>Feature sequence001 206 763 gene locus_tag LOCUS_00010 206 763 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_00010 771 1190 gene locus_tag LOCUS_00020 771 1190 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889423.1 protein_id gnl|my_center|LOCUS_00020 1423 1208 gene locus_tag LOCUS_00030 1423 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1311 1814 gene locus_tag LOCUS_00040 1311 1814 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879943.1 protein_id gnl|my_center|LOCUS_00040 2134 2706 gene locus_tag LOCUS_00050 2134 2706 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481612.1 protein_id gnl|my_center|LOCUS_00050 2717 4051 gene locus_tag LOCUS_00060 2717 4051 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_00060 4344 4183 gene locus_tag LOCUS_00070 4344 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 4331 6046 gene locus_tag LOCUS_00080 4331 6046 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941025.1 protein_id gnl|my_center|LOCUS_00080 6187 6840 gene locus_tag LOCUS_00090 gene ccmA 6187 6840 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705297.1 protein_id gnl|my_center|LOCUS_00090 6840 7508 gene locus_tag LOCUS_00100 gene ccmB 6840 7508 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_00100 7505 8236 gene locus_tag LOCUS_00110 gene ccmC 7505 8236 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_00110 8237 8428 gene locus_tag LOCUS_00120 8237 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 8425 8877 gene locus_tag LOCUS_00130 gene ccmE 8425 8877 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_00130 9003 10967 gene locus_tag LOCUS_00140 9003 10967 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_00140 10969 11490 gene locus_tag LOCUS_00150 10969 11490 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036835.1 protein_id gnl|my_center|LOCUS_00150 11487 11936 gene locus_tag LOCUS_00160 11487 11936 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946599.1 protein_id gnl|my_center|LOCUS_00160 11943 13226 gene locus_tag LOCUS_00170 gene ccmI 11943 13226 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063825.1 protein_id gnl|my_center|LOCUS_00170 13375 14310 gene locus_tag LOCUS_00180 13375 14310 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_00180 14352 14798 gene locus_tag LOCUS_00190 14352 14798 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194406.1 protein_id gnl|my_center|LOCUS_00190 14821 15636 gene locus_tag LOCUS_00200 14821 15636 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 protein_id gnl|my_center|LOCUS_00200 15733 15566 gene locus_tag LOCUS_00210 15733 15566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00210 16425 15778 gene locus_tag LOCUS_00220 16425 15778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00220 15808 15836 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17315 16422 gene locus_tag LOCUS_00230 17315 16422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 19587 17338 gene locus_tag LOCUS_00240 gene dsbD 19587 17338 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064751.1 protein_id gnl|my_center|LOCUS_00240 19961 19599 gene locus_tag LOCUS_00250 19961 19599 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_00250 20003 20362 gene locus_tag LOCUS_00260 20003 20362 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124704474.1 protein_id gnl|my_center|LOCUS_00260 20447 21484 gene locus_tag LOCUS_00270 gene purM 20447 21484 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 protein_id gnl|my_center|LOCUS_00270 21678 22325 gene locus_tag LOCUS_00280 gene purN 21678 22325 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064038.1 protein_id gnl|my_center|LOCUS_00280 22332 23369 gene locus_tag LOCUS_00290 22332 23369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00290 24518 23370 gene locus_tag LOCUS_00300 24518 23370 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809527.1 protein_id gnl|my_center|LOCUS_00300 25027 24515 gene locus_tag LOCUS_00310 gene purE 25027 24515 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037636.1 protein_id gnl|my_center|LOCUS_00310 26518 25118 gene locus_tag LOCUS_00320 26518 25118 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522260.1 protein_id gnl|my_center|LOCUS_00320 26853 28250 gene locus_tag LOCUS_00330 gene hemN 26853 28250 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403512.1 protein_id gnl|my_center|LOCUS_00330 28820 28296 gene locus_tag LOCUS_00340 28820 28296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 29045 28833 gene locus_tag LOCUS_00350 29045 28833 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197553.1 protein_id gnl|my_center|LOCUS_00350 29958 29038 gene locus_tag LOCUS_00360 gene ilvE 29958 29038 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_00360 31510 30209 gene locus_tag LOCUS_00370 gene umuC 31510 30209 CDS product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705000.1 protein_id gnl|my_center|LOCUS_00370 32084 31521 gene locus_tag LOCUS_00380 gene umuD 32084 31521 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946663.1 protein_id gnl|my_center|LOCUS_00380 33245 32652 gene locus_tag LOCUS_00390 33245 32652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 35218 33242 gene locus_tag LOCUS_00400 35218 33242 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895647.1 protein_id gnl|my_center|LOCUS_00400 36301 35222 gene locus_tag LOCUS_00410 36301 35222 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103696.1 protein_id gnl|my_center|LOCUS_00410 37185 36298 gene locus_tag LOCUS_00420 37185 36298 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921254.1 protein_id gnl|my_center|LOCUS_00420 38125 37178 gene locus_tag LOCUS_00430 38125 37178 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946515.1 protein_id gnl|my_center|LOCUS_00430 42678 39304 gene locus_tag LOCUS_00440 42678 39304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 42613 42804 gene locus_tag LOCUS_00450 42613 42804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 44178 42799 gene locus_tag LOCUS_00460 44178 42799 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387739.1 protein_id gnl|my_center|LOCUS_00460 44986 44168 gene locus_tag LOCUS_00470 44986 44168 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186421.1 protein_id gnl|my_center|LOCUS_00470 45531 44986 gene locus_tag LOCUS_00480 gene rfbC 45531 44986 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771397.1 protein_id gnl|my_center|LOCUS_00480 46412 45531 gene locus_tag LOCUS_00490 gene rfbA 46412 45531 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_00490 47479 46409 gene locus_tag LOCUS_00500 gene rfbB 47479 46409 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_00500 48328 47900 gene locus_tag LOCUS_00510 48328 47900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 48615 48325 gene locus_tag LOCUS_00520 48615 48325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 50930 48627 gene locus_tag LOCUS_00530 50930 48627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 51343 50927 gene locus_tag LOCUS_00540 51343 50927 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039680.1 protein_id gnl|my_center|LOCUS_00540 51882 51340 gene locus_tag LOCUS_00550 51882 51340 CDS product DUF1833 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039679.1 protein_id gnl|my_center|LOCUS_00550 53542 51896 gene locus_tag LOCUS_00560 53542 51896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 55258 53582 gene locus_tag LOCUS_00570 55258 53582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 55893 55255 gene locus_tag LOCUS_00580 55893 55255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 56417 55938 gene locus_tag LOCUS_00590 56417 55938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 59055 56428 gene locus_tag LOCUS_00600 59055 56428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 59307 59092 gene locus_tag LOCUS_00610 59307 59092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 59741 59391 gene locus_tag LOCUS_00620 59741 59391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 60700 59762 gene locus_tag LOCUS_00630 60700 59762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 61157 60726 gene locus_tag LOCUS_00640 61157 60726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 61816 61154 gene locus_tag LOCUS_00650 61816 61154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 62121 61813 gene locus_tag LOCUS_00660 62121 61813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 63139 62126 gene locus_tag LOCUS_00670 63139 62126 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339609.1 protein_id gnl|my_center|LOCUS_00670 63603 63226 gene locus_tag LOCUS_00680 63603 63226 CDS product head decoration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339610.1 protein_id gnl|my_center|LOCUS_00680 64869 63631 gene locus_tag LOCUS_00690 64869 63631 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253887.1 protein_id gnl|my_center|LOCUS_00690 66407 64866 gene locus_tag LOCUS_00700 66407 64866 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339612.1 protein_id gnl|my_center|LOCUS_00700 66613 66407 gene locus_tag LOCUS_00710 66613 66407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 68616 66628 gene locus_tag LOCUS_00720 68616 66628 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 protein_id gnl|my_center|LOCUS_00720 69197 68616 gene locus_tag LOCUS_00730 69197 68616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 69354 69629 gene locus_tag LOCUS_00740 69354 69629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 69637 70203 gene locus_tag LOCUS_00750 69637 70203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 70200 70559 gene locus_tag LOCUS_00760 70200 70559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 70534 70893 gene locus_tag LOCUS_00770 70534 70893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 70998 71261 gene locus_tag LOCUS_00780 70998 71261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 71354 71728 gene locus_tag LOCUS_00790 71354 71728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 71940 71692 gene locus_tag LOCUS_00800 71940 71692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 73229 71937 gene locus_tag LOCUS_00810 73229 71937 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_00810 73671 73222 gene locus_tag LOCUS_00820 73671 73222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 75082 73658 gene locus_tag LOCUS_00830 75082 73658 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940138.1 protein_id gnl|my_center|LOCUS_00830 75905 75513 gene locus_tag LOCUS_00840 75905 75513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 76107 75898 gene locus_tag LOCUS_00850 76107 75898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 76582 76109 gene locus_tag LOCUS_00860 76582 76109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 78653 76725 gene locus_tag LOCUS_00870 78653 76725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 78744 79001 gene locus_tag LOCUS_00880 78744 79001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 79374 79030 gene locus_tag LOCUS_00890 79374 79030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 80153 79371 gene locus_tag LOCUS_00900 80153 79371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 80491 80153 gene locus_tag LOCUS_00910 80491 80153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 82278 80596 gene locus_tag LOCUS_00920 82278 80596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 82911 82291 gene locus_tag LOCUS_00930 82911 82291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 83729 82926 gene locus_tag LOCUS_00940 83729 82926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 84015 83731 gene locus_tag LOCUS_00950 84015 83731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 84503 84021 gene locus_tag LOCUS_00960 84503 84021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 84712 84500 gene locus_tag LOCUS_00970 84712 84500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 85385 84918 gene locus_tag LOCUS_00980 85385 84918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 86830 85382 gene locus_tag LOCUS_00990 86830 85382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 87291 86827 gene locus_tag LOCUS_01000 87291 86827 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_01000 88642 87686 gene locus_tag LOCUS_01010 88642 87686 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084482.1 protein_id gnl|my_center|LOCUS_01010 88965 88639 gene locus_tag LOCUS_01020 88965 88639 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035668232.1 protein_id gnl|my_center|LOCUS_01020 89233 90468 gene locus_tag LOCUS_01030 89233 90468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 90461 91435 gene locus_tag LOCUS_01040 90461 91435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 91492 91716 gene locus_tag LOCUS_01050 91492 91716 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 protein_id gnl|my_center|LOCUS_01050 92098 92023 gene locus_tag LOCUS_t00010 92098 92023 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 92312 92698 gene locus_tag LOCUS_01060 92312 92698 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_01060 92695 93570 gene locus_tag LOCUS_01070 92695 93570 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_01070 93687 93896 gene locus_tag LOCUS_01080 gene rpmE 93687 93896 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768737.1 protein_id gnl|my_center|LOCUS_01080 93961 95523 gene locus_tag LOCUS_01090 93961 95523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 95510 96121 gene locus_tag LOCUS_01100 gene mobA 95510 96121 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099388.1 protein_id gnl|my_center|LOCUS_01100 96135 96353 gene locus_tag LOCUS_01110 gene yidD 96135 96353 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816027.1 protein_id gnl|my_center|LOCUS_01110 96427 97554 gene locus_tag LOCUS_01120 96427 97554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 97574 98113 gene locus_tag LOCUS_01130 gene hslV 97574 98113 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203414.1 protein_id gnl|my_center|LOCUS_01130 98633 98103 gene locus_tag LOCUS_01140 98633 98103 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_01140 99859 98630 gene locus_tag LOCUS_01150 99859 98630 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_01150 100126 102420 gene locus_tag LOCUS_01160 100126 102420 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925780.1 protein_id gnl|my_center|LOCUS_01160 102457 102894 gene locus_tag LOCUS_01170 102457 102894 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222219.1 protein_id gnl|my_center|LOCUS_01170 103682 102981 gene locus_tag LOCUS_01180 gene phoU 103682 102981 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813242.1 protein_id gnl|my_center|LOCUS_01180 104190 103750 gene locus_tag LOCUS_01190 104190 103750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 105116 104175 gene locus_tag LOCUS_01200 105116 104175 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064924.1 protein_id gnl|my_center|LOCUS_01200 106162 105113 gene locus_tag LOCUS_01210 106162 105113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 106573 106334 gene locus_tag LOCUS_01220 106573 106334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 106803 107492 gene locus_tag LOCUS_01230 106803 107492 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073341.1 protein_id gnl|my_center|LOCUS_01230 107544 107882 gene locus_tag LOCUS_01240 107544 107882 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_01240 107895 109382 gene locus_tag LOCUS_01250 107895 109382 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330072.1 protein_id gnl|my_center|LOCUS_01250 109533 110234 gene locus_tag LOCUS_01260 gene phoB 109533 110234 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_01260 110268 111605 gene locus_tag LOCUS_01270 gene phoR 110268 111605 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929655.1 protein_id gnl|my_center|LOCUS_01270 111984 111550 gene locus_tag LOCUS_01280 111984 111550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 115814 111981 gene locus_tag LOCUS_01290 115814 111981 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189879.1 protein_id gnl|my_center|LOCUS_01290 115975 116376 gene locus_tag LOCUS_01300 115975 116376 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198014.1 protein_id gnl|my_center|LOCUS_01300 116369 116608 gene locus_tag LOCUS_01310 116369 116608 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_01310 116605 118329 gene locus_tag LOCUS_01320 gene ptsP 116605 118329 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_01320 118436 119701 gene locus_tag LOCUS_01330 118436 119701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01330 121455 119752 gene locus_tag LOCUS_01340 gene hsbR 121455 119752 CDS product two-component system response regulator HsbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_01340 121769 121461 gene locus_tag LOCUS_01350 121769 121461 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616835.1 protein_id gnl|my_center|LOCUS_01350 123101 122052 gene locus_tag LOCUS_01360 123101 122052 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198645.1 protein_id gnl|my_center|LOCUS_01360 123747 123133 gene locus_tag LOCUS_01370 gene cheD 123747 123133 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_01370 124586 123744 gene locus_tag LOCUS_01380 124586 123744 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832274.1 protein_id gnl|my_center|LOCUS_01380 >Feature sequence002 <1 644 gene locus_tag LOCUS_01390 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000796079.1:BclA-related collagen-like exosporium protein 901 1620 gene locus_tag LOCUS_01400 901 1620 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072507.1 protein_id gnl|my_center|LOCUS_01400 1730 2896 gene locus_tag LOCUS_01410 1730 2896 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926799.1 protein_id gnl|my_center|LOCUS_01410 2942 3994 gene locus_tag LOCUS_01420 2942 3994 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 protein_id gnl|my_center|LOCUS_01420 4148 4462 gene locus_tag LOCUS_01430 4148 4462 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533578.1 protein_id gnl|my_center|LOCUS_01430 4507 4863 gene locus_tag LOCUS_01440 4507 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 4860 5135 gene locus_tag LOCUS_01450 4860 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 5299 5934 gene locus_tag LOCUS_01460 5299 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 7462 6005 gene locus_tag LOCUS_01470 7462 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 7725 7874 gene locus_tag LOCUS_01480 7725 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 7871 8731 gene locus_tag LOCUS_01490 7871 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 9825 9187 gene locus_tag LOCUS_01500 9825 9187 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199909.1 protein_id gnl|my_center|LOCUS_01500 10370 10738 gene locus_tag LOCUS_01510 10370 10738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 11477 11061 gene locus_tag LOCUS_01520 11477 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 12044 20560 gene locus_tag LOCUS_01530 12044 20560 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994041.1 protein_id gnl|my_center|LOCUS_01530 20824 21747 gene locus_tag LOCUS_01540 20824 21747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 21902 22657 gene locus_tag LOCUS_01550 21902 22657 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_01550 22899 23975 gene locus_tag LOCUS_01560 22899 23975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 24335 24553 gene locus_tag LOCUS_01570 24335 24553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 25219 24602 gene locus_tag LOCUS_01580 25219 24602 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095352.1 protein_id gnl|my_center|LOCUS_01580 25489 26355 gene locus_tag LOCUS_01590 25489 26355 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390563.1 protein_id gnl|my_center|LOCUS_01590 26564 26767 gene locus_tag LOCUS_01600 26564 26767 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187926.1 protein_id gnl|my_center|LOCUS_01600 26912 27280 gene locus_tag LOCUS_01610 26912 27280 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_01610 27693 29558 gene locus_tag LOCUS_01620 27693 29558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 29602 29811 gene locus_tag LOCUS_01630 29602 29811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 31223 29826 gene locus_tag LOCUS_01640 gene fumC 31223 29826 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705251.1 protein_id gnl|my_center|LOCUS_01640 33585 31390 gene locus_tag LOCUS_01650 gene katG 33585 31390 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_01650 34540 33764 gene locus_tag LOCUS_01660 34540 33764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 35016 34735 gene locus_tag LOCUS_01670 35016 34735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 37291 35321 gene locus_tag LOCUS_01680 37291 35321 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268217.1 protein_id gnl|my_center|LOCUS_01680 38090 37302 gene locus_tag LOCUS_01690 38090 37302 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_01690 38139 38876 gene locus_tag LOCUS_01700 38139 38876 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193115.1 protein_id gnl|my_center|LOCUS_01700 38934 39683 gene locus_tag LOCUS_01710 gene cysE 38934 39683 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771032.1 protein_id gnl|my_center|LOCUS_01710 39766 40254 gene locus_tag LOCUS_01720 gene iscR 39766 40254 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_01720 40254 41477 gene locus_tag LOCUS_01730 40254 41477 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524724.1 protein_id gnl|my_center|LOCUS_01730 41597 42028 gene locus_tag LOCUS_01740 gene iscU 41597 42028 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812460.1 protein_id gnl|my_center|LOCUS_01740 42030 42428 gene locus_tag LOCUS_01750 gene iscA 42030 42428 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_01750 42502 43032 gene locus_tag LOCUS_01760 gene hscB 42502 43032 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 protein_id gnl|my_center|LOCUS_01760 43123 44982 gene locus_tag LOCUS_01770 gene hscA 43123 44982 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193590.1 protein_id gnl|my_center|LOCUS_01770 44984 45775 gene locus_tag LOCUS_01780 44984 45775 CDS product DUF3050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219159941.1 protein_id gnl|my_center|LOCUS_01780 45763 46101 gene locus_tag LOCUS_01790 gene fdx 45763 46101 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193872.1 protein_id gnl|my_center|LOCUS_01790 46209 46403 gene locus_tag LOCUS_01800 gene iscX 46209 46403 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092814.1 protein_id gnl|my_center|LOCUS_01800 46400 46948 gene locus_tag LOCUS_01810 46400 46948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 47069 47446 gene locus_tag LOCUS_01820 47069 47446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 47453 48181 gene locus_tag LOCUS_01830 47453 48181 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083847.1 protein_id gnl|my_center|LOCUS_01830 48625 48263 gene locus_tag LOCUS_01840 48625 48263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 49886 48780 gene locus_tag LOCUS_01850 49886 48780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 50909 50058 gene locus_tag LOCUS_01860 50909 50058 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 protein_id gnl|my_center|LOCUS_01860 51458 51009 gene locus_tag LOCUS_01870 51458 51009 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 protein_id gnl|my_center|LOCUS_01870 51638 52243 gene locus_tag LOCUS_01880 51638 52243 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 protein_id gnl|my_center|LOCUS_01880 52263 52967 gene locus_tag LOCUS_01890 52263 52967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 54531 53011 gene locus_tag LOCUS_01900 54531 53011 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036607.1 protein_id gnl|my_center|LOCUS_01900 54798 55895 gene locus_tag LOCUS_01910 54798 55895 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731186.1 protein_id gnl|my_center|LOCUS_01910 56086 57516 gene locus_tag LOCUS_01920 56086 57516 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_01920 57577 58533 gene locus_tag LOCUS_01930 57577 58533 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388955.1 protein_id gnl|my_center|LOCUS_01930 58663 59730 gene locus_tag LOCUS_01940 58663 59730 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388956.1 protein_id gnl|my_center|LOCUS_01940 59791 60783 gene locus_tag LOCUS_01950 59791 60783 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041092.1 protein_id gnl|my_center|LOCUS_01950 61253 60798 gene locus_tag LOCUS_01960 61253 60798 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082024.1 protein_id gnl|my_center|LOCUS_01960 61421 63529 gene locus_tag LOCUS_01970 gene pbpC 61421 63529 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002102274.1 protein_id gnl|my_center|LOCUS_01970 63663 64247 gene locus_tag LOCUS_01980 gene sodB 63663 64247 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185841.1 protein_id gnl|my_center|LOCUS_01980 64434 64799 gene locus_tag LOCUS_01990 64434 64799 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895407.1 protein_id gnl|my_center|LOCUS_01990 65149 64862 gene locus_tag LOCUS_02000 65149 64862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 65585 65217 gene locus_tag LOCUS_02010 65585 65217 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_02010 65712 71309 gene locus_tag LOCUS_02020 65712 71309 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206210853.1 protein_id gnl|my_center|LOCUS_02020 71706 71512 gene locus_tag LOCUS_02030 71706 71512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 73254 72361 gene locus_tag LOCUS_02040 gene rlmJ 73254 72361 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538077.1 protein_id gnl|my_center|LOCUS_02040 74271 73321 gene locus_tag LOCUS_02050 gene miaA 74271 73321 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065014.1 protein_id gnl|my_center|LOCUS_02050 74990 74406 gene locus_tag LOCUS_02060 74990 74406 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_02060 75500 75285 gene locus_tag LOCUS_02070 75500 75285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 75742 75497 gene locus_tag LOCUS_02080 75742 75497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 76236 77339 gene locus_tag LOCUS_02090 76236 77339 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073642.1 protein_id gnl|my_center|LOCUS_02090 77457 77663 gene locus_tag LOCUS_02100 77457 77663 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171671.1 protein_id gnl|my_center|LOCUS_02100 77653 77928 gene locus_tag LOCUS_02110 77653 77928 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_02110 78030 78203 gene locus_tag LOCUS_02120 78030 78203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 78907 78515 gene locus_tag LOCUS_02130 78907 78515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 79262 79423 gene locus_tag LOCUS_02140 79262 79423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 79573 79704 gene locus_tag LOCUS_02150 79573 79704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 80243 79932 gene locus_tag LOCUS_02160 80243 79932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02160 80242 80820 gene locus_tag LOCUS_02170 80242 80820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 80267 80296 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 81009 81443 gene locus_tag LOCUS_02180 81009 81443 CDS product type II toxin-antitoxin system antitoxin Xre inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169556.1 protein_id gnl|my_center|LOCUS_02180 81443 81904 gene locus_tag LOCUS_02190 81443 81904 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402968.1 protein_id gnl|my_center|LOCUS_02190 82000 82311 gene locus_tag LOCUS_02200 82000 82311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 82386 82628 gene locus_tag LOCUS_02210 gene mazE 82386 82628 CDS product type II toxin-antitoxin system antitoxin MazE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581940.1 protein_id gnl|my_center|LOCUS_02210 82628 82966 gene locus_tag LOCUS_02220 gene mazF 82628 82966 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254750.1 protein_id gnl|my_center|LOCUS_02220 83328 83582 gene locus_tag LOCUS_02230 83328 83582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 83593 83859 gene locus_tag LOCUS_02240 83593 83859 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532247.1 protein_id gnl|my_center|LOCUS_02240 83859 84134 gene locus_tag LOCUS_02250 83859 84134 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421262.1 protein_id gnl|my_center|LOCUS_02250 84474 84181 gene locus_tag LOCUS_02260 84474 84181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 85383 84847 gene locus_tag LOCUS_02270 85383 84847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_02270 85661 85380 gene locus_tag LOCUS_02280 85661 85380 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693744.1 protein_id gnl|my_center|LOCUS_02280 86693 85788 gene locus_tag LOCUS_02290 gene ftsX 86693 85788 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084508.1 protein_id gnl|my_center|LOCUS_02290 87549 86896 gene locus_tag LOCUS_02300 gene ftsE 87549 86896 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 protein_id gnl|my_center|LOCUS_02300 88556 87546 gene locus_tag LOCUS_02310 88556 87546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 88603 90006 gene locus_tag LOCUS_02320 88603 90006 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_02320 90140 91462 gene locus_tag LOCUS_02330 90140 91462 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 protein_id gnl|my_center|LOCUS_02330 91443 91988 gene locus_tag LOCUS_02340 gene rsmD 91443 91988 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195251.1 protein_id gnl|my_center|LOCUS_02340 91985 92473 gene locus_tag LOCUS_02350 gene coaD 91985 92473 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808574.1 protein_id gnl|my_center|LOCUS_02350 92489 92740 gene locus_tag LOCUS_02360 92489 92740 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_02360 94769 92808 gene locus_tag LOCUS_02370 94769 92808 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_02370 95675 94860 gene locus_tag LOCUS_02380 gene mutM 95675 94860 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372546.1 protein_id gnl|my_center|LOCUS_02380 95837 97525 gene locus_tag LOCUS_02390 95837 97525 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_02390 97525 98115 gene locus_tag LOCUS_02400 gene lolB 97525 98115 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768866.1 protein_id gnl|my_center|LOCUS_02400 98112 98954 gene locus_tag LOCUS_02410 gene ispE 98112 98954 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195241.1 protein_id gnl|my_center|LOCUS_02410 99154 100086 gene locus_tag LOCUS_02420 99154 100086 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_02420 100151 100774 gene locus_tag LOCUS_02430 100151 100774 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808505.1 protein_id gnl|my_center|LOCUS_02430 100812 101426 gene locus_tag LOCUS_02440 gene pth 100812 101426 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185241.1 protein_id gnl|my_center|LOCUS_02440 101423 102514 gene locus_tag LOCUS_02450 gene ychF 101423 102514 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687306.1 protein_id gnl|my_center|LOCUS_02450 102625 102709 gene locus_tag LOCUS_t00020 102625 102709 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 102776 102849 gene locus_tag LOCUS_t00030 102776 102849 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence003 <1 1633 gene locus_tag LOCUS_02460 <1 1633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550744.1:ATP-binding cassette domain-containing protein 1300 1312 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1995 1729 gene locus_tag LOCUS_02470 1995 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 3049 2216 gene locus_tag LOCUS_02480 3049 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 3266 4927 gene locus_tag LOCUS_02490 gene ilvB 3266 4927 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272051.1 protein_id gnl|my_center|LOCUS_02490 4896 6668 gene locus_tag LOCUS_02500 4896 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 6665 7954 gene locus_tag LOCUS_02510 6665 7954 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_02510 9110 8196 gene locus_tag LOCUS_02520 9110 8196 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919349.1 protein_id gnl|my_center|LOCUS_02520 9283 9987 gene locus_tag LOCUS_02530 9283 9987 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919348.1 protein_id gnl|my_center|LOCUS_02530 10070 10696 gene locus_tag LOCUS_02540 gene ycaC 10070 10696 CDS product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165876.1 protein_id gnl|my_center|LOCUS_02540 10719 11330 gene locus_tag LOCUS_02550 10719 11330 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368006.1 protein_id gnl|my_center|LOCUS_02550 12389 11445 gene locus_tag LOCUS_02560 12389 11445 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_02560 14526 12532 gene locus_tag LOCUS_02570 gene aprA 14526 12532 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932546.1 protein_id gnl|my_center|LOCUS_02570 15018 14545 gene locus_tag LOCUS_02580 gene aprB 15018 14545 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932545.1 protein_id gnl|my_center|LOCUS_02580 16437 15220 gene locus_tag LOCUS_02590 gene sat 16437 15220 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_02590 16690 17400 gene locus_tag LOCUS_02600 16690 17400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091293.1 protein_id gnl|my_center|LOCUS_02600 17540 17992 gene locus_tag LOCUS_02610 gene sixA 17540 17992 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197673.1 protein_id gnl|my_center|LOCUS_02610 19232 18015 gene locus_tag LOCUS_02620 19232 18015 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_02620 21170 19281 gene locus_tag LOCUS_02630 21170 19281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 21972 21184 gene locus_tag LOCUS_02640 gene cheZ 21972 21184 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983609.1 protein_id gnl|my_center|LOCUS_02640 22402 22013 gene locus_tag LOCUS_02650 gene cheY 22402 22013 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811911.1 protein_id gnl|my_center|LOCUS_02650 23390 22452 gene locus_tag LOCUS_02660 23390 22452 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315817.1 protein_id gnl|my_center|LOCUS_02660 24348 23407 gene locus_tag LOCUS_02670 24348 23407 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168557.1 protein_id gnl|my_center|LOCUS_02670 24247 24477 gene locus_tag LOCUS_02680 24247 24477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 24489 25346 gene locus_tag LOCUS_02690 24489 25346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 25339 26688 gene locus_tag LOCUS_02700 gene fleR 25339 26688 CDS product sigma-54-dependent response regulator transcription factor FleR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082202.1 protein_id gnl|my_center|LOCUS_02700 26710 27018 gene locus_tag LOCUS_02710 gene fliE 26710 27018 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811835.1 protein_id gnl|my_center|LOCUS_02710 27036 27761 gene locus_tag LOCUS_02720 27036 27761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02720 27944 28705 gene locus_tag LOCUS_02730 27944 28705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02730 28702 29700 gene locus_tag LOCUS_02740 gene fliG 28702 29700 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 protein_id gnl|my_center|LOCUS_02740 29742 30410 gene locus_tag LOCUS_02750 gene fliH 29742 30410 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556525.1 protein_id gnl|my_center|LOCUS_02750 30398 31807 gene locus_tag LOCUS_02760 gene fliI 30398 31807 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197164.1 protein_id gnl|my_center|LOCUS_02760 31989 31861 gene locus_tag LOCUS_02770 31989 31861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 32535 32002 gene locus_tag LOCUS_02780 32535 32002 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072347.1 protein_id gnl|my_center|LOCUS_02780 33970 32549 gene locus_tag LOCUS_02790 gene ccoG 33970 32549 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040146.1 protein_id gnl|my_center|LOCUS_02790 35147 34164 gene locus_tag LOCUS_02800 35147 34164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 35322 35161 gene locus_tag LOCUS_02810 35322 35161 CDS product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351115.1 protein_id gnl|my_center|LOCUS_02810 35935 35324 gene locus_tag LOCUS_02820 gene ccoO 35935 35324 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212596.1 protein_id gnl|my_center|LOCUS_02820 37404 35953 gene locus_tag LOCUS_02830 gene ccoN 37404 35953 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063997.1 protein_id gnl|my_center|LOCUS_02830 37688 37491 gene locus_tag LOCUS_02840 gene ccoS 37688 37491 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766953.1 protein_id gnl|my_center|LOCUS_02840 40187 37752 gene locus_tag LOCUS_02850 40187 37752 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_02850 40996 40199 gene locus_tag LOCUS_02860 gene rsmA 40996 40199 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036027.1 protein_id gnl|my_center|LOCUS_02860 41997 40993 gene locus_tag LOCUS_02870 gene pdxA 41997 40993 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109023.1 protein_id gnl|my_center|LOCUS_02870 42724 42029 gene locus_tag LOCUS_02880 42724 42029 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095848.1 protein_id gnl|my_center|LOCUS_02880 42876 44105 gene locus_tag LOCUS_02890 42876 44105 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688344.1 protein_id gnl|my_center|LOCUS_02890 44181 44274 gene locus_tag LOCUS_t00040 44181 44274 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 44330 44406 gene locus_tag LOCUS_t00050 44330 44406 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 44458 45018 gene locus_tag LOCUS_02900 44458 45018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 45015 46223 gene locus_tag LOCUS_02910 45015 46223 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_02910 47225 46374 gene locus_tag LOCUS_02920 47225 46374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 49982 47292 gene locus_tag LOCUS_02930 gene glnE 49982 47292 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196324.1 protein_id gnl|my_center|LOCUS_02930 50074 52062 gene locus_tag LOCUS_02940 gene acs 50074 52062 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188376.1 protein_id gnl|my_center|LOCUS_02940 52300 52590 gene locus_tag LOCUS_02950 gene groES 52300 52590 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186661.1 protein_id gnl|my_center|LOCUS_02950 52747 54411 gene locus_tag LOCUS_02960 gene groL 52747 54411 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185913.1 protein_id gnl|my_center|LOCUS_02960 54570 56306 gene locus_tag LOCUS_02970 gene argS 54570 56306 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_02970 56328 56981 gene locus_tag LOCUS_02980 56328 56981 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818192.1 protein_id gnl|my_center|LOCUS_02980 56996 57631 gene locus_tag LOCUS_02990 56996 57631 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815939.1 protein_id gnl|my_center|LOCUS_02990 57637 57722 gene locus_tag LOCUS_t00060 57637 57722 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 58793 57774 gene locus_tag LOCUS_03000 58793 57774 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116248.1 protein_id gnl|my_center|LOCUS_03000 59064 59303 gene locus_tag LOCUS_03010 59064 59303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 59293 59580 gene locus_tag LOCUS_03020 59293 59580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 59577 59840 gene locus_tag LOCUS_03030 59577 59840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 59844 59981 gene locus_tag LOCUS_03040 59844 59981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 60054 60377 gene locus_tag LOCUS_03050 60054 60377 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 protein_id gnl|my_center|LOCUS_03050 60434 61276 gene locus_tag LOCUS_03060 60434 61276 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302976.1 protein_id gnl|my_center|LOCUS_03060 63126 61981 gene locus_tag LOCUS_03070 63126 61981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 63416 63222 gene locus_tag LOCUS_03080 63416 63222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 63508 64494 gene locus_tag LOCUS_03090 63508 64494 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150678942.1 protein_id gnl|my_center|LOCUS_03090 64592 65002 gene locus_tag LOCUS_03100 64592 65002 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986456.1 protein_id gnl|my_center|LOCUS_03100 66637 65027 gene locus_tag LOCUS_03110 66637 65027 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088888.1 protein_id gnl|my_center|LOCUS_03110 68309 66864 gene locus_tag LOCUS_03120 gene nuoN 68309 66864 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_03120 69817 68327 gene locus_tag LOCUS_03130 69817 68327 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_03130 71946 69943 gene locus_tag LOCUS_03140 gene nuoL 71946 69943 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185765.1 protein_id gnl|my_center|LOCUS_03140 72256 71951 gene locus_tag LOCUS_03150 gene nuoK 72256 71951 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_03150 72873 72253 gene locus_tag LOCUS_03160 72873 72253 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689941.1 protein_id gnl|my_center|LOCUS_03160 73099 72887 gene locus_tag LOCUS_03170 73099 72887 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_03170 73297 73103 gene locus_tag LOCUS_03180 73297 73103 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_03180 73743 73300 gene locus_tag LOCUS_03190 gene nuoI 73743 73300 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186558.1 protein_id gnl|my_center|LOCUS_03190 74904 73876 gene locus_tag LOCUS_03200 gene nuoH 74904 73876 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948471.1 protein_id gnl|my_center|LOCUS_03200 <75675 74904 gene locus_tag LOCUS_03210 <75675 74904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004543813.1:NADH-quinone oxidoreductase subunit NuoG >Feature sequence004 2 544 gene locus_tag LOCUS_03220 2 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 618 1988 gene locus_tag LOCUS_03230 618 1988 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814738.1 protein_id gnl|my_center|LOCUS_03230 3926 2022 gene locus_tag LOCUS_03240 3926 2022 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_03240 5272 3923 gene locus_tag LOCUS_03250 5272 3923 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926305.1 protein_id gnl|my_center|LOCUS_03250 6246 5269 gene locus_tag LOCUS_03260 6246 5269 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946695.1 protein_id gnl|my_center|LOCUS_03260 8464 6239 gene locus_tag LOCUS_03270 8464 6239 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_03270 8785 8504 gene locus_tag LOCUS_03280 8785 8504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 9087 8782 gene locus_tag LOCUS_03290 9087 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 10404 9112 gene locus_tag LOCUS_03300 10404 9112 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_03300 11601 10453 gene locus_tag LOCUS_03310 11601 10453 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192327.1 protein_id gnl|my_center|LOCUS_03310 11792 11598 gene locus_tag LOCUS_03320 11792 11598 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_03320 12671 11802 gene locus_tag LOCUS_03330 gene hflC 12671 11802 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810713.1 protein_id gnl|my_center|LOCUS_03330 13981 12668 gene locus_tag LOCUS_03340 gene hflK 13981 12668 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930788.1 protein_id gnl|my_center|LOCUS_03340 15212 13968 gene locus_tag LOCUS_03350 gene hflX 15212 13968 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191816.1 protein_id gnl|my_center|LOCUS_03350 15470 15234 gene locus_tag LOCUS_03360 gene hfq 15470 15234 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192796.1 protein_id gnl|my_center|LOCUS_03360 17407 15548 gene locus_tag LOCUS_03370 17407 15548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 18637 17471 gene locus_tag LOCUS_03380 18637 17471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 19144 18680 gene locus_tag LOCUS_03390 19144 18680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 20598 19141 gene locus_tag LOCUS_03400 20598 19141 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_03400 21657 20713 gene locus_tag LOCUS_03410 21657 20713 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_03410 22130 21654 gene locus_tag LOCUS_03420 22130 21654 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_03420 24169 22127 gene locus_tag LOCUS_03430 gene hdrA 24169 22127 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_03430 25138 24173 gene locus_tag LOCUS_03440 25138 24173 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_03440 25749 25135 gene locus_tag LOCUS_03450 25749 25135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 26951 25920 gene locus_tag LOCUS_03460 26951 25920 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391425.1 protein_id gnl|my_center|LOCUS_03460 28218 27073 gene locus_tag LOCUS_03470 28218 27073 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391423.1 protein_id gnl|my_center|LOCUS_03470 29085 28366 gene locus_tag LOCUS_03480 29085 28366 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391424.1 protein_id gnl|my_center|LOCUS_03480 30202 29198 gene locus_tag LOCUS_03490 30202 29198 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391425.1 protein_id gnl|my_center|LOCUS_03490 31002 30328 gene locus_tag LOCUS_03500 31002 30328 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_03500 31053 31715 gene locus_tag LOCUS_03510 31053 31715 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186021.1 protein_id gnl|my_center|LOCUS_03510 33059 31893 gene locus_tag LOCUS_03520 33059 31893 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_03520 34408 33257 gene locus_tag LOCUS_03530 34408 33257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 34883 34473 gene locus_tag LOCUS_03540 34883 34473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 35393 35142 gene locus_tag LOCUS_03550 35393 35142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 37149 36187 gene locus_tag LOCUS_03560 37149 36187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 37208 38299 gene locus_tag LOCUS_03570 37208 38299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03570 38371 39987 gene locus_tag LOCUS_03580 38371 39987 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080109.1 protein_id gnl|my_center|LOCUS_03580 41560 40157 gene locus_tag LOCUS_03590 41560 40157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 42835 41783 gene locus_tag LOCUS_03600 42835 41783 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931304.1 protein_id gnl|my_center|LOCUS_03600 43422 45026 gene locus_tag LOCUS_03610 43422 45026 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198600.1 protein_id gnl|my_center|LOCUS_03610 45036 45374 gene locus_tag LOCUS_03620 45036 45374 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720289.1 protein_id gnl|my_center|LOCUS_03620 46154 45420 gene locus_tag LOCUS_03630 46154 45420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 47151 46273 gene locus_tag LOCUS_03640 47151 46273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 48743 47343 gene locus_tag LOCUS_03650 48743 47343 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_03650 49276 48740 gene locus_tag LOCUS_03660 49276 48740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 49701 49276 gene locus_tag LOCUS_03670 49701 49276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 49855 50772 gene locus_tag LOCUS_03680 49855 50772 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_03680 50844 51146 gene locus_tag LOCUS_03690 50844 51146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 51134 51487 gene locus_tag LOCUS_03700 51134 51487 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817423.1 protein_id gnl|my_center|LOCUS_03700 51870 51550 gene locus_tag LOCUS_03710 51870 51550 CDS product DUF2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198082.1 protein_id gnl|my_center|LOCUS_03710 52517 51870 gene locus_tag LOCUS_03720 gene coq7 52517 51870 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269103.1 protein_id gnl|my_center|LOCUS_03720 52977 52594 gene locus_tag LOCUS_03730 52977 52594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 53758 52958 gene locus_tag LOCUS_03740 53758 52958 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266523.1 protein_id gnl|my_center|LOCUS_03740 55612 53771 gene locus_tag LOCUS_03750 gene typA 55612 53771 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193111.1 protein_id gnl|my_center|LOCUS_03750 57026 55812 gene locus_tag LOCUS_03760 gene purT 57026 55812 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896675.1 protein_id gnl|my_center|LOCUS_03760 57167 58468 gene locus_tag LOCUS_03770 57167 58468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 60044 58881 gene locus_tag LOCUS_03780 60044 58881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 61310 60069 gene locus_tag LOCUS_03790 gene yedE 61310 60069 CDS product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858372.1 protein_id gnl|my_center|LOCUS_03790 61786 61397 gene locus_tag LOCUS_03800 61786 61397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 62447 61848 gene locus_tag LOCUS_03810 62447 61848 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_03810 64042 62444 gene locus_tag LOCUS_03820 64042 62444 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_03820 64554 64201 gene locus_tag LOCUS_03830 64554 64201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 64935 66854 gene locus_tag LOCUS_03840 64935 66854 CDS product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 protein_id gnl|my_center|LOCUS_03840 68345 66888 gene locus_tag LOCUS_03850 68345 66888 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_03850 71514 68347 gene locus_tag LOCUS_03860 71514 68347 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_03860 72633 71527 gene locus_tag LOCUS_03870 72633 71527 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_03870 74288 72918 gene locus_tag LOCUS_03880 74288 72918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 >Feature sequence005 3043 806 gene locus_tag LOCUS_03890 3043 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 4111 3113 gene locus_tag LOCUS_03900 gene mutY 4111 3113 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064920.1 protein_id gnl|my_center|LOCUS_03900 3477 3495 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4110 4625 gene locus_tag LOCUS_03910 4110 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 4640 5323 gene locus_tag LOCUS_03920 gene dsbA 4640 5323 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_03920 5394 6227 gene locus_tag LOCUS_03930 5394 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 6979 6242 gene locus_tag LOCUS_03940 6979 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 7121 8404 gene locus_tag LOCUS_03950 7121 8404 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931221.1 protein_id gnl|my_center|LOCUS_03950 9205 8456 gene locus_tag LOCUS_03960 gene zapD 9205 8456 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_03960 9927 9283 gene locus_tag LOCUS_03970 gene coaE 9927 9283 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194322.1 protein_id gnl|my_center|LOCUS_03970 10820 9927 gene locus_tag LOCUS_03980 10820 9927 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_03980 11826 10840 gene locus_tag LOCUS_03990 11826 10840 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707570.