457 10702 gene locus_tag LOCUS_14490 11457 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14490 12642 11500 gene locus_tag LOCUS_14500 12642 11500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14500 13000 12695 gene locus_tag LOCUS_14510 gene nuoK 13000 12695 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_14510 13671 13063 gene locus_tag LOCUS_14520 13671 13063 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_14520 14179 13691 gene locus_tag LOCUS_14530 gene nuoI 14179 13691 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186558.1 protein_id gnl|my_center|LOCUS_14530 15291 14194 gene locus_tag LOCUS_14540 gene nuoH 15291 14194 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813926.1 protein_id gnl|my_center|LOCUS_14540 17729 15312 gene locus_tag LOCUS_14550 gene nuoG 17729 15312 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186393.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence054 1 258 gene locus_tag LOCUS_14560 gene rpmA 1 258 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807460.1 protein_id gnl|my_center|LOCUS_14560 379 1443 gene locus_tag LOCUS_14570 gene obgE 379 1443 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_14570 1437 2546 gene locus_tag LOCUS_14580 gene proB 1437 2546 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 protein_id gnl|my_center|LOCUS_14580 2568 3677 gene locus_tag LOCUS_14590 2568 3677 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104094.1 protein_id gnl|my_center|LOCUS_14590 4112 3891 gene locus_tag LOCUS_14600 4112 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 4274 4567 gene locus_tag LOCUS_14610 4274 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 4612 5298 gene locus_tag LOCUS_14620 4612 5298 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_14620 5295 6635 gene locus_tag LOCUS_14630 gene phoQ 5295 6635 CDS product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082438.1 protein_id gnl|my_center|LOCUS_14630 6920 6648 gene locus_tag LOCUS_14640 6920 6648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 7163 7471 gene locus_tag LOCUS_14650 7163 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 7496 8941 gene locus_tag LOCUS_14660 gene dacB 7496 8941 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189150.1 protein_id gnl|my_center|LOCUS_14660 9067 9657 gene locus_tag LOCUS_14670 9067 9657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 10960 9806 gene locus_tag LOCUS_14680 10960 9806 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085434.1 protein_id gnl|my_center|LOCUS_14680 10996 11460 gene locus_tag LOCUS_14690 10996 11460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 11469 12887 gene locus_tag LOCUS_14700 gene nhaC 11469 12887 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017141.1 protein_id gnl|my_center|LOCUS_14700 13362 14519 gene locus_tag LOCUS_14710 13362 14519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 16145 17119 gene locus_tag LOCUS_14720 16145 17119 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110811.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence055 830 477 gene locus_tag LOCUS_14730 830 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1339 1728 gene locus_tag LOCUS_14740 gene sdhC 1339 1728 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688393.1 protein_id gnl|my_center|LOCUS_14740 1722 2075 gene locus_tag LOCUS_14750 gene sdhD 1722 2075 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187439.1 protein_id gnl|my_center|LOCUS_14750 2077 3840 gene locus_tag LOCUS_14760 gene sdhA 2077 3840 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813651.1 protein_id gnl|my_center|LOCUS_14760 3913 4599 gene locus_tag LOCUS_14770 3913 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4818 6821 gene locus_tag LOCUS_14780 4818 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 7234 9351 gene locus_tag LOCUS_14790 7234 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 9365 9997 gene locus_tag LOCUS_14800 9365 9997 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_14800 10405 10169 gene locus_tag LOCUS_14810 10405 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 10874 10464 gene locus_tag LOCUS_14820 10874 10464 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120966.1 protein_id gnl|my_center|LOCUS_14820 12308 10968 gene locus_tag LOCUS_14830 12308 10968 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 protein_id gnl|my_center|LOCUS_14830 14319 13483 gene locus_tag LOCUS_14840 14319 13483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 14548 15360 gene locus_tag LOCUS_14850 14548 15360 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_14850 15353 16150 gene locus_tag LOCUS_14860 gene mlaE 15353 16150 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199929.1 protein_id gnl|my_center|LOCUS_14860 16150 16608 gene locus_tag LOCUS_14870 gene mlaD 16150 16608 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 protein_id gnl|my_center|LOCUS_14870 16942 17085 gene locus_tag LOCUS_14880 16942 17085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 17102 17317 gene locus_tag LOCUS_14890 17102 17317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence056 1855 740 gene locus_tag LOCUS_14900 gene hpnH 1855 740 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387821.1 protein_id gnl|my_center|LOCUS_14900 2687 2178 gene locus_tag LOCUS_14910 2687 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 2902 4038 gene locus_tag LOCUS_14920 2902 4038 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922286.1 protein_id gnl|my_center|LOCUS_14920 4804 4151 gene locus_tag LOCUS_14930 4804 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 6114 4930 gene locus_tag LOCUS_14940 6114 4930 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524929.1 protein_id gnl|my_center|LOCUS_14940 6371 6117 gene locus_tag LOCUS_14950 6371 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 7313 6402 gene locus_tag LOCUS_14960 7313 6402 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077137.1 protein_id gnl|my_center|LOCUS_14960 9138 7321 gene locus_tag LOCUS_14970 9138 7321 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390306.1 protein_id gnl|my_center|LOCUS_14970 9505 11364 gene locus_tag LOCUS_14980 9505 11364 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168667914.1 protein_id gnl|my_center|LOCUS_14980 12061 11477 gene locus_tag LOCUS_14990 12061 11477 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881302.1 protein_id gnl|my_center|LOCUS_14990 12502 12146 gene locus_tag LOCUS_15000 12502 12146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 13373 12681 gene locus_tag LOCUS_15010 13373 12681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 13499 13753 gene locus_tag LOCUS_15020 13499 13753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 14113 15057 gene locus_tag LOCUS_15030 14113 15057 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 protein_id gnl|my_center|LOCUS_15030 15539 15210 gene locus_tag LOCUS_15040 15539 15210 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210636.1 protein_id gnl|my_center|LOCUS_15040 17016 15883 gene locus_tag LOCUS_15050 17016 15883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence057 <1 650 gene locus_tag LOCUS_15060 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522936.1:alpha/beta hydrolase 1298 666 gene locus_tag LOCUS_15070 1298 666 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528392.1 protein_id gnl|my_center|LOCUS_15070 2739 1291 gene locus_tag LOCUS_15080 2739 1291 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545843.1 protein_id gnl|my_center|LOCUS_15080 3337 2951 gene locus_tag LOCUS_15090 3337 2951 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352231.1 protein_id gnl|my_center|LOCUS_15090 4242 3376 gene locus_tag LOCUS_15100 4242 3376 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_15100 4370 5296 gene locus_tag LOCUS_15110 4370 5296 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814158.1 protein_id gnl|my_center|LOCUS_15110 6010 7245 gene locus_tag LOCUS_15120 6010 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 11216 7509 gene locus_tag LOCUS_15130 gene metH 11216 7509 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064919.1 protein_id gnl|my_center|LOCUS_15130 11877 11416 gene locus_tag LOCUS_15140 11877 11416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 12479 12051 gene locus_tag LOCUS_15150 12479 12051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 13914 12556 gene locus_tag LOCUS_15160 13914 12556 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_15160 14495 13911 gene locus_tag LOCUS_15170 14495 13911 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880618.1 protein_id gnl|my_center|LOCUS_15170 15077 14517 gene locus_tag LOCUS_15180 15077 14517 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946938.1 protein_id gnl|my_center|LOCUS_15180 16548 15121 gene locus_tag LOCUS_15190 16548 15121 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356999.1 protein_id gnl|my_center|LOCUS_15190 16952 16545 gene locus_tag LOCUS_15200 16952 16545 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162839581.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence058 <1 987 gene locus_tag LOCUS_15210 <1 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002224766.1:sigma-54 dependent transcriptional regulator 1154 3169 gene locus_tag LOCUS_15220 gene tkt 1154 3169 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244175.1 protein_id gnl|my_center|LOCUS_15220 3250 4248 gene locus_tag LOCUS_15230 gene gap 3250 4248 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_15230 4397 5575 gene locus_tag LOCUS_15240 4397 5575 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704731.1 protein_id gnl|my_center|LOCUS_15240 5588 7042 gene locus_tag LOCUS_15250 gene pyk 5588 7042 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 protein_id gnl|my_center|LOCUS_15250 7173 8237 gene locus_tag LOCUS_15260 gene fba 7173 8237 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084964.1 protein_id gnl|my_center|LOCUS_15260 8604 8395 gene locus_tag LOCUS_15270 8604 8395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 8692 9099 gene locus_tag LOCUS_15280 gene rnk 8692 9099 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072033.1 protein_id gnl|my_center|LOCUS_15280 9496 9218 gene locus_tag LOCUS_15290 9496 9218 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_15290 10942 9602 gene locus_tag LOCUS_15300 gene argA 10942 9602 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_15300 11727 10984 gene locus_tag LOCUS_15310 11727 10984 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692438.1 protein_id gnl|my_center|LOCUS_15310 11881 12438 gene locus_tag LOCUS_15320 11881 12438 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_15320 12441 13223 gene locus_tag LOCUS_15330 12441 13223 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687170.1 protein_id gnl|my_center|LOCUS_15330 13275 14726 gene locus_tag LOCUS_15340 gene trkA 13275 14726 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_15340 14739 16196 gene locus_tag LOCUS_15350 14739 16196 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929886.1 protein_id gnl|my_center|LOCUS_15350 16301 16699 gene locus_tag LOCUS_15360 gene pilG 16301 16699 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence059 300 1232 gene locus_tag LOCUS_15370 gene pstC 300 1232 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941759.1 protein_id gnl|my_center|LOCUS_15370 1315 2241 gene locus_tag LOCUS_15380 gene pstA 1315 2241 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941758.1 protein_id gnl|my_center|LOCUS_15380 2247 3041 gene locus_tag LOCUS_15390 gene pstB 2247 3041 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107795169.1 protein_id gnl|my_center|LOCUS_15390 4047 3022 gene locus_tag LOCUS_15400 4047 3022 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920885.1 protein_id gnl|my_center|LOCUS_15400 4264 5781 gene locus_tag LOCUS_15410 4264 5781 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 protein_id gnl|my_center|LOCUS_15410 7340 5910 gene locus_tag LOCUS_15420 7340 5910 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209480.1 protein_id gnl|my_center|LOCUS_15420 7988 8218 gene locus_tag LOCUS_15430 7988 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 8380 8589 gene locus_tag LOCUS_15440 8380 8589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 8721 9245 gene locus_tag LOCUS_15450 8721 9245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 9262 12513 gene locus_tag LOCUS_15460 9262 12513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 12950 13417 gene locus_tag LOCUS_15470 gene nikR 12950 13417 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190062.1 protein_id gnl|my_center|LOCUS_15470 14466 13489 gene locus_tag LOCUS_15480 14466 13489 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938457.1 protein_id gnl|my_center|LOCUS_15480 15215 14580 gene locus_tag LOCUS_15490 gene ureG 15215 14580 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_15490 15911 15234 gene locus_tag LOCUS_15500 15911 15234 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533998.1 protein_id gnl|my_center|LOCUS_15500 16445 15915 gene locus_tag LOCUS_15510 gene ureE 16445 15915 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095526.