>Feature sequence001 134 3997 gene locus_tag LOCUS_00010 134 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3997 6129 gene locus_tag LOCUS_00020 3997 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 6166 11976 gene locus_tag LOCUS_00030 6166 11976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 12024 16733 gene locus_tag LOCUS_00040 12024 16733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 16915 19038 gene locus_tag LOCUS_00050 16915 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 19236 27380 gene locus_tag LOCUS_00060 19236 27380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 27698 27910 gene locus_tag LOCUS_00070 27698 27910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 28535 29419 gene locus_tag LOCUS_00080 28535 29419 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_00080 29873 29559 gene locus_tag LOCUS_00090 29873 29559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 30539 30453 gene locus_tag LOCUS_t00010 30539 30453 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 31237 30590 gene locus_tag LOCUS_00100 31237 30590 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_00100 31665 31234 gene locus_tag LOCUS_00110 31665 31234 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963521.1 protein_id gnl|my_center|LOCUS_00110 32797 31787 gene locus_tag LOCUS_00120 32797 31787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 34181 32940 gene locus_tag LOCUS_00130 34181 32940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 34632 36935 gene locus_tag LOCUS_00140 34632 36935 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879844.1 protein_id gnl|my_center|LOCUS_00140 36938 37975 gene locus_tag LOCUS_00150 36938 37975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 38002 42015 gene locus_tag LOCUS_00160 38002 42015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 42244 43107 gene locus_tag LOCUS_00170 42244 43107 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_00170 43118 44188 gene locus_tag LOCUS_00180 43118 44188 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476434.1 protein_id gnl|my_center|LOCUS_00180 46452 44236 gene locus_tag LOCUS_00190 46452 44236 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454973.1 protein_id gnl|my_center|LOCUS_00190 47639 46584 gene locus_tag LOCUS_00200 gene rhaS 47639 46584 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978052.1 protein_id gnl|my_center|LOCUS_00200 >Feature sequence002 63 995 gene locus_tag LOCUS_00210 63 995 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922118.1 protein_id gnl|my_center|LOCUS_00210 3296 1185 gene locus_tag LOCUS_00220 3296 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 4381 3359 gene locus_tag LOCUS_00230 4381 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 4563 5093 gene locus_tag LOCUS_00240 4563 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 6813 5134 gene locus_tag LOCUS_00250 6813 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 7714 6815 gene locus_tag LOCUS_00260 gene cysD 7714 6815 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_00260 8054 7740 gene locus_tag LOCUS_00270 8054 7740 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963432.1 protein_id gnl|my_center|LOCUS_00270 9726 8038 gene locus_tag LOCUS_00280 9726 8038 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963431.1 protein_id gnl|my_center|LOCUS_00280 10801 9743 gene locus_tag LOCUS_00290 10801 9743 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942002.1 protein_id gnl|my_center|LOCUS_00290 11618 10803 gene locus_tag LOCUS_00300 gene cysW 11618 10803 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142072.1 protein_id gnl|my_center|LOCUS_00300 12453 11620 gene locus_tag LOCUS_00310 gene cysT 12453 11620 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227884.1 protein_id gnl|my_center|LOCUS_00310 13498 12467 gene locus_tag LOCUS_00320 13498 12467 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 protein_id gnl|my_center|LOCUS_00320 13869 14810 gene locus_tag LOCUS_00330 13869 14810 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_00330 15422 14796 gene locus_tag LOCUS_00340 15422 14796 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437747.1 protein_id gnl|my_center|LOCUS_00340 15925 15422 gene locus_tag LOCUS_00350 gene cobO 15925 15422 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546229.1 protein_id gnl|my_center|LOCUS_00350 17407 15929 gene locus_tag LOCUS_00360 17407 15929 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 protein_id gnl|my_center|LOCUS_00360 18395 17391 gene locus_tag LOCUS_00370 18395 17391 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016795.1 protein_id gnl|my_center|LOCUS_00370 19353 18385 gene locus_tag LOCUS_00380 gene cbiB 19353 18385 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989705.1 protein_id gnl|my_center|LOCUS_00380 19870 19325 gene locus_tag LOCUS_00390 19870 19325 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680314.1 protein_id gnl|my_center|LOCUS_00390 20232 19867 gene locus_tag LOCUS_00400 20232 19867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 20978 20217 gene locus_tag LOCUS_00410 gene cobS 