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03990 13815 12094 gene locus_tag LOCUS_04000 gene pilB 13815 12094 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_04000 14269 13958 gene locus_tag LOCUS_04010 14269 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 14504 14226 gene locus_tag LOCUS_04020 14504 14226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 15093 14575 gene locus_tag LOCUS_04030 15093 14575 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383720.1 protein_id gnl|my_center|LOCUS_04030 16064 15105 gene locus_tag LOCUS_04040 16064 15105 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706425.1 protein_id gnl|my_center|LOCUS_04040 17025 16147 gene locus_tag LOCUS_04050 gene htpX 17025 16147 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397849.1 protein_id gnl|my_center|LOCUS_04050 17140 18018 gene locus_tag LOCUS_04060 gene nhaR 17140 18018 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_04060 19345 18026 gene locus_tag LOCUS_04070 gene rlmD 19345 18026 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192701.1 protein_id gnl|my_center|LOCUS_04070 20121 19342 gene locus_tag LOCUS_04080 20121 19342 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191371.1 protein_id gnl|my_center|LOCUS_04080 20286 21773 gene locus_tag LOCUS_04090 20286 21773 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011342568.1 protein_id gnl|my_center|LOCUS_04090 21779 22366 gene locus_tag LOCUS_04100 21779 22366 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024666025.1 protein_id gnl|my_center|LOCUS_04100 22575 23993 gene locus_tag LOCUS_04110 22575 23993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 24837 24043 gene locus_tag LOCUS_04120 24837 24043 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_04120 25358 24945 gene locus_tag LOCUS_04130 25358 24945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 25488 26030 gene locus_tag LOCUS_04140 25488 26030 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225416.1 protein_id gnl|my_center|LOCUS_04140 26041 26430 gene locus_tag LOCUS_04150 26041 26430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 26454 27224 gene locus_tag LOCUS_04160 26454 27224 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191514.1 protein_id gnl|my_center|LOCUS_04160 27338 28444 gene locus_tag LOCUS_04170 27338 28444 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 protein_id gnl|my_center|LOCUS_04170 28529 29011 gene locus_tag LOCUS_04180 28529 29011 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522636.1 protein_id gnl|my_center|LOCUS_04180 28995 29894 gene locus_tag LOCUS_04190 gene xerD 28995 29894 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_04190 31314 29899 gene locus_tag LOCUS_04200 31314 29899 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387757.1 protein_id gnl|my_center|LOCUS_04200 33071 31374 gene locus_tag LOCUS_04210 33071 31374 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_04210 34035 33082 gene locus_tag LOCUS_04220 34035 33082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_04220 34744 34070 gene locus_tag LOCUS_04230 34744 34070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04230 35748 34819 gene locus_tag LOCUS_04240 35748 34819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 37271 35868 gene locus_tag LOCUS_04250 37271 35868 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 protein_id gnl|my_center|LOCUS_04250 37771 37313 gene locus_tag LOCUS_04260 37771 37313 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_04260 37968 37878 gene locus_tag LOCUS_t00070 37968 37878 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 38415 38122 gene locus_tag LOCUS_04270 38415 38122 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_04270 38860 38459 gene locus_tag LOCUS_04280 38860 38459 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023525.1 protein_id gnl|my_center|LOCUS_04280 40095 38893 gene locus_tag LOCUS_04290 40095 38893 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_04290 41149 40331 gene locus_tag LOCUS_04300 gene tatC 41149 40331 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 protein_id gnl|my_center|LOCUS_04300 41690 41160 gene locus_tag LOCUS_04310 gene tatB 41690 41160 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906112.1 protein_id gnl|my_center|LOCUS_04310 42022 41792 gene locus_tag LOCUS_04320 42022 41792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 42395 42060 gene locus_tag LOCUS_04330 42395 42060 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687490.1 protein_id gnl|my_center|LOCUS_04330 42744 42415 gene locus_tag LOCUS_04340 42744 42415 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815805.1 protein_id gnl|my_center|LOCUS_04340 43130 42741 gene locus_tag LOCUS_04350 gene hisI 43130 42741 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201279.1 protein_id gnl|my_center|LOCUS_04350 43911 43141 gene locus_tag LOCUS_04360 gene hisF 43911 43141 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_04360 44670 43924 gene locus_tag LOCUS_04370 gene hisA 44670 43924 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_04370 45321 44674 gene locus_tag LOCUS_04380 gene hisH 45321 44674 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815798.1 protein_id gnl|my_center|LOCUS_04380 45911 45321 gene locus_tag LOCUS_04390 gene hisB 45911 45321 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199911.1 protein_id gnl|my_center|LOCUS_04390 47003 45930 gene locus_tag LOCUS_04400 gene hisC 47003 45930 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_04400 48384 47077 gene locus_tag LOCUS_04410 gene hisD 48384 47077 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185201.1 protein_id gnl|my_center|LOCUS_04410 49144 48500 gene locus_tag LOCUS_04420 gene hisG 49144 48500 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_04420 49603 49205 gene locus_tag LOCUS_04430 49603 49205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 49821 49576 gene locus_tag LOCUS_04440 49821 49576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 51152 49887 gene locus_tag LOCUS_04450 gene murA 51152 49887 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527889.1 protein_id gnl|my_center|LOCUS_04450 51333 51145 gene locus_tag LOCUS_04460 51333 51145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 52113 51352 gene locus_tag LOCUS_04470 52113 51352 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_04470 53021 52110 gene locus_tag LOCUS_04480 53021 52110 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_04480 53296 53033 gene locus_tag LOCUS_04490 53296 53033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 53919 53296 gene locus_tag LOCUS_04500 53919 53296 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_04500 54504 54022 gene locus_tag LOCUS_04510 gene mlaD 54504 54022 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 protein_id gnl|my_center|LOCUS_04510 55302 54508 gene locus_tag LOCUS_04520 gene mlaE 55302 54508 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931637.1 protein_id gnl|my_center|LOCUS_04520 56099 55299 gene locus_tag LOCUS_04530 56099 55299 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_04530 56669 56226 gene locus_tag LOCUS_04540 56669 56226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 56884 57711 gene locus_tag LOCUS_04550 56884 57711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 58245 57838 gene locus_tag LOCUS_04560 58245 57838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 59119 58223 gene locus_tag LOCUS_04570 59119 58223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 60819 59119 gene locus_tag LOCUS_04580 60819 59119 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247565.1 protein_id gnl|my_center|LOCUS_04580 60951 62015 gene locus_tag LOCUS_04590 60951 62015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 62012 63250 gene locus_tag LOCUS_04600 62012 63250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 63250 63879 gene locus_tag LOCUS_04610 63250 63879 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087890.1 protein_id gnl|my_center|LOCUS_04610 63933 64664 gene locus_tag LOCUS_04620 gene lpxH 63933 64664 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036171.1 protein_id gnl|my_center|LOCUS_04620 64783 65727 gene locus_tag LOCUS_04630 64783 65727 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556653.1 protein_id gnl|my_center|LOCUS_04630 65740 67524 gene locus_tag LOCUS_04640 65740 67524 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106635.1 protein_id gnl|my_center|LOCUS_04640 67524 68813 gene locus_tag LOCUS_04650 67524 68813 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902660.1 protein_id gnl|my_center|LOCUS_04650 69565 68804 gene locus_tag LOCUS_04660 69565 68804 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192990.1 protein_id gnl|my_center|LOCUS_04660 69622 69975 gene locus_tag LOCUS_04670 69622 69975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 70518 69991 gene locus_tag LOCUS_04680 70518 69991 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390931.1 protein_id gnl|my_center|LOCUS_04680 70912 70526 gene locus_tag LOCUS_04690 70912 70526 CDS product DUF1924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337164.1 protein_id gnl|my_center|LOCUS_04690 71523 70909 gene locus_tag LOCUS_04700 71523 70909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 71936 71529 gene locus_tag LOCUS_04710 71936 71529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 72810 72079 gene locus_tag LOCUS_04720 72810 72079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 73345 73797 gene locus_tag LOCUS_04730 73345 73797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 73794 74438 gene locus_tag LOCUS_04740 73794 74438 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072952.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence006 274 1893 gene locus_tag LOCUS_04750 274 1893 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 protein_id gnl|my_center|LOCUS_04750 2079 3944 gene locus_tag LOCUS_04760 2079 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 5004 3976 gene locus_tag LOCUS_04770 5004 3976 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_04770 5816 5154 gene locus_tag LOCUS_04780 5816 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 6300 5797 gene locus_tag LOCUS_04790 6300 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 6415 7050 gene locus_tag LOCUS_04800 6415 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 7063 8742 gene locus_tag LOCUS_04810 gene ubiB 7063 8742 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 protein_id gnl|my_center|LOCUS_04810 9047 10129 gene locus_tag LOCUS_04820 gene serC 9047 10129 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393775.1 protein_id gnl|my_center|LOCUS_04820 10195 11373 gene locus_tag LOCUS_04830 10195 11373 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_04830 11382 12443 gene locus_tag LOCUS_04840 gene pheA 11382 12443 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689394.1 protein_id gnl|my_center|LOCUS_04840 12995 12432 gene locus_tag LOCUS_04850 12995 12432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 12994 13590 gene locus_tag LOCUS_04860 12994 13590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04860 13587 14456 gene locus_tag LOCUS_04870 13587 14456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04870 14453 15757 gene locus_tag LOCUS_04880 14453 15757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04880 15762 16433 gene locus_tag LOCUS_04890 gene cmk 15762 16433 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813361.1 protein_id gnl|my_center|LOCUS_04890 16559 18244 gene locus_tag LOCUS_04900 gene rpsA 16559 18244 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189285.1 protein_id gnl|my_center|LOCUS_04900 18241 18543 gene locus_tag LOCUS_04910 18241 18543 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928906.1 protein_id gnl|my_center|LOCUS_04910 19161 18736 gene locus_tag LOCUS_04920 19161 18736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 19306 19551 gene locus_tag LOCUS_04930 19306 19551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 19554 20711 gene locus_tag LOCUS_04940 gene lapB 19554 20711 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188993.1 protein_id gnl|my_center|LOCUS_04940 20704 21402 gene locus_tag LOCUS_04950 gene pyrF 20704 21402 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999562.1 protein_id gnl|my_center|LOCUS_04950 21474 22361 gene locus_tag LOCUS_04960 gene cysM 21474 22361 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554618.1 protein_id gnl|my_center|LOCUS_04960 22364 23050 gene locus_tag LOCUS_04970 22364 23050 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_04970 23571 23101 gene locus_tag LOCUS_04980 23571 23101 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263284.1 protein_id gnl|my_center|LOCUS_04980 24348 23620 gene locus_tag LOCUS_04990 24348 23620 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_04990 24942 24352 gene locus_tag LOCUS_05000 24942 24352 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192535.1 protein_id gnl|my_center|LOCUS_05000 26875 25013 gene locus_tag LOCUS_05010 gene oadA 26875 25013 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105539.1 protein_id gnl|my_center|LOCUS_05010 28306 26888 gene locus_tag LOCUS_05020 28306 26888 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401293.1 protein_id gnl|my_center|LOCUS_05020 28416 28853 gene locus_tag LOCUS_05030 28416 28853 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091144.1 protein_id gnl|my_center|LOCUS_05030 28881 29066 gene locus_tag LOCUS_05040 gene rpmF 28881 29066 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813827.1 protein_id gnl|my_center|LOCUS_05040 29117 30157 gene locus_tag LOCUS_05050 gene plsX 29117 30157 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_05050 30154 31128 gene locus_tag LOCUS_05060 30154 31128 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_05060 31246 32172 gene locus_tag LOCUS_05070 gene fabD 31246 32172 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225819.1 protein_id gnl|my_center|LOCUS_05070 32223 32960 gene locus_tag LOCUS_05080 gene fabG 32223 32960 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197597.1 protein_id gnl|my_center|LOCUS_05080 33058 33297 gene locus_tag LOCUS_05090 gene acpP 33058 33297 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215574.1 protein_id gnl|my_center|LOCUS_05090 33385 34638 gene locus_tag LOCUS_05100 gene fabF 33385 34638 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_05100 34660 35481 gene locus_tag LOCUS_05110 gene pabC 34660 35481 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_05110 35474 36472 gene locus_tag LOCUS_05120 gene mltG 35474 36472 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930596.1 protein_id gnl|my_center|LOCUS_05120 36482 37090 gene locus_tag LOCUS_05130 gene tmk 36482 37090 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811733.1 protein_id gnl|my_center|LOCUS_05130 37087 38076 gene locus_tag LOCUS_05140 37087 38076 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 protein_id gnl|my_center|LOCUS_05140 38073 38438 gene locus_tag LOCUS_05150 38073 38438 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_05150 38549 39319 gene locus_tag LOCUS_05160 38549 39319 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192025.1 protein_id gnl|my_center|LOCUS_05160 41631 39367 gene locus_tag LOCUS_05170 gene clpA 41631 39367 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_05170 41834 41628 gene locus_tag LOCUS_05180 41834 41628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 42107 42310 gene locus_tag LOCUS_05190 42107 42310 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_05190 42421 42624 gene locus_tag LOCUS_05200 42421 42624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 43846 42605 gene locus_tag LOCUS_05210 gene icd 43846 42605 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189552.1 protein_id gnl|my_center|LOCUS_05210 43881 44417 gene locus_tag LOCUS_05220 43881 44417 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399826.1 protein_id gnl|my_center|LOCUS_05220 45779 44448 gene locus_tag LOCUS_05230 45779 44448 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_05230 45928 48495 gene locus_tag LOCUS_05240 gene gyrA 45928 48495 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926826.1 protein_id gnl|my_center|LOCUS_05240 48594 49181 gene locus_tag LOCUS_05250 48594 49181 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_05250 49198 50097 gene locus_tag LOCUS_05260 49198 50097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 52663 50177 gene locus_tag LOCUS_05270 52663 50177 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389647.1 protein_id gnl|my_center|LOCUS_05270 53992 52739 gene locus_tag LOCUS_05280 53992 52739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 54570 55091 gene locus_tag LOCUS_05290 gene hybE 54570 55091 CDS product [NiFe]-hydrogenase assembly chaperone HybE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089672.1 protein_id gnl|my_center|LOCUS_05290 55088 56197 gene locus_tag LOCUS_05300 55088 56197 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089671.1 protein_id gnl|my_center|LOCUS_05300 56204 56545 gene locus_tag LOCUS_05310 gene hypA 56204 56545 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388923.1 protein_id gnl|my_center|LOCUS_05310 56943 56488 gene locus_tag LOCUS_05320 56943 56488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 56884 57693 gene locus_tag LOCUS_05330 56884 57693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05330 57704 60166 gene locus_tag LOCUS_05340 gene hypF 57704 60166 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629133.1 protein_id gnl|my_center|LOCUS_05340 60177 60413 gene locus_tag LOCUS_05350 60177 60413 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_05350 60410 61549 gene locus_tag LOCUS_05360 gene hypD 60410 61549 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_05360 61546 62598 gene locus_tag LOCUS_05370 gene hypE 61546 62598 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_05370 62599 64299 gene locus_tag LOCUS_05380 62599 64299 CDS product hydrogenase maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089664.1 protein_id gnl|my_center|LOCUS_05380 65153 64305 gene locus_tag LOCUS_05390 65153 64305 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023915.1 protein_id gnl|my_center|LOCUS_05390 65700 65146 gene locus_tag LOCUS_05400 65700 65146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 66392 65745 gene locus_tag LOCUS_05410 66392 65745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 67400 66408 gene locus_tag LOCUS_05420 67400 66408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 67753 67397 gene locus_tag LOCUS_05430 67753 67397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 68523 67831 gene locus_tag LOCUS_05440 68523 67831 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267525.1 protein_id gnl|my_center|LOCUS_05440 69853 68636 gene locus_tag LOCUS_05450 gene lplT 69853 68636 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 protein_id gnl|my_center|LOCUS_05450 70056 70979 gene locus_tag LOCUS_05460 70056 70979 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_05460 70976 71323 gene locus_tag LOCUS_05470 70976 71323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 71387 72085 gene locus_tag LOCUS_05480 gene ubiG 71387 72085 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448326.1 protein_id gnl|my_center|LOCUS_05480 72078 72752 gene locus_tag LOCUS_05490 gene gph 72078 72752 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550108.1 protein_id gnl|my_center|LOCUS_05490 72835 73195 gene locus_tag LOCUS_tm00010 72835 73195 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence007 585 55 gene locus_tag LOCUS_05500 585 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 2095 1685 gene locus_tag LOCUS_05510 2095 1685 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_05510 2334 2092 gene locus_tag LOCUS_05520 2334 2092 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529932.1 protein_id gnl|my_center|LOCUS_05520 3089 2763 gene locus_tag LOCUS_05530 3089 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 4627 3437 gene locus_tag LOCUS_05540 4627 3437 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832356.1 protein_id gnl|my_center|LOCUS_05540 5238 4624 gene locus_tag LOCUS_05550 5238 4624 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 protein_id gnl|my_center|LOCUS_05550 5790 5245 gene locus_tag LOCUS_05560 5790 5245 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084136.1 protein_id gnl|my_center|LOCUS_05560 5934 6884 gene locus_tag LOCUS_05570 5934 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 7563 6925 gene locus_tag LOCUS_05580 gene cysC 7563 6925 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963430.1 protein_id gnl|my_center|LOCUS_05580 7725 8606 gene locus_tag LOCUS_05590 7725 8606 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970417.1 protein_id gnl|my_center|LOCUS_05590 8603 9553 gene locus_tag LOCUS_05600 8603 9553 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056892.1 protein_id gnl|my_center|LOCUS_05600 11089 9686 gene locus_tag LOCUS_05610 gene ntrC 11089 9686 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555721.1 protein_id gnl|my_center|LOCUS_05610 12218 11106 gene locus_tag LOCUS_05620 gene glnL 12218 11106 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192981.1 protein_id gnl|my_center|LOCUS_05620 13139 12690 gene locus_tag LOCUS_05630 13139 12690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 13589 16030 gene locus_tag LOCUS_05640 13589 16030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05640 16032 17045 gene locus_tag LOCUS_05650 16032 17045 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_05650 17119 18576 gene locus_tag LOCUS_05660 gene mgtE 17119 18576 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767763.1 protein_id gnl|my_center|LOCUS_05660 18573 19370 gene locus_tag LOCUS_05670 18573 19370 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095770.1 protein_id gnl|my_center|LOCUS_05670 21227 19425 gene locus_tag LOCUS_05680 gene msbA 21227 19425 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114544.1 protein_id gnl|my_center|LOCUS_05680 21899 21261 gene locus_tag LOCUS_05690 21899 21261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114545.1 protein_id gnl|my_center|LOCUS_05690 22373 24307 gene locus_tag LOCUS_05700 22373 24307 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268477.1 protein_id gnl|my_center|LOCUS_05700 24701 24219 gene locus_tag LOCUS_05710 24701 24219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 25990 24698 gene locus_tag LOCUS_05720 25990 24698 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268479.1 protein_id gnl|my_center|LOCUS_05720 27463 26081 gene locus_tag LOCUS_05730 gene qseC 27463 26081 CDS product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098726.1 protein_id gnl|my_center|LOCUS_05730 28125 27460 gene locus_tag LOCUS_05740 28125 27460 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_05740 28893 28249 gene locus_tag LOCUS_05750 28893 28249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_05750 29693 28905 gene locus_tag LOCUS_05760 29693 28905 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477831.1 protein_id gnl|my_center|LOCUS_05760 30349 29684 gene locus_tag LOCUS_05770 30349 29684 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_05770 31823 30336 gene locus_tag LOCUS_05780 31823 30336 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 protein_id gnl|my_center|LOCUS_05780 32418 31816 gene locus_tag LOCUS_05790 32418 31816 CDS product thermostable hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706992.1 protein_id gnl|my_center|LOCUS_05790 32549 33532 gene locus_tag LOCUS_05800 gene rfaD 32549 33532 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015772.1 protein_id gnl|my_center|LOCUS_05800 33540 34106 gene locus_tag LOCUS_05810 gene gmhA 33540 34106 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942729.1 protein_id gnl|my_center|LOCUS_05810 34108 35589 gene locus_tag LOCUS_05820 gene rfaE1 34108 35589 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921467.1 protein_id gnl|my_center|LOCUS_05820 35606 37318 gene locus_tag LOCUS_05830 35606 37318 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114551.1 protein_id gnl|my_center|LOCUS_05830 37315 38124 gene locus_tag LOCUS_05840 37315 38124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 38108 39619 gene locus_tag LOCUS_05850 38108 39619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 39641 40267 gene locus_tag LOCUS_05860 39641 40267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 40264 41187 gene locus_tag LOCUS_05870 gene wapR 40264 41187 CDS product alpha-1,3-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114547.1 protein_id gnl|my_center|LOCUS_05870 42032 41184 gene locus_tag LOCUS_05880 42032 41184 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524122.1 protein_id gnl|my_center|LOCUS_05880 43677 42259 gene locus_tag LOCUS_05890 43677 42259 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266465.1 protein_id gnl|my_center|LOCUS_05890 44438 43674 gene locus_tag LOCUS_05900 44438 43674 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095773.1 protein_id gnl|my_center|LOCUS_05900 45256 44435 gene locus_tag LOCUS_05910 gene rfaP 45256 44435 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114553.1 protein_id gnl|my_center|LOCUS_05910 46386 45256 gene locus_tag LOCUS_05920 46386 45256 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114554.1 protein_id gnl|my_center|LOCUS_05920 47450 46392 gene locus_tag LOCUS_05930 gene waaC 47450 46392 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095779.1 protein_id gnl|my_center|LOCUS_05930 48445 47450 gene locus_tag LOCUS_05940 gene waaF 48445 47450 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109905.1 protein_id gnl|my_center|LOCUS_05940 48680 49219 gene locus_tag LOCUS_05950 gene aroQ 48680 49219 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125573.1 protein_id gnl|my_center|LOCUS_05950 49224 49676 gene locus_tag LOCUS_05960 gene accB 49224 49676 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814952.1 protein_id gnl|my_center|LOCUS_05960 49885 51234 gene locus_tag LOCUS_05970 gene accC 49885 51234 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522043.1 protein_id gnl|my_center|LOCUS_05970 51305 52183 gene locus_tag LOCUS_05980 gene prmA 51305 52183 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194259.1 protein_id gnl|my_center|LOCUS_05980 52229 53134 gene locus_tag LOCUS_05990 52229 53134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 53641 54642 gene locus_tag LOCUS_06000 gene lipA 53641 54642 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172396.1 protein_id gnl|my_center|LOCUS_06000 54646 55725 gene locus_tag LOCUS_06010 gene gcvT 54646 55725 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202927.1 protein_id gnl|my_center|LOCUS_06010 55812 56201 gene locus_tag LOCUS_06020 gene gcvH 55812 56201 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114050.1 protein_id gnl|my_center|LOCUS_06020 56276 57664 gene locus_tag LOCUS_06030 gene gcvPA 56276 57664 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770511.1 protein_id gnl|my_center|LOCUS_06030 57688 58200 gene locus_tag LOCUS_06040 gene tpx 57688 58200 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210984.1 protein_id gnl|my_center|LOCUS_06040 58279 59727 gene locus_tag LOCUS_06050 gene gcvPB 58279 59727 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958389.1 protein_id gnl|my_center|LOCUS_06050 59724 60104 gene locus_tag LOCUS_06060 59724 60104 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463392.1 protein_id gnl|my_center|LOCUS_06060 60121 60669 gene locus_tag LOCUS_06070 60121 60669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 61023 60712 gene locus_tag LOCUS_06080 61023 60712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 61440 61138 gene locus_tag LOCUS_06090 61440 61138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 61757 61455 gene locus_tag LOCUS_06100 61757 61455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 61924 63021 gene locus_tag LOCUS_06110 61924 63021 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_06110 63496 63125 gene locus_tag LOCUS_06120 63496 63125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 66175 63617 gene locus_tag LOCUS_06130 gene mutS 66175 63617 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193335.1 protein_id gnl|my_center|LOCUS_06130 66646 67335 gene locus_tag LOCUS_06140 66646 67335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 >Feature sequence008 <1 1246 gene locus_tag LOCUS_06150 <1 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040196.1:THUMP domain-containing protein 1357 1281 gene locus_tag LOCUS_t00080 1357 1281 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1454 2272 gene locus_tag LOCUS_06160 1454 2272 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216672.1 protein_id gnl|my_center|LOCUS_06160 4306 2312 gene locus_tag LOCUS_06170 4306 2312 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524472.1 protein_id gnl|my_center|LOCUS_06170 4982 4359 gene locus_tag LOCUS_06180 4982 4359 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_06180 5239 5715 gene locus_tag LOCUS_06190 5239 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 5971 6990 gene locus_tag LOCUS_06200 gene hemB 5971 6990 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225417.1 protein_id gnl|my_center|LOCUS_06200 7785 7051 gene locus_tag LOCUS_06210 7785 7051 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197265.1 protein_id gnl|my_center|LOCUS_06210 7974 8759 gene locus_tag LOCUS_06220 7974 8759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 8790 9668 gene locus_tag LOCUS_06230 8790 9668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 9702 10481 gene locus_tag LOCUS_06240 9702 10481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 10689 13463 gene locus_tag LOCUS_06250 gene prsT 10689 13463 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 protein_id gnl|my_center|LOCUS_06250 13474 14685 gene locus_tag LOCUS_06260 13474 14685 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889588.1 protein_id gnl|my_center|LOCUS_06260 15180 14887 gene locus_tag LOCUS_06270 15180 14887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 15438 15220 gene locus_tag LOCUS_06280 15438 15220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 15860 16114 gene locus_tag LOCUS_06290 15860 16114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 16111 16533 gene locus_tag LOCUS_06300 16111 16533 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389967.1 protein_id gnl|my_center|LOCUS_06300 16958 18073 gene locus_tag LOCUS_06310 gene yjjJ 16958 18073 CDS product type II toxin-antitoxin system HipA family toxin YjjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035780.1 protein_id gnl|my_center|LOCUS_06310 18354 18139 gene locus_tag LOCUS_06320 18354 18139 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_06320 19965 18916 gene locus_tag LOCUS_06330 19965 18916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 20789 20505 gene locus_tag LOCUS_06340 20789 20505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 21442 20786 gene locus_tag LOCUS_06350 21442 20786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 22733 21483 gene locus_tag LOCUS_06360 22733 21483 CDS product PGL/p-HBAD biosynthesis rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414922.1 protein_id gnl|my_center|LOCUS_06360 22838 24079 gene locus_tag LOCUS_06370 22838 24079 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095708.1 protein_id gnl|my_center|LOCUS_06370 24096 25307 gene locus_tag LOCUS_06380 24096 25307 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263565.1 protein_id gnl|my_center|LOCUS_06380 26123 25335 gene locus_tag LOCUS_06390 26123 25335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 26297 27280 gene locus_tag LOCUS_06400 26297 27280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 27372 28856 gene locus_tag LOCUS_06410 27372 28856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 29938 28868 gene locus_tag LOCUS_06420 29938 28868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 32764 29948 gene locus_tag LOCUS_06430 32764 29948 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787323.1 protein_id gnl|my_center|LOCUS_06430 34203 32848 gene locus_tag LOCUS_06440 gene prsR 34203 32848 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_06440 36263 34200 gene locus_tag LOCUS_06450 gene prsK 36263 34200 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_06450 37239 36265 gene locus_tag LOCUS_06460 37239 36265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 37647 37252 gene locus_tag LOCUS_06470 37647 37252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 38457 37885 gene locus_tag LOCUS_06480 38457 37885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195097.1 protein_id gnl|my_center|LOCUS_06480 40959 38680 gene locus_tag LOCUS_06490 40959 38680 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011857932.1 protein_id gnl|my_center|LOCUS_06490 41186 42160 gene locus_tag LOCUS_06500 gene pilM 41186 42160 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 protein_id gnl|my_center|LOCUS_06500 42157 42756 gene locus_tag LOCUS_06510 42157 42756 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214520.1 protein_id gnl|my_center|LOCUS_06510 42753 43376 gene locus_tag LOCUS_06520 gene pilO 42753 43376 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_06520 43373 43924 gene locus_tag LOCUS_06530 43373 43924 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946665.1 protein_id gnl|my_center|LOCUS_06530 43930 44676 gene locus_tag LOCUS_06540 43930 44676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 44707 46104 gene locus_tag LOCUS_06550 44707 46104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06550 46357 46172 gene locus_tag LOCUS_06560 46357 46172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 47271 46357 gene locus_tag LOCUS_06570 gene lpxC 47271 46357 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461213.1 protein_id gnl|my_center|LOCUS_06570 48640 47435 gene locus_tag LOCUS_06580 gene ftsZ 48640 47435 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194380.1 protein_id gnl|my_center|LOCUS_06580 49944 48706 gene locus_tag LOCUS_06590 gene ftsA 49944 48706 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_06590 50669 49941 gene locus_tag LOCUS_06600 50669 49941 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_06600 51603 50659 gene locus_tag LOCUS_06610 51603 50659 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223420.1 protein_id gnl|my_center|LOCUS_06610 52579 51590 gene locus_tag LOCUS_06620 gene murB 52579 51590 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_06620 53985 52576 gene locus_tag LOCUS_06630 gene murC 53985 52576 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194319.1 protein_id gnl|my_center|LOCUS_06630 55273 54086 gene locus_tag LOCUS_06640 gene murG 55273 54086 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194182.1 protein_id gnl|my_center|LOCUS_06640 56430 55270 gene locus_tag LOCUS_06650 gene ftsW 56430 55270 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 protein_id gnl|my_center|LOCUS_06650 57835 56420 gene locus_tag LOCUS_06660 gene murD 57835 56420 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224926.1 protein_id gnl|my_center|LOCUS_06660 58925 57840 gene locus_tag LOCUS_06670 gene mraY 58925 57840 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_06670 60325 58916 gene locus_tag LOCUS_06680 gene murF 60325 58916 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194098.1 protein_id gnl|my_center|LOCUS_06680 61493 60312 gene locus_tag LOCUS_06690 61493 60312 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549955.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06690 63497 61752 gene locus_tag LOCUS_06700 63497 61752 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446492.1 protein_id gnl|my_center|LOCUS_06700 63769 63497 gene locus_tag LOCUS_06710 63769 63497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 64005 63757 gene locus_tag LOCUS_06720 64005 63757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06720 64754 64002 gene locus_tag LOCUS_06730 gene rsmH 64754 64002 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224919.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06730 64007 64012 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 65224 64751 gene locus_tag LOCUS_06740 gene mraZ 65224 64751 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295770.1 protein_id gnl|my_center|LOCUS_06740 65854 65675 gene locus_tag LOCUS_06750 65854 65675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 <67138 66047 gene locus_tag LOCUS_06760 <67138 66047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112650.1:aerotaxis transducer Aer2 >Feature sequence009 3 494 gene locus_tag LOCUS_06770 3 494 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085759.1 protein_id gnl|my_center|LOCUS_06770 484 1917 gene locus_tag LOCUS_06780 484 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 3263 1929 gene locus_tag LOCUS_06790 3263 1929 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042594919.1 protein_id gnl|my_center|LOCUS_06790 4863 3274 gene locus_tag LOCUS_06800 gene pilS 4863 3274 CDS product two-component system sensor histidine kinase PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094692.1 protein_id gnl|my_center|LOCUS_06800 5065 4838 gene locus_tag LOCUS_06810 5065 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 5366 5058 gene locus_tag LOCUS_06820 5366 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 5599 6009 gene locus_tag LOCUS_06830 5599 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 7049 6162 gene locus_tag LOCUS_06840 7049 6162 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870972.1 protein_id gnl|my_center|LOCUS_06840 7584 7042 gene locus_tag LOCUS_06850 7584 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 8096 7581 gene locus_tag LOCUS_06860 8096 7581 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570773.1 protein_id gnl|my_center|LOCUS_06860 9143 8112 gene locus_tag LOCUS_06870 9143 8112 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_06870 9541 9140 gene locus_tag LOCUS_06880 gene speD 9541 9140 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014510642.1 protein_id gnl|my_center|LOCUS_06880 9710 10126 gene locus_tag LOCUS_06890 9710 10126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 10315 10548 gene locus_tag LOCUS_06900 10315 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 10545 10961 gene locus_tag LOCUS_06910 10545 10961 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_06910 11921 11025 gene locus_tag LOCUS_06920 11921 11025 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_06920 12512 11928 gene locus_tag LOCUS_06930 12512 11928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 14778 12523 gene locus_tag LOCUS_06940 14778 12523 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545086.1 protein_id gnl|my_center|LOCUS_06940 16067 14784 gene locus_tag LOCUS_06950 16067 14784 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_06950 19084 16268 gene locus_tag LOCUS_06960 19084 16268 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521705.1 protein_id gnl|my_center|LOCUS_06960 19594 19181 gene locus_tag LOCUS_06970 19594 19181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 20034 19591 gene locus_tag LOCUS_06980 20034 19591 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813769.1 protein_id gnl|my_center|LOCUS_06980 20930 20052 gene locus_tag LOCUS_06990 gene sucD 20930 20052 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771707.1 protein_id gnl|my_center|LOCUS_06990 22110 20932 gene locus_tag LOCUS_07000 gene sucC 22110 20932 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721255.1 protein_id gnl|my_center|LOCUS_07000 22216 22809 gene locus_tag LOCUS_07010 gene wrbA 22216 22809 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946383.1 protein_id gnl|my_center|LOCUS_07010 22806 23534 gene locus_tag LOCUS_07020 22806 23534 CDS product HugZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 protein_id gnl|my_center|LOCUS_07020 23540 23899 gene locus_tag LOCUS_07030 23540 23899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 24003 24776 gene locus_tag LOCUS_07040 24003 24776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006788385.1 protein_id gnl|my_center|LOCUS_07040 24825 25949 gene locus_tag LOCUS_07050 24825 25949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 27511 25925 gene locus_tag LOCUS_07060 27511 25925 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980887.1 protein_id gnl|my_center|LOCUS_07060 28491 27694 gene locus_tag LOCUS_07070 gene pssA 28491 27694 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186682.1 protein_id gnl|my_center|LOCUS_07070 29147 28494 gene locus_tag LOCUS_07080 29147 28494 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225313.1 protein_id gnl|my_center|LOCUS_07080 30269 29253 gene locus_tag LOCUS_07090 gene ilvC 30269 29253 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218988.1 protein_id gnl|my_center|LOCUS_07090 30870 30379 gene locus_tag LOCUS_07100 gene ilvN 30870 30379 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 protein_id gnl|my_center|LOCUS_07100 32590 30881 gene locus_tag LOCUS_07110 32590 30881 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 protein_id gnl|my_center|LOCUS_07110 32789 32714 gene locus_tag LOCUS_t00090 32789 32714 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 32868 32793 gene locus_tag LOCUS_t00100 32868 32793 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 33602 32925 gene locus_tag LOCUS_07120 33602 32925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 34779 33685 gene locus_tag LOCUS_07130 34779 33685 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086289.1 protein_id gnl|my_center|LOCUS_07130 35526 34852 gene locus_tag LOCUS_07140 gene queC 35526 34852 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111415.1 protein_id gnl|my_center|LOCUS_07140 36176 35523 gene locus_tag LOCUS_07150 gene queE 36176 35523 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_07150 37045 36176 gene locus_tag LOCUS_07160 gene cpoB 37045 36176 CDS product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165506.1 protein_id gnl|my_center|LOCUS_07160 37755 37042 gene locus_tag LOCUS_07170 37755 37042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 39015 37783 gene locus_tag LOCUS_07180 gene tolB 39015 37783 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931417.1 protein_id gnl|my_center|LOCUS_07180 39959 39081 gene locus_tag LOCUS_07190 39959 39081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 40375 39956 gene locus_tag LOCUS_07200 gene tolR 40375 39956 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522197.1 protein_id gnl|my_center|LOCUS_07200 41052 40372 gene locus_tag LOCUS_07210 gene tolQ 41052 40372 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_07210 41477 41052 gene locus_tag LOCUS_07220 gene ybgC 41477 41052 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527641.1 protein_id gnl|my_center|LOCUS_07220 42570 41542 gene locus_tag LOCUS_07230 gene ruvB 42570 41542 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_07230 43171 42587 gene locus_tag LOCUS_07240 gene ruvA 43171 42587 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194029.1 protein_id gnl|my_center|LOCUS_07240 44121 43168 gene locus_tag LOCUS_07250 44121 43168 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466560.1 protein_id gnl|my_center|LOCUS_07250 44636 44118 gene locus_tag LOCUS_07260 gene ruvC 44636 44118 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_07260 45361 44633 gene locus_tag LOCUS_07270 45361 44633 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689207.1 protein_id gnl|my_center|LOCUS_07270 46314 45442 gene locus_tag LOCUS_07280 46314 45442 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_07280 46656 48164 gene locus_tag LOCUS_07290 46656 48164 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704217.1 protein_id gnl|my_center|LOCUS_07290 48161 48805 gene locus_tag LOCUS_07300 48161 48805 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966112.1 protein_id gnl|my_center|LOCUS_07300 49162 48806 gene locus_tag LOCUS_07310 gene folB 49162 48806 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212199.1 protein_id gnl|my_center|LOCUS_07310 49222 49836 gene locus_tag LOCUS_07320 gene plsY 49222 49836 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811015.1 protein_id gnl|my_center|LOCUS_07320 49839 50570 gene locus_tag LOCUS_07330 49839 50570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 51591 50575 gene locus_tag LOCUS_07340 gene tsaD 51591 50575 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811013.1 protein_id gnl|my_center|LOCUS_07340 51724 51936 gene locus_tag LOCUS_07350 gene rpsU 51724 51936 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006218592.1 protein_id gnl|my_center|LOCUS_07350 52029 52472 gene locus_tag LOCUS_07360 52029 52472 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_07360 52495 54213 gene locus_tag LOCUS_07370 gene dnaG 52495 54213 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003698307.1 protein_id gnl|my_center|LOCUS_07370 54312 55832 gene locus_tag LOCUS_07380 54312 55832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 55796 56176 gene locus_tag LOCUS_07390 55796 56176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 56208 56284 gene locus_tag LOCUS_t00110 56208 56284 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 56299 56574 gene locus_tag LOCUS_07400 56299 56574 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813109.1 protein_id gnl|my_center|LOCUS_07400 56567 57457 gene locus_tag LOCUS_07410 56567 57457 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697633.1 protein_id gnl|my_center|LOCUS_07410 57471 59312 gene locus_tag LOCUS_07420 gene dxs 57471 59312 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813105.1 protein_id gnl|my_center|LOCUS_07420 59373 60209 gene locus_tag LOCUS_07430 gene folE2 59373 60209 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_07430 60324 61028 gene locus_tag LOCUS_07440 60324 61028 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113559.1 protein_id gnl|my_center|LOCUS_07440 61025 61288 gene locus_tag LOCUS_07450 61025 61288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 61467 63026 gene locus_tag LOCUS_07460 61467 63026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 63029 63511 gene locus_tag LOCUS_07470 63029 63511 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113020.