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence060 568 1320 gene locus_tag LOCUS_15520 568 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1426 3303 gene locus_tag LOCUS_15530 gene thrS 1426 3303 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191232.1 protein_id gnl|my_center|LOCUS_15530 3425 3874 gene locus_tag LOCUS_15540 gene infC 3425 3874 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072302.1 protein_id gnl|my_center|LOCUS_15540 4011 4208 gene locus_tag LOCUS_15550 gene rpmI 4011 4208 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812834.1 protein_id gnl|my_center|LOCUS_15550 4224 4583 gene locus_tag LOCUS_15560 gene rplT 4224 4583 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225461.1 protein_id gnl|my_center|LOCUS_15560 4690 5709 gene locus_tag LOCUS_15570 gene pheS 4690 5709 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382398.1 protein_id gnl|my_center|LOCUS_15570 5750 8116 gene locus_tag LOCUS_15580 gene pheT 5750 8116 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193113.1 protein_id gnl|my_center|LOCUS_15580 8246 8551 gene locus_tag LOCUS_15590 8246 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 8517 8909 gene locus_tag LOCUS_15600 8517 8909 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526841.1 protein_id gnl|my_center|LOCUS_15600 8958 9034 gene locus_tag LOCUS_t00250 8958 9034 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9133 9876 gene locus_tag LOCUS_15610 gene surE 9133 9876 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930526.1 protein_id gnl|my_center|LOCUS_15610 9947 10582 gene locus_tag LOCUS_15620 9947 10582 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406213.1 protein_id gnl|my_center|LOCUS_15620 10602 11693 gene locus_tag LOCUS_15630 10602 11693 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455560.1 protein_id gnl|my_center|LOCUS_15630 12195 11896 gene locus_tag LOCUS_15640 12195 11896 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456005.1 protein_id gnl|my_center|LOCUS_15640 12652 12182 gene locus_tag LOCUS_15650 12652 12182 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192775.1 protein_id gnl|my_center|LOCUS_15650 12707 13150 gene locus_tag LOCUS_15660 gene smpB 12707 13150 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197080.1 protein_id gnl|my_center|LOCUS_15660 13255 14214 gene locus_tag LOCUS_15670 13255 14214 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165691202.1 protein_id gnl|my_center|LOCUS_15670 15708 14305 gene locus_tag LOCUS_15680 gene pilR 15708 14305 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_15680 <16664 15708 gene locus_tag LOCUS_15690 <16664 15708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094692.1:two-component system sensor histidine kinase PilS >Feature sequence061 694 431 gene locus_tag LOCUS_15700 gene rpsT 694 431 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189743.1 protein_id gnl|my_center|LOCUS_15700 837 1193 gene locus_tag LOCUS_15710 837 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1103 1576 gene locus_tag LOCUS_15720 1103 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2332 1880 gene locus_tag LOCUS_15730 2332 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 2875 2393 gene locus_tag LOCUS_15740 2875 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 4057 2900 gene locus_tag LOCUS_15750 4057 2900 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100962.1 protein_id gnl|my_center|LOCUS_15750 5103 4213 gene locus_tag LOCUS_15760 gene gluQRS 5103 4213 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951304.1 protein_id gnl|my_center|LOCUS_15760 5380 6768 gene locus_tag LOCUS_15770 gene mpl 5380 6768 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527766.1 protein_id gnl|my_center|LOCUS_15770 8055 6955 gene locus_tag LOCUS_15780 gene nirK 8055 6955 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965519.1 protein_id gnl|my_center|LOCUS_15780 10219 8240 gene locus_tag LOCUS_15790 10219 8240 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_15790 10338 11624 gene locus_tag LOCUS_15800 gene gshA 10338 11624 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522914.1 protein_id gnl|my_center|LOCUS_15800 11633 12598 gene locus_tag LOCUS_15810 gene gshB 11633 12598 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455768.1 protein_id gnl|my_center|LOCUS_15810 13460 12717 gene locus_tag LOCUS_15820 13460 12717 CDS product TenA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873942.1 protein_id gnl|my_center|LOCUS_15820 15830 13533 gene locus_tag LOCUS_15830 gene metE 15830 13533 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764814.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence062 966 262 gene locus_tag LOCUS_15840 966 262 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_15840 1402 1019 gene locus_tag LOCUS_15850 gene apaG 1402 1019 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815381.1 protein_id gnl|my_center|LOCUS_15850 1555 2232 gene locus_tag LOCUS_15860 gene rpe 1555 2232 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522003.1 protein_id gnl|my_center|LOCUS_15860 2283 3011 gene locus_tag LOCUS_15870 2283 3011 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_15870 3028 4500 gene locus_tag LOCUS_15880 gene trpE 3028 4500 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186866.1 protein_id gnl|my_center|LOCUS_15880 6301 4532 gene locus_tag LOCUS_15890 6301 4532 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_15890 6726 8582 gene locus_tag LOCUS_15900 6726 8582 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014486102.1 protein_id gnl|my_center|LOCUS_15900 8691 9608 gene locus_tag LOCUS_15910 8691 9608 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736950.1 protein_id gnl|my_center|LOCUS_15910 9680 10498 gene locus_tag LOCUS_15920 gene aroE 9680 10498 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194401.1 protein_id gnl|my_center|LOCUS_15920 10788 12230 gene locus_tag LOCUS_15930 gene mgtE 10788 12230 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085996.1 protein_id gnl|my_center|LOCUS_15930 12960 12346 gene locus_tag LOCUS_15940 12960 12346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 13472 15628 gene locus_tag LOCUS_15950 gene rlmKL 13472 15628 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence063 <1 1052 gene locus_tag LOCUS_15960 <1 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048655409.1:squalene--hopene cyclase 1043 1765 gene locus_tag LOCUS_15970 1043 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 3540 1741 gene locus_tag LOCUS_15980 gene hcuC 3540 1741 CDS product hydrophobic compound transporter HcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112499.1 protein_id gnl|my_center|LOCUS_15980 4926 3649 gene locus_tag LOCUS_15990 4926 3649 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482970.1 protein_id gnl|my_center|LOCUS_15990 5189 5509 gene locus_tag LOCUS_16000 5189 5509 CDS product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509441.1 protein_id gnl|my_center|LOCUS_16000 6449 5574 gene locus_tag LOCUS_16010 6449 5574 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_16010 6821 6450 gene locus_tag LOCUS_16020 6821 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 7221 6940 gene locus_tag LOCUS_16030 7221 6940 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553340.1 protein_id gnl|my_center|LOCUS_16030 7397 8062 gene locus_tag LOCUS_16040 7397 8062 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037424.1 protein_id gnl|my_center|LOCUS_16040 8059 10608 gene locus_tag LOCUS_16050 8059 10608 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003915882.1 protein_id gnl|my_center|LOCUS_16050 10611 11702 gene locus_tag LOCUS_16060 10611 11702 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_16060 12958 12368 gene locus_tag LOCUS_16070 12958 12368 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256689.1 protein_id gnl|my_center|LOCUS_16070 14948 13206 gene locus_tag LOCUS_16080 14948 13206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 >Feature sequence064 1562 3154 gene locus_tag LOCUS_16090 gene lysS 1562 3154 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192783.1 protein_id gnl|my_center|LOCUS_16090 3279 3611 gene locus_tag LOCUS_16100 3279 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 3729 3938 gene locus_tag LOCUS_16110 3729 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 4471 4773 gene locus_tag LOCUS_16120 4471 4773 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_16120 5542 4880 gene locus_tag LOCUS_16130 5542 4880 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_16130 6216 5539 gene locus_tag LOCUS_16140 gene hda 6216 5539 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196484.1 protein_id gnl|my_center|LOCUS_16140 7328 6264 gene locus_tag LOCUS_16150 7328 6264 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_16150 8735 7347 gene locus_tag LOCUS_16160 gene hpnO 8735 7347 CDS product aminobacteriohopanetriol synthase HpnO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085794.1 protein_id gnl|my_center|LOCUS_16160 9935 9009 gene locus_tag LOCUS_16170 9935 9009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141987.1 protein_id gnl|my_center|LOCUS_16170 10110 10313 gene locus_tag LOCUS_16180 10110 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 11337 10579 gene locus_tag LOCUS_16190 11337 10579 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771218.1 protein_id gnl|my_center|LOCUS_16190 12741 11392 gene locus_tag LOCUS_16200 gene radA 12741 11392 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928233.1 protein_id gnl|my_center|LOCUS_16200 13299 12751 gene locus_tag LOCUS_16210 gene rfbC 13299 12751 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_16210 14254 13325 gene locus_tag LOCUS_16220 gene rfbA 14254 13325 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence065 3845 2784 gene locus_tag LOCUS_16230 3845 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 4214 5413 gene locus_tag LOCUS_16240 4214 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 5783 6043 gene locus_tag LOCUS_16250 5783 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 6085 7707 gene locus_tag LOCUS_16260 6085 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 7918 8106 gene locus_tag LOCUS_16270 7918 8106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 8266 8679 gene locus_tag LOCUS_16280 8266 8679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 9588 8752 gene locus_tag LOCUS_16290 9588 8752 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167389.1 protein_id gnl|my_center|LOCUS_16290 9757 10122 gene locus_tag LOCUS_16300 9757 10122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 10222 10746 gene locus_tag LOCUS_16310 10222 10746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 11867 10830 gene locus_tag LOCUS_16320 11867 10830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 14617 12017 gene locus_tag LOCUS_16330 gene mutS 14617 12017 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193335.