20978 20217 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680312.1 protein_id gnl|my_center|LOCUS_00410 21483 20980 gene locus_tag LOCUS_00420 gene cobU 21483 20980 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948598.1 protein_id gnl|my_center|LOCUS_00420 22517 21483 gene locus_tag LOCUS_00430 gene cobT 22517 21483 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_00430 23836 22496 gene locus_tag LOCUS_00440 23836 22496 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861968.1 protein_id gnl|my_center|LOCUS_00440 24987 23833 gene locus_tag LOCUS_00450 24987 23833 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943626.1 protein_id gnl|my_center|LOCUS_00450 25708 24989 gene locus_tag LOCUS_00460 gene cobK 25708 24989 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721598.1 protein_id gnl|my_center|LOCUS_00460 26429 25701 gene locus_tag LOCUS_00470 gene cobJ 26429 25701 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016778.1 protein_id gnl|my_center|LOCUS_00470 27437 26436 gene locus_tag LOCUS_00480 gene cbiG 27437 26436 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948632.1 protein_id gnl|my_center|LOCUS_00480 28186 27434 gene locus_tag LOCUS_00490 28186 27434 CDS product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891957.1 protein_id gnl|my_center|LOCUS_00490 29255 28188 gene locus_tag LOCUS_00500 gene cbiD 29255 28188 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836528.1 protein_id gnl|my_center|LOCUS_00500 32439 29323 gene locus_tag LOCUS_00510 gene ileS 32439 29323 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_00510 33209 32769 gene locus_tag LOCUS_00520 33209 32769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 33976 33224 gene locus_tag LOCUS_00530 33976 33224 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 protein_id gnl|my_center|LOCUS_00530 34525 34061 gene locus_tag LOCUS_00540 34525 34061 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213920.1 protein_id gnl|my_center|LOCUS_00540 35254 34613 gene locus_tag LOCUS_00550 35254 34613 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_00550 36447 35263 gene locus_tag LOCUS_00560 36447 35263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 37670 36543 gene locus_tag LOCUS_00570 37670 36543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 39449 37728 gene locus_tag LOCUS_00580 39449 37728 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_00580 41045 39465 gene locus_tag LOCUS_00590 41045 39465 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_00590 >Feature sequence003 136 1614 gene locus_tag LOCUS_00600 gene spoIVA 136 1614 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_00600 1629 2321 gene locus_tag LOCUS_00610 1629 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 5676 2446 gene locus_tag LOCUS_00620 5676 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 5835 6401 gene locus_tag LOCUS_00630 5835 6401 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_00630 6361 6795 gene locus_tag LOCUS_00640 6361 6795 CDS product DUF1893 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761597.1 protein_id gnl|my_center|LOCUS_00640 8588 7347 gene locus_tag LOCUS_00650 8588 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 8849 11449 gene locus_tag LOCUS_00660 gene polA 8849 11449 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_00660 11643 12491 gene locus_tag LOCUS_00670 11643 12491 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964901.1 protein_id gnl|my_center|LOCUS_00670 12493 13155 gene locus_tag LOCUS_00680 12493 13155 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 protein_id gnl|my_center|LOCUS_00680 13163 13903 gene locus_tag LOCUS_00690 13163 13903 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059649.1 protein_id gnl|my_center|LOCUS_00690 13896 14702 gene locus_tag LOCUS_00700 13896 14702 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815052.1 protein_id gnl|my_center|LOCUS_00700 14707 15117 gene locus_tag LOCUS_00710 14707 15117 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458892.1 protein_id gnl|my_center|LOCUS_00710 15863 15141 gene locus_tag LOCUS_00720 15863 15141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 16824 15988 gene locus_tag LOCUS_00730 16824 15988 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_00730 16965 17840 gene locus_tag LOCUS_00740 16965 17840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 18747 17899 gene locus_tag LOCUS_00750 18747 17899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 19461 18769 gene locus_tag LOCUS_00760 19461 18769 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262722.1 protein_id gnl|my_center|LOCUS_00760 21301 19703 gene locus_tag LOCUS_00770 21301 19703 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_00770 21490 22635 gene locus_tag LOCUS_00780 21490 22635 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_00780 22656 23792 gene locus_tag LOCUS_00790 22656 23792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 23906 24919 gene locus_tag LOCUS_00800 23906 24919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 26456 25146 gene locus_tag LOCUS_00810 26456 25146 