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence010 1 309 gene locus_tag LOCUS_07480 1 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 309 1814 gene locus_tag LOCUS_07490 gene xrtA 309 1814 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_07490 1880 3031 gene locus_tag LOCUS_07500 1880 3031 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_07500 3050 4975 gene locus_tag LOCUS_07510 3050 4975 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_07510 5061 5267 gene locus_tag LOCUS_07520 5061 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 5351 5581 gene locus_tag LOCUS_07530 5351 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 5578 5916 gene locus_tag LOCUS_07540 5578 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 5913 7130 gene locus_tag LOCUS_07550 5913 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 7195 7392 gene locus_tag LOCUS_07560 7195 7392 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_07560 7475 7759 gene locus_tag LOCUS_07570 7475 7759 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106996.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07570 7843 8934 gene locus_tag LOCUS_07580 7843 8934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 9016 10569 gene locus_tag LOCUS_07590 9016 10569 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_07590 10582 11574 gene locus_tag LOCUS_07600 10582 11574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 11582 11854 gene locus_tag LOCUS_07610 11582 11854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 11956 13326 gene locus_tag LOCUS_07620 11956 13326 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_07620 13326 14666 gene locus_tag LOCUS_07630 13326 14666 CDS product putative O-glycosylation ligase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_07630 15023 14754 gene locus_tag LOCUS_07640 15023 14754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 16196 15087 gene locus_tag LOCUS_07650 16196 15087 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174158.1 protein_id gnl|my_center|LOCUS_07650 17707 16208 gene locus_tag LOCUS_07660 17707 16208 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943646.1 protein_id gnl|my_center|LOCUS_07660 18111 17704 gene locus_tag LOCUS_07670 18111 17704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 18301 19164 gene locus_tag LOCUS_07680 18301 19164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 19154 20164 gene locus_tag LOCUS_07690 19154 20164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 20377 21039 gene locus_tag LOCUS_07700 20377 21039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 22198 21224 gene locus_tag LOCUS_07710 22198 21224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 22432 23250 gene locus_tag LOCUS_07720 22432 23250 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_07720 23357 23554 gene locus_tag LOCUS_07730 23357 23554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 23551 23886 gene locus_tag LOCUS_07740 23551 23886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 24074 24364 gene locus_tag LOCUS_07750 24074 24364 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074357.1 protein_id gnl|my_center|LOCUS_07750 24361 24729 gene locus_tag LOCUS_07760 24361 24729 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141056643.1 protein_id gnl|my_center|LOCUS_07760 25245 25565 gene locus_tag LOCUS_07770 25245 25565 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142290.1 protein_id gnl|my_center|LOCUS_07770 25558 25911 gene locus_tag LOCUS_07780 25558 25911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 25971 27140 gene locus_tag LOCUS_07790 25971 27140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 27197 27409 gene locus_tag LOCUS_07800 27197 27409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 27650 28303 gene locus_tag LOCUS_07810 27650 28303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 28457 29623 gene locus_tag LOCUS_07820 28457 29623 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936352.1 protein_id gnl|my_center|LOCUS_07820 30069 29671 gene locus_tag LOCUS_07830 30069 29671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 30853 31794 gene locus_tag LOCUS_07840 30853 31794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 32329 33849 gene locus_tag LOCUS_07850 32329 33849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 34080 34313 gene locus_tag LOCUS_07860 34080 34313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 34310 34735 gene locus_tag LOCUS_07870 34310 34735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 34840 35916 gene locus_tag LOCUS_07880 34840 35916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 35940 37793 gene locus_tag LOCUS_07890 gene asnB 35940 37793 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194643.1 protein_id gnl|my_center|LOCUS_07890 37947 38912 gene locus_tag LOCUS_07900 37947 38912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 38909 39706 gene locus_tag LOCUS_07910 38909 39706 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976090.1 protein_id gnl|my_center|LOCUS_07910 39861 40196 gene locus_tag LOCUS_07920 39861 40196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 40163 40708 gene locus_tag LOCUS_07930 40163 40708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 40744 41697 gene locus_tag LOCUS_07940 40744 41697 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061611.1 protein_id gnl|my_center|LOCUS_07940 41710 42660 gene locus_tag LOCUS_07950 41710 42660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 42920 43357 gene locus_tag LOCUS_07960 42920 43357 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269184.1 protein_id gnl|my_center|LOCUS_07960 43396 44328 gene locus_tag LOCUS_07970 43396 44328 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_07970 44328 46457 gene locus_tag LOCUS_07980 44328 46457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 47169 46366 gene locus_tag LOCUS_07990 47169 46366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 48409 47264 gene locus_tag LOCUS_08000 48409 47264 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_08000 49774 48578 gene locus_tag LOCUS_08010 49774 48578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 51590 49791 gene locus_tag LOCUS_08020 gene asnB 51590 49791 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_08020 52117 51608 gene locus_tag LOCUS_08030 52117 51608 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941229.1 protein_id gnl|my_center|LOCUS_08030 52305 52183 gene locus_tag LOCUS_08040 52305 52183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 54958 52922 gene locus_tag LOCUS_08050 54958 52922 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550186.1 protein_id gnl|my_center|LOCUS_08050 55060 55587 gene locus_tag LOCUS_08060 55060 55587 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083618.1 protein_id gnl|my_center|LOCUS_08060 56463 55714 gene locus_tag LOCUS_08070 56463 55714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 57383 56526 gene locus_tag LOCUS_08080 gene trxA 57383 56526 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522640.1 protein_id gnl|my_center|LOCUS_08080 58805 57420 gene locus_tag LOCUS_08090 gene purB 58805 57420 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224850.1 protein_id gnl|my_center|LOCUS_08090 60522 59023 gene locus_tag LOCUS_08100 60522 59023 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073207.1 protein_id gnl|my_center|LOCUS_08100 61127 60534 gene locus_tag LOCUS_08110 gene recR 61127 60534 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193537.1 protein_id gnl|my_center|LOCUS_08110 61558 61232 gene locus_tag LOCUS_08120 61558 61232 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192342.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence011 <1 1180 gene locus_tag LOCUS_08130 <1 1180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114089.1:glutamate-5-semialdehyde dehydrogenase 1199 1903 gene locus_tag LOCUS_08140 gene nadD 1199 1903 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_08140 1896 2252 gene locus_tag LOCUS_08150 1896 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08150 2686 2327 gene locus_tag LOCUS_08160 2686 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 4329 2863 gene locus_tag LOCUS_08170 4329 2863 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_08170 8987 4329 gene locus_tag LOCUS_08180 8987 4329 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 protein_id gnl|my_center|LOCUS_08180 9957 9208 gene locus_tag LOCUS_08190 9957 9208 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_08190 10811 9963 gene locus_tag LOCUS_08200 10811 9963 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113017.1 protein_id gnl|my_center|LOCUS_08200 11207 10818 gene locus_tag LOCUS_08210 11207 10818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 11465 11899 gene locus_tag LOCUS_08220 11465 11899 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204701.1 protein_id gnl|my_center|LOCUS_08220 11981 12868 gene locus_tag LOCUS_08230 gene argB 11981 12868 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815193.1 protein_id gnl|my_center|LOCUS_08230 13021 13929 gene locus_tag LOCUS_08240 13021 13929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 13911 14366 gene locus_tag LOCUS_08250 13911 14366 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193808.1 protein_id gnl|my_center|LOCUS_08250 14368 15171 gene locus_tag LOCUS_08260 14368 15171 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_08260 15212 15940 gene locus_tag LOCUS_08270 15212 15940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 17086 15959 gene locus_tag LOCUS_08280 17086 15959 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704392.1 protein_id gnl|my_center|LOCUS_08280 18146 17106 gene locus_tag LOCUS_08290 18146 17106 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003489919.1 protein_id gnl|my_center|LOCUS_08290 18193 18897 gene locus_tag LOCUS_08300 18193 18897 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194162.1 protein_id gnl|my_center|LOCUS_08300 18894 19703 gene locus_tag LOCUS_08310 gene proC 18894 19703 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522133.1 protein_id gnl|my_center|LOCUS_08310 19703 20281 gene locus_tag LOCUS_08320 19703 20281 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073224.1 protein_id gnl|my_center|LOCUS_08320 20312 20614 gene locus_tag LOCUS_08330 20312 20614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 20614 22587 gene locus_tag LOCUS_08340 20614 22587 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_08340 24063 22612 gene locus_tag LOCUS_08350 gene rng 24063 22612 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 protein_id gnl|my_center|LOCUS_08350 24617 24060 gene locus_tag LOCUS_08360 24617 24060 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813200.1 protein_id gnl|my_center|LOCUS_08360 25212 24745 gene locus_tag LOCUS_08370 gene rlmH 25212 24745 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 protein_id gnl|my_center|LOCUS_08370 25520 25595 gene locus_tag LOCUS_t00120 25520 25595 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 27269 26151 gene locus_tag LOCUS_08380 27269 26151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 27841 27419 gene locus_tag LOCUS_08390 gene mscL 27841 27419 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207584.1 protein_id gnl|my_center|LOCUS_08390 29031 27952 gene locus_tag LOCUS_08400 gene nadA 29031 27952 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185886.1 protein_id gnl|my_center|LOCUS_08400 29146 29790 gene locus_tag LOCUS_08410 gene hda 29146 29790 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196484.1 protein_id gnl|my_center|LOCUS_08410 29787 30854 gene locus_tag LOCUS_08420 29787 30854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389361.1 protein_id gnl|my_center|LOCUS_08420 31219 30851 gene locus_tag LOCUS_08430 gene trxA 31219 30851 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224532.1 protein_id gnl|my_center|LOCUS_08430 31628 31338 gene locus_tag LOCUS_08440 31628 31338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 32406 32089 gene locus_tag LOCUS_08450 32406 32089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 32225 32245 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33808 32564 gene locus_tag LOCUS_08460 gene lysA 33808 32564 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114343.1 protein_id gnl|my_center|LOCUS_08460 33969 34253 gene locus_tag LOCUS_08470 gene cyaY 33969 34253 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806945.1 protein_id gnl|my_center|LOCUS_08470 34292 34846 gene locus_tag LOCUS_08480 34292 34846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 34846 35328 gene locus_tag LOCUS_08490 34846 35328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 35380 36276 gene locus_tag LOCUS_08500 35380 36276 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814325.1 protein_id gnl|my_center|LOCUS_08500 36619 38025 gene locus_tag LOCUS_08510 36619 38025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 39362 38022 gene locus_tag LOCUS_08520 39362 38022 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227556.1 protein_id gnl|my_center|LOCUS_08520 40391 39378 gene locus_tag LOCUS_08530 40391 39378 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119272.1 protein_id gnl|my_center|LOCUS_08530 44659 40610 gene locus_tag LOCUS_08540 44659 40610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 45518 44751 gene locus_tag LOCUS_08550 45518 44751 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525670.1 protein_id gnl|my_center|LOCUS_08550 47007 45556 gene locus_tag LOCUS_08560 47007 45556 CDS product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706120.1 protein_id gnl|my_center|LOCUS_08560 48302 47139 gene locus_tag LOCUS_08570 gene prpC 48302 47139 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036232.1 protein_id gnl|my_center|LOCUS_08570 49343 48423 gene locus_tag LOCUS_08580 gene prpB 49343 48423 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224930.1 protein_id gnl|my_center|LOCUS_08580 51355 49463 gene locus_tag LOCUS_08590 51355 49463 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813753.1 protein_id gnl|my_center|LOCUS_08590 51611 54550 gene locus_tag LOCUS_08600 51611 54550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 54712 55281 gene locus_tag LOCUS_08610 54712 55281 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_08610 55281 56309 gene locus_tag LOCUS_08620 gene trpD 55281 56309 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186823.1 protein_id gnl|my_center|LOCUS_08620 56394 56319 gene locus_tag LOCUS_t00130 56394 56319 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 56539 56964 gene locus_tag LOCUS_08630 56539 56964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence012 226 738 gene locus_tag LOCUS_08640 226 738 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258358.1 protein_id gnl|my_center|LOCUS_08640 1243 701 gene locus_tag LOCUS_08650 1243 701 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532473.1 protein_id gnl|my_center|LOCUS_08650 2447 1344 gene locus_tag LOCUS_08660 2447 1344 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191102.1 protein_id gnl|my_center|LOCUS_08660 3391 2444 gene locus_tag LOCUS_08670 gene gshB 3391 2444 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198015.1 protein_id gnl|my_center|LOCUS_08670 4686 3388 gene locus_tag LOCUS_08680 gene gshA 4686 3388 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522914.1 protein_id gnl|my_center|LOCUS_08680 4792 5265 gene locus_tag LOCUS_08690 gene trmL 4792 5265 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522909.1 protein_id gnl|my_center|LOCUS_08690 5323 5649 gene locus_tag LOCUS_08700 5323 5649 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120685.1 protein_id gnl|my_center|LOCUS_08700 5828 6094 gene locus_tag LOCUS_08710 5828 6094 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_08710 6114 6854 gene locus_tag LOCUS_08720 gene ubiE 6114 6854 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815111.1 protein_id gnl|my_center|LOCUS_08720 6939 7175 gene locus_tag LOCUS_08730 6939 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 7191 7598 gene locus_tag LOCUS_08740 7191 7598 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_08740 8495 7605 gene locus_tag LOCUS_08750 gene xerC 8495 7605 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064714.1 protein_id gnl|my_center|LOCUS_08750 8547 8575 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9303 8656 gene locus_tag LOCUS_08760 9303 8656 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064713.1 protein_id gnl|my_center|LOCUS_08760 10142 9300 gene locus_tag LOCUS_08770 gene dapF 10142 9300 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401768.1 protein_id gnl|my_center|LOCUS_08770 10632 10150 gene locus_tag LOCUS_08780 10632 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 11045 10629 gene locus_tag LOCUS_08790 11045 10629 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_08790 11581 11069 gene locus_tag LOCUS_08800 11581 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 12458 11571 gene locus_tag LOCUS_08810 12458 11571 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010356740.1 protein_id gnl|my_center|LOCUS_08810 12748 13878 gene locus_tag LOCUS_08820 gene metK 12748 13878 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199069.1 protein_id gnl|my_center|LOCUS_08820 13981 15381 gene locus_tag LOCUS_08830 gene ahcY 13981 15381 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807196.1 protein_id gnl|my_center|LOCUS_08830 15439 15828 gene locus_tag LOCUS_08840 15439 15828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 15825 16262 gene locus_tag LOCUS_08850 15825 16262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 16414 17589 gene locus_tag LOCUS_08860 16414 17589 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_08860 18007 19821 gene locus_tag LOCUS_08870 18007 19821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 19841 20740 gene locus_tag LOCUS_08880 gene gluQRS 19841 20740 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221978.1 protein_id gnl|my_center|LOCUS_08880 21727 20753 gene locus_tag LOCUS_08890 gene moaA 21727 20753 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092949.1 protein_id gnl|my_center|LOCUS_08890 21920 22411 gene locus_tag LOCUS_08900 gene mobB 21920 22411 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_08900 22466 22723 gene locus_tag LOCUS_08910 gene moaD 22466 22723 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193789.1 protein_id gnl|my_center|LOCUS_08910 22758 24179 gene locus_tag LOCUS_08920 22758 24179 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930991.1 protein_id gnl|my_center|LOCUS_08920 25633 24197 gene locus_tag LOCUS_08930 25633 24197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 26491 25661 gene locus_tag LOCUS_08940 26491 25661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 27509 26520 gene locus_tag LOCUS_08950 27509 26520 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_08950 28043 27567 gene locus_tag LOCUS_08960 gene secB 28043 27567 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687381.1 protein_id gnl|my_center|LOCUS_08960 28531 28112 gene locus_tag LOCUS_08970 gene trxC 28531 28112 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070806.1 protein_id gnl|my_center|LOCUS_08970 28862 28605 gene locus_tag LOCUS_08980 gene grxC 28862 28605 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 protein_id gnl|my_center|LOCUS_08980 29316 28906 gene locus_tag LOCUS_08990 29316 28906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 29581 29357 gene locus_tag LOCUS_09000 29581 29357 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 protein_id gnl|my_center|LOCUS_09000 32905 29618 gene locus_tag LOCUS_09010 32905 29618 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_09010 33992 32931 gene locus_tag LOCUS_09020 33992 32931 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_09020 35352 34006 gene locus_tag LOCUS_09030 35352 34006 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933704.1 protein_id gnl|my_center|LOCUS_09030 35924 35610 gene locus_tag LOCUS_09040 35924 35610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 36077 37639 gene locus_tag LOCUS_09050 gene gpmI 36077 37639 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 protein_id gnl|my_center|LOCUS_09050 37657 38829 gene locus_tag LOCUS_09060 gene envC 37657 38829 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704298.1 protein_id gnl|my_center|LOCUS_09060 38862 40262 gene locus_tag LOCUS_09070 gene cptA 38862 40262 CDS product protease CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929911.1 protein_id gnl|my_center|LOCUS_09070 40274 40669 gene locus_tag LOCUS_09080 40274 40669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 41274 40684 gene locus_tag LOCUS_09090 gene slmA 41274 40684 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198306.1 protein_id gnl|my_center|LOCUS_09090 41596 41282 gene locus_tag LOCUS_09100 41596 41282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 42614 41589 gene locus_tag LOCUS_09110 42614 41589 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_09110 42943 42719 gene locus_tag LOCUS_09120 42943 42719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 43782 42943 gene locus_tag LOCUS_09130 43782 42943 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_09130 44238 43786 gene locus_tag LOCUS_09140 44238 43786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 45198 44242 gene locus_tag LOCUS_09150 45198 44242 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930151.1 protein_id gnl|my_center|LOCUS_09150 46543 45200 gene locus_tag LOCUS_09160 gene miaB 46543 45200 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064327.1 protein_id gnl|my_center|LOCUS_09160 46652 46576 gene locus_tag LOCUS_t00140 46652 46576 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 46872 47327 gene locus_tag LOCUS_09170 46872 47327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 47964 47419 gene locus_tag LOCUS_09180 47964 47419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 48019 49593 gene locus_tag LOCUS_09190 48019 49593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 50494 49643 gene locus_tag LOCUS_09200 gene motD 50494 49643 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 protein_id gnl|my_center|LOCUS_09200 51252 50512 gene locus_tag LOCUS_09210 51252 50512 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 protein_id gnl|my_center|LOCUS_09210 51996 51271 gene locus_tag LOCUS_09220 51996 51271 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198636.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence013 802 431 gene locus_tag LOCUS_09230 802 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 2283 1042 gene locus_tag LOCUS_09240 2283 1042 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814929.1 protein_id gnl|my_center|LOCUS_09240 3184 2312 gene locus_tag LOCUS_09250 3184 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 6074 3195 gene locus_tag LOCUS_09260 6074 3195 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814928.1 protein_id gnl|my_center|LOCUS_09260 6360 7214 gene locus_tag LOCUS_09270 gene purU 6360 7214 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933485.1 protein_id gnl|my_center|LOCUS_09270 7279 8307 gene locus_tag LOCUS_09280 gene galE 7279 8307 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_09280 8304 9374 gene locus_tag LOCUS_09290 gene rfbB 8304 9374 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_09290 9374 10258 gene locus_tag LOCUS_09300 gene rfbA 9374 10258 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706707.1 protein_id gnl|my_center|LOCUS_09300 10258 10800 gene locus_tag LOCUS_09310 gene rfbC 10258 10800 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185665.1 protein_id gnl|my_center|LOCUS_09310 10797 11681 gene locus_tag LOCUS_09320 gene rfbD 10797 11681 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112614.1 protein_id gnl|my_center|LOCUS_09320 11678 11854 gene locus_tag LOCUS_09330 11678 11854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 12671 11868 gene locus_tag LOCUS_09340 gene ccsA 12671 11868 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448047.1 protein_id gnl|my_center|LOCUS_09340 12736 14082 gene locus_tag LOCUS_09350 gene ffh 12736 14082 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929607.1 protein_id gnl|my_center|LOCUS_09350 17031 14122 gene locus_tag LOCUS_09360 17031 14122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 18096 17173 gene locus_tag LOCUS_09370 18096 17173 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821521.1 protein_id gnl|my_center|LOCUS_09370 18218 20896 gene locus_tag LOCUS_09380 18218 20896 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040039036.1 protein_id gnl|my_center|LOCUS_09380 22414 20969 gene locus_tag LOCUS_09390 gene cysG 22414 20969 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005618952.1 protein_id gnl|my_center|LOCUS_09390 22869 22504 gene locus_tag LOCUS_09400 22869 22504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 24281 22893 gene locus_tag LOCUS_09410 gene cobB 24281 22893 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_09410 25558 24353 gene locus_tag LOCUS_09420 gene hmeB 25558 24353 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_09420 26308 25562 gene locus_tag LOCUS_09430 gene hmeA 26308 25562 CDS product Hdr-like menaquinol oxidoreductase iron-sulfur subunit HmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878006.1 protein_id gnl|my_center|LOCUS_09430 26763 26305 gene locus_tag LOCUS_09440 26763 26305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 28739 26781 gene locus_tag LOCUS_09450 28739 26781 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932535.1 protein_id gnl|my_center|LOCUS_09450 30370 28847 gene locus_tag LOCUS_09460 30370 28847 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_09460 31161 30424 gene locus_tag LOCUS_09470 gene dsrM 31161 30424 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810497.1 protein_id gnl|my_center|LOCUS_09470 31636 31301 gene locus_tag LOCUS_09480 31636 31301 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_09480 31961 31662 gene locus_tag LOCUS_09490 gene tusB 31961 31662 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481146.1 protein_id gnl|my_center|LOCUS_09490 32371 31973 gene locus_tag LOCUS_09500 gene tusC 32371 31973 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 protein_id gnl|my_center|LOCUS_09500 32741 32382 gene locus_tag LOCUS_09510 gene tusD 32741 32382 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_09510 33872 32799 gene locus_tag LOCUS_09520 gene dsrB 33872 32799 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_09520 35249 33948 gene locus_tag LOCUS_09530 gene dsrA 35249 33948 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_09530 35513 35752 gene locus_tag LOCUS_09540 35513 35752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 35756 36409 gene locus_tag LOCUS_09550 35756 36409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 36462 36794 gene locus_tag LOCUS_09560 36462 36794 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020235.1 protein_id gnl|my_center|LOCUS_09560 36856 37704 gene locus_tag LOCUS_09570 36856 37704 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109274.1 protein_id gnl|my_center|LOCUS_09570 37707 38285 gene locus_tag LOCUS_09580 37707 38285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 38293 39222 gene locus_tag LOCUS_09590 38293 39222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 39915 39259 gene locus_tag LOCUS_09600 39915 39259 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225188.1 protein_id gnl|my_center|LOCUS_09600 41150 39912 gene locus_tag LOCUS_09610 41150 39912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 42511 41225 gene locus_tag LOCUS_09620 gene amiC 42511 41225 CDS product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173271.1 protein_id gnl|my_center|LOCUS_09620 42957 42478 gene locus_tag LOCUS_09630 42957 42478 CDS product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189096.1 protein_id gnl|my_center|LOCUS_09630 42972 44039 gene locus_tag LOCUS_09640 gene queG 42972 44039 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_09640 44036 44848 gene locus_tag LOCUS_09650 gene murI 44036 44848 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223465.1 protein_id gnl|my_center|LOCUS_09650 44960 45262 gene locus_tag LOCUS_09660 gene nirM 44960 45262 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_09660 45445 45358 gene locus_tag LOCUS_t00150 45445 45358 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 45533 45913 gene locus_tag LOCUS_09670 45533 45913 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 protein_id gnl|my_center|LOCUS_09670 45963 48002 gene locus_tag LOCUS_09680 gene recG 45963 48002 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225638.1 protein_id gnl|my_center|LOCUS_09680 48029 48553 gene locus_tag LOCUS_09690 48029 48553 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957348.1 protein_id gnl|my_center|LOCUS_09690 48550 49422 gene locus_tag LOCUS_09700 gene ubiA 48550 49422 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_09700 49419 50138 gene locus_tag LOCUS_09710 49419 50138 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184121.1 protein_id gnl|my_center|LOCUS_09710 50667 50116 gene locus_tag LOCUS_09720 gene mog 50667 50116 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368355.1 protein_id gnl|my_center|LOCUS_09720 50730 51212 gene locus_tag LOCUS_09730 50730 51212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence014 3507 730 gene locus_tag LOCUS_09740 gene ppdK 3507 730 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392144.1 protein_id gnl|my_center|LOCUS_09740 3658 4257 gene locus_tag LOCUS_09750 3658 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 4275 4931 gene locus_tag LOCUS_09760 4275 4931 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185713.1 protein_id gnl|my_center|LOCUS_09760 5453 4941 gene locus_tag LOCUS_09770 5453 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 6144 5800 gene locus_tag LOCUS_09780 6144 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 6883 6173 gene locus_tag LOCUS_09790 6883 6173 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035648.1 protein_id gnl|my_center|LOCUS_09790 7745 6972 gene locus_tag LOCUS_09800 7745 6972 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 protein_id gnl|my_center|LOCUS_09800 7961 7782 gene locus_tag LOCUS_09810 7961 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 8184 8978 gene locus_tag LOCUS_09820 8184 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 9739 9065 gene locus_tag LOCUS_09830 9739 9065 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_09830 10175 9792 gene locus_tag LOCUS_09840 10175 9792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 11201 10257 gene locus_tag LOCUS_09850 11201 10257 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064714.1 protein_id gnl|my_center|LOCUS_09850 12655 11198 gene locus_tag LOCUS_09860 12655 11198 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939561.1 protein_id gnl|my_center|LOCUS_09860 13168 12719 gene locus_tag LOCUS_09870 13168 12719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 13895 13284 gene locus_tag LOCUS_09880 13895 13284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 14559 14281 gene locus_tag LOCUS_09890 14559 14281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 14829 14665 gene locus_tag LOCUS_09900 14829 14665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 15145 14951 gene locus_tag LOCUS_09910 15145 14951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 15471 16619 gene locus_tag LOCUS_09920 15471 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 16672 17100 gene locus_tag LOCUS_09930 16672 17100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 19150 17357 gene locus_tag LOCUS_09940 gene aspS 19150 17357 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807038.1 protein_id gnl|my_center|LOCUS_09940 19809 19171 gene locus_tag LOCUS_09950 19809 19171 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189093.1 protein_id gnl|my_center|LOCUS_09950 20113 19862 gene locus_tag LOCUS_09960 20113 19862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 21735 20194 gene locus_tag LOCUS_09970 21735 20194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 22228 21770 gene locus_tag LOCUS_09980 22228 21770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 23616 22231 gene locus_tag LOCUS_09990 23616 22231 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951164.1 protein_id gnl|my_center|LOCUS_09990 23831 24502 gene locus_tag LOCUS_10000 23831 24502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 24616 27429 gene locus_tag LOCUS_10010 gene uvrA 24616 27429 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526066.1 protein_id gnl|my_center|LOCUS_10010 27468 27710 gene locus_tag LOCUS_10020 27468 27710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 27691 27945 gene locus_tag LOCUS_10030 27691 27945 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517660.1 protein_id gnl|my_center|LOCUS_10030 28925 27960 gene locus_tag LOCUS_10040 28925 27960 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061271.1 protein_id gnl|my_center|LOCUS_10040 28975 29199 gene locus_tag LOCUS_10050 28975 29199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 29186 29524 gene locus_tag LOCUS_10060 gene mazF9 29186 29524 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_10060 29529 29702 gene locus_tag LOCUS_10070 29529 29702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 29725 30630 gene locus_tag LOCUS_10080 29725 30630 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_10080 30830 31096 gene locus_tag LOCUS_10090 30830 31096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 31144 32007 gene locus_tag LOCUS_10100 31144 32007 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_10100 32091 32831 gene locus_tag LOCUS_10110 32091 32831 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811964.1 protein_id gnl|my_center|LOCUS_10110 33904 32828 gene locus_tag LOCUS_10120 33904 32828 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088017.1 protein_id gnl|my_center|LOCUS_10120 34076 34414 gene locus_tag LOCUS_10130 34076 34414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 34415 34852 gene locus_tag LOCUS_10140 34415 34852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10140 34849 36147 gene locus_tag LOCUS_10150 34849 36147 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 protein_id gnl|my_center|LOCUS_10150 36859 36110 gene locus_tag LOCUS_10160 36859 36110 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_10160 37341 36952 gene locus_tag LOCUS_10170 gene rplQ 37341 36952 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197924.1 protein_id gnl|my_center|LOCUS_10170 38354 37359 gene locus_tag LOCUS_10180 gene rpoA 38354 37359 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197925.1 protein_id gnl|my_center|LOCUS_10180 39037 38411 gene locus_tag LOCUS_10190 gene rpsD 39037 38411 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135224.1 protein_id gnl|my_center|LOCUS_10190 39441 39049 gene locus_tag LOCUS_10200 gene rpsK 39441 39049 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216249.1 protein_id gnl|my_center|LOCUS_10200 39816 39454 gene locus_tag LOCUS_10210 gene rpsM 39816 39454 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197938.1 protein_id gnl|my_center|LOCUS_10210 40247 40029 gene locus_tag LOCUS_10220 gene infA 40247 40029 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521905.1 protein_id gnl|my_center|LOCUS_10220 41582 40257 gene locus_tag LOCUS_10230 gene secY 41582 40257 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_10230 42039 41599 gene locus_tag LOCUS_10240 gene rplO 42039 41599 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 protein_id gnl|my_center|LOCUS_10240 42221 42036 gene locus_tag LOCUS_10250 gene rpmD 42221 42036 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 protein_id gnl|my_center|LOCUS_10250 42737 42225 gene locus_tag LOCUS_10260 gene rpsE 42737 42225 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197945.1 protein_id gnl|my_center|LOCUS_10260 43102 42749 gene locus_tag LOCUS_10270 gene rplR 43102 42749 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215441.1 protein_id gnl|my_center|LOCUS_10270 43651 43118 gene locus_tag LOCUS_10280 gene rplF 43651 43118 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197947.1 protein_id gnl|my_center|LOCUS_10280 44055 43660 gene locus_tag LOCUS_10290 gene rpsH 44055 43660 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185153.1 protein_id gnl|my_center|LOCUS_10290 44373 44068 gene locus_tag LOCUS_10300 gene rpsN 44373 44068 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806919.1 protein_id gnl|my_center|LOCUS_10300 44920 44381 gene locus_tag LOCUS_10310 gene rplE 44920 44381 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215436.1 protein_id gnl|my_center|LOCUS_10310 45245 44931 gene locus_tag LOCUS_10320 gene rplX 45245 44931 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690072.1 protein_id gnl|my_center|LOCUS_10320 45624 45256 gene locus_tag LOCUS_10330 gene rplN 45624 45256 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215434.1 protein_id gnl|my_center|LOCUS_10330 46056 45784 gene locus_tag LOCUS_10340 gene rpsQ 46056 45784 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215433.1 protein_id gnl|my_center|LOCUS_10340 46267 46067 gene locus_tag LOCUS_10350 gene rpmC 46267 46067 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199856.1 protein_id gnl|my_center|LOCUS_10350 46685 46269 gene locus_tag LOCUS_10360 gene rplP 46685 46269 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806911.1 protein_id gnl|my_center|LOCUS_10360 47398 46691 gene locus_tag LOCUS_10370 gene rpsC 47398 46691 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038651.1 protein_id gnl|my_center|LOCUS_10370 47738 47409 gene locus_tag LOCUS_10380 gene rplV 47738 47409 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199272.1 protein_id gnl|my_center|LOCUS_10380 48028 47750 gene locus_tag LOCUS_10390 gene rpsS 48028 47750 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199273.1 protein_id gnl|my_center|LOCUS_10390 48866 48042 gene locus_tag LOCUS_10400 gene rplB 48866 48042 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806907.1 protein_id gnl|my_center|LOCUS_10400 49181 48870 gene locus_tag LOCUS_10410 gene rplW 49181 48870 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199275.1 protein_id gnl|my_center|LOCUS_10410 49801 49178 gene locus_tag LOCUS_10420 gene rplD 49801 49178 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690088.1 protein_id gnl|my_center|LOCUS_10420 50276 50371 gene locus_tag LOCUS_t00160 50276 50371 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 50851 50540 gene locus_tag LOCUS_10430 gene rpsJ 50851 50540 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199280.