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence066 <1 552 gene locus_tag LOCUS_16340 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000779661.1:LPS export ABC transporter permease LptF 555 1616 gene locus_tag LOCUS_16350 gene lptG 555 1616 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296409.1 protein_id gnl|my_center|LOCUS_16350 1678 2331 gene locus_tag LOCUS_16360 1678 2331 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375180.1 protein_id gnl|my_center|LOCUS_16360 2334 3701 gene locus_tag LOCUS_16370 2334 3701 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478321.1 protein_id gnl|my_center|LOCUS_16370 3771 5009 gene locus_tag LOCUS_16380 3771 5009 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919043.1 protein_id gnl|my_center|LOCUS_16380 5027 7027 gene locus_tag LOCUS_16390 5027 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 7591 7001 gene locus_tag LOCUS_16400 7591 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 8225 8046 gene locus_tag LOCUS_16410 8225 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 8424 9071 gene locus_tag LOCUS_16420 8424 9071 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894436.1 protein_id gnl|my_center|LOCUS_16420 9058 9459 gene locus_tag LOCUS_16430 9058 9459 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345964.1 protein_id gnl|my_center|LOCUS_16430 9470 10351 gene locus_tag LOCUS_16440 9470 10351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 10536 11858 gene locus_tag LOCUS_16450 10536 11858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 11880 13160 gene locus_tag LOCUS_16460 11880 13160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 13405 15198 gene locus_tag LOCUS_16470 gene mutL 13405 15198 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929705.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence067 520 693 gene locus_tag LOCUS_16480 520 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1113 2060 gene locus_tag LOCUS_16490 1113 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 2649 2176 gene locus_tag LOCUS_16500 2649 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 3092 2688 gene locus_tag LOCUS_16510 3092 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 3271 5133 gene locus_tag LOCUS_16520 3271 5133 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770458.1 protein_id gnl|my_center|LOCUS_16520 5500 6828 gene locus_tag LOCUS_16530 5500 6828 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390393.1 protein_id gnl|my_center|LOCUS_16530 7055 8638 gene locus_tag LOCUS_16540 7055 8638 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928748.1 protein_id gnl|my_center|LOCUS_16540 10052 8718 gene locus_tag LOCUS_16550 10052 8718 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107715.1 protein_id gnl|my_center|LOCUS_16550 12485 10197 gene locus_tag LOCUS_16560 12485 10197 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971506.1 protein_id gnl|my_center|LOCUS_16560 12865 14013 gene locus_tag LOCUS_16570 12865 14013 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162517810.1 protein_id gnl|my_center|LOCUS_16570 <15125 14025 gene locus_tag LOCUS_16580 <15125 14025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207754.1:dicarboxylate/amino acid:cation symporter >Feature sequence068 3124 26 gene locus_tag LOCUS_16590 3124 26 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_16590 4347 3136 gene locus_tag LOCUS_16600 4347 3136 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_16600 4706 6376 gene locus_tag LOCUS_16610 4706 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 6376 7353 gene locus_tag LOCUS_16620 6376 7353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 7920 7462 gene locus_tag LOCUS_16630 7920 7462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 8030 8482 gene locus_tag LOCUS_16640 8030 8482 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086970.1 protein_id gnl|my_center|LOCUS_16640 8757 8551 gene locus_tag LOCUS_16650 8757 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 11844 8866 gene locus_tag LOCUS_16660 11844 8866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 12482 11901 gene locus_tag LOCUS_16670 12482 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 13196 12507 gene locus_tag LOCUS_16680 13196 12507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 <14989 13306 gene locus_tag LOCUS_16690 <14989 13306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816615.1:subtilisin/kexin-like serine protease HreP >Feature sequence069 497 3601 gene locus_tag LOCUS_16700 497 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 3620 4366 gene locus_tag LOCUS_16710 3620 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 5225 4428 gene locus_tag LOCUS_16720 5225 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 5539 5333 gene locus_tag LOCUS_16730 5539 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 5514 6164 gene locus_tag LOCUS_16740 5514 6164 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081162185.1 protein_id gnl|my_center|LOCUS_16740 8284 6227 gene locus_tag LOCUS_16750 8284 6227 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_16750 9774 8515 gene locus_tag LOCUS_16760 9774 8515 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_16760 10589 9909 gene locus_tag LOCUS_16770 gene adk 10589 9909 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064094.1 protein_id gnl|my_center|LOCUS_16770 10791 11825 gene locus_tag LOCUS_16780 gene recA 10791 11825 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_16780 11831 12289 gene locus_tag LOCUS_16790 gene recX 11831 12289 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930990.1 protein_id gnl|my_center|LOCUS_16790 12286 12657 gene locus_tag LOCUS_16800 12286 12657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence070 1 1314 gene locus_tag LOCUS_16810 1 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1495 3210 gene locus_tag LOCUS_16820 1495 3210 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_16820 3602 4156 gene locus_tag LOCUS_16830 3602 4156 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185071.1 protein_id gnl|my_center|LOCUS_16830 4351 5076 gene locus_tag LOCUS_16840 4351 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 5390 5899 gene locus_tag LOCUS_16850 5390 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187158.1 protein_id gnl|my_center|LOCUS_16850 5979 7160 gene locus_tag LOCUS_16860 5979 7160 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644929.1 protein_id gnl|my_center|LOCUS_16860 8423 7170 gene locus_tag LOCUS_16870 8423 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 8818 9162 gene locus_tag LOCUS_16880 8818 9162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 9531 10052 gene locus_tag LOCUS_16890 9531 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 10279 10752 gene locus_tag LOCUS_16900 10279 10752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 13555 10925 gene locus_tag LOCUS_16910 13555 10925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 <14797 13828 gene locus_tag LOCUS_16920 <14797 13828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033452234.1:methyl-accepting chemotaxis protein >Feature sequence071 232 765 gene locus_tag LOCUS_16930 232 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 798 723 gene locus_tag LOCUS_t00260 798 723 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1948 1178 gene locus_tag LOCUS_16940 1948 1178 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092499.1 protein_id gnl|my_center|LOCUS_16940 2383 2000 gene locus_tag LOCUS_16950 2383 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 2721 3344 gene locus_tag LOCUS_16960 2721 3344 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_16960 3368 3685 gene locus_tag LOCUS_16970 3368 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 3722 4630 gene locus_tag LOCUS_16980 3722 4630 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_16980 4636 5259 gene locus_tag LOCUS_16990 4636 5259 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16990 5443 5685 gene locus_tag LOCUS_17000 5443 5685 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_17000 5808 6563 gene locus_tag LOCUS_17010 gene djlA 5808 6563 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073436.1 protein_id gnl|my_center|LOCUS_17010 7657 6773 gene locus_tag LOCUS_17020 gene htpX 7657 6773 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369784.1 protein_id gnl|my_center|LOCUS_17020 8228 7947 gene locus_tag LOCUS_17030 8228 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 9511 8228 gene locus_tag LOCUS_17040 gene eno 9511 8228 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813700.1 protein_id gnl|my_center|LOCUS_17040 11304 9625 gene locus_tag LOCUS_17050 11304 9625 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 protein_id gnl|my_center|LOCUS_17050 12273 11392 gene locus_tag LOCUS_17060 12273 11392 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence072 98 1213 gene locus_tag LOCUS_17070 gene dnaN 98 1213 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196275.1 protein_id gnl|my_center|LOCUS_17070 1302 3707 gene locus_tag LOCUS_17080 gene gyrB 1302 3707 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816022.1 protein_id gnl|my_center|LOCUS_17080 3732 4751 gene locus_tag LOCUS_17090 3732 4751 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921968.1 protein_id gnl|my_center|LOCUS_17090 5347 4874 gene locus_tag LOCUS_17100 5347 4874 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037815.1 protein_id gnl|my_center|LOCUS_17100 5677 7725 gene locus_tag LOCUS_17110 5677 7725 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_17110 7860 8339 gene locus_tag LOCUS_17120 7860 8339 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_17120 8449 9393 gene locus_tag LOCUS_17130 8449 9393 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188957.1 protein_id gnl|my_center|LOCUS_17130 10043 9495 gene locus_tag LOCUS_17140 10043 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 11040 10036 gene locus_tag LOCUS_17150 gene trxB 11040 10036 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186294.1 protein_id gnl|my_center|LOCUS_17150 11708 11046 gene locus_tag LOCUS_17160 gene pcaH 11708 11046 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965195.1 protein_id gnl|my_center|LOCUS_17160 <14313 12310 gene locus_tag LOCUS_17170 <14313 12310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000141537.1:type I restriction endonuclease subunit R >Feature sequence073 229 747 gene locus_tag LOCUS_17180 229 747 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_17180 769 1542 gene locus_tag LOCUS_17190 769 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258024.1 protein_id gnl|my_center|LOCUS_17190 1560 2021 gene locus_tag LOCUS_17200 1560 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2051 2464 gene locus_tag LOCUS_17210 2051 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 2461 3747 gene locus_tag LOCUS_17220 2461 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 3744 5837 gene locus_tag LOCUS_17230 3744 5837 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095509668.1 protein_id gnl|my_center|LOCUS_17230 5834 6097 gene locus_tag LOCUS_17240 5834 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 6189 7487 gene locus_tag LOCUS_17250 6189 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 7883 8092 gene locus_tag LOCUS_17260 7883 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 8419 10032 gene locus_tag LOCUS_17270 8419 10032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 10091 10744 gene locus_tag LOCUS_17280 10091 10744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258031.1 protein_id gnl|my_center|LOCUS_17280 10756 11052 gene locus_tag LOCUS_17290 10756 11052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258032.1 protein_id gnl|my_center|LOCUS_17290 11079 12200 gene locus_tag LOCUS_17300 11079 12200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258033.1 protein_id gnl|my_center|LOCUS_17300 12206 12694 gene locus_tag LOCUS_17310 12206 12694 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258034.1 protein_id gnl|my_center|LOCUS_17310 13014 13373 gene locus_tag LOCUS_17320 13014 13373 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258036.