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_00810 26608 27339 gene locus_tag LOCUS_00820 26608 27339 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_00820 27699 28001 gene locus_tag LOCUS_00830 27699 28001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 28771 28166 gene locus_tag LOCUS_00840 28771 28166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 >Feature sequence004 <1 1031 gene locus_tag LOCUS_00850 <1 1031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010081095.1:phosphoribosylformylglycinamidine cyclo-ligase 1142 1738 gene locus_tag LOCUS_00860 gene purN 1142 1738 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047940.1 protein_id gnl|my_center|LOCUS_00860 1738 2226 gene locus_tag LOCUS_00870 1738 2226 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_00870 2241 2954 gene locus_tag LOCUS_00880 2241 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 2992 4164 gene locus_tag LOCUS_00890 2992 4164 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_00890 4319 4161 gene locus_tag LOCUS_00900 4319 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 4405 5664 gene locus_tag LOCUS_00910 gene purD 4405 5664 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_00910 5713 6186 gene locus_tag LOCUS_00920 5713 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 6307 6789 gene locus_tag LOCUS_00930 6307 6789 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_00930 7217 7708 gene locus_tag LOCUS_00940 7217 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 7705 9768 gene locus_tag LOCUS_00950 7705 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 9785 10375 gene locus_tag LOCUS_00960 9785 10375 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583757.1 protein_id gnl|my_center|LOCUS_00960 10392 11393 gene locus_tag LOCUS_00970 10392 11393 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_00970 11425 12249 gene locus_tag LOCUS_00980 11425 12249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 12263 12763 gene locus_tag LOCUS_00990 12263 12763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 12779 14884 gene locus_tag LOCUS_01000 12779 14884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 14912 15667 gene locus_tag LOCUS_01010 14912 15667 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902702.1 protein_id gnl|my_center|LOCUS_01010 15757 16548 gene locus_tag LOCUS_01020 gene minD 15757 16548 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816779.1 protein_id gnl|my_center|LOCUS_01020 16570 16974 gene locus_tag LOCUS_01030 gene mgsA 16570 16974 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_01030 17328 18479 gene locus_tag LOCUS_01040 17328 18479 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436749.1 protein_id gnl|my_center|LOCUS_01040 18493 18984 gene locus_tag LOCUS_01050 gene trmL 18493 18984 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_01050 19162 20028 gene locus_tag LOCUS_01060 19162 20028 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438997.1 protein_id gnl|my_center|LOCUS_01060 20067 21281 gene locus_tag LOCUS_01070 20067 21281 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_01070 21318 22505 gene locus_tag LOCUS_01080 21318 22505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 22498 24426 gene locus_tag LOCUS_01090 gene metG 22498 24426 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_01090 25889 24849 gene locus_tag LOCUS_01100 gene ilvC 25889 24849 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_01100 26430 25930 gene locus_tag LOCUS_01110 gene ilvN 26430 25930 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 protein_id gnl|my_center|LOCUS_01110 28108 26432 gene locus_tag LOCUS_01120 28108 26432 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_01120 >Feature sequence005 120 725 gene locus_tag LOCUS_01130 120 725 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 protein_id gnl|my_center|LOCUS_01130 2012 786 gene locus_tag LOCUS_01140 2012 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 3364 2027 gene locus_tag LOCUS_01150 3364 2027 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_01150 3711 3349 gene locus_tag LOCUS_01160 3711 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 4700 3783 gene locus_tag LOCUS_01170 4700 3783 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_01170 5986 4697 gene locus_tag LOCUS_01180 gene hemL 5986 4697 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712943.1 protein_id gnl|my_center|LOCUS_01180 6172 5993 gene locus_tag LOCUS_01190 6172 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 6158 6310 gene locus_tag LOCUS_01200 6158 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 6411 7145 gene locus_tag LOCUS_01210 6411 7145 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812271.1 protein_id gnl|my_center|LOCUS_01210 7160 7444 gene locus_tag LOCUS_01220 7160 7444 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986836.1 protein_id gnl|my_center|LOCUS_01220 7434 8213 gene locus_tag LOCUS_01230 gene cbiQ 7434 8213 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812266.1 protein_id gnl|my_center|LOCUS_01230 8213 9055 gene locus_tag LOCUS_01240 8213 9055 