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence015 159 386 gene locus_tag LOCUS_10440 159 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 397 1113 gene locus_tag LOCUS_10450 397 1113 CDS product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185598.1 protein_id gnl|my_center|LOCUS_10450 1574 1125 gene locus_tag LOCUS_10460 1574 1125 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704544.1 protein_id gnl|my_center|LOCUS_10460 2785 1574 gene locus_tag LOCUS_10470 2785 1574 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064382.1 protein_id gnl|my_center|LOCUS_10470 4404 2785 gene locus_tag LOCUS_10480 4404 2785 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481841.1 protein_id gnl|my_center|LOCUS_10480 4473 4742 gene locus_tag LOCUS_10490 4473 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 5288 4746 gene locus_tag LOCUS_10500 5288 4746 CDS product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704735.1 protein_id gnl|my_center|LOCUS_10500 5976 5296 gene locus_tag LOCUS_10510 5976 5296 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_10510 8435 5991 gene locus_tag LOCUS_10520 gene gyrB 8435 5991 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196276.1 protein_id gnl|my_center|LOCUS_10520 9618 8512 gene locus_tag LOCUS_10530 gene dnaN 9618 8512 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223059.1 protein_id gnl|my_center|LOCUS_10530 11212 9818 gene locus_tag LOCUS_10540 gene dnaA 11212 9818 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401422.1 protein_id gnl|my_center|LOCUS_10540 11358 11492 gene locus_tag LOCUS_10550 gene rpmH 11358 11492 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816025.1 protein_id gnl|my_center|LOCUS_10550 11522 11896 gene locus_tag LOCUS_10560 11522 11896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 11933 13612 gene locus_tag LOCUS_10570 gene yidC 11933 13612 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169144818.1 protein_id gnl|my_center|LOCUS_10570 13630 14967 gene locus_tag LOCUS_10580 gene mnmE 13630 14967 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687082.1 protein_id gnl|my_center|LOCUS_10580 15488 15135 gene locus_tag LOCUS_10590 15488 15135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 15637 17445 gene locus_tag LOCUS_10600 15637 17445 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085865.1 protein_id gnl|my_center|LOCUS_10600 17569 20358 gene locus_tag LOCUS_10610 gene ppc 17569 20358 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207161458.1 protein_id gnl|my_center|LOCUS_10610 20498 22387 gene locus_tag LOCUS_10620 gene mnmG 20498 22387 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818282.1 protein_id gnl|my_center|LOCUS_10620 22384 23004 gene locus_tag LOCUS_10630 gene rsmG 22384 23004 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226919.1 protein_id gnl|my_center|LOCUS_10630 23001 23780 gene locus_tag LOCUS_10640 23001 23780 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195817.1 protein_id gnl|my_center|LOCUS_10640 23773 24612 gene locus_tag LOCUS_10650 23773 24612 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195818.1 protein_id gnl|my_center|LOCUS_10650 24704 25060 gene locus_tag LOCUS_10660 24704 25060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 25063 25905 gene locus_tag LOCUS_10670 gene atpB 25063 25905 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100237.1 protein_id gnl|my_center|LOCUS_10670 25946 26179 gene locus_tag LOCUS_10680 gene atpE 25946 26179 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307205.1 protein_id gnl|my_center|LOCUS_10680 26229 26699 gene locus_tag LOCUS_10690 gene atpF 26229 26699 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074334.1 protein_id gnl|my_center|LOCUS_10690 26702 27235 gene locus_tag LOCUS_10700 26702 27235 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_10700 27255 28796 gene locus_tag LOCUS_10710 gene atpA 27255 28796 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225830.1 protein_id gnl|my_center|LOCUS_10710 28814 29680 gene locus_tag LOCUS_10720 gene atpG 28814 29680 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_10720 29718 31097 gene locus_tag LOCUS_10730 gene atpD 29718 31097 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097130.1 protein_id gnl|my_center|LOCUS_10730 31181 31606 gene locus_tag LOCUS_10740 31181 31606 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_10740 31743 33119 gene locus_tag LOCUS_10750 gene glmU 31743 33119 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040718.1 protein_id gnl|my_center|LOCUS_10750 33246 35072 gene locus_tag LOCUS_10760 gene glmS 33246 35072 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114654.1 protein_id gnl|my_center|LOCUS_10760 35083 35850 gene locus_tag LOCUS_10770 35083 35850 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921580.1 protein_id gnl|my_center|LOCUS_10770 35908 37227 gene locus_tag LOCUS_10780 gene bioA 35908 37227 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189232.1 protein_id gnl|my_center|LOCUS_10780 37239 37712 gene locus_tag LOCUS_10790 37239 37712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 37868 39898 gene locus_tag LOCUS_10800 37868 39898 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_10800 39949 40254 gene locus_tag LOCUS_10810 39949 40254 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929235.1 protein_id gnl|my_center|LOCUS_10810 40407 41552 gene locus_tag LOCUS_10820 40407 41552 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525689.1 protein_id gnl|my_center|LOCUS_10820 41660 42589 gene locus_tag LOCUS_10830 41660 42589 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812854.1 protein_id gnl|my_center|LOCUS_10830 42582 43697 gene locus_tag LOCUS_10840 42582 43697 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812851.1 protein_id gnl|my_center|LOCUS_10840 43694 44467 gene locus_tag LOCUS_10850 43694 44467 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064072.1 protein_id gnl|my_center|LOCUS_10850 44464 45171 gene locus_tag LOCUS_10860 44464 45171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064071.1 protein_id gnl|my_center|LOCUS_10860 45331 46008 gene locus_tag LOCUS_10870 45331 46008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 46155 46856 gene locus_tag LOCUS_10880 46155 46856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 47479 46850 gene locus_tag LOCUS_10890 47479 46850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 48071 47760 gene locus_tag LOCUS_10900 48071 47760 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096316.1 protein_id gnl|my_center|LOCUS_10900 48303 48073 gene locus_tag LOCUS_10910 48303 48073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 49395 48328 gene locus_tag LOCUS_10920 gene hemE 49395 48328 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222724.1 protein_id gnl|my_center|LOCUS_10920 <50511 49421 gene locus_tag LOCUS_10930 <50511 49421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039227.1:cation acetate symporter >Feature sequence016 2371 1175 gene locus_tag LOCUS_10940 2371 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 3183 2368 gene locus_tag LOCUS_10950 3183 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 5077 3176 gene locus_tag LOCUS_10960 gene asnB 5077 3176 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_10960 5838 5077 gene locus_tag LOCUS_10970 5838 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 8046 5893 gene locus_tag LOCUS_10980 8046 5893 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862490.1 protein_id gnl|my_center|LOCUS_10980 8351 8121 gene locus_tag LOCUS_10990 8351 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 8801 10075 gene locus_tag LOCUS_11000 gene waaA 8801 10075 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532247.1 protein_id gnl|my_center|LOCUS_11000 11418 10099 gene locus_tag LOCUS_11010 11418 10099 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_11010 11749 11426 gene locus_tag LOCUS_11020 11749 11426 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_11020 12405 11752 gene locus_tag LOCUS_11030 12405 11752 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185654.1 protein_id gnl|my_center|LOCUS_11030 12581 13357 gene locus_tag LOCUS_11040 12581 13357 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225376.1 protein_id gnl|my_center|LOCUS_11040 13466 14008 gene locus_tag LOCUS_11050 13466 14008 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047949975.1 protein_id gnl|my_center|LOCUS_11050 14028 14621 gene locus_tag LOCUS_11060 14028 14621 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958360.1 protein_id gnl|my_center|LOCUS_11060 14633 14998 gene locus_tag LOCUS_11070 14633 14998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 15001 15852 gene locus_tag LOCUS_11080 15001 15852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 16029 17117 gene locus_tag LOCUS_11090 gene apbC 16029 17117 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_11090 17203 17769 gene locus_tag LOCUS_11100 gene dcd 17203 17769 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037700.1 protein_id gnl|my_center|LOCUS_11100 17865 20099 gene locus_tag LOCUS_11110 17865 20099 CDS product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191939.1 protein_id gnl|my_center|LOCUS_11110 20251 20628 gene locus_tag LOCUS_11120 gene rpsF 20251 20628 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980921.1 protein_id gnl|my_center|LOCUS_11120 20757 20924 gene locus_tag LOCUS_11130 20757 20924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 20955 21227 gene locus_tag LOCUS_11140 gene rpsR 20955 21227 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813094.1 protein_id gnl|my_center|LOCUS_11140 21242 21691 gene locus_tag LOCUS_11150 gene rplI 21242 21691 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232586.1 protein_id gnl|my_center|LOCUS_11150 22361 21753 gene locus_tag LOCUS_11160 22361 21753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552477.1 protein_id gnl|my_center|LOCUS_11160 22515 23909 gene locus_tag LOCUS_11170 22515 23909 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192724.1 protein_id gnl|my_center|LOCUS_11170 23925 24995 gene locus_tag LOCUS_11180 gene dadX 23925 24995 CDS product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705840.1 protein_id gnl|my_center|LOCUS_11180 25041 25850 gene locus_tag LOCUS_11190 gene trpC 25041 25850 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815394.1 protein_id gnl|my_center|LOCUS_11190 25854 27161 gene locus_tag LOCUS_11200 25854 27161 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_11200 27228 27932 gene locus_tag LOCUS_11210 27228 27932 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_11210 27929 29110 gene locus_tag LOCUS_11220 27929 29110 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_11220 29272 29751 gene locus_tag LOCUS_11230 29272 29751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 30293 29802 gene locus_tag LOCUS_11240 30293 29802 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705368.1 protein_id gnl|my_center|LOCUS_11240 30967 30341 gene locus_tag LOCUS_11250 30967 30341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 32465 31068 gene locus_tag LOCUS_11260 32465 31068 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053740.1 protein_id gnl|my_center|LOCUS_11260 34269 32491 gene locus_tag LOCUS_11270 34269 32491 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_11270 34629 34342 gene locus_tag LOCUS_11280 34629 34342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 34939 34616 gene locus_tag LOCUS_11290 34939 34616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 35421 35077 gene locus_tag LOCUS_11300 35421 35077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 35871 35431 gene locus_tag LOCUS_11310 35871 35431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 37773 35908 gene locus_tag LOCUS_11320 37773 35908 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_11320 38894 37848 gene locus_tag LOCUS_11330 38894 37848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 39249 38932 gene locus_tag LOCUS_11340 39249 38932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 39467 39252 gene locus_tag LOCUS_11350 39467 39252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 41360 39579 gene locus_tag LOCUS_11360 41360 39579 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944569.1 protein_id gnl|my_center|LOCUS_11360 42627 41365 gene locus_tag LOCUS_11370 42627 41365 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880594.1 protein_id gnl|my_center|LOCUS_11370 43283 42624 gene locus_tag LOCUS_11380 43283 42624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 44377 43286 gene locus_tag LOCUS_11390 44377 43286 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880596.1 protein_id gnl|my_center|LOCUS_11390 44848 44420 gene locus_tag LOCUS_11400 44848 44420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 45317 44838 gene locus_tag LOCUS_11410 45317 44838 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388919.1 protein_id gnl|my_center|LOCUS_11410 45463 45696 gene locus_tag LOCUS_11420 45463 45696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 45707 46534 gene locus_tag LOCUS_11430 gene mscS 45707 46534 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209961.1 protein_id gnl|my_center|LOCUS_11430 46871 46590 gene locus_tag LOCUS_11440 46871 46590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 46941 48023 gene locus_tag LOCUS_11450 46941 48023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 48199 48234 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence017 989 84 gene locus_tag LOCUS_11460 989 84 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167917.1 protein_id gnl|my_center|LOCUS_11460 1171 1344 gene locus_tag LOCUS_11470 1171 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1412 1690 gene locus_tag LOCUS_11480 1412 1690 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528365.1 protein_id gnl|my_center|LOCUS_11480 1714 2826 gene locus_tag LOCUS_11490 1714 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 2816 3799 gene locus_tag LOCUS_11500 2816 3799 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706514.1 protein_id gnl|my_center|LOCUS_11500 3855 4859 gene locus_tag LOCUS_11510 3855 4859 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192521.1 protein_id gnl|my_center|LOCUS_11510 4937 5833 gene locus_tag LOCUS_11520 4937 5833 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193564.1 protein_id gnl|my_center|LOCUS_11520 5914 6387 gene locus_tag LOCUS_11530 5914 6387 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193409.1 protein_id gnl|my_center|LOCUS_11530 6427 8265 gene locus_tag LOCUS_11540 gene mutL 6427 8265 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037442.1 protein_id gnl|my_center|LOCUS_11540 8268 8666 gene locus_tag LOCUS_11550 8268 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 9428 8670 gene locus_tag LOCUS_11560 9428 8670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11560 11755 9425 gene locus_tag LOCUS_11570 11755 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 12576 11752 gene locus_tag LOCUS_11580 12576 11752 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268833.1 protein_id gnl|my_center|LOCUS_11580 13655 12600 gene locus_tag LOCUS_11590 13655 12600 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037024.1 protein_id gnl|my_center|LOCUS_11590 14903 13737 gene locus_tag LOCUS_11600 14903 13737 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_11600 15105 15701 gene locus_tag LOCUS_11610 gene petA 15105 15701 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 protein_id gnl|my_center|LOCUS_11610 15724 16947 gene locus_tag LOCUS_11620 15724 16947 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215003.1 protein_id gnl|my_center|LOCUS_11620 16944 17675 gene locus_tag LOCUS_11630 16944 17675 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199892.1 protein_id gnl|my_center|LOCUS_11630 17696 18295 gene locus_tag LOCUS_11640 17696 18295 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 protein_id gnl|my_center|LOCUS_11640 18306 18761 gene locus_tag LOCUS_11650 18306 18761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 18790 18865 gene locus_tag LOCUS_t00170 18790 18865 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 19031 20512 gene locus_tag LOCUS_11660 19031 20512 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_11660 20572 21009 gene locus_tag LOCUS_11670 20572 21009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 21411 21160 gene locus_tag LOCUS_11680 21411 21160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 22084 21641 gene locus_tag LOCUS_11690 22084 21641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 22933 22244 gene locus_tag LOCUS_11700 gene narI 22933 22244 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096512.1 protein_id gnl|my_center|LOCUS_11700 23514 22975 gene locus_tag LOCUS_11710 23514 22975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 25223 23676 gene locus_tag LOCUS_11720 gene narH 25223 23676 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524710.1 protein_id gnl|my_center|LOCUS_11720 29195 25443 gene locus_tag LOCUS_11730 29195 25443 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555870.1 protein_id gnl|my_center|LOCUS_11730 29438 29223 gene locus_tag LOCUS_11740 29438 29223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 31188 29467 gene locus_tag LOCUS_11750 31188 29467 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014188.1 protein_id gnl|my_center|LOCUS_11750 32509 31244 gene locus_tag LOCUS_11760 32509 31244 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524713.1 protein_id gnl|my_center|LOCUS_11760 32782 34704 gene locus_tag LOCUS_11770 gene narX 32782 34704 CDS product two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105296.1 protein_id gnl|my_center|LOCUS_11770 34706 35359 gene locus_tag LOCUS_11780 gene narL 34706 35359 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_11780 36767 35298 gene locus_tag LOCUS_11790 36767 35298 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_11790 39895 36767 gene locus_tag LOCUS_11800 39895 36767 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_11800 41124 39907 gene locus_tag LOCUS_11810 41124 39907 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_11810 41282 41968 gene locus_tag LOCUS_11820 41282 41968 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406317.1 protein_id gnl|my_center|LOCUS_11820 42560 41985 gene locus_tag LOCUS_11830 42560 41985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 42982 42575 gene locus_tag LOCUS_11840 42982 42575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 43232 43035 gene locus_tag LOCUS_11850 43232 43035 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037775.1 protein_id gnl|my_center|LOCUS_11850 43816 43268 gene locus_tag LOCUS_11860 43816 43268 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197759.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence018 <1 691 gene locus_tag LOCUS_11870 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063742.1:flagellar hook-length control protein FliK 691 999 gene locus_tag LOCUS_11880 691 999 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523065.1 protein_id gnl|my_center|LOCUS_11880 3550 989 gene locus_tag LOCUS_11890 3550 989 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544413.1 protein_id gnl|my_center|LOCUS_11890 4382 3561 gene locus_tag LOCUS_11900 gene map 4382 3561 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193235.1 protein_id gnl|my_center|LOCUS_11900 4774 4490 gene locus_tag LOCUS_11910 4774 4490 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_11910 5253 4774 gene locus_tag LOCUS_11920 5253 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 7361 5277 gene locus_tag LOCUS_11930 gene metG 7361 5277 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203868.1 protein_id gnl|my_center|LOCUS_11930 7478 7554 gene locus_tag LOCUS_t00180 7478 7554 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7706 9601 gene locus_tag LOCUS_11940 gene thrS 7706 9601 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191232.1 protein_id gnl|my_center|LOCUS_11940 9739 10179 gene locus_tag LOCUS_11950 gene infC 9739 10179 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 protein_id gnl|my_center|LOCUS_11950 10352 10549 gene locus_tag LOCUS_11960 gene rpmI 10352 10549 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812834.1 protein_id gnl|my_center|LOCUS_11960 10564 10929 gene locus_tag LOCUS_11970 gene rplT 10564 10929 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225461.1 protein_id gnl|my_center|LOCUS_11970 11002 12018 gene locus_tag LOCUS_11980 gene pheS 11002 12018 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_11980 12031 14388 gene locus_tag LOCUS_11990 gene pheT 12031 14388 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114408.1 protein_id gnl|my_center|LOCUS_11990 14404 14712 gene locus_tag LOCUS_12000 14404 14712 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931006.1 protein_id gnl|my_center|LOCUS_12000 14687 15055 gene locus_tag LOCUS_12010 14687 15055 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526841.1 protein_id gnl|my_center|LOCUS_12010 15197 15273 gene locus_tag LOCUS_t00190 15197 15273 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 16317 15505 gene locus_tag LOCUS_12020 16317 15505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 16856 16329 gene locus_tag LOCUS_12030 16856 16329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 17506 16853 gene locus_tag LOCUS_12040 17506 16853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 19630 17519 gene locus_tag LOCUS_12050 19630 17519 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272394.1 protein_id gnl|my_center|LOCUS_12050 20094 19627 gene locus_tag LOCUS_12060 20094 19627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 20898 20188 gene locus_tag LOCUS_12070 20898 20188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 22625 20895 gene locus_tag LOCUS_12080 22625 20895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 23155 22643 gene locus_tag LOCUS_12090 23155 22643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 25313 23142 gene locus_tag LOCUS_12100 25313 23142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 25602 25390 gene locus_tag LOCUS_12110 25602 25390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 25877 25602 gene locus_tag LOCUS_12120 25877 25602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 27077 26169 gene locus_tag LOCUS_12130 27077 26169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 27324 27079 gene locus_tag LOCUS_12140 27324 27079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 28837 27407 gene locus_tag LOCUS_12150 28837 27407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 29108 29854 gene locus_tag LOCUS_12160 gene surE 29108 29854 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770587.1 protein_id gnl|my_center|LOCUS_12160 29851 30507 gene locus_tag LOCUS_12170 29851 30507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 30504 31220 gene locus_tag LOCUS_12180 30504 31220 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115226.1 protein_id gnl|my_center|LOCUS_12180 31226 32167 gene locus_tag LOCUS_12190 gene rpoS 31226 32167 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193640.1 protein_id gnl|my_center|LOCUS_12190 32164 32844 gene locus_tag LOCUS_12200 gene yrfG 32164 32844 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_12200 32841 33527 gene locus_tag LOCUS_12210 32841 33527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 33906 33538 gene locus_tag LOCUS_12220 33906 33538 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_12220 34007 35194 gene locus_tag LOCUS_12230 gene alaC 34007 35194 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931132.1 protein_id gnl|my_center|LOCUS_12230 35191 36504 gene locus_tag LOCUS_12240 35191 36504 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 protein_id gnl|my_center|LOCUS_12240 36561 38006 gene locus_tag LOCUS_12250 gene thrC 36561 38006 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192708.1 protein_id gnl|my_center|LOCUS_12250 38003 38368 gene locus_tag LOCUS_12260 38003 38368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 38370 38753 gene locus_tag LOCUS_12270 38370 38753 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037424.1 protein_id gnl|my_center|LOCUS_12270 39417 38764 gene locus_tag LOCUS_12280 gene narL 39417 38764 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_12280 41386 39428 gene locus_tag LOCUS_12290 gene narX 41386 39428 CDS product two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105296.1 protein_id gnl|my_center|LOCUS_12290 41653 42339 gene locus_tag LOCUS_12300 41653 42339 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191689.1 protein_id gnl|my_center|LOCUS_12300 42829 42377 gene locus_tag LOCUS_12310 gene nikR 42829 42377 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190057.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence019 518 943 gene locus_tag LOCUS_12320 gene ndk 518 943 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_12320 957 2042 gene locus_tag LOCUS_12330 gene rlmN 957 2042 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219171.1 protein_id gnl|my_center|LOCUS_12330 2088 2885 gene locus_tag LOCUS_12340 gene pilW 2088 2885 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017018640.1 protein_id gnl|my_center|LOCUS_12340 2882 3751 gene locus_tag LOCUS_12350 2882 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 3759 4994 gene locus_tag LOCUS_12360 gene ispG 3759 4994 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 protein_id gnl|my_center|LOCUS_12360 5113 6408 gene locus_tag LOCUS_12370 gene hisS 5113 6408 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521334.1 protein_id gnl|my_center|LOCUS_12370 6478 7107 gene locus_tag LOCUS_12380 6478 7107 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930791.1 protein_id gnl|my_center|LOCUS_12380 7109 8269 gene locus_tag LOCUS_12390 gene bamB 7109 8269 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_12390 8363 9781 gene locus_tag LOCUS_12400 gene der 8363 9781 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225394.1 protein_id gnl|my_center|LOCUS_12400 10864 9965 gene locus_tag LOCUS_12410 10864 9965 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808614.1 protein_id gnl|my_center|LOCUS_12410 11326 11009 gene locus_tag LOCUS_12420 11326 11009 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210636.1 protein_id gnl|my_center|LOCUS_12420 11611 11357 gene locus_tag LOCUS_12430 11611 11357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 14411 11913 gene locus_tag LOCUS_12440 14411 11913 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 protein_id gnl|my_center|LOCUS_12440 14776 14480 gene locus_tag LOCUS_12450 14776 14480 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_12450 15119 14913 gene locus_tag LOCUS_12460 15119 14913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 15658 15461 gene locus_tag LOCUS_12470 15658 15461 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061019.1 protein_id gnl|my_center|LOCUS_12470 16173 16439 gene locus_tag LOCUS_12480 16173 16439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 16461 16619 gene locus_tag LOCUS_12490 16461 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 16692 18122 gene locus_tag LOCUS_12500 16692 18122 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812985.1 protein_id gnl|my_center|LOCUS_12500 18462 20342 gene locus_tag LOCUS_12510 18462 20342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 20362 20619 gene locus_tag LOCUS_12520 20362 20619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 21094 20726 gene locus_tag LOCUS_12530 21094 20726 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_12530 21482 21315 gene locus_tag LOCUS_12540 21482 21315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 22102 21554 gene locus_tag LOCUS_12550 22102 21554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 23066 22578 gene locus_tag LOCUS_12560 23066 22578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 23994 23350 gene locus_tag LOCUS_12570 gene folE 23994 23350 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202069.1 protein_id gnl|my_center|LOCUS_12570 24526 24044 gene locus_tag LOCUS_12580 24526 24044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 27600 24673 gene locus_tag LOCUS_12590 27600 24673 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054625.1 protein_id gnl|my_center|LOCUS_12590 28703 27600 gene locus_tag LOCUS_12600 28703 27600 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338822.1 protein_id gnl|my_center|LOCUS_12600 29794 28709 gene locus_tag LOCUS_12610 gene tal 29794 28709 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689551.1 protein_id gnl|my_center|LOCUS_12610 32166 29791 gene locus_tag LOCUS_12620 32166 29791 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140999.1 protein_id gnl|my_center|LOCUS_12620 32257 32439 gene locus_tag LOCUS_12630 32257 32439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 32827 32399 gene locus_tag LOCUS_12640 32827 32399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 33107 32934 gene locus_tag LOCUS_12650 33107 32934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 33856 33302 gene locus_tag LOCUS_12660 33856 33302 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391513.1 protein_id gnl|my_center|LOCUS_12660 34486 33923 gene locus_tag LOCUS_12670 34486 33923 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 protein_id gnl|my_center|LOCUS_12670 34933 34616 gene locus_tag LOCUS_12680 34933 34616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 35871 34930 gene locus_tag LOCUS_12690 35871 34930 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 protein_id gnl|my_center|LOCUS_12690 36212 35949 gene locus_tag LOCUS_12700 36212 35949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 36744 36301 gene locus_tag LOCUS_12710 36744 36301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 37094 36879 gene locus_tag LOCUS_12720 37094 36879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 37772 37161 gene locus_tag LOCUS_12730 37772 37161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 38110 39297 gene locus_tag LOCUS_12740 38110 39297 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141757.1 protein_id gnl|my_center|LOCUS_12740 39630 40346 gene locus_tag LOCUS_12750 39630 40346 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_12750 40763 40383 gene locus_tag LOCUS_12760 40763 40383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 >Feature sequence020 452 162 gene locus_tag LOCUS_12770 gene nadS 452 162 CDS product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811547.1 protein_id gnl|my_center|LOCUS_12770 774 454 gene locus_tag LOCUS_12780 774 454 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_12780 1453 1037 gene locus_tag LOCUS_12790 1453 1037 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_12790 1694 1446 gene locus_tag LOCUS_12800 1694 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 3245 1920 gene locus_tag LOCUS_12810 3245 1920 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032802630.1 protein_id gnl|my_center|LOCUS_12810 3525 3235 gene locus_tag LOCUS_12820 3525 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 4368 3880 gene locus_tag LOCUS_12830 4368 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 4527 5252 gene locus_tag LOCUS_12840 4527 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 7035 5329 gene locus_tag LOCUS_12850 7035 5329 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114602.1 protein_id gnl|my_center|LOCUS_12850 7354 7082 gene locus_tag LOCUS_12860 7354 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 7401 9140 gene locus_tag LOCUS_12870 gene sulP 7401 9140 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085632.1 protein_id gnl|my_center|LOCUS_12870 9194 10207 gene locus_tag LOCUS_12880 9194 10207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 11331 10261 gene locus_tag LOCUS_12890 gene ydiK 11331 10261 CDS product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011416681.1 protein_id gnl|my_center|LOCUS_12890 11649 11350 gene locus_tag LOCUS_12900 11649 11350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 12570 11719 gene locus_tag LOCUS_12910 gene ppk2 12570 11719 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096528.1 protein_id gnl|my_center|LOCUS_12910 12779 13081 gene locus_tag LOCUS_12920 12779 13081 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200395.1 protein_id gnl|my_center|LOCUS_12920 13140 13511 gene locus_tag LOCUS_12930 13140 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 13498 13896 gene locus_tag LOCUS_12940 13498 13896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 15498 13906 gene locus_tag LOCUS_12950 15498 13906 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931292.1 protein_id gnl|my_center|LOCUS_12950 16597 15527 gene locus_tag LOCUS_12960 16597 15527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 16775 16930 gene locus_tag LOCUS_12970 16775 16930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 18256 16964 gene locus_tag LOCUS_12980 18256 16964 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065115.1 protein_id gnl|my_center|LOCUS_12980 19077 18253 gene locus_tag LOCUS_12990 19077 18253 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771218.1 protein_id gnl|my_center|LOCUS_12990 19153 20529 gene locus_tag LOCUS_13000 19153 20529 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205436.1 protein_id gnl|my_center|LOCUS_13000 21164 20526 gene locus_tag LOCUS_13010 21164 20526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 21310 21789 gene locus_tag LOCUS_13020 21310 21789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 23417 21786 gene locus_tag LOCUS_13030 gene cimA 23417 21786 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_13030 23583 26645 gene locus_tag LOCUS_13040 23583 26645 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020677315.1 protein_id gnl|my_center|LOCUS_13040 26769 27617 gene locus_tag LOCUS_13050 26769 27617 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_13050 27620 30541 gene locus_tag LOCUS_13060 27620 30541 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036268.1 protein_id gnl|my_center|LOCUS_13060 30541 31527 gene locus_tag LOCUS_13070 30541 31527 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064796.1 protein_id gnl|my_center|LOCUS_13070 31538 33628 gene locus_tag LOCUS_13080 31538 33628 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036269.1 protein_id gnl|my_center|LOCUS_13080 34599 33694 gene locus_tag LOCUS_13090 34599 33694 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_13090 34735 35181 gene locus_tag LOCUS_13100 34735 35181 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193608.1 protein_id gnl|my_center|LOCUS_13100 35222 36541 gene locus_tag LOCUS_13110 35222 36541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13110 36424 36451 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36460 37776 gene locus_tag LOCUS_13120 36460 37776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13120 >Feature sequence021 1938 1075 gene locus_tag LOCUS_13130 1938 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 2916 1951 gene locus_tag LOCUS_13140 2916 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 4511 2913 gene locus_tag LOCUS_13150 4511 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 4921 4511 gene locus_tag LOCUS_13160 4921 4511 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693848.1 protein_id gnl|my_center|LOCUS_13160 6489 4918 gene locus_tag LOCUS_13170 6489 4918 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103418.1 protein_id gnl|my_center|LOCUS_13170 6865 6638 gene locus_tag LOCUS_13180 6865 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 6976 7596 gene locus_tag LOCUS_13190 6976 7596 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083419.1 protein_id gnl|my_center|LOCUS_13190 7699 8271 gene locus_tag LOCUS_13200 7699 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 8274 8669 gene locus_tag LOCUS_13210 8274 8669 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085915.1 protein_id gnl|my_center|LOCUS_13210 8926 8654 gene locus_tag LOCUS_13220 8926 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 9193 9660 gene locus_tag LOCUS_13230 gene nudB 9193 9660 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189197.1 protein_id gnl|my_center|LOCUS_13230 10393 9674 gene locus_tag LOCUS_13240 10393 9674 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103309.1 protein_id gnl|my_center|LOCUS_13240 10456 10902 gene locus_tag LOCUS_13250 10456 10902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 10902 11885 gene locus_tag LOCUS_13260 gene bioB 10902 11885 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200336.1 protein_id gnl|my_center|LOCUS_13260 11993 13156 gene locus_tag LOCUS_13270 gene bioF 11993 13156 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113248.1 protein_id gnl|my_center|LOCUS_13270 13156 13896 gene locus_tag LOCUS_13280 gene bioH 13156 13896 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704304.1 protein_id gnl|my_center|LOCUS_13280 13889 14791 gene locus_tag LOCUS_13290 13889 14791 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065340943.1 protein_id gnl|my_center|LOCUS_13290 14788 15510 gene locus_tag LOCUS_13300 gene bioD 14788 15510 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530983.1 protein_id gnl|my_center|LOCUS_13300 15649 16104 gene locus_tag LOCUS_13310 15649 16104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 16101 16697 gene locus_tag LOCUS_13320 16101 16697 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815727.1 protein_id gnl|my_center|LOCUS_13320 16837 18282 gene locus_tag LOCUS_13330 gene ccoN 16837 18282 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 protein_id gnl|my_center|LOCUS_13330 18299 19042 gene locus_tag LOCUS_13340 gene ccoO 18299 19042 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971696.1 protein_id gnl|my_center|LOCUS_13340 19042 19221 gene locus_tag LOCUS_13350 19042 19221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 19214 20146 gene locus_tag LOCUS_13360 gene ccoP 19214 20146 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316282.1 protein_id gnl|my_center|LOCUS_13360 20283 21698 gene locus_tag LOCUS_13370 gene ccoG 20283 21698 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338980.1 protein_id gnl|my_center|LOCUS_13370 21705 22481 gene locus_tag LOCUS_13380 21705 22481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 22606 23088 gene locus_tag LOCUS_13390 gene rimP 22606 23088 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193908.1 protein_id gnl|my_center|LOCUS_13390 23085 24566 gene locus_tag LOCUS_13400 gene nusA 23085 24566 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193517.1 protein_id gnl|my_center|LOCUS_13400 24579 27245 gene locus_tag LOCUS_13410 24579 27245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 27307 27702 gene locus_tag LOCUS_13420 gene rbfA 27307 27702 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268880.1 protein_id gnl|my_center|LOCUS_13420 27686 28573 gene locus_tag LOCUS_13430 gene truB 27686 28573 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_13430 28700 28969 gene locus_tag LOCUS_13440 gene rpsO 28700 28969 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814002.1 protein_id gnl|my_center|LOCUS_13440 28980 31202 gene locus_tag LOCUS_13450 gene pnp 28980 31202 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690787.1 protein_id gnl|my_center|LOCUS_13450 31377 31099 gene locus_tag LOCUS_13460 31377 31099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 31584 32339 gene locus_tag LOCUS_13470 31584 32339 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_13470 34478 32346 gene locus_tag LOCUS_13480 34478 32346 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811115.1 protein_id gnl|my_center|LOCUS_13480 34708 34502 gene locus_tag LOCUS_13490 gene rpoZ 34708 34502 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_13490 34826 35314 gene locus_tag LOCUS_13500 34826 35314 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_13500 35431 35682 gene locus_tag LOCUS_13510 gene rpsP 35431 35682 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189402.1 protein_id gnl|my_center|LOCUS_13510 35696 36178 gene locus_tag LOCUS_13520 gene rimM 35696 36178 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113830.1 protein_id gnl|my_center|LOCUS_13520 36187 36948 gene locus_tag LOCUS_13530 gene trmD 36187 36948 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189914.1 protein_id gnl|my_center|LOCUS_13530 37052 37432 gene locus_tag LOCUS_13540 gene rplS 37052 37432 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189360.1 protein_id gnl|my_center|LOCUS_13540 38174 37494 gene locus_tag LOCUS_13550 38174 37494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence022 2848 1967 gene locus_tag LOCUS_13560 2848 1967 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 protein_id gnl|my_center|LOCUS_13560 4621 3008 gene locus_tag LOCUS_13570 4621 3008 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138513118.1 protein_id gnl|my_center|LOCUS_13570 5823 4756 gene locus_tag LOCUS_13580 gene fba 5823 4756 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022162.1 protein_id gnl|my_center|LOCUS_13580 7287 5851 gene locus_tag LOCUS_13590 gene pyk 7287 5851 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 protein_id gnl|my_center|LOCUS_13590 8557 7373 gene locus_tag LOCUS_13600 8557 7373 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704731.1 protein_id gnl|my_center|LOCUS_13600 9709 8711 gene locus_tag LOCUS_13610 gene gap 9709 8711 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_13610 11824 9836 gene locus_tag LOCUS_13620 gene tkt 11824 9836 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420542.1 protein_id gnl|my_center|LOCUS_13620 12931 12137 gene locus_tag LOCUS_13630 12931 12137 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687170.1 protein_id gnl|my_center|LOCUS_13630 13473 12919 gene locus_tag LOCUS_13640 13473 12919 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 protein_id gnl|my_center|LOCUS_13640 13535 14266 gene locus_tag LOCUS_13650 13535 14266 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_13650 14342 15658 gene locus_tag LOCUS_13660 gene argA 14342 15658 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_13660 15659 16477 gene locus_tag LOCUS_13670 15659 16477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 16474 19290 gene locus_tag LOCUS_13680 16474 19290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 22057 19352 gene locus_tag LOCUS_13690 22057 19352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 22679 22227 gene locus_tag LOCUS_13700 22679 22227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 24401 23142 gene locus_tag LOCUS_13710 24401 23142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 24703 24398 gene locus_tag LOCUS_13720 24703 24398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 27773 24705 gene locus_tag LOCUS_13730 27773 24705 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_13730 28819 27770 gene locus_tag LOCUS_13740 28819 27770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 29294 28968 gene locus_tag LOCUS_13750 29294 28968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 29517 30233 gene locus_tag LOCUS_13760 gene bfmR 29517 30233 CDS product two-component system response regulator BfmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113023.1 protein_id gnl|my_center|LOCUS_13760 30241 31551 gene locus_tag LOCUS_13770 30241 31551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 31827 32306 gene locus_tag LOCUS_13780 31827 32306 CDS product cytochrome C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930463.1 protein_id gnl|my_center|LOCUS_13780 32334 33602 gene locus_tag LOCUS_13790 32334 33602 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530417.1 protein_id gnl|my_center|LOCUS_13790 33604 34194 gene locus_tag LOCUS_13800 33604 34194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 34191 34940 gene locus_tag LOCUS_13810 34191 34940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 35190 35594 gene locus_tag LOCUS_13820 35190 35594 CDS product DUF1924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337164.1 protein_id gnl|my_center|LOCUS_13820 35596 36090 gene locus_tag LOCUS_13830 35596 36090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 36101 36706 gene locus_tag LOCUS_13840 36101 36706 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970806.1 protein_id gnl|my_center|LOCUS_13840 36720 37379 gene locus_tag LOCUS_13850 gene pmrA 36720 37379 CDS product two-component system response regulator PrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102236.