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence074 1136 903 gene locus_tag LOCUS_17330 1136 903 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948175.1 protein_id gnl|my_center|LOCUS_17330 1253 1786 gene locus_tag LOCUS_17340 1253 1786 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479613.1 protein_id gnl|my_center|LOCUS_17340 2065 2343 gene locus_tag LOCUS_17350 2065 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 3340 2429 gene locus_tag LOCUS_17360 3340 2429 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 protein_id gnl|my_center|LOCUS_17360 4211 4549 gene locus_tag LOCUS_17370 4211 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 5877 4570 gene locus_tag LOCUS_17380 5877 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 6794 5775 gene locus_tag LOCUS_17390 6794 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 7582 6818 gene locus_tag LOCUS_17400 7582 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 8914 7649 gene locus_tag LOCUS_17410 8914 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 9296 9964 gene locus_tag LOCUS_17420 9296 9964 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937648.1 protein_id gnl|my_center|LOCUS_17420 9975 10745 gene locus_tag LOCUS_17430 9975 10745 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012068.1 protein_id gnl|my_center|LOCUS_17430 10742 11674 gene locus_tag LOCUS_17440 10742 11674 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937646.1 protein_id gnl|my_center|LOCUS_17440 11671 12615 gene locus_tag LOCUS_17450 11671 12615 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937649.1 protein_id gnl|my_center|LOCUS_17450 12625 13266 gene locus_tag LOCUS_17460 12625 13266 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162995.1 protein_id gnl|my_center|LOCUS_17460 13282 13959 gene locus_tag LOCUS_17470 gene pgl 13282 13959 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence075 727 26 gene locus_tag LOCUS_17480 727 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1619 831 gene locus_tag LOCUS_17490 1619 831 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640161.1 protein_id gnl|my_center|LOCUS_17490 2787 1630 gene locus_tag LOCUS_17500 gene yghO 2787 1630 CDS product protein YghO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981816.1 protein_id gnl|my_center|LOCUS_17500 3344 2871 gene locus_tag LOCUS_17510 3344 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 3907 4614 gene locus_tag LOCUS_17520 3907 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 4651 5352 gene locus_tag LOCUS_17530 4651 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 5359 6720 gene locus_tag LOCUS_17540 5359 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 6717 8885 gene locus_tag LOCUS_17550 6717 8885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 8891 10009 gene locus_tag LOCUS_17560 8891 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 10033 12414 gene locus_tag LOCUS_17570 10033 12414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 >Feature sequence076 1917 1093 gene locus_tag LOCUS_17580 1917 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 2875 2066 gene locus_tag LOCUS_17590 2875 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 4119 3787 gene locus_tag LOCUS_17600 4119 3787 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370060.1 protein_id gnl|my_center|LOCUS_17600 4629 4318 gene locus_tag LOCUS_17610 4629 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 4976 4677 gene locus_tag LOCUS_17620 4976 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 5380 5177 gene locus_tag LOCUS_17630 5380 5177 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061019.1 protein_id gnl|my_center|LOCUS_17630 5745 5434 gene locus_tag LOCUS_17640 5745 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 7281 6301 gene locus_tag LOCUS_17650 7281 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 9428 8109 gene locus_tag LOCUS_17660 9428 8109 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117871.1 protein_id gnl|my_center|LOCUS_17660 10965 10105 gene locus_tag LOCUS_17670 10965 10105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 11004 11453 gene locus_tag LOCUS_17680 gene queD 11004 11453 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040017.1 protein_id gnl|my_center|LOCUS_17680 11478 12260 gene locus_tag LOCUS_17690 11478 12260 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930598.1 protein_id gnl|my_center|LOCUS_17690 12244 12894 gene locus_tag LOCUS_17700 12244 12894 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191824.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence077 <1 915 gene locus_tag LOCUS_17710 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258728.1:CHAT domain-containing protein 915 3077 gene locus_tag LOCUS_17720 915 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 3589 3239 gene locus_tag LOCUS_17730 3589 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 4414 3641 gene locus_tag LOCUS_17740 4414 3641 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222468.1 protein_id gnl|my_center|LOCUS_17740 5818 4520 gene locus_tag LOCUS_17750 gene hisD 5818 4520 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931641.1 protein_id gnl|my_center|LOCUS_17750 6504 5860 gene locus_tag LOCUS_17760 gene hisG 6504 5860 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_17760 7158 6517 gene locus_tag LOCUS_17770 7158 6517 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440414.1 protein_id gnl|my_center|LOCUS_17770 7675 7244 gene locus_tag LOCUS_17780 7675 7244 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206590.1 protein_id gnl|my_center|LOCUS_17780 7950 8411 gene locus_tag LOCUS_17790 gene purE 7950 8411 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 protein_id gnl|my_center|LOCUS_17790 8408 9556 gene locus_tag LOCUS_17800 8408 9556 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230480.1 protein_id gnl|my_center|LOCUS_17800 9553 10449 gene locus_tag LOCUS_17810 9553 10449 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 protein_id gnl|my_center|LOCUS_17810 11226 10513 gene locus_tag LOCUS_17820 11226 10513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155662648.1 protein_id gnl|my_center|LOCUS_17820 12065 11289 gene locus_tag LOCUS_17830 12065 11289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 13002 12448 gene locus_tag LOCUS_17840 13002 12448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142256.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence078 194 874 gene locus_tag LOCUS_17850 194 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 901 1815 gene locus_tag LOCUS_17860 901 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17860 1927 4110 gene locus_tag LOCUS_17870 1927 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17870 4171 4653 gene locus_tag LOCUS_17880 gene greA 4171 4653 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192392.1 protein_id gnl|my_center|LOCUS_17880 5049 4666 gene locus_tag LOCUS_17890 5049 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 5088 5675 gene locus_tag LOCUS_17900 5088 5675 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213963.1 protein_id gnl|my_center|LOCUS_17900 5844 6299 gene locus_tag LOCUS_17910 5844 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17910 6194 7759 gene locus_tag LOCUS_17920 gene ftsH 6194 7759 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930174.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17920 7885 8667 gene locus_tag LOCUS_17930 gene folP 7885 8667 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071428.1 protein_id gnl|my_center|LOCUS_17930 8727 10091 gene locus_tag LOCUS_17940 gene glmM 8727 10091 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266863.1 protein_id gnl|my_center|LOCUS_17940 10219 11217 gene locus_tag LOCUS_17950 10219 11217 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_17950 11375 12805 gene locus_tag LOCUS_17960 gene cysG 11375 12805 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence079 1199 936 gene locus_tag LOCUS_17970 1199 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17970 1674 1204 gene locus_tag LOCUS_17980 1674 1204 CDS product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487417.1 protein_id gnl|my_center|LOCUS_17980 2018 2545 gene locus_tag LOCUS_17990 2018 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2924 2742 gene locus_tag LOCUS_18000 2924 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 4852 3053 gene locus_tag LOCUS_18010 gene recQ 4852 3053 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198363.1 protein_id gnl|my_center|LOCUS_18010 5172 6581 gene locus_tag LOCUS_18020 gene glnA 5172 6581 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811164.1 protein_id gnl|my_center|LOCUS_18020 6721 7158 gene locus_tag LOCUS_18030 6721 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 7199 7660 gene locus_tag LOCUS_18040 7199 7660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 8434 7667 gene locus_tag LOCUS_18050 gene xth 8434 7667 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812032.1 protein_id gnl|my_center|LOCUS_18050 9225 8545 gene locus_tag LOCUS_18060 9225 8545 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931226.1 protein_id gnl|my_center|LOCUS_18060 11938 9473 gene locus_tag LOCUS_18070 11938 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 12423 12818 gene locus_tag LOCUS_18080 12423 12818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence080 368 1747 gene locus_tag LOCUS_18090 368 1747 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 protein_id gnl|my_center|LOCUS_18090 1766 2968 gene locus_tag LOCUS_18100 gene zapE 1766 2968 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921360.1 protein_id gnl|my_center|LOCUS_18100 3870 3016 gene locus_tag LOCUS_18110 3870 3016 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007836183.1 protein_id gnl|my_center|LOCUS_18110 4239 6074 gene locus_tag LOCUS_18120 4239 6074 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015482.1 protein_id gnl|my_center|LOCUS_18120 6441 6199 gene locus_tag LOCUS_18130 6441 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 6866 7867 gene locus_tag LOCUS_18140 6866 7867 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266577.1 protein_id gnl|my_center|LOCUS_18140 8153 8626 gene locus_tag LOCUS_18150 8153 8626 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037229002.1 protein_id gnl|my_center|LOCUS_18150 10343 8793 gene locus_tag LOCUS_18160 10343 8793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 <13082 10755 gene locus_tag LOCUS_18170 <13082 10755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921441.1:cadherin domain-containing protein >Feature sequence081 256 759 gene locus_tag LOCUS_18180 256 759 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974838.1 protein_id gnl|my_center|LOCUS_18180 756 2120 gene locus_tag LOCUS_18190 gene ccmI 756 2120 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070639.1 protein_id gnl|my_center|LOCUS_18190 2128 2598 gene locus_tag LOCUS_18200 2128 2598 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317382.1 protein_id gnl|my_center|LOCUS_18200 5017 2690 gene locus_tag LOCUS_18210 5017 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 5878 5072 gene locus_tag LOCUS_18220 5878 5072 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_18220 6478 6122 gene locus_tag LOCUS_18230 6478 6122 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_18230 7961 6540 gene locus_tag LOCUS_18240 7961 6540 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_18240 8184 9098 gene locus_tag LOCUS_18250 8184 9098 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_18250 9195 9863 gene locus_tag LOCUS_18260 9195 9863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 9897 10121 gene locus_tag LOCUS_18270 9897 10121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074051.1 protein_id gnl|my_center|LOCUS_18270 10475 10161 gene locus_tag LOCUS_18280 10475 10161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 10981 10472 gene locus_tag LOCUS_18290 10981 10472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 11145 12479 gene locus_tag LOCUS_18300 gene rimO 11145 12479 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521351.