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345602.1 protein_id gnl|my_center|LOCUS_01240 9058 9741 gene locus_tag LOCUS_01250 gene cobI 9058 9741 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 protein_id gnl|my_center|LOCUS_01250 9761 10894 gene locus_tag LOCUS_01260 9761 10894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 10891 11757 gene locus_tag LOCUS_01270 gene hemC 10891 11757 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886587.1 protein_id gnl|my_center|LOCUS_01270 11763 13196 gene locus_tag LOCUS_01280 gene cobA 11763 13196 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898657.1 protein_id gnl|my_center|LOCUS_01280 13193 14155 gene locus_tag LOCUS_01290 gene hemB 13193 14155 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963427.1 protein_id gnl|my_center|LOCUS_01290 14155 14742 gene locus_tag LOCUS_01300 14155 14742 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811192.1 protein_id gnl|my_center|LOCUS_01300 14739 15494 gene locus_tag LOCUS_01310 14739 15494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 18444 15547 gene locus_tag LOCUS_01320 18444 15547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 19568 18705 gene locus_tag LOCUS_01330 19568 18705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 20713 19565 gene locus_tag LOCUS_01340 gene dltB 20713 19565 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382500.1 protein_id gnl|my_center|LOCUS_01340 20978 20733 gene locus_tag LOCUS_01350 20978 20733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 22590 21055 gene locus_tag LOCUS_01360 22590 21055 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_01360 24136 22601 gene locus_tag LOCUS_01370 24136 22601 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_01370 25572 24502 gene locus_tag LOCUS_01380 25572 24502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 25904 25563 gene locus_tag LOCUS_01390 25904 25563 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_01390 26544 26242 gene locus_tag LOCUS_01400 26544 26242 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813638.1 protein_id gnl|my_center|LOCUS_01400 26748 26596 gene locus_tag LOCUS_01410 26748 26596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 27792 27028 gene locus_tag LOCUS_01420 27792 27028 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865121.1 protein_id gnl|my_center|LOCUS_01420 >Feature sequence006 2935 293 gene locus_tag LOCUS_01430 2935 293 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_01430 3142 2957 gene locus_tag LOCUS_01440 3142 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 3354 3992 gene locus_tag LOCUS_01450 3354 3992 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048153.1 protein_id gnl|my_center|LOCUS_01450 5882 4029 gene locus_tag LOCUS_01460 gene asnB 5882 4029 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233080.1 protein_id gnl|my_center|LOCUS_01460 6438 5968 gene locus_tag LOCUS_01470 gene pduV 6438 5968 CDS product propanediol utilization protein PduV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826280.1 protein_id gnl|my_center|LOCUS_01470 6812 6435 gene locus_tag LOCUS_01480 6812 6435 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904036.1 protein_id gnl|my_center|LOCUS_01480 7337 6882 gene locus_tag LOCUS_01490 7337 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 8522 7410 gene locus_tag LOCUS_01500 8522 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 9524 8535 gene locus_tag LOCUS_01510 9524 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 10445 9606 gene locus_tag LOCUS_01520 10445 9606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 12598 10457 gene locus_tag LOCUS_01530 12598 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 14463 12637 gene locus_tag LOCUS_01540 14463 12637 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802963.1 protein_id gnl|my_center|LOCUS_01540 16281 14533 gene locus_tag LOCUS_01550 16281 14533 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_01550 17945 16317 gene locus_tag LOCUS_01560 17945 16317 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_01560 19130 17955 gene locus_tag LOCUS_01570 19130 17955 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_01570 19609 19127 gene locus_tag LOCUS_01580 19609 19127 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_01580 20778 20008 gene locus_tag LOCUS_01590 gene rhaR 20778 20008 CDS product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 protein_id gnl|my_center|LOCUS_01590 21406 21179 gene locus_tag LOCUS_01600 21406 21179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 21527 22294 gene locus_tag LOCUS_01610 21527 22294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 23279 22338 gene locus_tag LOCUS_01620 23279 22338 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526539.1 protein_id gnl|my_center|LOCUS_01620 23534 23358 gene locus_tag LOCUS_01630 23534 23358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 25965 23629 gene locus_tag LOCUS_01640 25965 23629 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_01640 >Feature sequence007 2544 160 gene locus_tag LOCUS_01650 2544 160 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_01650 