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence023 <1 1012 gene locus_tag LOCUS_13860 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141326.1:glycoside hydrolase family 57 protein 1090 3099 gene locus_tag LOCUS_13870 1090 3099 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250760.1 protein_id gnl|my_center|LOCUS_13870 3131 3622 gene locus_tag LOCUS_13880 3131 3622 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669747.1 protein_id gnl|my_center|LOCUS_13880 4025 6043 gene locus_tag LOCUS_13890 4025 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 6132 7211 gene locus_tag LOCUS_13900 6132 7211 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103065.1 protein_id gnl|my_center|LOCUS_13900 7208 7711 gene locus_tag LOCUS_13910 7208 7711 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257683.1 protein_id gnl|my_center|LOCUS_13910 7715 9121 gene locus_tag LOCUS_13920 7715 9121 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_13920 9118 10584 gene locus_tag LOCUS_13930 9118 10584 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_13930 10745 13681 gene locus_tag LOCUS_13940 10745 13681 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114402.1 protein_id gnl|my_center|LOCUS_13940 14810 13965 gene locus_tag LOCUS_13950 gene nadC 14810 13965 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185611.1 protein_id gnl|my_center|LOCUS_13950 15228 14818 gene locus_tag LOCUS_13960 15228 14818 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403246.1 protein_id gnl|my_center|LOCUS_13960 15473 15219 gene locus_tag LOCUS_13970 15473 15219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 15955 15551 gene locus_tag LOCUS_13980 15955 15551 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034522187.1 protein_id gnl|my_center|LOCUS_13980 16188 15952 gene locus_tag LOCUS_13990 16188 15952 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141679.1 protein_id gnl|my_center|LOCUS_13990 16306 18906 gene locus_tag LOCUS_14000 gene clpB 16306 18906 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521310.1 protein_id gnl|my_center|LOCUS_14000 19672 19433 gene locus_tag LOCUS_14010 19672 19433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 19733 21178 gene locus_tag LOCUS_14020 19733 21178 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189765.1 protein_id gnl|my_center|LOCUS_14020 21315 21671 gene locus_tag LOCUS_14030 21315 21671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 21675 22520 gene locus_tag LOCUS_14040 gene soxA 21675 22520 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932698.1 protein_id gnl|my_center|LOCUS_14040 22639 24360 gene locus_tag LOCUS_14050 gene soxB 22639 24360 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_14050 24580 26301 gene locus_tag LOCUS_14060 24580 26301 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228351.1 protein_id gnl|my_center|LOCUS_14060 26444 27727 gene locus_tag LOCUS_14070 26444 27727 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918160.1 protein_id gnl|my_center|LOCUS_14070 27761 28624 gene locus_tag LOCUS_14080 27761 28624 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229732.1 protein_id gnl|my_center|LOCUS_14080 28621 28971 gene locus_tag LOCUS_14090 28621 28971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 29011 30861 gene locus_tag LOCUS_14100 29011 30861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 31878 31132 gene locus_tag LOCUS_14110 31878 31132 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100328.1 protein_id gnl|my_center|LOCUS_14110 31986 32414 gene locus_tag LOCUS_14120 gene rplM 31986 32414 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 protein_id gnl|my_center|LOCUS_14120 32424 32816 gene locus_tag LOCUS_14130 gene rpsI 32424 32816 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 protein_id gnl|my_center|LOCUS_14130 32885 33925 gene locus_tag LOCUS_14140 gene argC 32885 33925 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269099.1 protein_id gnl|my_center|LOCUS_14140 34023 34370 gene locus_tag LOCUS_14150 gene erpA 34023 34370 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194247.1 protein_id gnl|my_center|LOCUS_14150 34461 34652 gene locus_tag LOCUS_14160 34461 34652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 35330 34671 gene locus_tag LOCUS_14170 gene rpiA 35330 34671 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189743.1 protein_id gnl|my_center|LOCUS_14170 35405 36913 gene locus_tag LOCUS_14180 gene ilvA 35405 36913 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_14180 37142 36954 gene locus_tag LOCUS_14190 37142 36954 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_14190 37940 37287 gene locus_tag LOCUS_14200 37940 37287 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence024 <1 2030 gene locus_tag LOCUS_14210 <1 2030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522854.1:monovalent cation:proton antiporter family protein 2720 2037 gene locus_tag LOCUS_14220 2720 2037 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 protein_id gnl|my_center|LOCUS_14220 2906 4660 gene locus_tag LOCUS_14230 2906 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 5425 4700 gene locus_tag LOCUS_14240 gene pdxJ 5425 4700 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192885.1 protein_id gnl|my_center|LOCUS_14240 6126 5422 gene locus_tag LOCUS_14250 gene recO 6126 5422 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192953.1 protein_id gnl|my_center|LOCUS_14250 7006 6119 gene locus_tag LOCUS_14260 gene era 7006 6119 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 protein_id gnl|my_center|LOCUS_14260 7713 7003 gene locus_tag LOCUS_14270 7713 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 8198 7839 gene locus_tag LOCUS_14280 8198 7839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 9043 8207 gene locus_tag LOCUS_14290 gene lepB 9043 8207 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193513.1 protein_id gnl|my_center|LOCUS_14290 10864 9068 gene locus_tag LOCUS_14300 gene lepA 10864 9068 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225433.1 protein_id gnl|my_center|LOCUS_14300 11189 10938 gene locus_tag LOCUS_14310 11189 10938 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524616.1 protein_id gnl|my_center|LOCUS_14310 12698 11301 gene locus_tag LOCUS_14320 12698 11301 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192020.1 protein_id gnl|my_center|LOCUS_14320 13205 12753 gene locus_tag LOCUS_14330 13205 12753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 14221 13202 gene locus_tag LOCUS_14340 gene mucB 14221 13202 CDS product sigma factor AlgU regulator MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101960.1 protein_id gnl|my_center|LOCUS_14340 14742 14218 gene locus_tag LOCUS_14350 14742 14218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 15344 14745 gene locus_tag LOCUS_14360 gene rpoE 15344 14745 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_14360 15482 17047 gene locus_tag LOCUS_14370 gene nadB 15482 17047 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114182.1 protein_id gnl|my_center|LOCUS_14370 18546 17044 gene locus_tag LOCUS_14380 gene pepA 18546 17044 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 protein_id gnl|my_center|LOCUS_14380 18649 19719 gene locus_tag LOCUS_14390 gene lptF 18649 19719 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 protein_id gnl|my_center|LOCUS_14390 19716 20789 gene locus_tag LOCUS_14400 gene lptG 19716 20789 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764084.1 protein_id gnl|my_center|LOCUS_14400 21214 20786 gene locus_tag LOCUS_14410 21214 20786 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533619.1 protein_id gnl|my_center|LOCUS_14410 21585 21211 gene locus_tag LOCUS_14420 21585 21211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 21908 21561 gene locus_tag LOCUS_14430 21908 21561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 22468 21905 gene locus_tag LOCUS_14440 22468 21905 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 protein_id gnl|my_center|LOCUS_14440 22598 22912 gene locus_tag LOCUS_14450 gene rplU 22598 22912 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_14450 22938 23201 gene locus_tag LOCUS_14460 gene rpmA 22938 23201 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551972.1 protein_id gnl|my_center|LOCUS_14460 23281 24342 gene locus_tag LOCUS_14470 gene obgE 23281 24342 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_14470 24339 25460 gene locus_tag LOCUS_14480 gene proB 24339 25460 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 protein_id gnl|my_center|LOCUS_14480 26453 25506 gene locus_tag LOCUS_14490 gene ispH 26453 25506 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186453.1 protein_id gnl|my_center|LOCUS_14490 26871 26440 gene locus_tag LOCUS_14500 gene fkpB 26871 26440 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105680.1 protein_id gnl|my_center|LOCUS_14500 27419 26868 gene locus_tag LOCUS_14510 gene lspA 27419 26868 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 protein_id gnl|my_center|LOCUS_14510 30153 27388 gene locus_tag LOCUS_14520 gene ileS 30153 27388 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699451.1 protein_id gnl|my_center|LOCUS_14520 31578 30646 gene locus_tag LOCUS_14530 31578 30646 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 protein_id gnl|my_center|LOCUS_14530 33137 31635 gene locus_tag LOCUS_14540 gene murJ 33137 31635 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816533.1 protein_id gnl|my_center|LOCUS_14540 33348 33611 gene locus_tag LOCUS_14550 gene rpsT 33348 33611 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212556.1 protein_id gnl|my_center|LOCUS_14550 34003 33647 gene locus_tag LOCUS_14560 34003 33647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 34093 34641 gene locus_tag LOCUS_14570 gene ppa 34093 34641 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210169.1 protein_id gnl|my_center|LOCUS_14570 34717 35274 gene locus_tag LOCUS_14580 34717 35274 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111658546.1 protein_id gnl|my_center|LOCUS_14580 36048 35275 gene locus_tag LOCUS_14590 36048 35275 CDS product DUF3025 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527732.1 protein_id gnl|my_center|LOCUS_14590 36176 36045 gene locus_tag LOCUS_14600 36176 36045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence025 124 1110 gene locus_tag LOCUS_14610 124 1110 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037924.1 protein_id gnl|my_center|LOCUS_14610 1107 1649 gene locus_tag LOCUS_14620 1107 1649 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_14620 1646 2221 gene locus_tag LOCUS_14630 1646 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 2205 2750 gene locus_tag LOCUS_14640 gene lptA 2205 2750 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936242.1 protein_id gnl|my_center|LOCUS_14640 2747 3469 gene locus_tag LOCUS_14650 gene lptB 2747 3469 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689540.1 protein_id gnl|my_center|LOCUS_14650 3505 4902 gene locus_tag LOCUS_14660 3505 4902 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_14660 4929 5258 gene locus_tag LOCUS_14670 gene raiA 4929 5258 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815178.1 protein_id gnl|my_center|LOCUS_14670 5314 5769 gene locus_tag LOCUS_14680 gene ptsN 5314 5769 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 protein_id gnl|my_center|LOCUS_14680 5757 6767 gene locus_tag LOCUS_14690 gene hprK 5757 6767 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225452.1 protein_id gnl|my_center|LOCUS_14690 6767 7600 gene locus_tag LOCUS_14700 gene rapZ 6767 7600 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530937.1 protein_id gnl|my_center|LOCUS_14700 7597 7965 gene locus_tag LOCUS_14710 7597 7965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 7994 8485 gene locus_tag LOCUS_14720 gene eetB 7994 8485 CDS product flavin-based extracellular electron transfer system protein EetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723627.1 protein_id gnl|my_center|LOCUS_14720 8482 9081 gene locus_tag LOCUS_14730 8482 9081 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707290.1 protein_id gnl|my_center|LOCUS_14730 9583 9176 gene locus_tag LOCUS_14740 9583 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 10387 9677 gene locus_tag LOCUS_14750 10387 9677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14750 10761 10351 gene locus_tag LOCUS_14760 10761 10351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14760 10522 10552 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11548 10775 gene locus_tag LOCUS_14770 11548 10775 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097486.1 protein_id gnl|my_center|LOCUS_14770 12101 11610 gene locus_tag LOCUS_14780 12101 11610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 12722 12144 gene locus_tag LOCUS_14790 12722 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 13020 12829 gene locus_tag LOCUS_14800 13020 12829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 14289 13165 gene locus_tag LOCUS_14810 14289 13165 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196750.1 protein_id gnl|my_center|LOCUS_14810 15379 14282 gene locus_tag LOCUS_14820 gene aroB 15379 14282 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196751.1 protein_id gnl|my_center|LOCUS_14820 15711 15917 gene locus_tag LOCUS_14830 15711 15917 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217533.1 protein_id gnl|my_center|LOCUS_14830 16015 16287 gene locus_tag LOCUS_14840 gene infA 16015 16287 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201563.1 protein_id gnl|my_center|LOCUS_14840 16284 16964 gene locus_tag LOCUS_14850 16284 16964 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037565.1 protein_id gnl|my_center|LOCUS_14850 18114 17035 gene locus_tag LOCUS_14860 gene modC 18114 17035 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925958.1 protein_id gnl|my_center|LOCUS_14860 18788 18111 gene locus_tag LOCUS_14870 gene modB 18788 18111 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_14870 19602 18790 gene locus_tag LOCUS_14880 gene modA 19602 18790 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074080.1 protein_id gnl|my_center|LOCUS_14880 19984 19628 gene locus_tag LOCUS_14890 19984 19628 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206717.1 protein_id gnl|my_center|LOCUS_14890 20161 20925 gene locus_tag LOCUS_14900 gene xth 20161 20925 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546769.1 protein_id gnl|my_center|LOCUS_14900 21077 23923 gene locus_tag LOCUS_14910 21077 23923 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529996.1 protein_id gnl|my_center|LOCUS_14910 26605 24248 gene locus_tag LOCUS_14920 26605 24248 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039712.1 protein_id gnl|my_center|LOCUS_14920 26656 27207 gene locus_tag LOCUS_14930 26656 27207 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_14930 28089 27217 gene locus_tag LOCUS_14940 gene soxA 28089 27217 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965225.1 protein_id gnl|my_center|LOCUS_14940 28398 28099 gene locus_tag LOCUS_14950 gene soxX 28398 28099 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926970.1 protein_id gnl|my_center|LOCUS_14950 28424 28487 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29393 28689 gene locus_tag LOCUS_14960 gene lolD 29393 28689 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172452211.1 protein_id gnl|my_center|LOCUS_14960 30630 29386 gene locus_tag LOCUS_14970 30630 29386 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_14970 31082 30663 gene locus_tag LOCUS_14980 31082 30663 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 protein_id gnl|my_center|LOCUS_14980 31899 31114 gene locus_tag LOCUS_14990 31899 31114 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967317.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence026 747 349 gene locus_tag LOCUS_15000 747 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1867 1124 gene locus_tag LOCUS_15010 1867 1124 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044922.1 protein_id gnl|my_center|LOCUS_15010 1936 2607 gene locus_tag LOCUS_15020 1936 2607 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_15020 3044 2727 gene locus_tag LOCUS_15030 3044 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 4248 3400 gene locus_tag LOCUS_15040 4248 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 5613 4303 gene locus_tag LOCUS_15050 5613 4303 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203793.1 protein_id gnl|my_center|LOCUS_15050 7279 5648 gene locus_tag LOCUS_15060 7279 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15060 7658 7269 gene locus_tag LOCUS_15070 7658 7269 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_15070 10740 7645 gene locus_tag LOCUS_15080 10740 7645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15080 12806 10737 gene locus_tag LOCUS_15090 12806 10737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 14139 12853 gene locus_tag LOCUS_15100 14139 12853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 15272 14433 gene locus_tag LOCUS_15110 15272 14433 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032609424.1 protein_id gnl|my_center|LOCUS_15110 16086 15256 gene locus_tag LOCUS_15120 16086 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15120 19394 16041 gene locus_tag LOCUS_15130 19394 16041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 19619 24586 gene locus_tag LOCUS_15140 19619 24586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 24583 25158 gene locus_tag LOCUS_15150 24583 25158 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384488.1 protein_id gnl|my_center|LOCUS_15150 27104 25653 gene locus_tag LOCUS_15160 gene norB 27104 25653 CDS product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 protein_id gnl|my_center|LOCUS_15160 27786 27115 gene locus_tag LOCUS_15170 27786 27115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 28134 27799 gene locus_tag LOCUS_15180 28134 27799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 28382 30067 gene locus_tag LOCUS_15190 gene nirS 28382 30067 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_15190 30164 30592 gene locus_tag LOCUS_15200 30164 30592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 30589 31851 gene locus_tag LOCUS_15210 gene nirF 30589 31851 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence027 170 646 gene locus_tag LOCUS_15220 170 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 636 974 gene locus_tag LOCUS_15230 636 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 974 1228 gene locus_tag LOCUS_15240 974 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1257 1859 gene locus_tag LOCUS_15250 1257 1859 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941458.1 protein_id gnl|my_center|LOCUS_15250 1859 2332 gene locus_tag LOCUS_15260 1859 2332 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941913.1 protein_id gnl|my_center|LOCUS_15260 2988 2341 gene locus_tag LOCUS_15270 2988 2341 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813020.1 protein_id gnl|my_center|LOCUS_15270 4436 3024 gene locus_tag LOCUS_15280 gene gltX 4436 3024 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197094.1 protein_id gnl|my_center|LOCUS_15280 4591 4665 gene locus_tag LOCUS_t00200 4591 4665 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4706 5374 gene locus_tag LOCUS_15290 4706 5374 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929830.1 protein_id gnl|my_center|LOCUS_15290 5353 5700 gene locus_tag LOCUS_15300 5353 5700 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193415.1 protein_id gnl|my_center|LOCUS_15300 5701 6636 gene locus_tag LOCUS_15310 5701 6636 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 protein_id gnl|my_center|LOCUS_15310 6633 6878 gene locus_tag LOCUS_15320 6633 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 7340 6966 gene locus_tag LOCUS_15330 7340 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 7924 7454 gene locus_tag LOCUS_15340 7924 7454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 8729 7983 gene locus_tag LOCUS_15350 8729 7983 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507974.1 protein_id gnl|my_center|LOCUS_15350 9930 8746 gene locus_tag LOCUS_15360 9930 8746 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266654.1 protein_id gnl|my_center|LOCUS_15360 10533 10288 gene locus_tag LOCUS_15370 10533 10288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 10575 11102 gene locus_tag LOCUS_15380 10575 11102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 11118 12185 gene locus_tag LOCUS_15390 11118 12185 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_15390 15482 12261 gene locus_tag LOCUS_15400 15482 12261 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_15400 16831 15479 gene locus_tag LOCUS_15410 16831 15479 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222955.1 protein_id gnl|my_center|LOCUS_15410 18159 16912 gene locus_tag LOCUS_15420 18159 16912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 19898 18162 gene locus_tag LOCUS_15430 19898 18162 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 protein_id gnl|my_center|LOCUS_15430 20019 21431 gene locus_tag LOCUS_15440 20019 21431 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_15440 22256 21447 gene locus_tag LOCUS_15450 22256 21447 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_15450 22376 23593 gene locus_tag LOCUS_15460 gene patB 22376 23593 CDS product cystathionine beta-lyase PatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228854.1 protein_id gnl|my_center|LOCUS_15460 23647 24204 gene locus_tag LOCUS_15470 gene grpE 23647 24204 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 protein_id gnl|my_center|LOCUS_15470 24367 26289 gene locus_tag LOCUS_15480 gene dnaK 24367 26289 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039219.1 protein_id gnl|my_center|LOCUS_15480 26323 26679 gene locus_tag LOCUS_15490 26323 26679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 26713 27837 gene locus_tag LOCUS_15500 gene dnaJ 26713 27837 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522147.1 protein_id gnl|my_center|LOCUS_15500 28207 28668 gene locus_tag LOCUS_15510 28207 28668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 28867 30039 gene locus_tag LOCUS_15520 gene odhB 28867 30039 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930204.1 protein_id gnl|my_center|LOCUS_15520 30586 30089 gene locus_tag LOCUS_15530 30586 30089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence028 976 281 gene locus_tag LOCUS_15540 gene mtgA 976 281 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814960.1 protein_id gnl|my_center|LOCUS_15540 1779 973 gene locus_tag LOCUS_15550 gene aroE 1779 973 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194401.1 protein_id gnl|my_center|LOCUS_15550 2016 3425 gene locus_tag LOCUS_15560 gene glnA 2016 3425 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192601.1 protein_id gnl|my_center|LOCUS_15560 3550 5193 gene locus_tag LOCUS_15570 3550 5193 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942023.1 protein_id gnl|my_center|LOCUS_15570 5236 5709 gene locus_tag LOCUS_15580 5236 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 5780 7504 gene locus_tag LOCUS_15590 5780 7504 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194217.1 protein_id gnl|my_center|LOCUS_15590 7501 8157 gene locus_tag LOCUS_15600 7501 8157 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 protein_id gnl|my_center|LOCUS_15600 8079 8447 gene locus_tag LOCUS_15610 8079 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 8631 8894 gene locus_tag LOCUS_15620 8631 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 8894 9298 gene locus_tag LOCUS_15630 8894 9298 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140634.1 protein_id gnl|my_center|LOCUS_15630 9351 9581 gene locus_tag LOCUS_15640 9351 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 9562 9837 gene locus_tag LOCUS_15650 9562 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 10148 10408 gene locus_tag LOCUS_15660 10148 10408 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_15660 10363 10683 gene locus_tag LOCUS_15670 10363 10683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 11972 11109 gene locus_tag LOCUS_15680 11972 11109 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 protein_id gnl|my_center|LOCUS_15680 12781 11969 gene locus_tag LOCUS_15690 12781 11969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 13840 12959 gene locus_tag LOCUS_15700 13840 12959 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042652447.1 protein_id gnl|my_center|LOCUS_15700 14019 14903 gene locus_tag LOCUS_15710 14019 14903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 15666 16724 gene locus_tag LOCUS_15720 15666 16724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 16731 19094 gene locus_tag LOCUS_15730 16731 19094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 19585 19112 gene locus_tag LOCUS_15740 gene yhaV 19585 19112 CDS product type II toxin-antitoxin system ribonuclease toxin YhaV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347252.1 protein_id gnl|my_center|LOCUS_15740 19980 19588 gene locus_tag LOCUS_15750 19980 19588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 20840 19977 gene locus_tag LOCUS_15760 20840 19977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 21445 21690 gene locus_tag LOCUS_15770 21445 21690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 21694 21981 gene locus_tag LOCUS_15780 21694 21981 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973871.1 protein_id gnl|my_center|LOCUS_15780 21978 22223 gene locus_tag LOCUS_15790 21978 22223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 22220 22642 gene locus_tag LOCUS_15800 22220 22642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 22658 23143 gene locus_tag LOCUS_15810 22658 23143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 23295 24002 gene locus_tag LOCUS_15820 23295 24002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 23999 24127 gene locus_tag LOCUS_15830 23999 24127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 24139 24360 gene locus_tag LOCUS_15840 24139 24360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 24444 24635 gene locus_tag LOCUS_15850 24444 24635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 24632 25012 gene locus_tag LOCUS_15860 24632 25012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 25014 26714 gene locus_tag LOCUS_15870 25014 26714 CDS product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971786.1 protein_id gnl|my_center|LOCUS_15870 26638 27444 gene locus_tag LOCUS_15880 26638 27444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 27441 27629 gene locus_tag LOCUS_15890 27441 27629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 27631 27861 gene locus_tag LOCUS_15900 27631 27861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 27865 28878 gene locus_tag LOCUS_15910 27865 28878 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104854.1 protein_id gnl|my_center|LOCUS_15910 29012 28937 gene locus_tag LOCUS_t00210 29012 28937 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 29589 29119 gene locus_tag LOCUS_15920 gene ybaK 29589 29119 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229713.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence029 <1 2193 gene locus_tag LOCUS_15930 <1 2193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112465.1:diguanylate cyclase 3563 2112 gene locus_tag LOCUS_15940 3563 2112 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807338.1 protein_id gnl|my_center|LOCUS_15940 6363 4930 gene locus_tag LOCUS_15950 gene trkA 6363 4930 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_15950 6666 8474 gene locus_tag LOCUS_15960 gene kdpA 6666 8474 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185359.1 protein_id gnl|my_center|LOCUS_15960 8484 10559 gene locus_tag LOCUS_15970 gene kdpB 8484 10559 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522436.1 protein_id gnl|my_center|LOCUS_15970 10571 11143 gene locus_tag LOCUS_15980 gene kdpC 10571 11143 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186443.1 protein_id gnl|my_center|LOCUS_15980 11214 11663 gene locus_tag LOCUS_15990 gene ptsN 11214 11663 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 protein_id gnl|my_center|LOCUS_15990 11798 12106 gene locus_tag LOCUS_16000 11798 12106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 12120 12299 gene locus_tag LOCUS_16010 12120 12299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 12304 13953 gene locus_tag LOCUS_16020 12304 13953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 13950 16661 gene locus_tag LOCUS_16030 13950 16661 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526440.1 protein_id gnl|my_center|LOCUS_16030 16661 17365 gene locus_tag LOCUS_16040 gene kdpE 16661 17365 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185947.1 protein_id gnl|my_center|LOCUS_16040 18641 17382 gene locus_tag LOCUS_16050 18641 17382 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690124.1 protein_id gnl|my_center|LOCUS_16050 20798 18645 gene locus_tag LOCUS_16060 20798 18645 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807333.1 protein_id gnl|my_center|LOCUS_16060 21380 20811 gene locus_tag LOCUS_16070 21380 20811 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216221.1 protein_id gnl|my_center|LOCUS_16070 22623 21358 gene locus_tag LOCUS_16080 gene rsmB 22623 21358 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951361.1 protein_id gnl|my_center|LOCUS_16080 23811 22834 gene locus_tag LOCUS_16090 23811 22834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 23913 25283 gene locus_tag LOCUS_16100 gene mpl 23913 25283 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527766.1 protein_id gnl|my_center|LOCUS_16100 25414 26532 gene locus_tag LOCUS_16110 25414 26532 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294607.1 protein_id gnl|my_center|LOCUS_16110 26529 27281 gene locus_tag LOCUS_16120 26529 27281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 protein_id gnl|my_center|LOCUS_16120 27282 28253 gene locus_tag LOCUS_16130 27282 28253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 28359 28793 gene locus_tag LOCUS_16140 28359 28793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 28826 29383 gene locus_tag LOCUS_16150 28826 29383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194143.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence030 4 894 gene locus_tag LOCUS_16160 4 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 907 2256 gene locus_tag LOCUS_16170 gene aceF 907 2256 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063727.1 protein_id gnl|my_center|LOCUS_16170 2361 4064 gene locus_tag LOCUS_16180 gene lpdA 2361 4064 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035792.1 protein_id gnl|my_center|LOCUS_16180 4156 4434 gene locus_tag LOCUS_16190 4156 4434 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 protein_id gnl|my_center|LOCUS_16190 4444 4752 gene locus_tag LOCUS_16200 4444 4752 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103139.1 protein_id gnl|my_center|LOCUS_16200 4749 9239 gene locus_tag LOCUS_16210 4749 9239 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814813.1 protein_id gnl|my_center|LOCUS_16210 9558 9725 gene locus_tag LOCUS_16220 9558 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16220 9722 9955 gene locus_tag LOCUS_16230 9722 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 10406 9960 gene locus_tag LOCUS_16240 10406 9960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 10512 11972 gene locus_tag LOCUS_16250 gene lpdA 10512 11972 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 protein_id gnl|my_center|LOCUS_16250 12054 12371 gene locus_tag LOCUS_16260 12054 12371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 13882 12548 gene locus_tag LOCUS_16270 13882 12548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 15887 14169 gene locus_tag LOCUS_16280 15887 14169 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967240.1 protein_id gnl|my_center|LOCUS_16280 16004 16564 gene locus_tag LOCUS_16290 16004 16564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 16678 19989 gene locus_tag LOCUS_16300 16678 19989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 20036 22060 gene locus_tag LOCUS_16310 20036 22060 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038157.1 protein_id gnl|my_center|LOCUS_16310 22995 22330 gene locus_tag LOCUS_16320 22995 22330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 23247 23501 gene locus_tag LOCUS_16330 23247 23501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 23501 23878 gene locus_tag LOCUS_16340 23501 23878 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857681.1 protein_id gnl|my_center|LOCUS_16340 23897 25561 gene locus_tag LOCUS_16350 gene ettA 23897 25561 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243991.1 protein_id gnl|my_center|LOCUS_16350 25561 26082 gene locus_tag LOCUS_16360 25561 26082 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_16360 26324 26590 gene locus_tag LOCUS_16370 26324 26590 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041364541.1 protein_id gnl|my_center|LOCUS_16370 26621 26818 gene locus_tag LOCUS_16380 26621 26818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 26815 27912 gene locus_tag LOCUS_16390 26815 27912 CDS product DUF2914 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405391.1 protein_id gnl|my_center|LOCUS_16390 27909 28280 gene locus_tag LOCUS_16400 27909 28280 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence031 2716 350 gene locus_tag LOCUS_16410 2716 350 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_16410 3542 2823 gene locus_tag LOCUS_16420 3542 2823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445444.1 protein_id gnl|my_center|LOCUS_16420 4932 3604 gene locus_tag LOCUS_16430 4932 3604 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948105.1 protein_id gnl|my_center|LOCUS_16430 5872 4943 gene locus_tag LOCUS_16440 5872 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 6724 5930 gene locus_tag LOCUS_16450 6724 5930 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_16450 7647 6724 gene locus_tag LOCUS_16460 7647 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 8329 7775 gene locus_tag LOCUS_16470 8329 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 9056 8313 gene locus_tag LOCUS_16480 9056 8313 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820991.1 protein_id gnl|my_center|LOCUS_16480 9757 9053 gene locus_tag LOCUS_16490 gene aat 9757 9053 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814164.1 protein_id gnl|my_center|LOCUS_16490 10143 9754 gene locus_tag LOCUS_16500 gene gloA 10143 9754 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_16500 10891 10157 gene locus_tag LOCUS_16510 10891 10157 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 protein_id gnl|my_center|LOCUS_16510 11607 10885 gene locus_tag LOCUS_16520 11607 10885 CDS product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070759.1 protein_id gnl|my_center|LOCUS_16520 13590 11617 gene locus_tag LOCUS_16530 13590 11617 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070758.1 protein_id gnl|my_center|LOCUS_16530 14357 13587 gene locus_tag LOCUS_16540 14357 13587 CDS product fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183634.1 protein_id gnl|my_center|LOCUS_16540 15081 14380 gene locus_tag LOCUS_16550 15081 14380 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814405.1 protein_id gnl|my_center|LOCUS_16550 15631 15089 gene locus_tag LOCUS_16560 gene gmhB 15631 15089 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 protein_id gnl|my_center|LOCUS_16560 17808 15679 gene locus_tag LOCUS_16570 gene glyS 17808 15679 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189008.1 protein_id gnl|my_center|LOCUS_16570 18840 17911 gene locus_tag LOCUS_16580 gene glyQ 18840 17911 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189444.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence032 195 629 gene locus_tag LOCUS_16590 195 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 1124 633 gene locus_tag LOCUS_16600 1124 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1657 1178 gene locus_tag LOCUS_16610 gene ispF 1657 1178 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_16610 2094 1654 gene locus_tag LOCUS_16620 2094 1654 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090444.1 protein_id gnl|my_center|LOCUS_16620 2140 2487 gene locus_tag LOCUS_16630 2140 2487 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067705.1 protein_id gnl|my_center|LOCUS_16630 2531 3664 gene locus_tag LOCUS_16640 gene dapE 2531 3664 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521179.1 protein_id gnl|my_center|LOCUS_16640 3657 4547 gene locus_tag LOCUS_16650 gene prmB 3657 4547 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235090.1 protein_id gnl|my_center|LOCUS_16650 4611 5297 gene locus_tag LOCUS_16660 4611 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 5319 5807 gene locus_tag LOCUS_16670 5319 5807 CDS product retropepsin-like aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947723.1 protein_id gnl|my_center|LOCUS_16670 6737 5823 gene locus_tag LOCUS_16680 6737 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16680 7415 6789 gene locus_tag LOCUS_16690 7415 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 8346 7480 gene locus_tag LOCUS_16700 8346 7480 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_16700 9430 8408 gene locus_tag LOCUS_16710 9430 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16710 11922 9391 gene locus_tag LOCUS_16720 11922 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16720 9626 9638 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12950 12009 gene locus_tag LOCUS_16730 12950 12009 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225965.1 protein_id gnl|my_center|LOCUS_16730 13411 16140 gene locus_tag LOCUS_16740 13411 16140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 16665 16186 gene locus_tag LOCUS_16750 16665 16186 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_16750 18598 16667 gene locus_tag LOCUS_16760 gene uvrB 18598 16667 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199587.1 protein_id gnl|my_center|LOCUS_16760 18765 19955 gene locus_tag LOCUS_16770 18765 19955 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_16770 20010 20085 gene locus_tag LOCUS_t00220 20010 20085 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 20209 21357 gene locus_tag LOCUS_16780 20209 21357 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083692.1 protein_id gnl|my_center|LOCUS_16780 21601 23250 gene locus_tag LOCUS_16790 21601 23250 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384751.1 protein_id gnl|my_center|LOCUS_16790 23424 24617 gene locus_tag LOCUS_16800 23424 24617 CDS product TIGR03790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009545347.1 protein_id gnl|my_center|LOCUS_16800 25021 25368 gene locus_tag LOCUS_16810 25021 25368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 25365 26624 gene locus_tag LOCUS_16820 25365 26624 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268088.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence033 1245 598 gene locus_tag LOCUS_16830 1245 598 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705587.1 protein_id gnl|my_center|LOCUS_16830 3082 1364 gene locus_tag LOCUS_16840 3082 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 4998 3061 gene locus_tag LOCUS_16850 4998 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16850 5863 5024 gene locus_tag LOCUS_16860 5863 5024 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118789.1 protein_id gnl|my_center|LOCUS_16860 6782 5958 gene locus_tag LOCUS_16870 gene dapD 6782 5958 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 protein_id gnl|my_center|LOCUS_16870 7089 6811 gene locus_tag LOCUS_16880 7089 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 8297 7104 gene locus_tag LOCUS_16890 gene dapC 8297 7104 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198896.1 protein_id gnl|my_center|LOCUS_16890 8359 9246 gene locus_tag LOCUS_16900 8359 9246 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_16900 9239 9610 gene locus_tag LOCUS_16910 9239 9610 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057535.1 protein_id gnl|my_center|LOCUS_16910 9730 12255 gene locus_tag LOCUS_16920 9730 12255 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022951227.1 protein_id gnl|my_center|LOCUS_16920 12619 13485 gene locus_tag LOCUS_16930 12619 13485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 13730 14701 gene locus_tag LOCUS_16940 13730 14701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143461.1 protein_id gnl|my_center|LOCUS_16940 14698 15963 gene locus_tag LOCUS_16950 14698 15963 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099434.1 protein_id gnl|my_center|LOCUS_16950 16552 15992 gene locus_tag LOCUS_16960 16552 15992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 17935 16655 gene locus_tag LOCUS_16970 17935 16655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 19241 17976 gene locus_tag LOCUS_16980 19241 17976 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706047.1 protein_id gnl|my_center|LOCUS_16980 20975 19251 gene locus_tag LOCUS_16990 20975 19251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 <26571 20972 gene locus_tag LOCUS_17000 <26571 20972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706045.1:PAS domain S-box protein >Feature sequence034 392 1843 gene locus_tag LOCUS_17010 392 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1862 2911 gene locus_tag LOCUS_17020 1862 2911 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_17020 2908 3588 gene locus_tag LOCUS_17030 2908 3588 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020708.1 protein_id gnl|my_center|LOCUS_17030 3715 4377 gene locus_tag LOCUS_17040 3715 4377 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869098.1 protein_id gnl|my_center|LOCUS_17040 4370 4957 gene locus_tag LOCUS_17050 gene rsxA 4370 4957 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366851.1 protein_id gnl|my_center|LOCUS_17050 5031 5219 gene locus_tag LOCUS_17060 5031 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 5281 7080 gene locus_tag LOCUS_17070 gene recQ 5281 7080 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_17070 8898 7096 gene locus_tag LOCUS_17080 8898 7096 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_17080 11117 8955 gene locus_tag LOCUS_17090 11117 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 13070 11151 gene locus_tag LOCUS_17100 13070 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 13789 13295 gene locus_tag LOCUS_17110 gene yjgA 13789 13295 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522378.1 protein_id gnl|my_center|LOCUS_17110 13849 15228 gene locus_tag LOCUS_17120 gene pmbA 13849 15228 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188997.1 protein_id gnl|my_center|LOCUS_17120 15232 15852 gene locus_tag LOCUS_17130 15232 15852 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220465.1 protein_id gnl|my_center|LOCUS_17130 15854 16393 gene locus_tag LOCUS_17140 15854 16393 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227767.1 protein_id gnl|my_center|LOCUS_17140 16390 17790 gene locus_tag LOCUS_17150 16390 17790 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173616429.1 protein_id gnl|my_center|LOCUS_17150 17870 18604 gene locus_tag LOCUS_17160 17870 18604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 18726 19070 gene locus_tag LOCUS_17170 18726 19070 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 protein_id gnl|my_center|LOCUS_17170 19913 19089 gene locus_tag LOCUS_17180 19913 19089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17180 20539 19913 gene locus_tag LOCUS_17190 20539 19913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17190 21709 20627 gene locus_tag LOCUS_17200 21709 20627 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_17200 22183 21743 gene locus_tag LOCUS_17210 22183 21743 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_17210 23376 22237 gene locus_tag LOCUS_17220 23376 22237 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535743.1 protein_id gnl|my_center|LOCUS_17220 23449 23910 gene locus_tag LOCUS_17230 gene bcp 23449 23910 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_17230 23911 24396 gene locus_tag LOCUS_17240 23911 24396 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_17240 24454 25419 gene locus_tag LOCUS_17250 24454 25419 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193249.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence035 43 1140 gene locus_tag LOCUS_17260 gene ppk2 43 1140 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121626.1 protein_id gnl|my_center|LOCUS_17260 1863 1312 gene locus_tag LOCUS_17270 1863 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 2422 1883 gene locus_tag LOCUS_17280 2422 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 3145 2486 gene locus_tag LOCUS_17290 gene agmR 3145 2486 CDS product response regulator AgmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107754.1 protein_id gnl|my_center|LOCUS_17290 4014 3178 gene locus_tag LOCUS_17300 gene metF 4014 3178 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_17300 5081 4047 gene locus_tag LOCUS_17310 5081 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 6765 5272 gene locus_tag LOCUS_17320 6765 5272 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224914.1 protein_id gnl|my_center|LOCUS_17320 7773 6868 gene locus_tag LOCUS_17330 7773 6868 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815026.1 protein_id gnl|my_center|LOCUS_17330 8206 7781 gene locus_tag LOCUS_17340 8206 7781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 9365 8265 gene locus_tag LOCUS_17350 9365 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 9958 9530 gene locus_tag LOCUS_17360 9958 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 10171 10701 gene locus_tag LOCUS_17370 10171 10701 CDS product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707298.1 protein_id gnl|my_center|LOCUS_17370 10715 11413 gene locus_tag LOCUS_17380 10715 11413 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 protein_id gnl|my_center|LOCUS_17380 11410 12051 gene locus_tag LOCUS_17390 11410 12051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17390 12097 12672 gene locus_tag LOCUS_17400 12097 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17400 12680 13252 gene locus_tag LOCUS_17410 12680 13252 CDS product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769001.1 protein_id gnl|my_center|LOCUS_17410 13928 14305 gene locus_tag LOCUS_17420 13928 14305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 14411 14869 gene locus_tag LOCUS_17430 14411 14869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 15011 15235 gene locus_tag LOCUS_17440 15011 15235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 15949 16272 gene locus_tag LOCUS_17450 15949 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 16336 16752 gene locus_tag LOCUS_17460 16336 16752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 16968 17228 gene locus_tag LOCUS_17470 16968 17228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 17345 17626 gene locus_tag LOCUS_17480 17345 17626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 17657 17989 gene locus_tag LOCUS_17490 17657 17989 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941369.1 protein_id gnl|my_center|LOCUS_17490 18344 18087 gene locus_tag LOCUS_17500 18344 18087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 18666 19136 gene locus_tag LOCUS_17510 18666 19136 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926836.1 protein_id gnl|my_center|LOCUS_17510 19246 20034 gene locus_tag LOCUS_17520 19246 20034 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970721.1 protein_id gnl|my_center|LOCUS_17520 20385 20056 gene locus_tag LOCUS_17530 20385 20056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 20615 20385 gene locus_tag LOCUS_17540 20615 20385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 21896 20667 gene locus_tag LOCUS_17550 gene argJ 21896 20667 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202972.1 protein_id gnl|my_center|LOCUS_17550 23559 21916 gene locus_tag LOCUS_17560 23559 21916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 23842 23543 gene locus_tag LOCUS_17570 23842 23543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 23938 24531 gene locus_tag LOCUS_17580 23938 24531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 26184 24631 gene locus_tag LOCUS_17590 26184 24631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence036 <1 1037 gene locus_tag LOCUS_17600 <1 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942384.1:indolepyruvate ferredoxin oxidoreductase subunit alpha 1164 1658 gene locus_tag LOCUS_17610 1164 1658 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_17610 1673 3007 gene locus_tag LOCUS_17620 1673 3007 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_17620 3180 3605 gene locus_tag LOCUS_17630 3180 3605 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938903.1 protein_id gnl|my_center|LOCUS_17630 3640 4968 gene locus_tag LOCUS_17640 3640 4968 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_17640 5083 5445 gene locus_tag LOCUS_17650 gene paaI 5083 5445 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228333.1 protein_id gnl|my_center|LOCUS_17650 5582 5839 gene locus_tag LOCUS_17660 5582 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 5937 6152 gene locus_tag LOCUS_17670 5937 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 6418 6717 gene locus_tag LOCUS_17680 6418 6717 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_17680 7321 7085 gene locus_tag LOCUS_17690 7321 7085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 7232 7729 gene locus_tag LOCUS_17700 7232 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 7819 8247 gene locus_tag LOCUS_17710 7819 8247 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090283.1 protein_id gnl|my_center|LOCUS_17710 8854 8327 gene locus_tag LOCUS_17720 8854 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 9022 9438 gene locus_tag LOCUS_17730 9022 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 9636 10049 gene locus_tag LOCUS_17740 9636 10049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 10155 10640 gene locus_tag LOCUS_17750 10155 10640 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036604.1 protein_id gnl|my_center|LOCUS_17750 11087 10689 gene locus_tag LOCUS_17760 11087 10689 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_17760 11317 11084 gene locus_tag LOCUS_17770 11317 11084 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528289.1 protein_id gnl|my_center|LOCUS_17770 11856 11476 gene locus_tag LOCUS_17780 11856 11476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 12098 11868 gene locus_tag LOCUS_17790 12098 11868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 12679 12110 gene locus_tag LOCUS_17800 12679 12110 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073017.1 protein_id gnl|my_center|LOCUS_17800 13233 12688 gene locus_tag LOCUS_17810 13233 12688 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094859.1 protein_id gnl|my_center|LOCUS_17810 14513 13227 gene locus_tag LOCUS_17820 14513 13227 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036521.1 protein_id gnl|my_center|LOCUS_17820 15286 14510 gene locus_tag LOCUS_17830 15286 14510 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275405.1 protein_id gnl|my_center|LOCUS_17830 16529 15255 gene locus_tag LOCUS_17840 16529 15255 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_17840 17062 16526 gene locus_tag LOCUS_17850 17062 16526 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039192.1 protein_id gnl|my_center|LOCUS_17850 17701 17072 gene locus_tag LOCUS_17860 17701 17072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 18495 17698 gene locus_tag LOCUS_17870 18495 17698 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920946.1 protein_id gnl|my_center|LOCUS_17870 19052 18492 gene locus_tag LOCUS_17880 19052 18492 CDS product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942967.1 protein_id gnl|my_center|LOCUS_17880 20110 19049 gene locus_tag LOCUS_17890 20110 19049 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044885.1 protein_id gnl|my_center|LOCUS_17890 20305 20123 gene locus_tag LOCUS_17900 20305 20123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 20933 20316 gene locus_tag LOCUS_17910 20933 20316 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036687.1 protein_id gnl|my_center|LOCUS_17910 21019 21942 gene locus_tag LOCUS_17920 gene carH 21019 21942 CDS product HTH-type transcriptional repressor CarH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229194.1 protein_id gnl|my_center|LOCUS_17920 21953 22735 gene locus_tag LOCUS_17930 21953 22735 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225376.1 protein_id gnl|my_center|LOCUS_17930 23581 22742 gene locus_tag LOCUS_17940 23581 22742 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336944.1 protein_id gnl|my_center|LOCUS_17940 24320 23616 gene locus_tag LOCUS_17950 24320 23616 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918816.1 protein_id gnl|my_center|LOCUS_17950 25530 24313 gene locus_tag LOCUS_17960 25530 24313 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963567.1 protein_id gnl|my_center|LOCUS_17960 <26180 25540 gene locus_tag LOCUS_17970 <26180 25540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162494103.