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence082 1665 466 gene locus_tag LOCUS_18310 1665 466 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037142.1 protein_id gnl|my_center|LOCUS_18310 4218 1690 gene locus_tag LOCUS_18320 4218 1690 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037143.1 protein_id gnl|my_center|LOCUS_18320 4741 4385 gene locus_tag LOCUS_18330 4741 4385 CDS product Spx/MgsR family RNA polymerase-binding regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218968.1 protein_id gnl|my_center|LOCUS_18330 5117 4776 gene locus_tag LOCUS_18340 5117 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 6425 5226 gene locus_tag LOCUS_18350 6425 5226 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727834.1 protein_id gnl|my_center|LOCUS_18350 7733 6552 gene locus_tag LOCUS_18360 7733 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 8146 7898 gene locus_tag LOCUS_18370 8146 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 8897 8553 gene locus_tag LOCUS_18380 8897 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 9468 8908 gene locus_tag LOCUS_18390 9468 8908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 9757 9503 gene locus_tag LOCUS_18400 gene acpP 9757 9503 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942249.1 protein_id gnl|my_center|LOCUS_18400 10991 9774 gene locus_tag LOCUS_18410 gene fabF 10991 9774 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_18410 11991 11215 gene locus_tag LOCUS_18420 11991 11215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence083 662 2620 gene locus_tag LOCUS_18430 662 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2924 4249 gene locus_tag LOCUS_18440 2924 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 5031 4438 gene locus_tag LOCUS_18450 5031 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 5271 5071 gene locus_tag LOCUS_18460 5271 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 5856 5275 gene locus_tag LOCUS_18470 5856 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 6960 5995 gene locus_tag LOCUS_18480 6960 5995 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530692.1 protein_id gnl|my_center|LOCUS_18480 8436 7171 gene locus_tag LOCUS_18490 8436 7171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 8635 9639 gene locus_tag LOCUS_18500 8635 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 9700 11136 gene locus_tag LOCUS_18510 9700 11136 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970335.1 protein_id gnl|my_center|LOCUS_18510 11565 11236 gene locus_tag LOCUS_18520 11565 11236 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370060.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence084 2013 370 gene locus_tag LOCUS_18530 2013 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 3143 2784 gene locus_tag LOCUS_18540 3143 2784 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807250.1 protein_id gnl|my_center|LOCUS_18540 4282 3269 gene locus_tag LOCUS_18550 4282 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 4597 4782 gene locus_tag LOCUS_18560 4597 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 4948 5412 gene locus_tag LOCUS_18570 gene bfr 4948 5412 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188572.1 protein_id gnl|my_center|LOCUS_18570 6316 6630 gene locus_tag LOCUS_18580 6316 6630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 6648 7508 gene locus_tag LOCUS_18590 6648 7508 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072092.1 protein_id gnl|my_center|LOCUS_18590 7474 8265 gene locus_tag LOCUS_18600 7474 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 10272 8335 gene locus_tag LOCUS_18610 10272 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 10770 10417 gene locus_tag LOCUS_18620 10770 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 11570 11004 gene locus_tag LOCUS_18630 11570 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence085 631 353 gene locus_tag LOCUS_18640 631 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1239 673 gene locus_tag LOCUS_18650 1239 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18650 1769 1329 gene locus_tag LOCUS_18660 1769 1329 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767420.1 protein_id gnl|my_center|LOCUS_18660 3112 1817 gene locus_tag LOCUS_18670 3112 1817 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_18670 4297 3146 gene locus_tag LOCUS_18680 4297 3146 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192327.1 protein_id gnl|my_center|LOCUS_18680 4527 4342 gene locus_tag LOCUS_18690 4527 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 5654 4779 gene locus_tag LOCUS_18700 gene hflC 5654 4779 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810713.1 protein_id gnl|my_center|LOCUS_18700 6836 5655 gene locus_tag LOCUS_18710 gene hflK 6836 5655 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928767.1 protein_id gnl|my_center|LOCUS_18710 8032 6872 gene locus_tag LOCUS_18720 gene hflX 8032 6872 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191816.1 protein_id gnl|my_center|LOCUS_18720 8307 8050 gene locus_tag LOCUS_18730 gene hfq 8307 8050 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810707.1 protein_id gnl|my_center|LOCUS_18730 9696 8704 gene locus_tag LOCUS_18740 9696 8704 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 protein_id gnl|my_center|LOCUS_18740 10402 9845 gene locus_tag LOCUS_18750 10402 9845 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814635.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence086 345 698 gene locus_tag LOCUS_18760 345 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1979 870 gene locus_tag LOCUS_18770 gene dnaJ 1979 870 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209249.1 protein_id gnl|my_center|LOCUS_18770 4053 2119 gene locus_tag LOCUS_18780 gene dnaK 4053 2119 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039219.1 protein_id gnl|my_center|LOCUS_18780 4716 4123 gene locus_tag LOCUS_18790 gene grpE 4716 4123 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 protein_id gnl|my_center|LOCUS_18790 6222 4825 gene locus_tag LOCUS_18800 gene purB 6222 4825 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194180.1 protein_id gnl|my_center|LOCUS_18800 6686 6405 gene locus_tag LOCUS_18810 6686 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 6910 7419 gene locus_tag LOCUS_18820 6910 7419 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_18820 7416 8522 gene locus_tag LOCUS_18830 7416 8522 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064805.1 protein_id gnl|my_center|LOCUS_18830 8528 9370 gene locus_tag LOCUS_18840 gene fghA 8528 9370 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189817.1 protein_id gnl|my_center|LOCUS_18840 11112 9730 gene locus_tag LOCUS_18850 gene cysS 11112 9730 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010355798.1 protein_id gnl|my_center|LOCUS_18850 11214 11855 gene locus_tag LOCUS_18860 11214 11855 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence087 499 113 gene locus_tag LOCUS_18870 499 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 619 2052 gene locus_tag LOCUS_18880 gene sbcB 619 2052 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123272.1 protein_id gnl|my_center|LOCUS_18880 2419 3930 gene locus_tag LOCUS_18890 gene ilvA 2419 3930 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_18890 4134 6233 gene locus_tag LOCUS_18900 gene pilJ 4134 6233 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_18900 6274 10860 gene locus_tag LOCUS_18910 6274 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 11279 11827 gene locus_tag LOCUS_18920 11279 11827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence088 103 399 gene locus_tag LOCUS_18930 103 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 3074 687 gene locus_tag LOCUS_18940 3074 687 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090828103.1 protein_id gnl|my_center|LOCUS_18940 3293 4435 gene locus_tag LOCUS_18950 gene flhB 3293 4435 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938913.1 protein_id gnl|my_center|LOCUS_18950 4478 6580 gene locus_tag LOCUS_18960 gene flhA 4478 6580 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198639.1 protein_id gnl|my_center|LOCUS_18960 6577 7854 gene locus_tag LOCUS_18970 6577 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 7895 8743 gene locus_tag LOCUS_18980 7895 8743 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073096.1 protein_id gnl|my_center|LOCUS_18980 8750 9466 gene locus_tag LOCUS_18990 8750 9466 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198636.1 protein_id gnl|my_center|LOCUS_18990 9510 10265 gene locus_tag LOCUS_19000 9510 10265 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 protein_id gnl|my_center|LOCUS_19000 10321 11133 gene locus_tag LOCUS_19010 gene motD 10321 11133 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103791.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence089 <1 2893 gene locus_tag LOCUS_19020 <1 2893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037394620.1:M10 family metallopeptidase C-terminal domain-containing protein 3575 3961 gene locus_tag LOCUS_19030 3575 3961 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198014.1 protein_id gnl|my_center|LOCUS_19030 4240 5967 gene locus_tag LOCUS_19040 gene ptsP 4240 5967 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_19040 6108 7235 gene locus_tag LOCUS_19050 6108 7235 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198305.1 protein_id gnl|my_center|LOCUS_19050 7262 7879 gene locus_tag LOCUS_19060 gene metW 7262 7879 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688371.1 protein_id gnl|my_center|LOCUS_19060 8122 8673 gene locus_tag LOCUS_19070 8122 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 8943 10388 gene locus_tag LOCUS_19080 8943 10388 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082330.1 protein_id gnl|my_center|LOCUS_19080 10401 11126 gene locus_tag LOCUS_19090 10401 11126 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420904.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence090 1683 478 gene locus_tag LOCUS_19100 1683 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 4365 1753 gene locus_tag LOCUS_19110 4365 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 7868 4554 gene locus_tag LOCUS_19120 7868 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 8175 9554 gene locus_tag LOCUS_19130 8175 9554 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971847.1 protein_id gnl|my_center|LOCUS_19130 <10907 9551 gene locus_tag LOCUS_19140 <10907 9551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391173.1:DUF3422 domain-containing protein >Feature sequence091 902 18 gene locus_tag LOCUS_19150 902 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 1086 1814 gene locus_tag LOCUS_19160 1086 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 1939 2283 gene locus_tag LOCUS_19170 1939 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 2280 2495 gene locus_tag LOCUS_19180 2280 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19180 2488 4818 gene locus_tag LOCUS_19190 2488 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 5004 5477 gene locus_tag LOCUS_19200 5004 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 5906 5820 gene locus_tag LOCUS_t00270 5906 5820 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6018 7052 gene locus_tag LOCUS_19210 gene queA 6018 7052 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930156.1 protein_id gnl|my_center|LOCUS_19210 7049 8134 gene locus_tag LOCUS_19220 gene tgt 7049 8134 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809419.1 protein_id gnl|my_center|LOCUS_19220 8186 8644 gene locus_tag LOCUS_19230 8186 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence092 1358 288 gene locus_tag LOCUS_19240 gene pheA 1358 288 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190098.1 protein_id gnl|my_center|LOCUS_19240 2592 1375 gene locus_tag LOCUS_19250 2592 1375 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_19250 3676 2585 gene locus_tag LOCUS_19260 gene serC 3676 2585 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766746.1 protein_id gnl|my_center|LOCUS_19260 6264 3706 gene locus_tag LOCUS_19270 gene gyrA 6264 3706 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527513.1 protein_id gnl|my_center|LOCUS_19270 6824 7996 gene locus_tag LOCUS_19280 6824 7996 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948653.1 protein_id gnl|my_center|LOCUS_19280 8033 8956 gene locus_tag LOCUS_19290 gene argF 8033 8956 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190177.1 protein_id gnl|my_center|LOCUS_19290 9030 10271 gene locus_tag LOCUS_19300 9030 10271 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence093 267 43 gene locus_tag LOCUS_19310 267 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 1182 358 gene locus_tag LOCUS_19320 1182 358 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_19320 3112 1217 gene locus_tag LOCUS_19330 gene thiC 3112 1217 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929683.1 protein_id gnl|my_center|LOCUS_19330 3333 3911 gene locus_tag LOCUS_19340 3333 3911 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_19340 4077 5429 gene locus_tag LOCUS_19350 4077 5429 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_19350 8726 5439 gene locus_tag LOCUS_19360 gene mscK 8726 5439 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463895.