8282 2652 gene locus_tag LOCUS_01660 8282 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 8448 9293 gene locus_tag LOCUS_01670 8448 9293 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966103.1 protein_id gnl|my_center|LOCUS_01670 9589 9281 gene locus_tag LOCUS_01680 9589 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01680 15559 10157 gene locus_tag LOCUS_01690 15559 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 15861 15556 gene locus_tag LOCUS_01700 15861 15556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 16614 15973 gene locus_tag LOCUS_01710 16614 15973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 16868 16599 gene locus_tag LOCUS_01720 16868 16599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 17559 17215 gene locus_tag LOCUS_01730 17559 17215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 18091 17543 gene locus_tag LOCUS_01740 18091 17543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 18490 18299 gene locus_tag LOCUS_01750 18490 18299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 20472 18625 gene locus_tag LOCUS_01760 20472 18625 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281991.1 protein_id gnl|my_center|LOCUS_01760 20793 21794 gene locus_tag LOCUS_01770 20793 21794 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080613.1 protein_id gnl|my_center|LOCUS_01770 21815 22801 gene locus_tag LOCUS_01780 gene mgrA 21815 22801 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878153.1 protein_id gnl|my_center|LOCUS_01780 >Feature sequence008 1553 141 gene locus_tag LOCUS_01790 1553 141 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084045.1 protein_id gnl|my_center|LOCUS_01790 1965 1570 gene locus_tag LOCUS_01800 1965 1570 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964000.1 protein_id gnl|my_center|LOCUS_01800 3728 2031 gene locus_tag LOCUS_01810 gene atzF 3728 2031 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268766.1 protein_id gnl|my_center|LOCUS_01810 7319 3732 gene locus_tag LOCUS_01820 gene uca 7319 3732 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138224727.1 protein_id gnl|my_center|LOCUS_01820 7990 7343 gene locus_tag LOCUS_01830 7990 7343 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_01830 8728 8009 gene locus_tag LOCUS_01840 8728 8009 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 protein_id gnl|my_center|LOCUS_01840 9703 8948 gene locus_tag LOCUS_01850 9703 8948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 12121 9821 gene locus_tag LOCUS_01860 12121 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 12860 12237 gene locus_tag LOCUS_01870 12860 12237 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_01870 14282 12882 gene locus_tag LOCUS_01880 14282 12882 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_01880 16073 14301 gene locus_tag LOCUS_01890 16073 14301 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876586.1 protein_id gnl|my_center|LOCUS_01890 16713 16105 gene locus_tag LOCUS_01900 16713 16105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 17040 16732 gene locus_tag LOCUS_01910 17040 16732 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_01910 17191 17018 gene locus_tag LOCUS_01920 17191 17018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 17784 17362 gene locus_tag LOCUS_01930 17784 17362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 19720 17822 gene locus_tag LOCUS_01940 19720 17822 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_01940 20779 19733 gene locus_tag LOCUS_01950 20779 19733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 21107 20796 gene locus_tag LOCUS_01960 21107 20796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 22555 21188 gene locus_tag LOCUS_01970 22555 21188 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_01970 >Feature sequence009 76 1617 gene locus_tag LOCUS_01980 76 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 1716 3125 gene locus_tag LOCUS_01990 gene cysS 1716 3125 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048360.1 protein_id gnl|my_center|LOCUS_01990 3299 3697 gene locus_tag LOCUS_02000 3299 3697 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357282.1 protein_id gnl|my_center|LOCUS_02000 3720 4568 gene locus_tag LOCUS_02010 3720 4568 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_02010 4568 5497 gene locus_tag LOCUS_02020 4568 5497 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_02020 5515 6063 gene locus_tag LOCUS_02030 5515 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 6249 6734 gene locus_tag LOCUS_02040 6249 6734 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_02040 6797 7486 gene locus_tag LOCUS_02050 gene ispD 6797 7486 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048363.1 protein_id gnl|my_center|LOCUS_02050 7483 7950 gene locus_tag LOCUS_02060 gene ispF 7483 7950 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_02060 7964 8920 gene locus_tag LOCUS_02070 7964 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 10404 9139 gene locus_tag LOCUS_02080 gene aroA 10404 9139 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664630.1 protein_id gnl|my_center|LOCUS_02080 