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence037 2693 1461 gene locus_tag LOCUS_17980 2693 1461 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626230.1 protein_id gnl|my_center|LOCUS_17980 3298 2693 gene locus_tag LOCUS_17990 3298 2693 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855670.1 protein_id gnl|my_center|LOCUS_17990 3831 3295 gene locus_tag LOCUS_18000 3831 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 4643 4023 gene locus_tag LOCUS_18010 4643 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 4684 5871 gene locus_tag LOCUS_18020 4684 5871 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933556.1 protein_id gnl|my_center|LOCUS_18020 5894 6442 gene locus_tag LOCUS_18030 5894 6442 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_18030 6484 6921 gene locus_tag LOCUS_18040 6484 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 7812 6946 gene locus_tag LOCUS_18050 gene rsgA 7812 6946 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550124.1 protein_id gnl|my_center|LOCUS_18050 8194 7850 gene locus_tag LOCUS_18060 8194 7850 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947715.1 protein_id gnl|my_center|LOCUS_18060 8590 8285 gene locus_tag LOCUS_18070 8590 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 9869 8601 gene locus_tag LOCUS_18080 9869 8601 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_18080 9946 10497 gene locus_tag LOCUS_18090 gene orn 9946 10497 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813303.1 protein_id gnl|my_center|LOCUS_18090 10710 13106 gene locus_tag LOCUS_18100 10710 13106 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888825.1 protein_id gnl|my_center|LOCUS_18100 13206 13526 gene locus_tag LOCUS_18110 gene crcB 13206 13526 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208262.1 protein_id gnl|my_center|LOCUS_18110 13529 13852 gene locus_tag LOCUS_18120 13529 13852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 13929 15569 gene locus_tag LOCUS_18130 13929 15569 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 protein_id gnl|my_center|LOCUS_18130 15566 16405 gene locus_tag LOCUS_18140 gene kdsA 15566 16405 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193658.1 protein_id gnl|my_center|LOCUS_18140 16450 17733 gene locus_tag LOCUS_18150 gene eno 16450 17733 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065136.1 protein_id gnl|my_center|LOCUS_18150 17735 18040 gene locus_tag LOCUS_18160 gene ftsB 17735 18040 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065137.1 protein_id gnl|my_center|LOCUS_18160 18037 19401 gene locus_tag LOCUS_18170 18037 19401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 19412 21454 gene locus_tag LOCUS_18180 gene ligA 19412 21454 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937986.1 protein_id gnl|my_center|LOCUS_18180 21573 22463 gene locus_tag LOCUS_18190 gene galU 21573 22463 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_18190 23212 22460 gene locus_tag LOCUS_18200 23212 22460 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225227.1 protein_id gnl|my_center|LOCUS_18200 23274 23344 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24726 23407 gene locus_tag LOCUS_18210 gene hpnE 24726 23407 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040124.1 protein_id gnl|my_center|LOCUS_18210 25541 24693 gene locus_tag LOCUS_18220 gene hpnD 25541 24693 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence038 795 1871 gene locus_tag LOCUS_18230 795 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1868 2245 gene locus_tag LOCUS_18240 1868 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 3307 2246 gene locus_tag LOCUS_18250 3307 2246 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083628.1 protein_id gnl|my_center|LOCUS_18250 3458 3736 gene locus_tag LOCUS_18260 3458 3736 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_18260 3746 4051 gene locus_tag LOCUS_18270 3746 4051 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_18270 4241 5629 gene locus_tag LOCUS_18280 4241 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 5895 5644 gene locus_tag LOCUS_18290 5895 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18290 6706 5864 gene locus_tag LOCUS_18300 6706 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18300 7259 6795 gene locus_tag LOCUS_18310 7259 6795 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 protein_id gnl|my_center|LOCUS_18310 7615 7343 gene locus_tag LOCUS_18320 7615 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 8944 7631 gene locus_tag LOCUS_18330 gene rimO 8944 7631 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705268.1 protein_id gnl|my_center|LOCUS_18330 9787 8963 gene locus_tag LOCUS_18340 9787 8963 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223919.1 protein_id gnl|my_center|LOCUS_18340 10613 9813 gene locus_tag LOCUS_18350 10613 9813 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_18350 11492 10659 gene locus_tag LOCUS_18360 gene pgeF 11492 10659 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112833.1 protein_id gnl|my_center|LOCUS_18360 12417 11482 gene locus_tag LOCUS_18370 12417 11482 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203970.1 protein_id gnl|my_center|LOCUS_18370 12562 13296 gene locus_tag LOCUS_18380 12562 13296 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193722.1 protein_id gnl|my_center|LOCUS_18380 13404 15572 gene locus_tag LOCUS_18390 13404 15572 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193103.1 protein_id gnl|my_center|LOCUS_18390 15670 16128 gene locus_tag LOCUS_18400 15670 16128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 16826 16143 gene locus_tag LOCUS_18410 gene ispD 16826 16143 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092359.1 protein_id gnl|my_center|LOCUS_18410 16900 17712 gene locus_tag LOCUS_18420 gene amrB 16900 17712 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_18420 17702 18271 gene locus_tag LOCUS_18430 17702 18271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 18608 19381 gene locus_tag LOCUS_18440 18608 19381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18440 19677 19435 gene locus_tag LOCUS_18450 19677 19435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 19942 20787 gene locus_tag LOCUS_18460 19942 20787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 20805 20975 gene locus_tag LOCUS_18470 20805 20975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 21497 21048 gene locus_tag LOCUS_18480 21497 21048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 24255 21514 gene locus_tag LOCUS_18490 gene napA 24255 21514 CDS product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852404.1 protein_id gnl|my_center|LOCUS_18490 24767 24525 gene locus_tag LOCUS_18500 24767 24525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 25604 24909 gene locus_tag LOCUS_18510 25604 24909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence039 1934 1973 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1984 2646 gene locus_tag LOCUS_18520 1984 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 2778 3095 gene locus_tag LOCUS_18530 gene yajC 2778 3095 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947718.1 protein_id gnl|my_center|LOCUS_18530 3200 5029 gene locus_tag LOCUS_18540 gene secD 3200 5029 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064324.1 protein_id gnl|my_center|LOCUS_18540 5043 5975 gene locus_tag LOCUS_18550 gene secF 5043 5975 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064325.1 protein_id gnl|my_center|LOCUS_18550 6069 6947 gene locus_tag LOCUS_18560 6069 6947 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857952.1 protein_id gnl|my_center|LOCUS_18560 6978 7556 gene locus_tag LOCUS_18570 6978 7556 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_18570 7715 8134 gene locus_tag LOCUS_18580 7715 8134 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_18580 8229 9563 gene locus_tag LOCUS_18590 8229 9563 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_18590 9560 10168 gene locus_tag LOCUS_18600 9560 10168 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_18600 10217 10804 gene locus_tag LOCUS_18610 10217 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 11398 11096 gene locus_tag LOCUS_18620 11398 11096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 11289 13121 gene locus_tag LOCUS_18630 11289 13121 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815090.1 protein_id gnl|my_center|LOCUS_18630 13253 13825 gene locus_tag LOCUS_18640 13253 13825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038181.1 protein_id gnl|my_center|LOCUS_18640 13832 14602 gene locus_tag LOCUS_18650 gene kdsB 13832 14602 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185994.1 protein_id gnl|my_center|LOCUS_18650 14709 16856 gene locus_tag LOCUS_18660 14709 16856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 17079 17234 gene locus_tag LOCUS_18670 17079 17234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 17421 17744 gene locus_tag LOCUS_18680 17421 17744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 17741 18226 gene locus_tag LOCUS_18690 17741 18226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 18226 18456 gene locus_tag LOCUS_18700 18226 18456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 18846 18463 gene locus_tag LOCUS_18710 18846 18463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 18978 19385 gene locus_tag LOCUS_18720 18978 19385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 19650 20657 gene locus_tag LOCUS_18730 19650 20657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 20716 21972 gene locus_tag LOCUS_18740 20716 21972 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_18740 22034 22252 gene locus_tag LOCUS_18750 22034 22252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 22364 24436 gene locus_tag LOCUS_18760 22364 24436 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence040 3 470 gene locus_tag LOCUS_18770 3 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 607 1536 gene locus_tag LOCUS_18780 607 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1527 3254 gene locus_tag LOCUS_18790 1527 3254 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414375.1 protein_id gnl|my_center|LOCUS_18790 3316 4053 gene locus_tag LOCUS_18800 3316 4053 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168989238.1 protein_id gnl|my_center|LOCUS_18800 4301 4810 gene locus_tag LOCUS_18810 4301 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 4807 5091 gene locus_tag LOCUS_18820 4807 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 5078 5425 gene locus_tag LOCUS_18830 5078 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 5422 5676 gene locus_tag LOCUS_18840 5422 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 5673 6368 gene locus_tag LOCUS_18850 5673 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 6365 6643 gene locus_tag LOCUS_18860 6365 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 6636 8075 gene locus_tag LOCUS_18870 6636 8075 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090055.1 protein_id gnl|my_center|LOCUS_18870 8072 10765 gene locus_tag LOCUS_18880 8072 10765 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_18880 10823 11107 gene locus_tag LOCUS_18890 10823 11107 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045668639.1 protein_id gnl|my_center|LOCUS_18890 11104 11460 gene locus_tag LOCUS_18900 11104 11460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 11853 13364 gene locus_tag LOCUS_18910 11853 13364 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902375.1 protein_id gnl|my_center|LOCUS_18910 13415 13858 gene locus_tag LOCUS_18920 13415 13858 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 protein_id gnl|my_center|LOCUS_18920 13855 14505 gene locus_tag LOCUS_18930 13855 14505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 14519 15595 gene locus_tag LOCUS_18940 14519 15595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 15592 16425 gene locus_tag LOCUS_18950 15592 16425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 16422 16856 gene locus_tag LOCUS_18960 16422 16856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 17038 18321 gene locus_tag LOCUS_18970 gene nhaD 17038 18321 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_18970 18482 21295 gene locus_tag LOCUS_18980 18482 21295 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 protein_id gnl|my_center|LOCUS_18980 21295 21624 gene locus_tag LOCUS_18990 21295 21624 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 protein_id gnl|my_center|LOCUS_18990 21653 23152 gene locus_tag LOCUS_19000 21653 23152 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 protein_id gnl|my_center|LOCUS_19000 23149 23643 gene locus_tag LOCUS_19010 23149 23643 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 protein_id gnl|my_center|LOCUS_19010 23637 23906 gene locus_tag LOCUS_19020 23637 23906 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 protein_id gnl|my_center|LOCUS_19020 23917 24282 gene locus_tag LOCUS_19030 23917 24282 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082083.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence041 700 437 gene locus_tag LOCUS_19040 700 437 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256445.1 protein_id gnl|my_center|LOCUS_19040 1614 910 gene locus_tag LOCUS_19050 1614 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 3507 1618 gene locus_tag LOCUS_19060 3507 1618 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269181.1 protein_id gnl|my_center|LOCUS_19060 4891 3593 gene locus_tag LOCUS_19070 4891 3593 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526222.1 protein_id gnl|my_center|LOCUS_19070 5583 4888 gene locus_tag LOCUS_19080 5583 4888 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_19080 5904 5674 gene locus_tag LOCUS_19090 5904 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 8104 6068 gene locus_tag LOCUS_19100 8104 6068 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941729.1 protein_id gnl|my_center|LOCUS_19100 8501 8184 gene locus_tag LOCUS_19110 8501 8184 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942988.1 protein_id gnl|my_center|LOCUS_19110 8825 9481 gene locus_tag LOCUS_19120 8825 9481 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812762.1 protein_id gnl|my_center|LOCUS_19120 9498 9950 gene locus_tag LOCUS_19130 gene moaE 9498 9950 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535771.1 protein_id gnl|my_center|LOCUS_19130 11441 9957 gene locus_tag LOCUS_19140 11441 9957 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943374.1 protein_id gnl|my_center|LOCUS_19140 14302 11522 gene locus_tag LOCUS_19150 gene polA 14302 11522 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190446.1 protein_id gnl|my_center|LOCUS_19150 14388 15116 gene locus_tag LOCUS_19160 14388 15116 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_19160 15166 15498 gene locus_tag LOCUS_19170 15166 15498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 15558 16304 gene locus_tag LOCUS_19180 15558 16304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 16301 16789 gene locus_tag LOCUS_19190 16301 16789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 16908 17762 gene locus_tag LOCUS_19200 16908 17762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 17486 17543 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18100 17648 gene locus_tag LOCUS_19210 18100 17648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 18196 19533 gene locus_tag LOCUS_19220 gene hslU 18196 19533 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707776.1 protein_id gnl|my_center|LOCUS_19220 19633 21483 gene locus_tag LOCUS_19230 19633 21483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 21617 22750 gene locus_tag LOCUS_19240 gene flhB 21617 22750 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063731.1 protein_id gnl|my_center|LOCUS_19240 22824 24905 gene locus_tag LOCUS_19250 gene flhA 22824 24905 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198639.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence042 <1 1179 gene locus_tag LOCUS_19260 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044884.1:PAS domain S-box protein 1079 1834 gene locus_tag LOCUS_19270 1079 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 1922 3205 gene locus_tag LOCUS_19280 gene serS 1922 3205 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 protein_id gnl|my_center|LOCUS_19280 4498 3227 gene locus_tag LOCUS_19290 gene mltF 4498 3227 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104806.1 protein_id gnl|my_center|LOCUS_19290 4687 4778 gene locus_tag LOCUS_t00230 4687 4778 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4907 5863 gene locus_tag LOCUS_19300 4907 5863 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812176.1 protein_id gnl|my_center|LOCUS_19300 5976 6452 gene locus_tag LOCUS_19310 5976 6452 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395796.1 protein_id gnl|my_center|LOCUS_19310 6458 7402 gene locus_tag LOCUS_19320 6458 7402 CDS product histidine decarboxylase, pyruvoyl type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786245.1 protein_id gnl|my_center|LOCUS_19320 9029 7383 gene locus_tag LOCUS_19330 gene ade 9029 7383 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118829317.1 protein_id gnl|my_center|LOCUS_19330 9201 9602 gene locus_tag LOCUS_19340 9201 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 10354 9680 gene locus_tag LOCUS_19350 10354 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 12865 10460 gene locus_tag LOCUS_19360 gene lon 12865 10460 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101982.1 protein_id gnl|my_center|LOCUS_19360 14130 12928 gene locus_tag LOCUS_19370 14130 12928 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_19370 14364 14149 gene locus_tag LOCUS_19380 14364 14149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 15085 14381 gene locus_tag LOCUS_19390 15085 14381 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_19390 15716 15090 gene locus_tag LOCUS_19400 15716 15090 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229052.1 protein_id gnl|my_center|LOCUS_19400 16540 15710 gene locus_tag LOCUS_19410 16540 15710 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_19410 16649 17254 gene locus_tag LOCUS_19420 16649 17254 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 protein_id gnl|my_center|LOCUS_19420 17251 17556 gene locus_tag LOCUS_19430 17251 17556 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404138.1 protein_id gnl|my_center|LOCUS_19430 17574 17819 gene locus_tag LOCUS_19440 17574 17819 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813873.1 protein_id gnl|my_center|LOCUS_19440 17897 18703 gene locus_tag LOCUS_19450 17897 18703 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527206.1 protein_id gnl|my_center|LOCUS_19450 19256 18747 gene locus_tag LOCUS_19460 19256 18747 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 protein_id gnl|my_center|LOCUS_19460 20111 19269 gene locus_tag LOCUS_19470 20111 19269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 20233 21804 gene locus_tag LOCUS_19480 20233 21804 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056336.1 protein_id gnl|my_center|LOCUS_19480 21886 23832 gene locus_tag LOCUS_19490 21886 23832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 >Feature sequence043 275 1705 gene locus_tag LOCUS_19500 gene glgA 275 1705 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389900.1 protein_id gnl|my_center|LOCUS_19500 2185 1718 gene locus_tag LOCUS_19510 2185 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 4295 2301 gene locus_tag LOCUS_19520 gene htpG 4295 2301 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929604.1 protein_id gnl|my_center|LOCUS_19520 5103 4303 gene locus_tag LOCUS_19530 gene dapB 5103 4303 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689993.1 protein_id gnl|my_center|LOCUS_19530 5489 5100 gene locus_tag LOCUS_19540 5489 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 5591 6016 gene locus_tag LOCUS_19550 gene fur 5591 6016 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_19550 7731 6013 gene locus_tag LOCUS_19560 gene recN 7731 6013 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194023.1 protein_id gnl|my_center|LOCUS_19560 8695 7823 gene locus_tag LOCUS_19570 8695 7823 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533590.1 protein_id gnl|my_center|LOCUS_19570 8723 9778 gene locus_tag LOCUS_19580 gene hrcA 8723 9778 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 protein_id gnl|my_center|LOCUS_19580 9886 10992 gene locus_tag LOCUS_19590 gene hemH 9886 10992 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527679.1 protein_id gnl|my_center|LOCUS_19590 11242 11544 gene locus_tag LOCUS_19600 11242 11544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 11566 12933 gene locus_tag LOCUS_19610 11566 12933 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_19610 14432 12990 gene locus_tag LOCUS_19620 14432 12990 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521883.1 protein_id gnl|my_center|LOCUS_19620 16225 14513 gene locus_tag LOCUS_19630 16225 14513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 17162 16401 gene locus_tag LOCUS_19640 17162 16401 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_19640 19374 17173 gene locus_tag LOCUS_19650 19374 17173 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444419.1 protein_id gnl|my_center|LOCUS_19650 20358 19396 gene locus_tag LOCUS_19660 20358 19396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 20903 20355 gene locus_tag LOCUS_19670 20903 20355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 20986 21780 gene locus_tag LOCUS_19680 20986 21780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 21777 22229 gene locus_tag LOCUS_19690 21777 22229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 22199 23221 gene locus_tag LOCUS_19700 22199 23221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence044 710 354 gene locus_tag LOCUS_19710 710 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 1362 976 gene locus_tag LOCUS_19720 gene flaF 1362 976 CDS product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626463.1 protein_id gnl|my_center|LOCUS_19720 1741 1343 gene locus_tag LOCUS_19730 gene flbT 1741 1343 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088588.1 protein_id gnl|my_center|LOCUS_19730 2370 1753 gene locus_tag LOCUS_19740 2370 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 2912 2538 gene locus_tag LOCUS_19750 2912 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19750 3394 2840 gene locus_tag LOCUS_19760 3394 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19760 4762 3638 gene locus_tag LOCUS_19770 4762 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 9490 4862 gene locus_tag LOCUS_19780 9490 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 9945 9571 gene locus_tag LOCUS_19790 9945 9571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 10590 10216 gene locus_tag LOCUS_19800 10590 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19800 10946 10518 gene locus_tag LOCUS_19810 10946 10518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 11558 11301 gene locus_tag LOCUS_19820 11558 11301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 11496 11741 gene locus_tag LOCUS_19830 gene hfq 11496 11741 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810707.1 protein_id gnl|my_center|LOCUS_19830 12347 11880 gene locus_tag LOCUS_19840 12347 11880 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891887.1 protein_id gnl|my_center|LOCUS_19840 13261 12344 gene locus_tag LOCUS_19850 gene napH 13261 12344 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462914.1 protein_id gnl|my_center|LOCUS_19850 14052 13258 gene locus_tag LOCUS_19860 gene napG 14052 13258 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091291.1 protein_id gnl|my_center|LOCUS_19860 16922 14154 gene locus_tag LOCUS_19870 gene napA 16922 14154 CDS product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852404.1 protein_id gnl|my_center|LOCUS_19870 17264 16941 gene locus_tag LOCUS_19880 17264 16941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 17400 18086 gene locus_tag LOCUS_19890 17400 18086 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191689.1 protein_id gnl|my_center|LOCUS_19890 19265 18087 gene locus_tag LOCUS_19900 19265 18087 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 protein_id gnl|my_center|LOCUS_19900 20773 19262 gene locus_tag LOCUS_19910 gene purF 20773 19262 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525195.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence045 <1 1166 gene locus_tag LOCUS_19920 <1 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204961.1:FtsX-like permease family protein 1266 2498 gene locus_tag LOCUS_19930 1266 2498 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_19930 3352 2513 gene locus_tag LOCUS_19940 3352 2513 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402256.1 protein_id gnl|my_center|LOCUS_19940 3532 5811 gene locus_tag LOCUS_19950 3532 5811 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_19950 5808 6584 gene locus_tag LOCUS_19960 5808 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 8043 6571 gene locus_tag LOCUS_19970 8043 6571 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107284302.1 protein_id gnl|my_center|LOCUS_19970 8514 8119 gene locus_tag LOCUS_19980 8514 8119 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_19980 8732 8514 gene locus_tag LOCUS_19990 8732 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 10586 8889 gene locus_tag LOCUS_20000 10586 8889 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225531.1 protein_id gnl|my_center|LOCUS_20000 11469 10603 gene locus_tag LOCUS_20010 11469 10603 CDS product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189141.1 protein_id gnl|my_center|LOCUS_20010 12311 11607 gene locus_tag LOCUS_20020 12311 11607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 12494 13330 gene locus_tag LOCUS_20030 12494 13330 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816840.1 protein_id gnl|my_center|LOCUS_20030 13327 13887 gene locus_tag LOCUS_20040 13327 13887 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390014.1 protein_id gnl|my_center|LOCUS_20040 14809 13865 gene locus_tag LOCUS_20050 14809 13865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 15392 14844 gene locus_tag LOCUS_20060 15392 14844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 16380 15418 gene locus_tag LOCUS_20070 16380 15418 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037478.1 protein_id gnl|my_center|LOCUS_20070 18553 16385 gene locus_tag LOCUS_20080 gene glgB 18553 16385 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_20080 18858 20144 gene locus_tag LOCUS_20090 gene glgC 18858 20144 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence046 217 1353 gene locus_tag LOCUS_20100 gene carA 217 1353 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706536.1 protein_id gnl|my_center|LOCUS_20100 1346 4561 gene locus_tag LOCUS_20110 gene carB 1346 4561 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809588.1 protein_id gnl|my_center|LOCUS_20110 4582 5058 gene locus_tag LOCUS_20120 gene greA 4582 5058 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192392.1 protein_id gnl|my_center|LOCUS_20120 5058 5513 gene locus_tag LOCUS_20130 5058 5513 CDS product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688914.1 protein_id gnl|my_center|LOCUS_20130 5822 5505 gene locus_tag LOCUS_20140 5822 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 5856 6503 gene locus_tag LOCUS_20150 gene rlmE 5856 6503 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443939.1 protein_id gnl|my_center|LOCUS_20150 6566 8455 gene locus_tag LOCUS_20160 gene ftsH 6566 8455 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039235.1 protein_id gnl|my_center|LOCUS_20160 8556 9443 gene locus_tag LOCUS_20170 gene folP 8556 9443 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 protein_id gnl|my_center|LOCUS_20170 9457 10818 gene locus_tag LOCUS_20180 gene glmM 9457 10818 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266863.1 protein_id gnl|my_center|LOCUS_20180 11575 10826 gene locus_tag LOCUS_20190 11575 10826 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266561.1 protein_id gnl|my_center|LOCUS_20190 12041 11715 gene locus_tag LOCUS_20200 12041 11715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 12219 13223 gene locus_tag LOCUS_20210 12219 13223 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140012.1 protein_id gnl|my_center|LOCUS_20210 13276 14223 gene locus_tag LOCUS_20220 gene pstC 13276 14223 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140013.1 protein_id gnl|my_center|LOCUS_20220 14226 15179 gene locus_tag LOCUS_20230 gene pstA 14226 15179 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140014.1 protein_id gnl|my_center|LOCUS_20230 15173 15976 gene locus_tag LOCUS_20240 gene pstB 15173 15976 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107795169.1 protein_id gnl|my_center|LOCUS_20240 16183 17211 gene locus_tag LOCUS_20250 gene pstS 16183 17211 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099410.1 protein_id gnl|my_center|LOCUS_20250 17319 18290 gene locus_tag LOCUS_20260 gene pstC 17319 18290 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193912.1 protein_id gnl|my_center|LOCUS_20260 18301 19143 gene locus_tag LOCUS_20270 gene pstA 18301 19143 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521821.1 protein_id gnl|my_center|LOCUS_20270 19158 19940 gene locus_tag LOCUS_20280 gene pstB 19158 19940 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500183.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence047 903 637 gene locus_tag LOCUS_20290 903 637 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818417.1 protein_id gnl|my_center|LOCUS_20290 1763 900 gene locus_tag LOCUS_20300 1763 900 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189800.1 protein_id gnl|my_center|LOCUS_20300 2987 1845 gene locus_tag LOCUS_20310 2987 1845 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064727.1 protein_id gnl|my_center|LOCUS_20310 4428 3109 gene locus_tag LOCUS_20320 4428 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 5573 4476 gene locus_tag LOCUS_20330 gene rodA 5573 4476 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_20330 7540 5570 gene locus_tag LOCUS_20340 gene mrdA 7540 5570 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 protein_id gnl|my_center|LOCUS_20340 8129 7560 gene locus_tag LOCUS_20350 8129 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 9021 8116 gene locus_tag LOCUS_20360 9021 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 10154 9114 gene locus_tag LOCUS_20370 10154 9114 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_20370 10233 10520 gene locus_tag LOCUS_20380 gene gatC 10233 10520 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_20380 10625 12079 gene locus_tag LOCUS_20390 gene gatA 10625 12079 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_20390 12082 13545 gene locus_tag LOCUS_20400 gene gatB 12082 13545 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552444.1 protein_id gnl|my_center|LOCUS_20400 13692 13552 gene locus_tag LOCUS_20410 13692 13552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 14759 14112 gene locus_tag LOCUS_20420 gene pyrE 14759 14112 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 protein_id gnl|my_center|LOCUS_20420 14778 15560 gene locus_tag LOCUS_20430 14778 15560 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815212.1 protein_id gnl|my_center|LOCUS_20430 15714 15983 gene locus_tag LOCUS_20440 15714 15983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 15970 16386 gene locus_tag LOCUS_20450 15970 16386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 16383 17906 gene locus_tag LOCUS_20460 16383 17906 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387908.1 protein_id gnl|my_center|LOCUS_20460 18013 18996 gene locus_tag LOCUS_20470 18013 18996 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390710.1 protein_id gnl|my_center|LOCUS_20470 19021 19701 gene locus_tag LOCUS_20480 19021 19701 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831045.1 protein_id gnl|my_center|LOCUS_20480 20352 19720 gene locus_tag LOCUS_20490 20352 19720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence048 <1 829 gene locus_tag LOCUS_20500 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001250141.1:alpha/beta hydrolase 2749 845 gene locus_tag LOCUS_20510 2749 845 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_20510 3054 2752 gene locus_tag LOCUS_20520 3054 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 4382 3054 gene locus_tag LOCUS_20530 4382 3054 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194757.1 protein_id gnl|my_center|LOCUS_20530 5146 4382 gene locus_tag LOCUS_20540 5146 4382 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_20540 6275 5151 gene locus_tag LOCUS_20550 gene bamC 6275 5151 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524737.1 protein_id gnl|my_center|LOCUS_20550 7162 6287 gene locus_tag LOCUS_20560 gene dapA 7162 6287 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809954.1 protein_id gnl|my_center|LOCUS_20560 7726 7226 gene locus_tag LOCUS_20570 7726 7226 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192474.1 protein_id gnl|my_center|LOCUS_20570 8508 7723 gene locus_tag LOCUS_20580 gene fliR 8508 7723 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 protein_id gnl|my_center|LOCUS_20580 8782 8513 gene locus_tag LOCUS_20590 gene fliQ 8782 8513 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160414.1 protein_id gnl|my_center|LOCUS_20590 9513 8779 gene locus_tag LOCUS_20600 gene fliP 9513 8779 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549847.1 protein_id gnl|my_center|LOCUS_20600 9761 9570 gene locus_tag LOCUS_20610 9761 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 9669 9971 gene locus_tag LOCUS_20620 9669 9971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 10465 9983 gene locus_tag LOCUS_20630 10465 9983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 11460 10465 gene locus_tag LOCUS_20640 gene fliM 11460 10465 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524547.1 protein_id gnl|my_center|LOCUS_20640 11971 11471 gene locus_tag LOCUS_20650 11971 11471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 13401 12118 gene locus_tag LOCUS_20660 13401 12118 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204243.1 protein_id gnl|my_center|LOCUS_20660 13870 13415 gene locus_tag LOCUS_20670 gene fliJ 13870 13415 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367979.1 protein_id gnl|my_center|LOCUS_20670 14087 13905 gene locus_tag LOCUS_20680 14087 13905 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196455.1 protein_id gnl|my_center|LOCUS_20680 15033 14068 gene locus_tag LOCUS_20690 gene lpxK 15033 14068 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706582.1 protein_id gnl|my_center|LOCUS_20690 15503 15078 gene locus_tag LOCUS_20700 15503 15078 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931122.1 protein_id gnl|my_center|LOCUS_20700 16108 15503 gene locus_tag LOCUS_20710 16108 15503 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064089.1 protein_id gnl|my_center|LOCUS_20710 16258 17613 gene locus_tag LOCUS_20720 gene pcnB 16258 17613 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065010.1 protein_id gnl|my_center|LOCUS_20720 17606 18115 gene locus_tag LOCUS_20730 gene folK 17606 18115 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687713.1 protein_id gnl|my_center|LOCUS_20730 18140 18778 gene locus_tag LOCUS_20740 18140 18778 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_20740 18794 19576 gene locus_tag LOCUS_20750 gene panB 18794 19576 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence049 1242 205 gene locus_tag LOCUS_20760 gene holA 1242 205 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 protein_id gnl|my_center|LOCUS_20760 1730 1239 gene locus_tag LOCUS_20770 1730 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 4533 1741 gene locus_tag LOCUS_20780 4533 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 4740 5630 gene locus_tag LOCUS_20790 4740 5630 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125013.1 protein_id gnl|my_center|LOCUS_20790 5742 6110 gene locus_tag LOCUS_20800 gene queD 5742 6110 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008576903.1 protein_id gnl|my_center|LOCUS_20800 6317 6577 gene locus_tag LOCUS_20810 6317 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 7895 6618 gene locus_tag LOCUS_20820 7895 6618 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_20820 9389 7908 gene locus_tag LOCUS_20830 9389 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 11262 9748 gene locus_tag LOCUS_20840 11262 9748 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337441.1 protein_id gnl|my_center|LOCUS_20840 11532 11398 gene locus_tag LOCUS_20850 11532 11398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20850 13274 11529 gene locus_tag LOCUS_20860 gene thiC 13274 11529 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521865.1 protein_id gnl|my_center|LOCUS_20860 13585 13501 gene locus_tag LOCUS_t00240 13585 13501 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13678 14727 gene locus_tag LOCUS_20870 gene queA 13678 14727 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064321.1 protein_id gnl|my_center|LOCUS_20870 15066 16658 gene locus_tag LOCUS_20880 15066 16658 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038720.1 protein_id gnl|my_center|LOCUS_20880 17147 16668 gene locus_tag LOCUS_20890 17147 16668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 17146 18252 gene locus_tag LOCUS_20900 gene tgt 17146 18252 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930155.1 protein_id gnl|my_center|LOCUS_20900 18274 18861 gene locus_tag LOCUS_20910 18274 18861 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 protein_id gnl|my_center|LOCUS_20910 19348 18866 gene locus_tag LOCUS_20920 19348 18866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 <19994 19447 gene locus_tag LOCUS_20930 <19994 19447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918027.1:response regulator >Feature sequence050 357 43 gene locus_tag LOCUS_20940 357 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 1144 395 gene locus_tag LOCUS_20950 1144 395 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392892.1 protein_id gnl|my_center|LOCUS_20950 1850 1185 gene locus_tag LOCUS_20960 gene dmsB 1850 1185 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392901.1 protein_id gnl|my_center|LOCUS_20960 4461 1864 gene locus_tag LOCUS_20970 4461 1864 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392899.1 protein_id gnl|my_center|LOCUS_20970 5335 4445 gene locus_tag LOCUS_20980 5335 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 6297 5443 gene locus_tag LOCUS_20990 6297 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 6578 6267 gene locus_tag LOCUS_21000 6578 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 6999 6649 gene locus_tag LOCUS_21010 6999 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 7137 7385 gene locus_tag LOCUS_21020 7137 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 7385 7885 gene locus_tag LOCUS_21030 7385 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 8524 8108 gene locus_tag LOCUS_21040 8524 8108 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969926.1 protein_id gnl|my_center|LOCUS_21040 8781 8524 gene locus_tag LOCUS_21050 8781 8524 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192482.1 protein_id gnl|my_center|LOCUS_21050 9655 12822 gene locus_tag LOCUS_21060 9655 12822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21060 12845 16288 gene locus_tag LOCUS_21070 12845 16288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 16378 16797 gene locus_tag LOCUS_21080 16378 16797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 16790 18289 gene locus_tag LOCUS_21090 16790 18289 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261952.1 protein_id gnl|my_center|LOCUS_21090 18463 19428 gene locus_tag LOCUS_21100 18463 19428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 >Feature sequence051 575 135 gene locus_tag LOCUS_21110 575 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 2042 606 gene locus_tag LOCUS_21120 gene tldD 2042 606 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931196.1 protein_id gnl|my_center|LOCUS_21120 3057 2143 gene locus_tag LOCUS_21130 3057 2143 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931197.1 protein_id gnl|my_center|LOCUS_21130 6956 3135 gene locus_tag LOCUS_21140 6956 3135 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947481.1 protein_id gnl|my_center|LOCUS_21140 8036 6999 gene locus_tag LOCUS_21150 8036 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 9538 8033 gene locus_tag LOCUS_21160 9538 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 11519 9558 gene locus_tag LOCUS_21170 11519 9558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21170 13209 11425 gene locus_tag LOCUS_21180 13209 11425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21180 13469 13855 gene locus_tag LOCUS_21190 13469 13855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 14930 14073 gene locus_tag LOCUS_21200 14930 14073 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812386.1 protein_id gnl|my_center|LOCUS_21200 15798 14941 gene locus_tag LOCUS_21210 15798 14941 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 protein_id gnl|my_center|LOCUS_21210 18272 15786 gene locus_tag LOCUS_21220 18272 15786 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257097.1 protein_id gnl|my_center|LOCUS_21220 18487 18278 gene locus_tag LOCUS_21230 18487 18278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 <19353 18543 gene locus_tag LOCUS_21240 <19353 18543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002117074.1:AI-2E family transporter >Feature sequence052 125 1519 gene locus_tag LOCUS_21250 125 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 1637 1891 gene locus_tag LOCUS_21260 1637 1891 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370228.1 protein_id gnl|my_center|LOCUS_21260 1891 2322 gene locus_tag LOCUS_21270 1891 2322 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_21270 3091 4371 gene locus_tag LOCUS_21280 3091 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 4517 5173 gene locus_tag LOCUS_21290 4517 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 6717 6001 gene locus_tag LOCUS_21300 6717 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 7343 7164 gene locus_tag LOCUS_21310 7343 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 8082 7594 gene locus_tag LOCUS_21320 8082 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 8329 8075 gene locus_tag LOCUS_21330 8329 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 8674 8883 gene locus_tag LOCUS_21340 8674 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 9404 9195 gene locus_tag LOCUS_21350 9404 9195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21350 9633 9394 gene locus_tag LOCUS_21360 9633 9394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 10226 9825 gene locus_tag LOCUS_21370 10226 9825 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331447.1 protein_id gnl|my_center|LOCUS_21370 10425 10210 gene locus_tag LOCUS_21380 10425 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 10686 10925 gene locus_tag LOCUS_21390 10686 10925 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144325.1 protein_id gnl|my_center|LOCUS_21390 10922 11344 gene locus_tag LOCUS_21400 10922 11344 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967510.1 protein_id gnl|my_center|LOCUS_21400 11456 13921 gene locus_tag LOCUS_21410 11456 13921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 14895 13834 gene locus_tag LOCUS_21420 14895 13834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 15912 14971 gene locus_tag LOCUS_21430 15912 14971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 17413 15983 gene locus_tag LOCUS_21440 17413 15983 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_21440 18335 17586 gene locus_tag LOCUS_21450 18335 17586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence053 687 1151 gene locus_tag LOCUS_21460 687 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 1197 1970 gene locus_tag LOCUS_21470 1197 1970 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384594.1 protein_id gnl|my_center|LOCUS_21470 1967 2725 gene locus_tag LOCUS_21480 1967 2725 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121328.1 protein_id gnl|my_center|LOCUS_21480 2736 3719 gene locus_tag LOCUS_21490 2736 3719 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461831.1 protein_id gnl|my_center|LOCUS_21490 4507 3827 gene locus_tag LOCUS_21500 4507 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21500 5900 4479 gene locus_tag LOCUS_21510 5900 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21510 6650 5970 gene locus_tag LOCUS_21520 6650 5970 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 protein_id gnl|my_center|LOCUS_21520 7531 6650 gene locus_tag LOCUS_21530 7531 6650 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742052.1 protein_id gnl|my_center|LOCUS_21530 7821 9707 gene locus_tag LOCUS_21540 7821 9707 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112594.1 protein_id gnl|my_center|LOCUS_21540 11210 9942 gene locus_tag LOCUS_21550 11210 9942 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_21550 11548 11243 gene locus_tag LOCUS_21560 11548 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 12003 12458 gene locus_tag LOCUS_21570 gene dtd 12003 12458 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038819.1 protein_id gnl|my_center|LOCUS_21570 13346 12474 gene locus_tag LOCUS_21580 gene hisG 13346 12474 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_21580 13505 15142 gene locus_tag LOCUS_21590 gene pgm 13505 15142 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_21590 15449 15189 gene locus_tag LOCUS_21600 15449 15189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 15580 16461 gene locus_tag LOCUS_21610 gene ylqF 15580 16461 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 protein_id gnl|my_center|LOCUS_21610 16923 16480 gene locus_tag LOCUS_21620 16923 16480 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764777.1 protein_id gnl|my_center|LOCUS_21620 <17807 17039 gene locus_tag LOCUS_21630 <17807 17039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941614.1:EAL domain-containing protein >Feature sequence054 1205 273 gene locus_tag LOCUS_21640 gene hemC 1205 273 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820470.1 protein_id gnl|my_center|LOCUS_21640 1271 1768 gene locus_tag LOCUS_21650 1271 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2541 1795 gene locus_tag LOCUS_21660 2541 1795 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068574319.1 protein_id gnl|my_center|LOCUS_21660 3584 2538 gene locus_tag LOCUS_21670 3584 2538 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012777536.1 protein_id gnl|my_center|LOCUS_21670 3629 5059 gene locus_tag LOCUS_21680 gene argH 3629 5059 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812010.1 protein_id gnl|my_center|LOCUS_21680 5257 5811 gene locus_tag LOCUS_21690 5257 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 7058 5820 gene locus_tag LOCUS_21700 7058 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 7352 7083 gene locus_tag LOCUS_21710 7352 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 8724 7591 gene locus_tag LOCUS_21720 8724 7591 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522370.1 protein_id gnl|my_center|LOCUS_21720 9592 8738 gene locus_tag LOCUS_21730 gene folD 9592 8738 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404473.1 protein_id gnl|my_center|LOCUS_21730 9695 9771 gene locus_tag LOCUS_t00250 9695 9771 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9814 9890 gene locus_tag LOCUS_t00260 9814 9890 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9966 11105 gene locus_tag LOCUS_21740 9966 11105 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_21740 11117 13456 gene locus_tag LOCUS_21750 11117 13456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 13823 13449 gene locus_tag LOCUS_21760 13823 13449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 17000 13848 gene locus_tag LOCUS_21770 17000 13848 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108104.