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence094 2728 1979 gene locus_tag LOCUS_19370 2728 1979 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 protein_id gnl|my_center|LOCUS_19370 3956 2757 gene locus_tag LOCUS_19380 3956 2757 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521997.1 protein_id gnl|my_center|LOCUS_19380 4189 4264 gene locus_tag LOCUS_t00280 4189 4264 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5699 4929 gene locus_tag LOCUS_19390 5699 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 6504 7487 gene locus_tag LOCUS_19400 6504 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 7860 8108 gene locus_tag LOCUS_19410 7860 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 8228 10129 gene locus_tag LOCUS_19420 8228 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence095 3524 1650 gene locus_tag LOCUS_19430 3524 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 5658 3658 gene locus_tag LOCUS_19440 5658 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 9540 5767 gene locus_tag LOCUS_19450 9540 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence096 1458 622 gene locus_tag LOCUS_19460 gene serB 1458 622 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 protein_id gnl|my_center|LOCUS_19460 2967 1507 gene locus_tag LOCUS_19470 2967 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 3227 4723 gene locus_tag LOCUS_19480 gene pepA 3227 4723 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 protein_id gnl|my_center|LOCUS_19480 4877 5209 gene locus_tag LOCUS_19490 4877 5209 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522571.1 protein_id gnl|my_center|LOCUS_19490 5239 5616 gene locus_tag LOCUS_19500 5239 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 5751 8513 gene locus_tag LOCUS_19510 5751 8513 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521705.1 protein_id gnl|my_center|LOCUS_19510 8601 9302 gene locus_tag LOCUS_19520 8601 9302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19520 9271 9639 gene locus_tag LOCUS_19530 9271 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19530 >Feature sequence097 133 552 gene locus_tag LOCUS_19540 133 552 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370062.1 protein_id gnl|my_center|LOCUS_19540 934 626 gene locus_tag LOCUS_19550 gene grxD 934 626 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186955.1 protein_id gnl|my_center|LOCUS_19550 1847 1011 gene locus_tag LOCUS_19560 gene prmC 1847 1011 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948043.1 protein_id gnl|my_center|LOCUS_19560 2955 1876 gene locus_tag LOCUS_19570 gene prfA 2955 1876 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186862.1 protein_id gnl|my_center|LOCUS_19570 4205 2955 gene locus_tag LOCUS_19580 gene hemA 4205 2955 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521984.1 protein_id gnl|my_center|LOCUS_19580 4831 4334 gene locus_tag LOCUS_19590 gene creA 4831 4334 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875811.1 protein_id gnl|my_center|LOCUS_19590 5405 4923 gene locus_tag LOCUS_19600 5405 4923 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_19600 5908 5408 gene locus_tag LOCUS_19610 gene tadA 5908 5408 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191221.1 protein_id gnl|my_center|LOCUS_19610 6022 6921 gene locus_tag LOCUS_19620 gene prmB 6022 6921 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235090.1 protein_id gnl|my_center|LOCUS_19620 7785 6991 gene locus_tag LOCUS_19630 7785 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 <9662 7846 gene locus_tag LOCUS_19640 <9662 7846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence098 2796 1681 gene locus_tag LOCUS_19650 gene hcuB 2796 1681 CDS product hydrophobic compound transporter HcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112500.1 protein_id gnl|my_center|LOCUS_19650 4019 2898 gene locus_tag LOCUS_19660 4019 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 4860 4048 gene locus_tag LOCUS_19670 4860 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 5431 4925 gene locus_tag LOCUS_19680 5431 4925 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045300.1 protein_id gnl|my_center|LOCUS_19680 7689 5623 gene locus_tag LOCUS_19690 gene pqqU 7689 5623 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 protein_id gnl|my_center|LOCUS_19690 7979 8383 gene locus_tag LOCUS_19700 7979 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 8376 9347 gene locus_tag LOCUS_19710 8376 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 9349 9480 gene locus_tag LOCUS_19720 9349 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence099 1458 811 gene locus_tag LOCUS_19730 gene lipB 1458 811 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071393.1 protein_id gnl|my_center|LOCUS_19730 2675 1806 gene locus_tag LOCUS_19740 2675 1806 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189800.1 protein_id gnl|my_center|LOCUS_19740 3842 2721 gene locus_tag LOCUS_19750 3842 2721 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064727.1 protein_id gnl|my_center|LOCUS_19750 4608 4063 gene locus_tag LOCUS_19760 4608 4063 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_19760 5495 4638 gene locus_tag LOCUS_19770 5495 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 5778 7805 gene locus_tag LOCUS_19780 gene ligA 5778 7805 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937986.1 protein_id gnl|my_center|LOCUS_19780 8470 7826 gene locus_tag LOCUS_19790 8470 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 8585 8923 gene locus_tag LOCUS_19800 8585 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 8942 9373 gene locus_tag LOCUS_19810 8942 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence100 3869 2031 gene locus_tag LOCUS_19820 3869 2031 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073024.1 protein_id gnl|my_center|LOCUS_19820 5126 3885 gene locus_tag LOCUS_19830 5126 3885 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 protein_id gnl|my_center|LOCUS_19830 5372 5773 gene locus_tag LOCUS_19840 5372 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 7526 5823 gene locus_tag LOCUS_19850 7526 5823 CDS product hydrogenase maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089664.1 protein_id gnl|my_center|LOCUS_19850 8594 7536 gene locus_tag LOCUS_19860 gene hypE 8594 7536 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_19860 9229 8594 gene locus_tag LOCUS_19870 9229 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19870 >Feature sequence101 1945 2892 gene locus_tag LOCUS_19880 1945 2892 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 protein_id gnl|my_center|LOCUS_19880 2916 5729 gene locus_tag LOCUS_19890 gene ileS 2916 5729 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225664.1 protein_id gnl|my_center|LOCUS_19890 5753 6244 gene locus_tag LOCUS_19900 gene lspA 5753 6244 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 protein_id gnl|my_center|LOCUS_19900 6459 6277 gene locus_tag LOCUS_19910 6459 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 6773 7648 gene locus_tag LOCUS_19920 6773 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 <9453 7823 gene locus_tag LOCUS_19930 <9453 7823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071465.1:lysophospholipid acyltransferase family protein >Feature sequence102 2855 1671 gene locus_tag LOCUS_19940 2855 1671 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_19940 3299 2865 gene locus_tag LOCUS_19950 gene gspG 3299 2865 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_19950 4132 3449 gene locus_tag LOCUS_19960 4132 3449 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416253.1 protein_id gnl|my_center|LOCUS_19960 4589 8614 gene locus_tag LOCUS_19970 4589 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 9177 8698 gene locus_tag LOCUS_19980 9177 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence103 1749 439 gene locus_tag LOCUS_19990 1749 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 2152 1751 gene locus_tag LOCUS_20000 2152 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 3102 3371 gene locus_tag LOCUS_20010 3102 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 3668 3489 gene locus_tag LOCUS_20020 3668 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 3880 4203 gene locus_tag LOCUS_20030 3880 4203 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771072.1 protein_id gnl|my_center|LOCUS_20030 4232 6994 gene locus_tag LOCUS_20040 4232 6994 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence104 855 295 gene locus_tag LOCUS_20050 855 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 1027 1581 gene locus_tag LOCUS_20060 1027 1581 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194377.1 protein_id gnl|my_center|LOCUS_20060 1594 2340 gene locus_tag LOCUS_20070 1594 2340 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_20070 2330 2863 gene locus_tag LOCUS_20080 gene def 2330 2863 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193946.1 protein_id gnl|my_center|LOCUS_20080 4394 2910 gene locus_tag LOCUS_20090 4394 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 6013 5168 gene locus_tag LOCUS_20100 6013 5168 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798219.1 protein_id gnl|my_center|LOCUS_20100 7814 6234 gene locus_tag LOCUS_20110 7814 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence105 2842 1607 gene locus_tag LOCUS_20120 gene acrA 2842 1607 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005019446.1 protein_id gnl|my_center|LOCUS_20120 3437 2886 gene locus_tag LOCUS_20130 3437 2886 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933129.1 protein_id gnl|my_center|LOCUS_20130 4856 3531 gene locus_tag LOCUS_20140 4856 3531 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_20140 5370 7802 gene locus_tag LOCUS_20150 5370 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 7832 8758 gene locus_tag LOCUS_20160 7832 8758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence106 <1 1341 gene locus_tag LOCUS_20170 <1 1341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921313.1:alpha-amylase family glycosyl hydrolase 1706 2461 gene locus_tag LOCUS_20180 1706 2461 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_20180 3201 2509 gene locus_tag LOCUS_20190 3201 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 3996 3433 gene locus_tag LOCUS_20200 3996 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 4537 4178 gene locus_tag LOCUS_20210 4537 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 4905 4603 gene locus_tag LOCUS_20220 4905 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 5191 6102 gene locus_tag LOCUS_20230 5191 6102 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104663.1 protein_id gnl|my_center|LOCUS_20230 7787 6201 gene locus_tag LOCUS_20240 7787 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence107 111 311 gene locus_tag LOCUS_20250 111 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 1880 498 gene locus_tag LOCUS_20260 1880 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 4220 1902 gene locus_tag LOCUS_20270 4220 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258039.1 protein_id gnl|my_center|LOCUS_20270 5991 4228 gene locus_tag LOCUS_20280 5991 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 7507 6008 gene locus_tag LOCUS_20290 7507 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 <8714 7504 gene locus_tag LOCUS_20300 <8714 7504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258037.1:putative baseplate assembly protein >Feature sequence108 232 675 gene locus_tag LOCUS_20310 232 675 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091210.1 protein_id