10518 12050 gene locus_tag LOCUS_02090 10518 12050 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966489.1 protein_id gnl|my_center|LOCUS_02090 12121 12897 gene locus_tag LOCUS_02100 12121 12897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 13052 13327 gene locus_tag LOCUS_02110 13052 13327 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043904.1 protein_id gnl|my_center|LOCUS_02110 13441 13683 gene locus_tag LOCUS_02120 13441 13683 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_02120 13751 14050 gene locus_tag LOCUS_02130 13751 14050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 14047 14481 gene locus_tag LOCUS_02140 gene yabQ 14047 14481 CDS product spore cortex biosynthesis protein YabQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359440.1 protein_id gnl|my_center|LOCUS_02140 14471 14791 gene locus_tag LOCUS_02150 14471 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 14815 15261 gene locus_tag LOCUS_02160 14815 15261 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966482.1 protein_id gnl|my_center|LOCUS_02160 15329 17407 gene locus_tag LOCUS_02170 15329 17407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 17425 18870 gene locus_tag LOCUS_02180 17425 18870 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964320.1 protein_id gnl|my_center|LOCUS_02180 18888 19907 gene locus_tag LOCUS_02190 18888 19907 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_02190 20185 20634 gene locus_tag LOCUS_02200 20185 20634 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_02200 20636 21094 gene locus_tag LOCUS_02210 gene rimI 20636 21094 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_02210 21099 22100 gene locus_tag LOCUS_02220 gene tsaD 21099 22100 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_02220 >Feature sequence010 1789 416 gene locus_tag LOCUS_02230 gene radA 1789 416 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_02230 2218 3609 gene locus_tag LOCUS_02240 2218 3609 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_02240 3637 4086 gene locus_tag LOCUS_02250 gene mscL 3637 4086 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338438.1 protein_id gnl|my_center|LOCUS_02250 4977 4126 gene locus_tag LOCUS_02260 4977 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02260 5949 4993 gene locus_tag LOCUS_02270 5949 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02270 6076 6164 gene locus_tag LOCUS_t00020 6076 6164 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6232 7995 gene locus_tag LOCUS_02280 6232 7995 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_02280 9565 8030 gene locus_tag LOCUS_02290 gene cls 9565 8030 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 protein_id gnl|my_center|LOCUS_02290 10109 9588 gene locus_tag LOCUS_02300 10109 9588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 10875 10237 gene locus_tag LOCUS_02310 gene hisIE 10875 10237 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_02310 11463 10912 gene locus_tag LOCUS_02320 gene pgsA 11463 10912 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 protein_id gnl|my_center|LOCUS_02320 12791 11463 gene locus_tag LOCUS_02330 gene rimO 12791 11463 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_02330 13278 12796 gene locus_tag LOCUS_02340 13278 12796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 14462 13275 gene locus_tag LOCUS_02350 14462 13275 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853125.1 protein_id gnl|my_center|LOCUS_02350 15677 14469 gene locus_tag LOCUS_02360 gene ilvA 15677 14469 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_02360 16120 17478 gene locus_tag LOCUS_02370 16120 17478 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_02370 17691 17615 gene locus_tag LOCUS_t00030 17691 17615 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 18942 17809 gene locus_tag LOCUS_02380 18942 17809 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510611.1 protein_id gnl|my_center|LOCUS_02380 19216 19656 gene locus_tag LOCUS_02390 gene rplM 19216 19656 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_02390 19671 20066 gene locus_tag LOCUS_02400 gene rpsI 19671 20066 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_02400 21501 20278 gene locus_tag LOCUS_02410 21501 20278 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462194.1 protein_id gnl|my_center|LOCUS_02410 >Feature sequence011 1030 146 gene locus_tag LOCUS_02420 1030 146 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_02420 1253 1023 gene locus_tag LOCUS_02430 1253 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 2440 1256 gene locus_tag LOCUS_02440 gene xseA 2440 1256 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965382.1 protein_id gnl|my_center|LOCUS_02440 3381 2443 gene locus_tag LOCUS_02450 3381 2443 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_02450 3791 3378 gene locus_tag LOCUS_02460 gene nusB 3791 3378 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101470.1 protein_id gnl|my_center|LOCUS_02460 4439 3909 gene locus_tag LOCUS_02470 4439 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 5155 4499 gene locus_tag LOCUS_02480 5155 