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence055 1604 333 gene locus_tag LOCUS_21780 1604 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 1716 2219 gene locus_tag LOCUS_21790 gene def 1716 2219 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525852.1 protein_id gnl|my_center|LOCUS_21790 2306 3229 gene locus_tag LOCUS_21800 gene fmt 2306 3229 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549892.1 protein_id gnl|my_center|LOCUS_21800 3309 4154 gene locus_tag LOCUS_21810 gene htpX 3309 4154 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189409.1 protein_id gnl|my_center|LOCUS_21810 4268 4738 gene locus_tag LOCUS_21820 4268 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 5766 4840 gene locus_tag LOCUS_21830 gene lipA 5766 4840 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555327.1 protein_id gnl|my_center|LOCUS_21830 6819 5914 gene locus_tag LOCUS_21840 6819 5914 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_21840 6957 7466 gene locus_tag LOCUS_21850 6957 7466 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_21850 7534 8598 gene locus_tag LOCUS_21860 7534 8598 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389301.1 protein_id gnl|my_center|LOCUS_21860 8694 8894 gene locus_tag LOCUS_21870 8694 8894 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070919.1 protein_id gnl|my_center|LOCUS_21870 9102 9581 gene locus_tag LOCUS_21880 gene bfr 9102 9581 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815898.1 protein_id gnl|my_center|LOCUS_21880 9929 10090 gene locus_tag LOCUS_21890 9929 10090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 10097 10396 gene locus_tag LOCUS_21900 10097 10396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 10407 11780 gene locus_tag LOCUS_21910 10407 11780 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626085.1 protein_id gnl|my_center|LOCUS_21910 13046 12075 gene locus_tag LOCUS_21920 gene dmeF 13046 12075 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389388.1 protein_id gnl|my_center|LOCUS_21920 13901 13140 gene locus_tag LOCUS_21930 13901 13140 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_21930 14803 13898 gene locus_tag LOCUS_21940 14803 13898 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 protein_id gnl|my_center|LOCUS_21940 15740 14859 gene locus_tag LOCUS_21950 15740 14859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478317.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21950 16211 15741 gene locus_tag LOCUS_21960 16211 15741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 16705 16286 gene locus_tag LOCUS_21970 16705 16286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence056 1191 1 gene locus_tag LOCUS_21980 gene tuf 1191 1 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198356.1 protein_id gnl|my_center|LOCUS_21980 3300 1207 gene locus_tag LOCUS_21990 gene fusA 3300 1207 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198357.1 protein_id gnl|my_center|LOCUS_21990 3789 3319 gene locus_tag LOCUS_22000 gene rpsG 3789 3319 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198359.1 protein_id gnl|my_center|LOCUS_22000 4200 3823 gene locus_tag LOCUS_22010 gene rpsL 4200 3823 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218431.1 protein_id gnl|my_center|LOCUS_22010 8511 4318 gene locus_tag LOCUS_22020 gene rpoC 8511 4318 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818292.1 protein_id gnl|my_center|LOCUS_22020 12952 8630 gene locus_tag LOCUS_22030 12952 8630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 13499 13125 gene locus_tag LOCUS_22040 gene rplL 13499 13125 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215374.1 protein_id gnl|my_center|LOCUS_22040 14072 13545 gene locus_tag LOCUS_22050 gene rplJ 14072 13545 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199864.1 protein_id gnl|my_center|LOCUS_22050 15067 14372 gene locus_tag LOCUS_22060 gene rplA 15067 14372 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806887.1 protein_id gnl|my_center|LOCUS_22060 15500 15069 gene locus_tag LOCUS_22070 gene rplK 15500 15069 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198368.1 protein_id gnl|my_center|LOCUS_22070 16126 15593 gene locus_tag LOCUS_22080 gene nusG 16126 15593 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198369.1 protein_id gnl|my_center|LOCUS_22080 16474 16130 gene locus_tag LOCUS_22090 gene secE 16474 16130 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806884.1 protein_id gnl|my_center|LOCUS_22090 16595 16520 gene locus_tag LOCUS_t00270 16595 16520 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence057 206 1189 gene locus_tag LOCUS_22100 206 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22100 1231 2958 gene locus_tag LOCUS_22110 1231 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 3787 2966 gene locus_tag LOCUS_22120 3787 2966 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_22120 4534 3869 gene locus_tag LOCUS_22130 gene narP 4534 3869 CDS product nitrate/nitrite response regulator protein NarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113641.1 protein_id gnl|my_center|LOCUS_22130 5288 4731 gene locus_tag LOCUS_22140 gene greB 5288 4731 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_22140 5977 5285 gene locus_tag LOCUS_22150 5977 5285 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267309.1 protein_id gnl|my_center|LOCUS_22150 6213 6512 gene locus_tag LOCUS_22160 6213 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 6560 6766 gene locus_tag LOCUS_22170 6560 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 6897 7526 gene locus_tag LOCUS_22180 6897 7526 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_22180 7570 9132 gene locus_tag LOCUS_22190 7570 9132 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_22190 9147 10151 gene locus_tag LOCUS_22200 9147 10151 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390867.1 protein_id gnl|my_center|LOCUS_22200 10171 11736 gene locus_tag LOCUS_22210 10171 11736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 11739 12749 gene locus_tag LOCUS_22220 11739 12749 CDS product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390863.1 protein_id gnl|my_center|LOCUS_22220 12746 13855 gene locus_tag LOCUS_22230 gene wecB 12746 13855 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_22230 13862 14716 gene locus_tag LOCUS_22240 13862 14716 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_22240 14713 15747 gene locus_tag LOCUS_22250 14713 15747 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_22250 >Feature sequence058 573 3050 gene locus_tag LOCUS_22260 573 3050 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084250.1 protein_id gnl|my_center|LOCUS_22260 3464 3066 gene locus_tag LOCUS_22270 3464 3066 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072739.1 protein_id gnl|my_center|LOCUS_22270 4626 3529 gene locus_tag LOCUS_22280 4626 3529 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_22280 5497 4805 gene locus_tag LOCUS_22290 5497 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 5710 5501 gene locus_tag LOCUS_22300 5710 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 6702 5743 gene locus_tag LOCUS_22310 6702 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 7678 6797 gene locus_tag LOCUS_22320 7678 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_22320 8331 7675 gene locus_tag LOCUS_22330 8331 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 9318 8344 gene locus_tag LOCUS_22340 9318 8344 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706425.1 protein_id gnl|my_center|LOCUS_22340 9844 9335 gene locus_tag LOCUS_22350 9844 9335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 10337 9987 gene locus_tag LOCUS_22360 10337 9987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 10455 11360 gene locus_tag LOCUS_22370 gene nhaR 10455 11360 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_22370 11705 11475 gene locus_tag LOCUS_22380 11705 11475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 11982 13070 gene locus_tag LOCUS_22390 11982 13070 CDS product DUF3616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037817.1 protein_id gnl|my_center|LOCUS_22390 13063 14103 gene locus_tag LOCUS_22400 13063 14103 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065071.1 protein_id gnl|my_center|LOCUS_22400 14100 14891 gene locus_tag LOCUS_22410 14100 14891 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813954.1 protein_id gnl|my_center|LOCUS_22410 15899 15216 gene locus_tag LOCUS_22420 15899 15216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477491.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence059 3079 2750 gene locus_tag LOCUS_22430 gene nirD 3079 2750 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087853.1 protein_id gnl|my_center|LOCUS_22430 3169 3215 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5685 3232 gene locus_tag LOCUS_22440 gene nirB 5685 3232 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_22440 6208 8571 gene locus_tag LOCUS_22450 gene cas3 6208 8571 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932807.1 protein_id gnl|my_center|LOCUS_22450 8564 9283 gene locus_tag LOCUS_22460 gene cas5c 8564 9283 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922512.1 protein_id gnl|my_center|LOCUS_22460 9258 11195 gene locus_tag LOCUS_22470 9258 11195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 11215 12108 gene locus_tag LOCUS_22480 gene cas7c 11215 12108 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 protein_id gnl|my_center|LOCUS_22480 12120 12326 gene locus_tag LOCUS_22490 12120 12326 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393634.1 protein_id gnl|my_center|LOCUS_22490 12323 12565 gene locus_tag LOCUS_22500 12323 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 13090 12866 gene locus_tag LOCUS_22510 13090 12866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 13154 13786 gene locus_tag LOCUS_22520 gene cas4 13154 13786 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_22520 14177 13779 gene locus_tag LOCUS_22530 14177 13779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 14466 14161 gene locus_tag LOCUS_22540 14466 14161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 14505 15539 gene locus_tag LOCUS_22550 gene cas1c 14505 15539 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392030.1 protein_id gnl|my_center|LOCUS_22550 15556 15846 gene locus_tag LOCUS_22560 gene cas2 15556 15846 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392029.1 protein_id gnl|my_center|LOCUS_22560 16026 16352 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcatcgcccggcctcacggccgggcgcggattgaaac >Feature sequence060 551 634 gene locus_tag LOCUS_t00280 551 634 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 782 2068 gene locus_tag LOCUS_22570 gene tig 782 2068 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521257.1 protein_id gnl|my_center|LOCUS_22570 2068 2691 gene locus_tag LOCUS_22580 gene clpP 2068 2691 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552734.1 protein_id gnl|my_center|LOCUS_22580 2730 3986 gene locus_tag LOCUS_22590 gene clpX 2730 3986 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770751.1 protein_id gnl|my_center|LOCUS_22590 4075 6489 gene locus_tag LOCUS_22600 gene lon 4075 6489 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_22600 6595 6867 gene locus_tag LOCUS_22610 6595 6867 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 protein_id gnl|my_center|LOCUS_22610 7443 6955 gene locus_tag LOCUS_22620 7443 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 7403 7615 gene locus_tag LOCUS_22630 7403 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 7834 7986 gene locus_tag LOCUS_22640 7834 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 8257 9450 gene locus_tag LOCUS_22650 8257 9450 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_22650 9762 9676 gene locus_tag LOCUS_t00290 9762 9676 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9799 12093 gene locus_tag LOCUS_22660 gene rnr 9799 12093 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695198.1 protein_id gnl|my_center|LOCUS_22660 12278 13018 gene locus_tag LOCUS_22670 gene rlmB 12278 13018 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191786.1 protein_id gnl|my_center|LOCUS_22670 13097 13648 gene locus_tag LOCUS_22680 13097 13648 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194377.1 protein_id gnl|my_center|LOCUS_22680 13648 14433 gene locus_tag LOCUS_22690 13648 14433 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765040.1 protein_id gnl|my_center|LOCUS_22690 15031 14471 gene locus_tag LOCUS_22700 gene efp 15031 14471 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810194.1 protein_id gnl|my_center|LOCUS_22700 16205 15066 gene locus_tag LOCUS_22710 gene earP 16205 15066 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114754.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence061 <1 637 gene locus_tag LOCUS_22720 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112618.1:methyltransferase 634 993 gene locus_tag LOCUS_22730 634 993 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104394.1 protein_id gnl|my_center|LOCUS_22730 1246 1521 gene locus_tag LOCUS_22740 1246 1521 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_22740 1508 1750 gene locus_tag LOCUS_22750 1508 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 1796 2614 gene locus_tag LOCUS_22760 1796 2614 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947780.1 protein_id gnl|my_center|LOCUS_22760 2986 3906 gene locus_tag LOCUS_22770 2986 3906 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222332.1 protein_id gnl|my_center|LOCUS_22770 4444 4070 gene locus_tag LOCUS_22780 4444 4070 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_22780 4518 5777 gene locus_tag LOCUS_22790 4518 5777 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186490.1 protein_id gnl|my_center|LOCUS_22790 5865 6326 gene locus_tag LOCUS_22800 gene nrdR 5865 6326 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771735.1 protein_id gnl|my_center|LOCUS_22800 6332 7414 gene locus_tag LOCUS_22810 gene ribD 6332 7414 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113051.1 protein_id gnl|my_center|LOCUS_22810 7434 7889 gene locus_tag LOCUS_22820 7434 7889 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688300.1 protein_id gnl|my_center|LOCUS_22820 7891 8637 gene locus_tag LOCUS_22830 7891 8637 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943419.1 protein_id gnl|my_center|LOCUS_22830 8673 9290 gene locus_tag LOCUS_22840 8673 9290 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_22840 9290 10393 gene locus_tag LOCUS_22850 gene ribBA 9290 10393 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808597.1 protein_id gnl|my_center|LOCUS_22850 10395 10862 gene locus_tag LOCUS_22860 gene ribH 10395 10862 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 protein_id gnl|my_center|LOCUS_22860 10859 11341 gene locus_tag LOCUS_22870 gene nusB 10859 11341 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039075.1 protein_id gnl|my_center|LOCUS_22870 11354 12310 gene locus_tag LOCUS_22880 gene thiL 11354 12310 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931503.1 protein_id gnl|my_center|LOCUS_22880 12324 12794 gene locus_tag LOCUS_22890 12324 12794 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 protein_id gnl|my_center|LOCUS_22890 12785 13279 gene locus_tag LOCUS_22900 gene pncC 12785 13279 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132240.1 protein_id gnl|my_center|LOCUS_22900 13324 14022 gene locus_tag LOCUS_22910 13324 14022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22910 14019 14291 gene locus_tag LOCUS_22920 14019 14291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22920 14288 14716 gene locus_tag LOCUS_22930 14288 14716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 15921 14737 gene locus_tag LOCUS_22940 15921 14737 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926962.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence062 1258 194 gene locus_tag LOCUS_22950 gene thiO 1258 194 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 protein_id gnl|my_center|LOCUS_22950 1923 1405 gene locus_tag LOCUS_22960 gene tppE 1923 1405 CDS product type IVa pilus pseudopilin TppE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704647.1 protein_id gnl|my_center|LOCUS_22960 2678 2202 gene locus_tag LOCUS_22970 2678 2202 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266587.1 protein_id gnl|my_center|LOCUS_22970 7233 2689 gene locus_tag LOCUS_22980 7233 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 7843 7265 gene locus_tag LOCUS_22990 7843 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 8680 7850 gene locus_tag LOCUS_23000 8680 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 9216 8677 gene locus_tag LOCUS_23010 gene pilV 9216 8677 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103292.1 protein_id gnl|my_center|LOCUS_23010 9722 9213 gene locus_tag LOCUS_23020 9722 9213 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073355.1 protein_id gnl|my_center|LOCUS_23020 10081 10323 gene locus_tag LOCUS_23030 10081 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 10373 10831 gene locus_tag LOCUS_23040 10373 10831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 10883 11233 gene locus_tag LOCUS_23050 10883 11233 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_23050 11983 11690 gene locus_tag LOCUS_23060 11983 11690 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071641.1 protein_id gnl|my_center|LOCUS_23060 12165 11971 gene locus_tag LOCUS_23070 12165 11971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 12459 13430 gene locus_tag LOCUS_23080 gene birA 12459 13430 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070602.1 protein_id gnl|my_center|LOCUS_23080 13567 14310 gene locus_tag LOCUS_23090 13567 14310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 14420 15085 gene locus_tag LOCUS_23100 14420 15085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence063 812 1243 gene locus_tag LOCUS_23110 812 1243 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194168.1 protein_id gnl|my_center|LOCUS_23110 1255 1620 gene locus_tag LOCUS_23120 1255 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 1837 2835 gene locus_tag LOCUS_23130 gene prfB 1837 2835 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199566.1 protein_id gnl|my_center|LOCUS_23130 2856 4364 gene locus_tag LOCUS_23140 gene lysS 2856 4364 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192783.1 protein_id gnl|my_center|LOCUS_23140 5588 4437 gene locus_tag LOCUS_23150 5588 4437 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_23150 5923 5654 gene locus_tag LOCUS_23160 5923 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 6822 5929 gene locus_tag LOCUS_23170 6822 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 8036 6819 gene locus_tag LOCUS_23180 8036 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 8662 8033 gene locus_tag LOCUS_23190 8662 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037422308.1 protein_id gnl|my_center|LOCUS_23190 12335 8655 gene locus_tag LOCUS_23200 12335 8655 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073731.1 protein_id gnl|my_center|LOCUS_23200 12843 12607 gene locus_tag LOCUS_23210 12843 12607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 12926 13903 gene locus_tag LOCUS_23220 12926 13903 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_23220 14065 14646 gene locus_tag LOCUS_23230 14065 14646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23230 14407 14443 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14538 14972 gene locus_tag LOCUS_23240 14538 14972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23240 >Feature sequence064 <1 1165 gene locus_tag LOCUS_23250 <1 1165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194277.1:RNB domain-containing ribonuclease 1135 2067 gene locus_tag LOCUS_23260 1135 2067 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 protein_id gnl|my_center|LOCUS_23260 2246 3253 gene locus_tag LOCUS_23270 2246 3253 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 protein_id gnl|my_center|LOCUS_23270 3689 3270 gene locus_tag LOCUS_23280 3689 3270 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_23280 3909 3670 gene locus_tag LOCUS_23290 3909 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 3908 4237 gene locus_tag LOCUS_23300 3908 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 5354 4266 gene locus_tag LOCUS_23310 5354 4266 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390849.1 protein_id gnl|my_center|LOCUS_23310 6325 5402 gene locus_tag LOCUS_23320 6325 5402 CDS product HprK-related kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390848.1 protein_id gnl|my_center|LOCUS_23320 6579 6307 gene locus_tag LOCUS_23330 6579 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 7249 6584 gene locus_tag LOCUS_23340 7249 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 8395 7394 gene locus_tag LOCUS_23350 gene prmC 8395 7394 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929958.1 protein_id gnl|my_center|LOCUS_23350 8108 8129 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9518 8400 gene locus_tag LOCUS_23360 gene prfA 9518 8400 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527811.1 protein_id gnl|my_center|LOCUS_23360 10797 9544 gene locus_tag LOCUS_23370 gene hemA 10797 9544 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521984.1 protein_id gnl|my_center|LOCUS_23370 11783 10878 gene locus_tag LOCUS_23380 11783 10878 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269392.1 protein_id gnl|my_center|LOCUS_23380 12132 11824 gene locus_tag LOCUS_23390 12132 11824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 14112 12205 gene locus_tag LOCUS_23400 gene ilvD 14112 12205 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819105.1 protein_id gnl|my_center|LOCUS_23400 14168 14953 gene locus_tag LOCUS_23410 gene lgt 14168 14953 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814606.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence065 4112 3147 gene locus_tag LOCUS_23420 gene hemF 4112 3147 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930863.1 protein_id gnl|my_center|LOCUS_23420 4865 4209 gene locus_tag LOCUS_23430 4865 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 5489 4935 gene locus_tag LOCUS_23440 gene tsaC 5489 4935 CDS product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063622.1 protein_id gnl|my_center|LOCUS_23440 6780 5503 gene locus_tag LOCUS_23450 gene purD 6780 5503 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186246.1 protein_id gnl|my_center|LOCUS_23450 8484 6916 gene locus_tag LOCUS_23460 gene purH 8484 6916 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_23460 8851 8606 gene locus_tag LOCUS_23470 8851 8606 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 protein_id gnl|my_center|LOCUS_23470 9891 8869 gene locus_tag LOCUS_23480 gene dusB 9891 8869 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_23480 9076 9129 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10820 10029 gene locus_tag LOCUS_23490 10820 10029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367094.1 protein_id gnl|my_center|LOCUS_23490 11859 10936 gene locus_tag LOCUS_23500 gene ntrB 11859 10936 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 protein_id gnl|my_center|LOCUS_23500 11863 11868 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13161 11884 gene locus_tag LOCUS_23510 13161 11884 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705089.1 protein_id gnl|my_center|LOCUS_23510 13887 13444 gene locus_tag LOCUS_23520 13887 13444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 14342 13884 gene locus_tag LOCUS_23530 14342 13884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 >Feature sequence066 2115 1174 gene locus_tag LOCUS_23540 2115 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 2535 2143 gene locus_tag LOCUS_23550 2535 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 3709 2468 gene locus_tag LOCUS_23560 3709 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 4685 3747 gene locus_tag LOCUS_23570 gene flgJ 4685 3747 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197262.1 protein_id gnl|my_center|LOCUS_23570 5808 4690 gene locus_tag LOCUS_23580 5808 4690 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550967.1 protein_id gnl|my_center|LOCUS_23580 6520 5846 gene locus_tag LOCUS_23590 6520 5846 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447174.1 protein_id gnl|my_center|LOCUS_23590 7338 6553 gene locus_tag LOCUS_23600 gene flgG 7338 6553 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197257.1 protein_id gnl|my_center|LOCUS_23600 8095 7352 gene locus_tag LOCUS_23610 gene flgF 8095 7352 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 protein_id gnl|my_center|LOCUS_23610 9481 8246 gene locus_tag LOCUS_23620 gene flgE 9481 8246 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037113.1 protein_id gnl|my_center|LOCUS_23620 10180 9494 gene locus_tag LOCUS_23630 10180 9494 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930324.1 protein_id gnl|my_center|LOCUS_23630 10606 10193 gene locus_tag LOCUS_23640 gene flgC 10606 10193 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817176.1 protein_id gnl|my_center|LOCUS_23640 11033 10620 gene locus_tag LOCUS_23650 gene flgB 11033 10620 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884694.1 protein_id gnl|my_center|LOCUS_23650 12858 11215 gene locus_tag LOCUS_23660 12858 11215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 12809 13573 gene locus_tag LOCUS_23670 gene flgA 12809 13573 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197247.1 protein_id gnl|my_center|LOCUS_23670 13715 14062 gene locus_tag LOCUS_23680 13715 14062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 14059 14514 gene locus_tag LOCUS_23690 14059 14514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 14511 14720 gene locus_tag LOCUS_23700 14511 14720 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730261.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence067 2947 2027 gene locus_tag LOCUS_23710 2947 2027 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037679.1 protein_id gnl|my_center|LOCUS_23710 4097 2985 gene locus_tag LOCUS_23720 gene asd 4097 2985 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111187.1 protein_id gnl|my_center|LOCUS_23720 5280 4219 gene locus_tag LOCUS_23730 gene leuB 5280 4219 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213431.1 protein_id gnl|my_center|LOCUS_23730 5930 5292 gene locus_tag LOCUS_23740 gene leuD 5930 5292 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222556.1 protein_id gnl|my_center|LOCUS_23740 6085 5927 gene locus_tag LOCUS_23750 6085 5927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 7518 6082 gene locus_tag LOCUS_23760 gene leuC 7518 6082 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528981.1 protein_id gnl|my_center|LOCUS_23760 8743 7592 gene locus_tag LOCUS_23770 8743 7592 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_23770 9053 8814 gene locus_tag LOCUS_23780 9053 8814 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073163.1 protein_id gnl|my_center|LOCUS_23780 10186 9080 gene locus_tag LOCUS_23790 gene aroC 10186 9080 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266572.1 protein_id gnl|my_center|LOCUS_23790 10785 10255 gene locus_tag LOCUS_23800 10785 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 12389 10854 gene locus_tag LOCUS_23810 12389 10854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence068 628 422 gene locus_tag LOCUS_23820 628 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 925 2739 gene locus_tag LOCUS_23830 925 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 2885 3115 gene locus_tag LOCUS_23840 2885 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 3115 3501 gene locus_tag LOCUS_23850 3115 3501 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_23850 6343 3860 gene locus_tag LOCUS_23860 6343 3860 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974867.1 protein_id gnl|my_center|LOCUS_23860 7333 6365 gene locus_tag LOCUS_23870 7333 6365 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045231753.1 protein_id gnl|my_center|LOCUS_23870 8928 7954 gene locus_tag LOCUS_23880 8928 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 9785 8925 gene locus_tag LOCUS_23890 9785 8925 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_23890 10023 9814 gene locus_tag LOCUS_23900 10023 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 10752 10141 gene locus_tag LOCUS_23910 10752 10141 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408266.1 protein_id gnl|my_center|LOCUS_23910 11027 12340 gene locus_tag LOCUS_23920 11027 12340 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932228.1 protein_id gnl|my_center|LOCUS_23920 13018 12368 gene locus_tag LOCUS_23930 13018 12368 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722188.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence069 2344 1142 gene locus_tag LOCUS_23940 gene gspF 2344 1142 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173470.1 protein_id gnl|my_center|LOCUS_23940 3945 2476 gene locus_tag LOCUS_23950 3945 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23950 3989 4189 gene locus_tag LOCUS_23960 3989 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 5601 4174 gene locus_tag LOCUS_23970 gene prsR 5601 4174 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_23970 7348 5684 gene locus_tag LOCUS_23980 7348 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 9998 7383 gene locus_tag LOCUS_23990 gene alaS 9998 7383 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191158.1 protein_id gnl|my_center|LOCUS_23990 10319 10113 gene locus_tag LOCUS_24000 10319 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 11162 10482 gene locus_tag LOCUS_24010 gene trmB 11162 10482 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185899.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24010 11982 11200 gene locus_tag LOCUS_24020 11982 11200 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931559.1 protein_id gnl|my_center|LOCUS_24020 12226 12023 gene locus_tag LOCUS_24030 gene thiS 12226 12023 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_24030 12277 12350 gene locus_tag LOCUS_t00300 12277 12350 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12375 13574 gene locus_tag LOCUS_24040 gene tyrS 12375 13574 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence070 1546 629 gene locus_tag LOCUS_24050 1546 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 3845 1602 gene locus_tag LOCUS_24060 gene uvrD 3845 1602 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480961.1 protein_id gnl|my_center|LOCUS_24060 3953 4216 gene locus_tag LOCUS_24070 3953 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 4222 5730 gene locus_tag LOCUS_24080 gene lnt 4222 5730 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105186.1 protein_id gnl|my_center|LOCUS_24080 5788 6861 gene locus_tag LOCUS_24090 gene selD 5788 6861 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551284.1 protein_id gnl|my_center|LOCUS_24090 6937 8082 gene locus_tag LOCUS_24100 6937 8082 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_24100 8532 8209 gene locus_tag LOCUS_24110 8532 8209 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 protein_id gnl|my_center|LOCUS_24110 8698 9024 gene locus_tag LOCUS_24120 gene trxA 8698 9024 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_24120 9226 10362 gene locus_tag LOCUS_24130 gene rho 9226 10362 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810577.1 protein_id gnl|my_center|LOCUS_24130 10406 13273 gene locus_tag LOCUS_24140 gene prsT 10406 13273 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence071 <1 627 gene locus_tag LOCUS_24150 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011807735.1:uracil-DNA glycosylase 792 1424 gene locus_tag LOCUS_24160 792 1424 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190125.1 protein_id gnl|my_center|LOCUS_24160 2256 1447 gene locus_tag LOCUS_24170 2256 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 5062 2327 gene locus_tag LOCUS_24180 gene acnA 5062 2327 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020308.1 protein_id gnl|my_center|LOCUS_24180 5545 5620 gene locus_tag LOCUS_t00310 5545 5620 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5630 7501 gene locus_tag LOCUS_24190 5630 7501 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039990.1 protein_id gnl|my_center|LOCUS_24190 8359 7568 gene locus_tag LOCUS_24200 gene fabI 8359 7568 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223367.1 protein_id gnl|my_center|LOCUS_24200 8457 9110 gene locus_tag LOCUS_24210 gene parA 8457 9110 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 protein_id gnl|my_center|LOCUS_24210 9115 9723 gene locus_tag LOCUS_24220 9115 9723 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_24220 9957 9730 gene locus_tag LOCUS_24230 9957 9730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24230 12137 9879 gene locus_tag LOCUS_24240 12137 9879 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 protein_id gnl|my_center|LOCUS_24240 12615 12175 gene locus_tag LOCUS_24250 12615 12175 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553866.1 protein_id gnl|my_center|LOCUS_24250 >Feature sequence072 <1 977 gene locus_tag LOCUS_24260 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003911903.1:circularly permuted type 2 ATP-grasp protein 980 1888 gene locus_tag LOCUS_24270 980 1888 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_24270 2034 4574 gene locus_tag LOCUS_24280 2034 4574 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141000.1 protein_id gnl|my_center|LOCUS_24280 4587 4718 gene locus_tag LOCUS_24290 4587 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 4875 5222 gene locus_tag LOCUS_24300 4875 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 5233 5772 gene locus_tag LOCUS_24310 5233 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 6302 5970 gene locus_tag LOCUS_24320 6302 5970 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_24320 6553 6299 gene locus_tag LOCUS_24330 6553 6299 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102761837.1 protein_id gnl|my_center|LOCUS_24330 7242 6841 gene locus_tag LOCUS_24340 7242 6841 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972683.1 protein_id gnl|my_center|LOCUS_24340 7481 7248 gene locus_tag LOCUS_24350 7481 7248 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244189.1 protein_id gnl|my_center|LOCUS_24350 9055 7802 gene locus_tag LOCUS_24360 9055 7802 CDS product lpg1639 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947366.1 protein_id gnl|my_center|LOCUS_24360 10070 9102 gene locus_tag LOCUS_24370 10070 9102 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_24370 11527 10070 gene locus_tag LOCUS_24380 11527 10070 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340179.1 protein_id gnl|my_center|LOCUS_24380 11638 12378 gene locus_tag LOCUS_24390 11638 12378 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 protein_id gnl|my_center|LOCUS_24390 12451 12991 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq caatccgcgcccggccgtgaggccgggcgatgcc 13000 13251 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccgcgcccggccgtgaggccgggcgatgc >Feature sequence073 1075 2406 gene locus_tag LOCUS_24400 1075 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 3669 2419 gene locus_tag LOCUS_24410 3669 2419 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_24410 4396 3725 gene locus_tag LOCUS_24420 4396 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 4612 4478 gene locus_tag LOCUS_24430 4612 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 4882 4640 gene locus_tag LOCUS_24440 4882 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 7790 4974 gene locus_tag LOCUS_24450 7790 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 9370 7856 gene locus_tag LOCUS_24460 9370 7856 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448947.1 protein_id gnl|my_center|LOCUS_24460 10400 9549 gene locus_tag LOCUS_24470 10400 9549 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192869.1 protein_id gnl|my_center|LOCUS_24470 11352 10546 gene locus_tag LOCUS_24480 11352 10546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 12220 11378 gene locus_tag LOCUS_24490 12220 11378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 12389 12946 gene locus_tag LOCUS_24500 gene tadA 12389 12946 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191221.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence074 521 1891 gene locus_tag LOCUS_24510 521 1891 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 protein_id gnl|my_center|LOCUS_24510 1893 2975 gene locus_tag LOCUS_24520 1893 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 4059 3025 gene locus_tag LOCUS_24530 4059 3025 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035992.1 protein_id gnl|my_center|LOCUS_24530 4742 4179 gene locus_tag LOCUS_24540 4742 4179 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191124.1 protein_id gnl|my_center|LOCUS_24540 5240 4848 gene locus_tag LOCUS_24550 5240 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 5717 5253 gene locus_tag LOCUS_24560 5717 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 6356 5808 gene locus_tag LOCUS_24570 6356 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142078.1 protein_id gnl|my_center|LOCUS_24570 6566 7675 gene locus_tag LOCUS_24580 6566 7675 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101519.1 protein_id gnl|my_center|LOCUS_24580 7950 7783 gene locus_tag LOCUS_24590 7950 7783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 7892 8458 gene locus_tag LOCUS_24600 7892 8458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 8572 8997 gene locus_tag LOCUS_24610 8572 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 9007 10473 gene locus_tag LOCUS_24620 gene ubiD 9007 10473 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096332.1 protein_id gnl|my_center|LOCUS_24620 10479 11513 gene locus_tag LOCUS_24630 10479 11513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 11606 12145 gene locus_tag LOCUS_24640 11606 12145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence075 448 1218 gene locus_tag LOCUS_24650 448 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 1990 1247 gene locus_tag LOCUS_24660 1990 1247 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689299.1 protein_id gnl|my_center|LOCUS_24660 3165 2014 gene locus_tag LOCUS_24670 3165 2014 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521997.1 protein_id gnl|my_center|LOCUS_24670 4345 3188 gene locus_tag LOCUS_24680 gene ubiH 4345 3188 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_24680 5642 4335 gene locus_tag LOCUS_24690 5642 4335 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549996.1 protein_id gnl|my_center|LOCUS_24690 6349 5627 gene locus_tag LOCUS_24700 6349 5627 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039134.1 protein_id gnl|my_center|LOCUS_24700 7394 6399 gene locus_tag LOCUS_24710 7394 6399 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931410.1 protein_id gnl|my_center|LOCUS_24710 7444 9765 gene locus_tag LOCUS_24720 7444 9765 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814429.1 protein_id gnl|my_center|LOCUS_24720 9743 11032 gene locus_tag LOCUS_24730 9743 11032 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103188.1 protein_id gnl|my_center|LOCUS_24730 11210 11995 gene locus_tag LOCUS_24740 11210 11995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 11307 11330 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence076 257 45 gene locus_tag LOCUS_24750 257 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 931 419 gene locus_tag LOCUS_24760 931 419 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_24760 1210 983 gene locus_tag LOCUS_24770 1210 983 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932528.1 protein_id gnl|my_center|LOCUS_24770 1636 1310 gene locus_tag LOCUS_24780 1636 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 1776 1851 gene locus_tag LOCUS_t00320 1776 1851 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1885 2853 gene locus_tag LOCUS_24790 1885 2853 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204136.1 protein_id gnl|my_center|LOCUS_24790 2880 2956 gene locus_tag LOCUS_t00330 2880 2956 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3525 2965 gene locus_tag LOCUS_24800 3525 2965 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194433.1 protein_id gnl|my_center|LOCUS_24800 4084 3536 gene locus_tag LOCUS_24810 4084 3536 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202184.1 protein_id gnl|my_center|LOCUS_24810 4620 4081 gene locus_tag LOCUS_24820 4620 4081 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_24820 5116 4643 gene locus_tag LOCUS_24830 5116 4643 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142456.1 protein_id gnl|my_center|LOCUS_24830 5751 5113 gene locus_tag LOCUS_24840 5751 5113 CDS product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528547.1 protein_id gnl|my_center|LOCUS_24840 6012 6971 gene locus_tag LOCUS_24850 6012 6971 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_24850 7166 8260 gene locus_tag LOCUS_24860 7166 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 8369 8593 gene locus_tag LOCUS_24870 8369 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 9816 8635 gene locus_tag LOCUS_24880 gene hemW 9816 8635 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229174.1 protein_id gnl|my_center|LOCUS_24880 9864 10562 gene locus_tag LOCUS_24890 9864 10562 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771596.1 protein_id gnl|my_center|LOCUS_24890 10578 12209 gene locus_tag LOCUS_24900 10578 12209 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268468.