gnl|my_center|LOCUS_20310 1512 697 gene locus_tag LOCUS_20320 1512 697 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244053.1 protein_id gnl|my_center|LOCUS_20320 1499 2524 gene locus_tag LOCUS_20330 gene rluD 1499 2524 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073400.1 protein_id gnl|my_center|LOCUS_20330 4020 2623 gene locus_tag LOCUS_20340 4020 2623 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922914.1 protein_id gnl|my_center|LOCUS_20340 4936 4262 gene locus_tag LOCUS_20350 4936 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 5056 5472 gene locus_tag LOCUS_20360 5056 5472 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188900.1 protein_id gnl|my_center|LOCUS_20360 6176 5628 gene locus_tag LOCUS_20370 gene greB 6176 5628 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_20370 6533 6201 gene locus_tag LOCUS_20380 6533 6201 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 protein_id gnl|my_center|LOCUS_20380 7541 6573 gene locus_tag LOCUS_20390 7541 6573 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence109 874 2535 gene locus_tag LOCUS_20400 874 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3935 2778 gene locus_tag LOCUS_20410 3935 2778 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_20410 4393 3962 gene locus_tag LOCUS_20420 gene trxC 4393 3962 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_20420 4751 4434 gene locus_tag LOCUS_20430 4751 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 5705 4755 gene locus_tag LOCUS_20440 5705 4755 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 protein_id gnl|my_center|LOCUS_20440 7013 5841 gene locus_tag LOCUS_20450 7013 5841 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028042.1 protein_id gnl|my_center|LOCUS_20450 7188 7508 gene locus_tag LOCUS_20460 7188 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 >Feature sequence110 294 695 gene locus_tag LOCUS_20470 294 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 708 2729 gene locus_tag LOCUS_20480 708 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 8403 2767 gene locus_tag LOCUS_20490 8403 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence111 36 953 gene locus_tag LOCUS_20500 36 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 1785 1132 gene locus_tag LOCUS_20510 1785 1132 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114764.1 protein_id gnl|my_center|LOCUS_20510 2063 1824 gene locus_tag LOCUS_20520 2063 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 2918 2400 gene locus_tag LOCUS_20530 gene msrB 2918 2400 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404837.1 protein_id gnl|my_center|LOCUS_20530 3145 3717 gene locus_tag LOCUS_20540 3145 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 4762 3812 gene locus_tag LOCUS_20550 4762 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 5194 4799 gene locus_tag LOCUS_20560 5194 4799 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_20560 5703 5188 gene locus_tag LOCUS_20570 5703 5188 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_20570 8009 5700 gene locus_tag LOCUS_20580 8009 5700 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942422.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence112 430 2190 gene locus_tag LOCUS_20590 gene nuoF 430 2190 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_20590 2197 2934 gene locus_tag LOCUS_20600 gene hoxU 2197 2934 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_20600 2918 3463 gene locus_tag LOCUS_20610 2918 3463 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_20610 3467 4960 gene locus_tag LOCUS_20620 3467 4960 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_20620 5584 5057 gene locus_tag LOCUS_20630 5584 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 7902 5938 gene locus_tag LOCUS_20640 7902 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence113 517 1080 gene locus_tag LOCUS_20650 gene efp 517 1080 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707002.1 protein_id gnl|my_center|LOCUS_20650 1283 1756 gene locus_tag LOCUS_20660 1283 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 1777 2604 gene locus_tag LOCUS_20670 gene dapF 1777 2604 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073967.1 protein_id gnl|my_center|LOCUS_20670 2619 3329 gene locus_tag LOCUS_20680 2619 3329 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931281.1 protein_id gnl|my_center|LOCUS_20680 3286 4206 gene locus_tag LOCUS_20690 gene xerC 3286 4206 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275252.1 protein_id gnl|my_center|LOCUS_20690 4283 4804 gene locus_tag LOCUS_20700 gene hslV 4283 4804 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818422.1 protein_id gnl|my_center|LOCUS_20700 4933 6264 gene locus_tag LOCUS_20710 gene hslU 4933 6264 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198316.1 protein_id gnl|my_center|LOCUS_20710 6677 6429 gene locus_tag LOCUS_20720 6677 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 7360 6983 gene locus_tag LOCUS_20730 7360 6983 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_20730 7738 7451 gene locus_tag LOCUS_20740 7738 7451 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_20740 >Feature sequence114 747 2657 gene locus_tag LOCUS_20750 gene htpG 747 2657 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185742.1 protein_id gnl|my_center|LOCUS_20750 2798 3316 gene locus_tag LOCUS_20760 2798 3316 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189321.1 protein_id gnl|my_center|LOCUS_20760 3303 4214 gene locus_tag LOCUS_20770 gene xerD 3303 4214 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266933.1 protein_id gnl|my_center|LOCUS_20770 4705 4232 gene locus_tag LOCUS_20780 4705 4232 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099230.1 protein_id gnl|my_center|LOCUS_20780 4872 5225 gene locus_tag LOCUS_20790 4872 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 5715 5323 gene locus_tag LOCUS_20800 5715 5323 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811293.1 protein_id gnl|my_center|LOCUS_20800 7073 5763 gene locus_tag LOCUS_20810 gene xseA 7073 5763 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812887.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence115 700 299 gene locus_tag LOCUS_20820 700 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 1108 764 gene locus_tag LOCUS_20830 1108 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 1562 1176 gene locus_tag LOCUS_20840 1562 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 2016 1627 gene locus_tag LOCUS_20850 2016 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068582.1 protein_id gnl|my_center|LOCUS_20850 3979 3137 gene locus_tag LOCUS_20860 3979 3137 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_20860 4305 4826 gene locus_tag LOCUS_20870 4305 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 4914 5948 gene locus_tag LOCUS_20880 4914 5948 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526322.1 protein_id gnl|my_center|LOCUS_20880 7388 5982 gene locus_tag LOCUS_20890 7388 5982 CDS product GTPase/DUF3482 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112966.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence116 <1 1307 gene locus_tag LOCUS_20900 <1 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268766.1:allophanate hydrolase 1855 3453 gene locus_tag LOCUS_20910 1855 3453 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114382.1 protein_id gnl|my_center|LOCUS_20910 3524 5089 gene locus_tag LOCUS_20920 3524 5089 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045022.1 protein_id gnl|my_center|LOCUS_20920 5434 5114 gene locus_tag LOCUS_20930 5434 5114 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901934.1 protein_id gnl|my_center|LOCUS_20930 5544 6437 gene locus_tag LOCUS_20940 5544 6437 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816436.1 protein_id gnl|my_center|LOCUS_20940 6491 6841 gene locus_tag LOCUS_20950 6491 6841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993823.1 protein_id gnl|my_center|LOCUS_20950 6881 7510 gene locus_tag LOCUS_20960 gene ycaC 6881 7510 CDS product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943220.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence117 2905 1967 gene locus_tag LOCUS_20970 2905 1967 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713800.1 protein_id gnl|my_center|LOCUS_20970 3856 5895 gene locus_tag LOCUS_20980 3856 5895 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_20980 5969 6469 gene locus_tag LOCUS_20990 5969 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 7049 6657 gene locus_tag LOCUS_21000 7049 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence118 <1 539 gene locus_tag LOCUS_21010 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391330.1:Lon protease family protein 613 1752 gene locus_tag LOCUS_21020 613 1752 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958179.1 protein_id gnl|my_center|LOCUS_21020 4527 1696 gene locus_tag LOCUS_21030 4527 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 5066 4599 gene locus_tag LOCUS_21040 gene gspG 5066 4599 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085349.1 protein_id gnl|my_center|LOCUS_21040 5485 6714 gene locus_tag LOCUS_21050 5485 6714 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527177.1 protein_id gnl|my_center|LOCUS_21050 7413 6760 gene locus_tag LOCUS_21060 7413 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence119 <1 1454 gene locus_tag LOCUS_21070 <1 1454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071650.1:N-6 DNA methylase 2185 1733 gene locus_tag LOCUS_21080 gene guaD 2185 1733 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245084.1 protein_id gnl|my_center|LOCUS_21080 2450 2902 gene locus_tag LOCUS_21090 2450 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2991 3551 gene locus_tag LOCUS_21100 2991 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 4008 6863 gene locus_tag LOCUS_21110 gene polA 4008 6863 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_21110 7011 7178 gene locus_tag LOCUS_21120 7011 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 7108 7365 gene locus_tag LOCUS_21130 7108 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence120 546 1562 gene locus_tag LOCUS_21140 546 1562 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140012.1 protein_id gnl|my_center|LOCUS_21140 1584 2045 gene locus_tag LOCUS_21150 1584 2045 CDS product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057304.1 protein_id gnl|my_center|LOCUS_21150 2142 2233 gene locus_tag LOCUS_t00290 2142 2233 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2496 2654 gene locus_tag LOCUS_21160 2496 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 3553 2699 gene locus_tag LOCUS_21170 3553 2699 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921634.1 protein_id gnl|my_center|LOCUS_21170 3672 4109 gene locus_tag LOCUS_21180 3672 4109 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152611757.1 protein_id gnl|my_center|LOCUS_21180 4255 5175 gene locus_tag LOCUS_21190 4255 5175 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038034.1 protein_id gnl|my_center|LOCUS_21190 <7317 5313 gene locus_tag LOCUS_21200 <7317 5313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958091.1:UvrD-helicase domain-containing protein >Feature sequence121 2192 543 gene locus_tag LOCUS_21210 2192 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 2444 3256 gene locus_tag LOCUS_21220 2444 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 3414 4301 gene locus_tag LOCUS_21230 3414 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 4334 5383 gene locus_tag LOCUS_21240 4334 5383 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009348805.1 protein_id gnl|my_center|LOCUS_21240 5502 5771 gene locus_tag LOCUS_21250 5502 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 <7029 5796 gene locus_tag LOCUS_21260 <7029 5796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113875.1:MBL fold metallo-hydrolase >Feature sequence122 1483 2268 gene locus_tag LOCUS_21270 1483 2268 CDS product DUF6502 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966857.1 protein_id gnl|my_center|LOCUS_21270 2284 3684 gene locus_tag LOCUS_21280 2284 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 4756 3785 gene locus_tag LOCUS_21290 gene speB 4756 3785 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525503.1 protein_id gnl|my_center|LOCUS_21290 4950 5450 gene locus_tag LOCUS_21300 4950 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 <6742 5537 gene locus_tag LOCUS_21310 <6742 5537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004204967.1:alanine--tRNA ligase >Feature sequence123 1849 668 gene locus_tag LOCUS_21320 1849 668 CDS product malate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329404.1 protein_id gnl|my_center|LOCUS_21320 2904 1957 gene locus_tag LOCUS_21330 2904 1957 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163160.1 protein_id gnl|my_center|LOCUS_21330 5961 3271 gene locus_tag LOCUS_21340 5961 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 <6734 6004 gene locus_tag LOCUS_21350 <6734 6004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940539.1:ADP-ribosylglycohydrolase family protein >Feature sequence124 291 109 gene locus_tag LOCUS_21360 291 109 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196455.1 protein_id gnl|my_center|LOCUS_21360 1174 332 gene locus_tag LOCUS_21370 1174 332 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195818.1 protein_id gnl|my_center|LOCUS_21370 1975 1217 gene locus_tag LOCUS_21380 1975 1217 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195817.1 protein_id gnl|my_center|LOCUS_21380 2676 2023 gene locus_tag LOCUS_21390 gene rsmG 2676 2023 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377883.1 protein_id gnl|my_center|LOCUS_21390 4571 2673 gene locus_tag LOCUS_21400 gene mnmG 4571 2673 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818282.1 protein_id gnl|my_center|LOCUS_21400 <6653 4753 gene locus_tag LOCUS_21410 <6653 4753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941340.1:DUF748 domain-containing protein >Feature sequence125 307 1206 gene locus_tag LOCUS_21420 307 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 1470 2825 gene locus_tag LOCUS_21430 1470 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 2908 4332 gene locus_tag LOCUS_21440 2908 4332 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_21440 5094 4393 gene locus_tag LOCUS_21450 5094 4393 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113559.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence126 1112 270 gene locus_tag LOCUS_21460 gene pstC 1112 270 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073954.1 protein_id gnl|my_center|LOCUS_21460 1944 1102 gene locus_tag LOCUS_21470 1944 1102 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754393.1 protein_id gnl|my_center|LOCUS_21470 2949 2002 gene locus_tag LOCUS_21480 2949 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 3997 2951 gene locus_tag LOCUS_21490 3997 2951 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 protein_id gnl|my_center|LOCUS_21490 4734 4045 gene locus_tag LOCUS_21500 4734 4045 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_21500 5437 4727 gene locus_tag LOCUS_21510 5437 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence127 859 44 gene locus_tag LOCUS_21520 859 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 1661 3529 gene locus_tag LOCUS_21530 1661 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 3549 4238 gene locus_tag LOCUS_21540 3549 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 4864 6399 gene locus_tag LOCUS_21550 4864 6399 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence128 92 1444 gene locus_tag LOCUS_21560 gene gcvPA 92 1444 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945877.1 protein_id gnl|my_center|LOCUS_21560 1480 1977 gene locus_tag LOCUS_21570 gene tpx 1480 1977 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704596.1 protein_id gnl|my_center|LOCUS_21570 1999 3450 gene locus_tag LOCUS_21580 gene gcvPB 1999 3450 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945875.1 protein_id gnl|my_center|LOCUS_21580 3490 4425 gene locus_tag LOCUS_21590 3490 4425 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_21590 5004 6038 gene locus_tag LOCUS_21600 5004 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 6456 6070 gene locus_tag LOCUS_21610 6456 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence129 <1 508 gene locus_tag LOCUS_21620 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192666.1:dCTP deaminase 877 2052 gene locus_tag LOCUS_21630 877 2052 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545474.1 protein_id gnl|my_center|LOCUS_21630 2535 2161 gene locus_tag LOCUS_21640 2535 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 3461 2667 gene locus_tag LOCUS_21650 3461 2667 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_21650 3637 5097 gene locus_tag LOCUS_21660 3637 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 6443 5160 gene locus_tag LOCUS_21670 6443 5160 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814738.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence130 2 2767 gene locus_tag LOCUS_21680 2 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2982 4520 gene locus_tag LOCUS_21690 2982 4520 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 protein_id gnl|my_center|LOCUS_21690 4565 5167 gene locus_tag LOCUS_21700 4565 5167 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626398.1 protein_id gnl|my_center|LOCUS_21700 5821 5180 gene locus_tag LOCUS_21710 gene pyrE 5821 5180 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence131 511 203 gene locus_tag LOCUS_21720 gene cutA 511 203 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868105.1 protein_id gnl|my_center|LOCUS_21720 649 1584 gene locus_tag LOCUS_21730 649 1584 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945412.1 protein_id gnl|my_center|LOCUS_21730 5805 1669 gene locus_tag LOCUS_21740 5805 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence132 1024 2412 gene locus_tag LOCUS_21750 gene pcnB 1024 2412 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039149.1 protein_id gnl|my_center|LOCUS_21750 2421 2915 gene locus_tag LOCUS_21760 gene folK 2421 2915 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221222.1 protein_id gnl|my_center|LOCUS_21760 2917 3708 gene locus_tag LOCUS_21770 gene panB 2917 3708 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_21770 3724 4554 gene locus_tag LOCUS_21780 gene panC 3724 4554 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192993.1 protein_id gnl|my_center|LOCUS_21780 4624 6003 gene locus_tag LOCUS_21790 gene dnaA 4624 6003 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769932.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence133 <1 584 gene locus_tag LOCUS_21800 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015366112.1:Y-family DNA polymerase 699 1787 gene locus_tag LOCUS_21810 699 1787 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967012.1 protein_id gnl|my_center|LOCUS_21810 2547 3962 gene locus_tag LOCUS_21820 2547 3962 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521883.1 protein_id gnl|my_center|LOCUS_21820 4124 4609 gene locus_tag LOCUS_21830 4124 4609 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_21830 5125 4667 gene locus_tag LOCUS_21840 5125 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 5370 5873 gene locus_tag LOCUS_21850 5370 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence134 1247 1798 gene locus_tag LOCUS_21860 1247 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 1788 2978 gene locus_tag LOCUS_21870 1788 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 3484 3113 gene locus_tag LOCUS_21880 3484 3113 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635769.1 protein_id gnl|my_center|LOCUS_21880 4120 3578 gene locus_tag LOCUS_21890 gene bcp 4120 3578 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_21890 5367 4126 gene locus_tag LOCUS_21900 5367 4126 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943373.1 protein_id gnl|my_center|LOCUS_21900 5398 5473 gene locus_tag LOCUS_t00300 5398 5473 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence135 <1 1094 gene locus_tag LOCUS_21910 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003403032.1:3-dehydroquinate synthase 1087 2208 gene locus_tag LOCUS_21920 1087 2208 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521919.1 protein_id gnl|my_center|LOCUS_21920 2310 3464 gene locus_tag LOCUS_21930 gene hemE 2310 3464 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222724.1 protein_id gnl|my_center|LOCUS_21930 3492 4187 gene locus_tag LOCUS_21940 3492 4187 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_21940 4162 5436 gene locus_tag LOCUS_21950 4162 5436 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808475.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence136 1788 127 gene locus_tag LOCUS_21960 1788 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 2164 2301 gene locus_tag LOCUS_21970 2164 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 2826 2674 gene locus_tag LOCUS_21980 2826 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 2818 3576 gene locus_tag LOCUS_21990 2818 3576 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403682.1 protein_id gnl|my_center|LOCUS_21990 4534 3647 gene locus_tag LOCUS_22000 4534 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 <5619 5068 gene locus_tag LOCUS_22010 <5619 5068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009873398.1:thioredoxin family protein >Feature sequence137 1034 453 gene locus_tag LOCUS_22020 1034 453 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977659.1 protein_id gnl|my_center|LOCUS_22020 1405 1665 gene locus_tag LOCUS_22030 1405 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 2544 1750 gene locus_tag LOCUS_22040 2544 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 3447 3680 gene locus_tag LOCUS_22050 3447 3680 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_22050 3681 4067 gene locus_tag LOCUS_22060 3681 4067 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_22060 4666 4412 gene locus_tag LOCUS_22070 4666 4412 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971059.1 protein_id gnl|my_center|LOCUS_22070 4865 4644 gene locus_tag LOCUS_22080 4865 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence138 1211 123 gene locus_tag LOCUS_22090 gene apbC 1211 123 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_22090 1336 3450 gene locus_tag LOCUS_22100 gene metG 1336 3450 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203868.1 protein_id gnl|my_center|LOCUS_22100 3460 3843 gene locus_tag LOCUS_22110 3460 3843 CDS product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965849.1 protein_id gnl|my_center|LOCUS_22110 3840 4607 gene locus_tag LOCUS_22120 3840 4607 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811326.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence139 677 63 gene locus_tag LOCUS_22130 677 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 1558 731 gene locus_tag LOCUS_22140 1558 731 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_22140 2103 1651 gene locus_tag LOCUS_22150 gene ybeY 2103 1651 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093160.1 protein_id gnl|my_center|LOCUS_22150 3115 2117 gene locus_tag LOCUS_22160 3115 2117 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522785.1 protein_id gnl|my_center|LOCUS_22160 4471 3182 gene locus_tag LOCUS_22170 gene miaB 4471 3182 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927876.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence140 998 612 gene locus_tag LOCUS_22180 998 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 1887 991 gene locus_tag LOCUS_22190 1887 991 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205740.1 protein_id gnl|my_center|LOCUS_22190 3890 4096 gene locus_tag LOCUS_22200 3890 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 4749 5033 gene locus_tag LOCUS_22210 4749 5033 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140834.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence141 1249 170 gene locus_tag LOCUS_22220 1249 170 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112811.1 protein_id gnl|my_center|LOCUS_22220 1382 2743 gene locus_tag LOCUS_22230 1382 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 3493 2927 gene locus_tag LOCUS_22240 3493 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 4381 3803 gene locus_tag LOCUS_22250 4381 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250