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence077 775 152 gene locus_tag LOCUS_24910 gene nth 775 152 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813856.1 protein_id gnl|my_center|LOCUS_24910 1479 772 gene locus_tag LOCUS_24920 1479 772 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112914.1 protein_id gnl|my_center|LOCUS_24920 2141 1476 gene locus_tag LOCUS_24930 gene rsxG 2141 1476 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_24930 3175 2138 gene locus_tag LOCUS_24940 gene rsxD 3175 2138 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706452.1 protein_id gnl|my_center|LOCUS_24940 4809 3172 gene locus_tag LOCUS_24950 4809 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 5176 4889 gene locus_tag LOCUS_24960 5176 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 5982 5407 gene locus_tag LOCUS_24970 gene rsxA 5982 5407 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418573.1 protein_id gnl|my_center|LOCUS_24970 6424 6059 gene locus_tag LOCUS_24980 6424 6059 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767605.1 protein_id gnl|my_center|LOCUS_24980 6682 6443 gene locus_tag LOCUS_24990 6682 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 8659 6776 gene locus_tag LOCUS_25000 8659 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 9612 8656 gene locus_tag LOCUS_25010 9612 8656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 11561 9624 gene locus_tag LOCUS_25020 11561 9624 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114252.1 protein_id gnl|my_center|LOCUS_25020 >Feature sequence078 2318 756 gene locus_tag LOCUS_25030 gene ahpF 2318 756 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315309.1 protein_id gnl|my_center|LOCUS_25030 3005 2439 gene locus_tag LOCUS_25040 gene ahpC 3005 2439 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083828.1 protein_id gnl|my_center|LOCUS_25040 3771 3259 gene locus_tag LOCUS_25050 3771 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 4050 3865 gene locus_tag LOCUS_25060 4050 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 4192 5040 gene locus_tag LOCUS_25070 4192 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720152.1 protein_id gnl|my_center|LOCUS_25070 5288 5079 gene locus_tag LOCUS_25080 5288 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 5175 6257 gene locus_tag LOCUS_25090 5175 6257 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089020.1 protein_id gnl|my_center|LOCUS_25090 6336 7508 gene locus_tag LOCUS_25100 6336 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 8022 7561 gene locus_tag LOCUS_25110 8022 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 9497 8019 gene locus_tag LOCUS_25120 9497 8019 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_25120 10066 9509 gene locus_tag LOCUS_25130 10066 9509 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_25130 10821 10063 gene locus_tag LOCUS_25140 10821 10063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 <12123 10818 gene locus_tag LOCUS_25150 <12123 10818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257071.1:NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein >Feature sequence079 1676 1146 gene locus_tag LOCUS_25160 1676 1146 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553800.1 protein_id gnl|my_center|LOCUS_25160 2937 1861 gene locus_tag LOCUS_25170 gene aroG 2937 1861 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_25170 4528 3155 gene locus_tag LOCUS_25180 4528 3155 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_25180 4674 5225 gene locus_tag LOCUS_25190 4674 5225 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526464.1 protein_id gnl|my_center|LOCUS_25190 5252 5614 gene locus_tag LOCUS_25200 5252 5614 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329333.1 protein_id gnl|my_center|LOCUS_25200 5622 5933 gene locus_tag LOCUS_25210 5622 5933 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_25210 5941 6543 gene locus_tag LOCUS_25220 5941 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064728.1 protein_id gnl|my_center|LOCUS_25220 6540 7451 gene locus_tag LOCUS_25230 6540 7451 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810478.1 protein_id gnl|my_center|LOCUS_25230 7444 8205 gene locus_tag LOCUS_25240 7444 8205 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192376.1 protein_id gnl|my_center|LOCUS_25240 9510 8209 gene locus_tag LOCUS_25250 9510 8209 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_25250 10484 9507 gene locus_tag LOCUS_25260 10484 9507 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_25260 10984 10481 gene locus_tag LOCUS_25270 gene pyrR 10984 10481 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_25270 11405 10959 gene locus_tag LOCUS_25280 gene ruvX 11405 10959 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213272.1 protein_id gnl|my_center|LOCUS_25280 11992 11405 gene locus_tag LOCUS_25290 11992 11405 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 protein_id gnl|my_center|LOCUS_25290 >Feature sequence080 296 562 gene locus_tag LOCUS_25300 296 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 1673 600 gene locus_tag LOCUS_25310 1673 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 2969 1683 gene locus_tag LOCUS_25320 gene hemL 2969 1683 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814987.1 protein_id gnl|my_center|LOCUS_25320 3600 2956 gene locus_tag LOCUS_25330 gene thiE 3600 2956 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038371.1 protein_id gnl|my_center|LOCUS_25330 4411 3590 gene locus_tag LOCUS_25340 4411 3590 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_25340 4489 4674 gene locus_tag LOCUS_25350 4489 4674 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186709.1 protein_id gnl|my_center|LOCUS_25350 4751 5929 gene locus_tag LOCUS_25360 4751 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 5950 6345 gene locus_tag LOCUS_25370 gene pilG 5950 6345 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_25370 6363 6728 gene locus_tag LOCUS_25380 6363 6728 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116220.1 protein_id gnl|my_center|LOCUS_25380 6826 7311 gene locus_tag LOCUS_25390 6826 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 7384 9471 gene locus_tag LOCUS_25400 gene pilJ 7384 9471 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence081 668 1894 gene locus_tag LOCUS_25410 668 1894 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_25410 1973 2191 gene locus_tag LOCUS_25420 1973 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 2663 3745 gene locus_tag LOCUS_25430 2663 3745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119359.1 protein_id gnl|my_center|LOCUS_25430 3732 4655 gene locus_tag LOCUS_25440 3732 4655 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092241.1 protein_id gnl|my_center|LOCUS_25440 4652 5431 gene locus_tag LOCUS_25450 4652 5431 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113878.1 protein_id gnl|my_center|LOCUS_25450 5428 6492 gene locus_tag LOCUS_25460 5428 6492 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113877.1 protein_id gnl|my_center|LOCUS_25460 7913 6585 gene locus_tag LOCUS_25470 gene glgC 7913 6585 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389901.1 protein_id gnl|my_center|LOCUS_25470 8720 8115 gene locus_tag LOCUS_25480 8720 8115 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877750.1 protein_id gnl|my_center|LOCUS_25480 8899 9948 gene locus_tag LOCUS_25490 gene fbaB 8899 9948 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129551.1 protein_id gnl|my_center|LOCUS_25490 9983 10288 gene locus_tag LOCUS_25500 9983 10288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 10844 10482 gene locus_tag LOCUS_25510 10844 10482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 11214 10825 gene locus_tag LOCUS_25520 11214 10825 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024360564.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence082 765 532 gene locus_tag LOCUS_25530 765 532 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095205.1 protein_id gnl|my_center|LOCUS_25530 1582 770 gene locus_tag LOCUS_25540 1582 770 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_25540 1938 1600 gene locus_tag LOCUS_25550 1938 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 2897 1935 gene locus_tag LOCUS_25560 2897 1935 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660365.1 protein_id gnl|my_center|LOCUS_25560 3912 2995 gene locus_tag LOCUS_25570 3912 2995 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169775301.1 protein_id gnl|my_center|LOCUS_25570 5041 3965 gene locus_tag LOCUS_25580 gene arsB 5041 3965 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272375.1 protein_id gnl|my_center|LOCUS_25580 5449 5045 gene locus_tag LOCUS_25590 5449 5045 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_25590 5803 5483 gene locus_tag LOCUS_25600 5803 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 6556 5930 gene locus_tag LOCUS_25610 6556 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 6754 7443 gene locus_tag LOCUS_25620 6754 7443 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405955.1 protein_id gnl|my_center|LOCUS_25620 7446 8114 gene locus_tag LOCUS_25630 7446 8114 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405954.1 protein_id gnl|my_center|LOCUS_25630 8631 8290 gene locus_tag LOCUS_25640 8631 8290 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 protein_id gnl|my_center|LOCUS_25640 8906 8631 gene locus_tag LOCUS_25650 8906 8631 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888120.1 protein_id gnl|my_center|LOCUS_25650 10050 8995 gene locus_tag LOCUS_25660 10050 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25660 10339 10623 gene locus_tag LOCUS_25670 10339 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 11094 11019 gene locus_tag LOCUS_t00340 11094 11019 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence083 1920 943 gene locus_tag LOCUS_25680 1920 943 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 protein_id gnl|my_center|LOCUS_25680 4149 2245 gene locus_tag LOCUS_25690 4149 2245 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807207.1 protein_id gnl|my_center|LOCUS_25690 4771 4256 gene locus_tag LOCUS_25700 4771 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 5226 4801 gene locus_tag LOCUS_25710 5226 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 5322 6035 gene locus_tag LOCUS_25720 gene ompR 5322 6035 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199523.1 protein_id gnl|my_center|LOCUS_25720 6032 7327 gene locus_tag LOCUS_25730 6032 7327 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090196.1 protein_id gnl|my_center|LOCUS_25730 7507 7328 gene locus_tag LOCUS_25740 7507 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 8625 7642 gene locus_tag LOCUS_25750 8625 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 10091 8622 gene locus_tag LOCUS_25760 10091 8622 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_25760 >Feature sequence084 555 725 gene locus_tag LOCUS_25770 555 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 852 1232 gene locus_tag LOCUS_25780 gene acpS 852 1232 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212541.1 protein_id gnl|my_center|LOCUS_25780 1229 2353 gene locus_tag LOCUS_25790 gene nagZ 1229 2353 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040152.1 protein_id gnl|my_center|LOCUS_25790 2384 3544 gene locus_tag LOCUS_25800 2384 3544 CDS product DUF2863 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039403.1 protein_id gnl|my_center|LOCUS_25800 3603 4253 gene locus_tag LOCUS_25810 3603 4253 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_25810 4255 4443 gene locus_tag LOCUS_25820 4255 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 4985 4476 gene locus_tag LOCUS_25830 4985 4476 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_25830 5746 4982 gene locus_tag LOCUS_25840 5746 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 5971 7860 gene locus_tag LOCUS_25850 gene uvrC 5971 7860 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157147433.1 protein_id gnl|my_center|LOCUS_25850 7918 8493 gene locus_tag LOCUS_25860 gene pgsA 7918 8493 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810356.1 protein_id gnl|my_center|LOCUS_25860 8625 8698 gene locus_tag LOCUS_t00350 8625 8698 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence085 689 96 gene locus_tag LOCUS_25870 gene rdgB 689 96 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687551.1 protein_id gnl|my_center|LOCUS_25870 1426 701 gene locus_tag LOCUS_25880 gene rph 1426 701 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_25880 2374 1454 gene locus_tag LOCUS_25890 2374 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 3312 2371 gene locus_tag LOCUS_25900 3312 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 3369 4265 gene locus_tag LOCUS_25910 3369 4265 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185526.1 protein_id gnl|my_center|LOCUS_25910 4274 4888 gene locus_tag LOCUS_25920 gene gmk 4274 4888 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_25920 5221 4910 gene locus_tag LOCUS_25930 5221 4910 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 protein_id gnl|my_center|LOCUS_25930 5445 5224 gene locus_tag LOCUS_25940 5445 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 6822 5593 gene locus_tag LOCUS_25950 6822 5593 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_25950 7098 6871 gene locus_tag LOCUS_25960 7098 6871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 8021 7095 gene locus_tag LOCUS_25970 gene argF 8021 7095 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064107.1 protein_id gnl|my_center|LOCUS_25970 9198 8026 gene locus_tag LOCUS_25980 9198 8026 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039570.1 protein_id gnl|my_center|LOCUS_25980 9298 10707 gene locus_tag LOCUS_25990 gene xseA 9298 10707 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812887.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence086 1011 1775 gene locus_tag LOCUS_26000 gene moeB 1011 1775 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038762.1 protein_id gnl|my_center|LOCUS_26000 2600 1836 gene locus_tag LOCUS_26010 2600 1836 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_26010 3923 2712 gene locus_tag LOCUS_26020 3923 2712 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114306.1 protein_id gnl|my_center|LOCUS_26020 4071 4391 gene locus_tag LOCUS_26030 gene grxD 4071 4391 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186955.1 protein_id gnl|my_center|LOCUS_26030 4533 5705 gene locus_tag LOCUS_26040 gene cttP 4533 5705 CDS product trichloroethylene chemotactic transducer CttP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106690.1 protein_id gnl|my_center|LOCUS_26040 5726 6091 gene locus_tag LOCUS_26050 5726 6091 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083943.1 protein_id gnl|my_center|LOCUS_26050 6161 6691 gene locus_tag LOCUS_26060 6161 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 6699 8414 gene locus_tag LOCUS_26070 6699 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 8424 8906 gene locus_tag LOCUS_26080 gene cheW 8424 8906 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199265.1 protein_id gnl|my_center|LOCUS_26080 >Feature sequence087 261 1223 gene locus_tag LOCUS_26090 261 1223 CDS product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118774.1 protein_id gnl|my_center|LOCUS_26090 1622 1272 gene locus_tag LOCUS_26100 1622 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 1922 2539 gene locus_tag LOCUS_26110 1922 2539 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_26110 2541 3629 gene locus_tag LOCUS_26120 2541 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 3660 4940 gene locus_tag LOCUS_26130 3660 4940 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_26130 5488 5075 gene locus_tag LOCUS_26140 5488 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 5598 6113 gene locus_tag LOCUS_26150 gene cheZ 5598 6113 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811909.1 protein_id gnl|my_center|LOCUS_26150 6316 6149 gene locus_tag LOCUS_26160 6316 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 7898 6357 gene locus_tag LOCUS_26170 7898 6357 CDS product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497115.1 protein_id gnl|my_center|LOCUS_26170 9270 8095 gene locus_tag LOCUS_26180 gene nirJ 9270 8095 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_26180 9806 9273 gene locus_tag LOCUS_26190 9806 9273 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 protein_id gnl|my_center|LOCUS_26190 10295 9831 gene locus_tag LOCUS_26200 10295 9831 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 protein_id gnl|my_center|LOCUS_26200 >Feature sequence088 <1 555 gene locus_tag LOCUS_26210 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269333.1:type VI secretion system membrane subunit TssM 904 599 gene locus_tag LOCUS_26220 904 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 3034 911 gene locus_tag LOCUS_26230 3034 911 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113236.1 protein_id gnl|my_center|LOCUS_26230 5895 3031 gene locus_tag LOCUS_26240 5895 3031 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888895.1 protein_id gnl|my_center|LOCUS_26240 6284 5898 gene locus_tag LOCUS_26250 6284 5898 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876264.1 protein_id gnl|my_center|LOCUS_26250 6607 6281 gene locus_tag LOCUS_26260 6607 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 7474 6662 gene locus_tag LOCUS_26270 7474 6662 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_26270 8357 7590 gene locus_tag LOCUS_26280 8357 7590 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294685.1 protein_id gnl|my_center|LOCUS_26280 9894 8398 gene locus_tag LOCUS_26290 gene lidL 9894 8398 CDS product Dot/Icm type IV secretion system effector LidL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946906.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence089 2052 685 gene locus_tag LOCUS_26300 2052 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 3944 2142 gene locus_tag LOCUS_26310 3944 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 4180 5178 gene locus_tag LOCUS_26320 4180 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 5281 7572 gene locus_tag LOCUS_26330 gene plpD 5281 7572 CDS product patatin-like phospholipase PlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_26330 7622 8101 gene locus_tag LOCUS_26340 7622 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 9745 8126 gene locus_tag LOCUS_26350 9745 8126 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538238.1 protein_id gnl|my_center|LOCUS_26350 <10498 9942 gene locus_tag LOCUS_26360 <10498 9942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194633.1:ATP-binding protein >Feature sequence090 461 171 gene locus_tag LOCUS_26370 461 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306985.1 protein_id gnl|my_center|LOCUS_26370 1406 465 gene locus_tag LOCUS_26380 1406 465 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306982.1 protein_id gnl|my_center|LOCUS_26380 1761 1459 gene locus_tag LOCUS_26390 1761 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 2590 1766 gene locus_tag LOCUS_26400 2590 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 4727 2598 gene locus_tag LOCUS_26410 4727 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 4825 5976 gene locus_tag LOCUS_26420 4825 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 6648 6019 gene locus_tag LOCUS_26430 6648 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124702.1 protein_id gnl|my_center|LOCUS_26430 9010 6653 gene locus_tag LOCUS_26440 9010 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 10025 9102 gene locus_tag LOCUS_26450 10025 9102 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731550.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence091 1943 492 gene locus_tag LOCUS_26460 gene glcD 1943 492 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765139.1 protein_id gnl|my_center|LOCUS_26460 3297 1921 gene locus_tag LOCUS_26470 3297 1921 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140919.1 protein_id gnl|my_center|LOCUS_26470 5067 3355 gene locus_tag LOCUS_26480 5067 3355 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143066.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26480 5474 4986 gene locus_tag LOCUS_26490 5474 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26490 5565 6323 gene locus_tag LOCUS_26500 5565 6323 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814178.1 protein_id gnl|my_center|LOCUS_26500 6391 7578 gene locus_tag LOCUS_26510 gene coaBC 6391 7578 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039645.1 protein_id gnl|my_center|LOCUS_26510 7583 8029 gene locus_tag LOCUS_26520 gene dut 7583 8029 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186718.1 protein_id gnl|my_center|LOCUS_26520 8353 9048 gene locus_tag LOCUS_26530 8353 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 9764 9147 gene locus_tag LOCUS_26540 gene lipB 9764 9147 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313884.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence092 681 2270 gene locus_tag LOCUS_26550 681 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 2368 2919 gene locus_tag LOCUS_26560 2368 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 2916 3206 gene locus_tag LOCUS_26570 2916 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 3229 3969 gene locus_tag LOCUS_26580 3229 3969 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_26580 4836 4138 gene locus_tag LOCUS_26590 4836 4138 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_26590 5771 5139 gene locus_tag LOCUS_26600 gene rqpR 5771 5139 CDS product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 protein_id gnl|my_center|LOCUS_26600 6675 5746 gene locus_tag LOCUS_26610 6675 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 9109 6692 gene locus_tag LOCUS_26620 9109 6692 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26620 >Feature sequence093 <1 554 gene locus_tag LOCUS_26630 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194146.1:glycolate oxidase subunit GlcF 647 1321 gene locus_tag LOCUS_26640 gene radC 647 1321 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_26640 1387 1620 gene locus_tag LOCUS_26650 gene rpmB 1387 1620 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216391.1 protein_id gnl|my_center|LOCUS_26650 1633 1800 gene locus_tag LOCUS_26660 gene rpmG 1633 1800 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185395.1 protein_id gnl|my_center|LOCUS_26660 3040 1874 gene locus_tag LOCUS_26670 3040 1874 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 protein_id gnl|my_center|LOCUS_26670 4368 3082 gene locus_tag LOCUS_26680 4368 3082 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522601.1 protein_id gnl|my_center|LOCUS_26680 4928 4365 gene locus_tag LOCUS_26690 4928 4365 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957925.1 protein_id gnl|my_center|LOCUS_26690 6226 4925 gene locus_tag LOCUS_26700 6226 4925 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186079.1 protein_id gnl|my_center|LOCUS_26700 7121 6213 gene locus_tag LOCUS_26710 7121 6213 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_26710 7312 8664 gene locus_tag LOCUS_26720 7312 8664 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_26720 8751 9077 gene locus_tag LOCUS_26730 8751 9077 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence094 1317 532 gene locus_tag LOCUS_26740 1317 532 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 protein_id gnl|my_center|LOCUS_26740 1495 2241 gene locus_tag LOCUS_26750 gene tpiA 1495 2241 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186004.1 protein_id gnl|my_center|LOCUS_26750 2254 2592 gene locus_tag LOCUS_26760 gene secG 2254 2592 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 protein_id gnl|my_center|LOCUS_26760 2624 2708 gene locus_tag LOCUS_t00360 2624 2708 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2856 3212 gene locus_tag LOCUS_26770 2856 3212 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224824.1 protein_id gnl|my_center|LOCUS_26770 3223 3699 gene locus_tag LOCUS_26780 3223 3699 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_26780 3718 4317 gene locus_tag LOCUS_26790 3718 4317 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 protein_id gnl|my_center|LOCUS_26790 4464 5717 gene locus_tag LOCUS_26800 4464 5717 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_26800 5726 6199 gene locus_tag LOCUS_26810 gene nuoE 5726 6199 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185492.1 protein_id gnl|my_center|LOCUS_26810 6196 7482 gene locus_tag LOCUS_26820 gene nuoF 6196 7482 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence095 520 1002 gene locus_tag LOCUS_26830 520 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 2543 1011 gene locus_tag LOCUS_26840 2543 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 2712 3107 gene locus_tag LOCUS_26850 2712 3107 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039223.1 protein_id gnl|my_center|LOCUS_26850 3200 3445 gene locus_tag LOCUS_26860 3200 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 3504 3887 gene locus_tag LOCUS_26870 gene sirB2 3504 3887 CDS product invasion regulator SirB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367107.1 protein_id gnl|my_center|LOCUS_26870 3884 4288 gene locus_tag LOCUS_26880 3884 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26880 4237 5031 gene locus_tag LOCUS_26890 4237 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26890 6290 5019 gene locus_tag LOCUS_26900 6290 5019 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895459.1 protein_id gnl|my_center|LOCUS_26900 6388 6930 gene locus_tag LOCUS_26910 gene msrA 6388 6930 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_26910 6944 7849 gene locus_tag LOCUS_26920 gene hslO 6944 7849 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550203.1 protein_id gnl|my_center|LOCUS_26920 >Feature sequence096 46 453 gene locus_tag LOCUS_26930 46 453 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194347.1 protein_id gnl|my_center|LOCUS_26930 554 1294 gene locus_tag LOCUS_26940 554 1294 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704857.1 protein_id gnl|my_center|LOCUS_26940 1291 2745 gene locus_tag LOCUS_26950 1291 2745 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704858.1 protein_id gnl|my_center|LOCUS_26950 2846 5152 gene locus_tag LOCUS_26960 2846 5152 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100071.1 protein_id gnl|my_center|LOCUS_26960 6148 5243 gene locus_tag LOCUS_26970 6148 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 6319 7509 gene locus_tag LOCUS_26980 6319 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 <8652 7526 gene locus_tag LOCUS_26990 <8652 7526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204185.1:bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC 7857 7937 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence097 646 200 gene locus_tag LOCUS_27000 646 200 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391721.1 protein_id gnl|my_center|LOCUS_27000 869 636 gene locus_tag LOCUS_27010 869 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 1034 1762 gene locus_tag LOCUS_27020 1034 1762 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_27020 2328 1882 gene locus_tag LOCUS_27030 2328 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 3122 2331 gene locus_tag LOCUS_27040 3122 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 3198 4481 gene locus_tag LOCUS_27050 3198 4481 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_27050 4527 4907 gene locus_tag LOCUS_27060 4527 4907 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_27060 4904 6019 gene locus_tag LOCUS_27070 4904 6019 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063858.1 protein_id gnl|my_center|LOCUS_27070 6069 7190 gene locus_tag LOCUS_27080 gene dacB 6069 7190 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064320.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27080 7076 7432 gene locus_tag LOCUS_27090 7076 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27090 >Feature sequence098 3598 1349 gene locus_tag LOCUS_27100 3598 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27100 3823 4086 gene locus_tag LOCUS_27110 3823 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 5046 5993 gene locus_tag LOCUS_27120 5046 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 6109 6486 gene locus_tag LOCUS_27130 6109 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 <7937 6670 gene locus_tag LOCUS_27140 <7937 6670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545132.1:ferrous iron transport protein B >Feature sequence099 1518 313 gene locus_tag LOCUS_27150 1518 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 2071 1673 gene locus_tag LOCUS_27160 2071 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 2350 3723 gene locus_tag LOCUS_27170 2350 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 6499 3833 gene locus_tag LOCUS_27180 6499 3833 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_27180 6975 6499 gene locus_tag LOCUS_27190 6975 6499 CDS product DUF494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815964.1 protein_id gnl|my_center|LOCUS_27190 7541 6975 gene locus_tag LOCUS_27200 7541 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence100 545 1330 gene locus_tag LOCUS_27210 gene ygiD 545 1330 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174107.1 protein_id gnl|my_center|LOCUS_27210 2353 1331 gene locus_tag LOCUS_27220 gene pyrC 2353 1331 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_27220 3219 2356 gene locus_tag LOCUS_27230 gene rsmI 3219 2356 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525682.1 protein_id gnl|my_center|LOCUS_27230 3404 3751 gene locus_tag LOCUS_27240 3404 3751 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707590.1 protein_id gnl|my_center|LOCUS_27240 3858 3905 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3933 4511 gene locus_tag LOCUS_27250 3933 4511 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219976.1 protein_id gnl|my_center|LOCUS_27250 4515 5084 gene locus_tag LOCUS_27260 4515 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 5157 5819 gene locus_tag LOCUS_27270 5157 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 5865 6563 gene locus_tag LOCUS_27280 5865 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 >Feature sequence101 424 1314 gene locus_tag LOCUS_27290 424 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 3288 1324 gene locus_tag LOCUS_27300 3288 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 3818 3294 gene locus_tag LOCUS_27310 3818 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 5756 3831 gene locus_tag LOCUS_27320 gene btuB 5756 3831 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172310.1 protein_id gnl|my_center|LOCUS_27320 5911 6930 gene locus_tag LOCUS_27330 5911 6930 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103236.1 protein_id gnl|my_center|LOCUS_27330 >Feature sequence102 3969 370 gene locus_tag LOCUS_27340 3969 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 5886 4159 gene locus_tag LOCUS_27350 5886 4159 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267488.1 protein_id gnl|my_center|LOCUS_27350 7254 6022 gene locus_tag LOCUS_27360 7254 6022 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929184.1 protein_id gnl|my_center|LOCUS_27360 >Feature sequence103 408 1415 gene locus_tag LOCUS_27370 gene hemX 408 1415 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211463.1 protein_id gnl|my_center|LOCUS_27370 1415 1852 gene locus_tag LOCUS_27380 1415 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 2879 1863 gene locus_tag LOCUS_27390 2879 1863 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_27390 2903 3790 gene locus_tag LOCUS_27400 2903 3790 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194782.1 protein_id gnl|my_center|LOCUS_27400 3917 4480 gene locus_tag LOCUS_27410 3917 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 4549 6180 gene locus_tag LOCUS_27420 4549 6180 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545554.1 protein_id gnl|my_center|LOCUS_27420 <7324 6184 gene locus_tag LOCUS_27430 <7324 6184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259342.1:deoxyribodipyrimidine photo-lyase >Feature sequence104 <1 755 gene locus_tag LOCUS_27440 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104738.1:FimV/HubP family polar landmark protein 756 1358 gene locus_tag LOCUS_27450 756 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 1343 2140 gene locus_tag LOCUS_27460 gene truA 1343 2140 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203245.1 protein_id gnl|my_center|LOCUS_27460 2151 2789 gene locus_tag LOCUS_27470 2151 2789 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_27470 2776 3975 gene locus_tag LOCUS_27480 gene trpB 2776 3975 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_27480 3977 4774 gene locus_tag LOCUS_27490 gene trpA 3977 4774 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 protein_id gnl|my_center|LOCUS_27490 4783 5646 gene locus_tag LOCUS_27500 gene accD 4783 5646 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_27500 5660 6958 gene locus_tag LOCUS_27510 gene folC 5660 6958 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039854.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence105 1337 372 gene locus_tag LOCUS_27520 1337 372 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_27520 2056 1478 gene locus_tag LOCUS_27530 2056 1478 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_27530 2660 2082 gene locus_tag LOCUS_27540 2660 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 3082 2693 gene locus_tag LOCUS_27550 3082 2693 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902059.1 protein_id gnl|my_center|LOCUS_27550 3517 3095 gene locus_tag LOCUS_27560 3517 3095 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526443.1 protein_id gnl|my_center|LOCUS_27560 4012 3590 gene locus_tag LOCUS_27570 4012 3590 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 protein_id gnl|my_center|LOCUS_27570 4178 5296 gene locus_tag LOCUS_27580 gene trpD 4178 5296 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531738.1 protein_id gnl|my_center|LOCUS_27580 5307 5615 gene locus_tag LOCUS_27590 5307 5615 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259323.1 protein_id gnl|my_center|LOCUS_27590 6594 5629 gene locus_tag LOCUS_27600 6594 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 7079 6636 gene locus_tag LOCUS_27610 7079 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 >Feature sequence106 107 544 gene locus_tag LOCUS_27620 107 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 713 534 gene locus_tag LOCUS_27630 713 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 636 929 gene locus_tag LOCUS_27640 gene lsrG 636 929 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098845.1 protein_id gnl|my_center|LOCUS_27640 951 1145 gene locus_tag LOCUS_27650 951 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 1264 2124 gene locus_tag LOCUS_27660 1264 2124 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142292.1 protein_id gnl|my_center|LOCUS_27660 2155 2601 gene locus_tag LOCUS_27670 gene msrB 2155 2601 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038734.1 protein_id gnl|my_center|LOCUS_27670 3987 2641 gene locus_tag LOCUS_27680 3987 2641 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_27680 5888 3984 gene locus_tag LOCUS_27690 5888 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 <6845 6202 gene locus_tag LOCUS_27700 <6845 6202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868956.1:NAD nucleotidase >Feature sequence107 <1 721 gene locus_tag LOCUS_27710 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244797.1:redoxin domain-containing protein 1342 743 gene locus_tag LOCUS_27720 1342 743 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_27720 2973 1339 gene locus_tag LOCUS_27730 2973 1339 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_27730 3571 3026 gene locus_tag LOCUS_27740 3571 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 5025 3673 gene locus_tag LOCUS_27750 gene radA 5025 3673 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930258.1 protein_id gnl|my_center|LOCUS_27750 5309 5103 gene locus_tag LOCUS_27760 5309 5103 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_27760 5709 6152 gene locus_tag LOCUS_27770 5709 6152 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_27770 6169 6396 gene locus_tag LOCUS_27780 6169 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 >Feature sequence108 1138 35 gene locus_tag LOCUS_27790 1138 35 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706047.1 protein_id gnl|my_center|LOCUS_27790 1342 2592 gene locus_tag LOCUS_27800 1342 2592 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_27800 2619 4280 gene locus_tag LOCUS_27810 2619 4280 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268468.1 protein_id gnl|my_center|LOCUS_27810 4290 4946 gene locus_tag LOCUS_27820 4290 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 4987 6351 gene locus_tag LOCUS_27830 4987 6351 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038711081.1 protein_id gnl|my_center|LOCUS_27830 >Feature sequence109 <1 619 gene locus_tag LOCUS_27840 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090709.1:HlyD family efflux transporter periplasmic adaptor subunit 704 1204 gene locus_tag LOCUS_27850 704 1204 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064487.1 protein_id gnl|my_center|LOCUS_27850 1470 1201 gene locus_tag LOCUS_27860 1470 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 2235 1822 gene locus_tag LOCUS_27870 2235 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 2420 3382 gene locus_tag LOCUS_27880 2420 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 3503 3919 gene locus_tag LOCUS_27890 3503 3919 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990749.1 protein_id gnl|my_center|LOCUS_27890 4441 3968 gene locus_tag LOCUS_27900 4441 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 4581 5156 gene locus_tag LOCUS_27910 4581 5156 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112585.1 protein_id gnl|my_center|LOCUS_27910 6059 5175 gene locus_tag LOCUS_27920 6059 5175 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920721.1 protein_id gnl|my_center|LOCUS_27920 <6602 6088 gene locus_tag LOCUS_27930 <6602 6088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090446.1:secretin N-terminal domain-containing protein >Feature sequence110 765 214 gene locus_tag LOCUS_27940 765 214 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388112.1 protein_id gnl|my_center|LOCUS_27940 1847 762 gene locus_tag LOCUS_27950 gene mtnA 1847 762 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_27950 1908 2492 gene locus_tag LOCUS_27960 1908 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 2689 2913 gene locus_tag LOCUS_27970 2689 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 2918 4438 gene locus_tag LOCUS_27980 gene ubiB 2918 4438 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 protein_id gnl|my_center|LOCUS_27980 5347 4571 gene locus_tag LOCUS_27990 5347 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence111 233 799 gene locus_tag LOCUS_28000 233 799 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199294.1 protein_id gnl|my_center|LOCUS_28000 796 1539 gene locus_tag LOCUS_28010 796 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 1694 2194 gene locus_tag LOCUS_28020 1694 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 3712 2222 gene locus_tag LOCUS_28030 gene trpE 3712 2222 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186866.1 protein_id gnl|my_center|LOCUS_28030 4572 3886 gene locus_tag LOCUS_28040 4572 3886 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_28040 5358 4672 gene locus_tag LOCUS_28050 gene rpe 5358 4672 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085122.1 protein_id gnl|my_center|LOCUS_28050 5746 6129 gene locus_tag LOCUS_28060 gene apaG 5746 6129 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186878.1 protein_id gnl|my_center|LOCUS_28060 >Feature sequence112 866 237 gene locus_tag LOCUS_28070 866 237 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029005.1 protein_id gnl|my_center|LOCUS_28070 1534 863 gene locus_tag LOCUS_28080 1534 863 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460533.1 protein_id gnl|my_center|LOCUS_28080 1606 2142 gene locus_tag LOCUS_28090 1606 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 2370 2143 gene locus_tag LOCUS_28100 2370 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941352.1 protein_id gnl|my_center|LOCUS_28100 3872 2385 gene locus_tag LOCUS_28110 3872 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 4828 3860 gene locus_tag LOCUS_28120 gene arsS 4828 3860 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_28120 5157 5825 gene locus_tag LOCUS_28130 5157 5825 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 protein_id gnl|my_center|LOCUS_28130 5812 6006 gene locus_tag LOCUS_28140 5812 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 >Feature sequence113 1387 1109 gene locus_tag LOCUS_28150 1387 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28150 2594 1458 gene locus_tag LOCUS_28160 2594 1458 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941915.1 protein_id gnl|my_center|LOCUS_28160 2896 2591 gene locus_tag LOCUS_28170 2896 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 4408 3002 gene locus_tag LOCUS_28180 gene htrA 4408 3002 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873435.1 protein_id gnl|my_center|LOCUS_28180 4744 5052 gene locus_tag LOCUS_28190 4744 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 5042 5392 gene locus_tag LOCUS_28200 5042 5392 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_28200 5729 5415 gene locus_tag LOCUS_28210 5729 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 >Feature sequence114 1308 778 gene locus_tag LOCUS_28220 1308 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 1721 1356 gene locus_tag LOCUS_28230 1721 1356 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932426.1 protein_id gnl|my_center|LOCUS_28230 1846 3684 gene locus_tag LOCUS_28240 1846 3684 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 protein_id gnl|my_center|LOCUS_28240 3694 3864 gene locus_tag LOCUS_28250 3694 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 3854 5233 gene locus_tag LOCUS_28260 3854 5233 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005032135.1 protein_id gnl|my_center|LOCUS_28260 >Feature sequence115 <1 512 gene locus_tag LOCUS_28270 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000247794.1:4Fe-4S binding protein 671 1897 gene locus_tag LOCUS_28280 671 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 2040 5141 gene locus_tag LOCUS_28290 2040 5141 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_28290 >Feature sequence116 439 1788 gene locus_tag LOCUS_28300 gene chrA 439 1788 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_28300 1791 2105 gene locus_tag LOCUS_28310 1791 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 2159 2779 gene locus_tag LOCUS_28320 2159 2779 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095305.1 protein_id gnl|my_center|LOCUS_28320 2815 3270 gene locus_tag LOCUS_28330 2815 3270 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 protein_id gnl|my_center|LOCUS_28330 3267 4475 gene locus_tag LOCUS_28340 3267 4475 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194502.1 protein_id gnl|my_center|LOCUS_28340 5437 4577 gene locus_tag LOCUS_28350 5437 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 5651 5427 gene locus_tag LOCUS_28360 5651 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 >Feature sequence117 673 719 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 836 1771 gene locus_tag LOCUS_28370 836 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 1828 3105 gene locus_tag LOCUS_28380 1828 3105 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808794.1 protein_id gnl|my_center|LOCUS_28380 3124 4134 gene locus_tag LOCUS_28390 3124 4134 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_28390 4381 4719 gene locus_tag LOCUS_28400 4381 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 >Feature sequence118 1020 571 gene locus_tag LOCUS_28410 1020 571 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771285.1 protein_id gnl|my_center|LOCUS_28410 1672 1022 gene locus_tag LOCUS_28420 1672 1022 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768984.1 protein_id gnl|my_center|LOCUS_28420 1835 2047 gene locus_tag LOCUS_28430 1835 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 2153 3676 gene locus_tag LOCUS_28440 2153 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 >Feature sequence119 556 17 gene locus_tag LOCUS_28450 556 17 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_28450 617 799 gene locus_tag LOCUS_28460 617 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 867 1754 gene locus_tag LOCUS_28470 867 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 1775 2830 gene locus_tag LOCUS_28480 1775 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 2925 3230 gene locus_tag LOCUS_28490 2925 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 3209 4186 gene locus_tag LOCUS_28500 3209 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28500 >Feature sequence120 >Feature sequence121 818 2884 gene locus_tag LOCUS_28510 gene ppk1 818 2884 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192053.1 protein_id gnl|my_center|LOCUS_28510 3476 2925 gene locus_tag LOCUS_28520 3476 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085577.1 protein_id gnl|my_center|LOCUS_28520 >Feature sequence122 122 1270 gene locus_tag LOCUS_28530 gene egtB 122 1270 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339021.1 protein_id gnl|my_center|LOCUS_28530 2314 1364 gene locus_tag LOCUS_28540 gene egtD 2314 1364 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931515.1 protein_id gnl|my_center|LOCUS_28540 2910 2311 gene locus_tag LOCUS_28550 2910 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 >Feature sequence123 591 1109 gene locus_tag LOCUS_28560 591 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 1102 2589 gene locus_tag LOCUS_28570 1102 2589 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546144.1 protein_id gnl|my_center|LOCUS_28570 3222 2686 gene locus_tag LOCUS_28580 3222 2686 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_28580 >Feature sequence124 99 1505 gene locus_tag LOCUS_28590 gene pabB 99 1505 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267422.1 protein_id gnl|my_center|LOCUS_28590 2940 1570 gene locus_tag LOCUS_28600 2940 1570 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090883.1 protein_id gnl|my_center|LOCUS_28600 3611 2937 gene locus_tag LOCUS_28610 3611 2937 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 protein_id gnl|my_center|LOCUS_28610 >Feature sequence125 907 734 gene locus_tag LOCUS_28620 907 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 888 1724 gene locus_tag LOCUS_28630 888 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 1753 2922 gene locus_tag LOCUS_28640 1753 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 >Feature sequence126 920 174 gene locus_tag LOCUS_28650 920 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 1988 1059 gene locus_tag LOCUS_28660 1988 1059 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 protein_id gnl|my_center|LOCUS_28660 2253 3137 gene locus_tag LOCUS_28670 2253 3137 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761242.1 protein_id gnl|my_center|LOCUS_28670 >Feature sequence127 774 226 gene locus_tag LOCUS_28680 774 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 1321 764 gene locus_tag LOCUS_28690 1321 764 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055993.1 protein_id gnl|my_center|LOCUS_28690 2070 1456 gene locus_tag LOCUS_28700 gene fixJ 2070 1456 CDS product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970952.1 protein_id gnl|my_center|LOCUS_28700 3254 2067 gene locus_tag LOCUS_28710 3254 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence128 <1 603 gene locus_tag LOCUS_28720 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583323.1:glycosyltransferase family 4 protein 600 1751 gene locus_tag LOCUS_28730 600 1751 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_28730 2015 1767 gene locus_tag LOCUS_28740 2015 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 <3230 2025 gene locus_tag LOCUS_28750 <3230 2025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056367.1:pyruvate kinase >Feature sequence129 180 398 gene locus_tag LOCUS_28760 180 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 632 1453 gene locus_tag LOCUS_28770 632 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 2602 1445 gene locus_tag LOCUS_28780 2602 1445 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113459.1 protein_id gnl|my_center|LOCUS_28780 >Feature sequence130 866 180 gene locus_tag LOCUS_28790 866 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 2128 881 gene locus_tag LOCUS_28800 2128 881 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932090.1 protein_id gnl|my_center|LOCUS_28800 >Feature sequence131 <1 1117 gene locus_tag LOCUS_28810 <1 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940349.1:outer membrane protein transport protein 1206 2084 gene locus_tag LOCUS_28820 1206 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 2540 2178 gene locus_tag LOCUS_28830 2540 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 >Feature sequence132 <1 994 gene locus_tag LOCUS_28840 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192700.1:ATP-dependent DNA helicase 1398 1835 gene locus_tag LOCUS_28850 1398 1835 CDS product HIRAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940728.1 protein_id gnl|my_center|LOCUS_28850 1872 2603 gene locus_tag LOCUS_28860 gene tsaB 1872 2603 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038052.1 protein_id gnl|my_center|LOCUS_28860 >Feature sequence133 495 214 gene locus_tag LOCUS_28870 495 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 1643 492 gene locus_tag LOCUS_28880 1643 492 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880596.1 protein_id gnl|my_center|LOCUS_28880 2004 1687 gene locus_tag LOCUS_28890 2004 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 <2980 2148 gene locus_tag LOCUS_28900 <2980 2148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_039644929.1:membrane protein