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 5648 5157 gene locus_tag LOCUS_02490 5648 5157 CDS product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428419.1 protein_id gnl|my_center|LOCUS_02490 6090 5641 gene locus_tag LOCUS_02500 6090 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 7300 6236 gene locus_tag LOCUS_02510 7300 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 7673 7281 gene locus_tag LOCUS_02520 gene spoIIIAD 7673 7281 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230228.1 protein_id gnl|my_center|LOCUS_02520 7877 7683 gene locus_tag LOCUS_02530 gene spoIIIAC 7877 7683 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153142.1 protein_id gnl|my_center|LOCUS_02530 8382 7891 gene locus_tag LOCUS_02540 8382 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 9302 8376 gene locus_tag LOCUS_02550 gene spoIIIAA 9302 8376 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438117.1 protein_id gnl|my_center|LOCUS_02550 9625 9443 gene locus_tag LOCUS_02560 gene rpmF 9625 9443 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_02560 10168 9659 gene locus_tag LOCUS_02570 10168 9659 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419111.1 protein_id gnl|my_center|LOCUS_02570 10575 10204 gene locus_tag LOCUS_02580 gene rplL 10575 10204 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966422.1 protein_id gnl|my_center|LOCUS_02580 11201 10617 gene locus_tag LOCUS_02590 gene rplJ 11201 10617 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832306.1 protein_id gnl|my_center|LOCUS_02590 12200 11508 gene locus_tag LOCUS_02600 gene rplA 12200 11508 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_02600 12685 12260 gene locus_tag LOCUS_02610 gene rplK 12685 12260 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_02610 13344 12820 gene locus_tag LOCUS_02620 gene nusG 13344 12820 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966426.1 protein_id gnl|my_center|LOCUS_02620 13610 13380 gene locus_tag LOCUS_02630 13610 13380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 13786 13637 gene locus_tag LOCUS_02640 gene rpmG 13786 13637 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_02640 14028 17528 gene locus_tag LOCUS_02650 gene addB 14028 17528 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_02650 17521 21222 gene locus_tag LOCUS_02660 gene addA 17521 21222 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861079.1 protein_id gnl|my_center|LOCUS_02660 >Feature sequence012 <1 500 gene locus_tag LOCUS_02670 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232060.1:ribosome small subunit-dependent GTPase A 497 1126 gene locus_tag LOCUS_02680 gene rpe 497 1126 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906199.1 protein_id gnl|my_center|LOCUS_02680 1126 1734 gene locus_tag LOCUS_02690 1126 1734 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454892.1 protein_id gnl|my_center|LOCUS_02690 1731 2858 gene locus_tag LOCUS_02700 1731 2858 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_02700 2859 4037 gene locus_tag LOCUS_02710 gene thiI 2859 4037 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_02710 4057 4557 gene locus_tag LOCUS_02720 4057 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 4662 5789 gene locus_tag LOCUS_02730 gene recA 4662 5789 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_02730 5966 6229 gene locus_tag LOCUS_02740 5966 6229 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_02740 6302 8170 gene locus_tag LOCUS_02750 gene uvrC 6302 8170 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_02750 8163 8963 gene locus_tag LOCUS_02760 gene pgeF 8163 8963 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_02760 8978 10576 gene locus_tag LOCUS_02770 8978 10576 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_02770 10573 11796 gene locus_tag LOCUS_02780 10573 11796 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_02780 11814 12230 gene locus_tag LOCUS_02790 11814 12230 CDS product HutP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392857.1 protein_id gnl|my_center|LOCUS_02790 12249 12608 gene locus_tag LOCUS_02800 gene aroH 12249 12608 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020790.1 protein_id gnl|my_center|LOCUS_02800 12626 13303 gene locus_tag LOCUS_02810 gene cmk 12626 13303 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990268.1 protein_id gnl|my_center|LOCUS_02810 13307 13915 gene locus_tag LOCUS_02820 13307 13915 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881346.1 protein_id gnl|my_center|LOCUS_02820 13912 15933 gene locus_tag LOCUS_02830 13912 15933 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965152.1 protein_id gnl|my_center|LOCUS_02830 16138 17511 gene locus_tag LOCUS_02840 gene murD 16138 17511 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966471.1 protein_id gnl|my_center|LOCUS_02840 17513 18541 gene locus_tag LOCUS_02850 17513 18541 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_02850 18526 19542 gene locus_tag LOCUS_02860 18526 19542 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_02860 19542 20531 gene locus_tag LOCUS_02870 19542 20531 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_02870 >Feature sequence013 321 166 gene locus_tag LOCUS_02880 321 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 2634 568 gene locus_tag LOCUS_02890 2634 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 2850 2638 gene locus_tag LOCUS_02900 2850 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 3587 2847 gene locus_tag LOCUS_02910 3587 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 5621 3591 gene locus_tag LOCUS_02920 5621 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 6429 5635 gene locus_tag LOCUS_02930 6429 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 8502 6439 gene locus_tag LOCUS_02940 8502 6439 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861108.1 protein_id gnl|my_center|LOCUS_02940 8897 8586 gene locus_tag LOCUS_02950 8897 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 9615 8983 gene locus_tag LOCUS_02960 9615 8983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 9883 9605 gene locus_tag LOCUS_02970 9883 9605 CDS product DUF4315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861111.1 protein_id gnl|my_center|LOCUS_02970 10651 9905 gene locus_tag LOCUS_02980 10651 9905 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861012.1 protein_id gnl|my_center|LOCUS_02980 13187 10653 gene locus_tag LOCUS_02990 13187 10653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 14000 13203 gene locus_tag LOCUS_03000 14000 13203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 14396 14196 gene locus_tag LOCUS_03010 14396 14196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 14569 14345 gene locus_tag LOCUS_03020 14569 14345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 17646 15208 gene locus_tag LOCUS_03030 17646 15208 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_03030 18016 17582 gene locus_tag LOCUS_03040 18016 17582 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_03040 18896 18027 gene locus_tag LOCUS_03050 18896 18027 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610323.1 protein_id gnl|my_center|LOCUS_03050 19111 18896 gene locus_tag LOCUS_03060 19111 18896 CDS product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 protein_id gnl|my_center|LOCUS_03060 20535 19132 gene locus_tag LOCUS_03070 20535 19132 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03070 >Feature sequence014 1181 690 gene locus_tag LOCUS_03080 gene ybaK 1181 690 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288577.1 protein_id gnl|my_center|LOCUS_03080 3588 1192 gene locus_tag LOCUS_03090 3588 1192 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_03090 4260 3604 gene locus_tag LOCUS_03100 4260 3604 CDS product YesU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233822.1 protein_id gnl|my_center|LOCUS_03100 4443 6269 gene locus_tag LOCUS_03110 gene glmS 4443 6269 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_03110 6945 9026 gene locus_tag LOCUS_03120 6945 9026 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_03120 9669 9118 gene locus_tag LOCUS_03130 9669 9118 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966371.1 protein_id gnl|my_center|LOCUS_03130 10704 9670 gene locus_tag LOCUS_03140 10704 9670 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830750.1 protein_id gnl|my_center|LOCUS_03140 11410 10793 gene locus_tag LOCUS_03150 11410 10793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 12708 11410 gene locus_tag LOCUS_03160 gene hisD 12708 11410 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530482.1 protein_id gnl|my_center|LOCUS_03160 13855 12725 gene locus_tag LOCUS_03170 gene dnaJ 13855 12725 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_03170 15809 13977 gene locus_tag LOCUS_03180 gene dnaK 15809 13977 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_03180 16366 15833 gene locus_tag LOCUS_03190 gene grpE 16366 15833 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_03190 17420 16383 gene locus_tag LOCUS_03200 gene hrcA 17420 16383 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_03200 18691 17594 gene locus_tag LOCUS_03210 gene hemW 18691 17594 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099423.1 protein_id gnl|my_center|LOCUS_03210 19221 18745 gene locus_tag LOCUS_03220 19221 18745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428343.1 protein_id gnl|my_center|LOCUS_03220 19863 19303 gene locus_tag LOCUS_03230 gene efp 19863 19303 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965394.1 protein_id gnl|my_center|LOCUS_03230 >Feature sequence015 <1 1704 gene locus_tag LOCUS_03240 <1 1704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272760.1:sensor histidine kinase 1729 2991 gene locus_tag LOCUS_03250 1729 2991 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027805.1 protein_id gnl|my_center|LOCUS_03250 4392 3040 gene locus_tag LOCUS_03260 4392 3040 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_03260 6529 4385 gene locus_tag LOCUS_03270 6529 4385 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263809.1 protein_id gnl|my_center|LOCUS_03270 7543 6743 gene locus_tag LOCUS_03280 7543 6743 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966200.1 protein_id gnl|my_center|LOCUS_03280 13908 7618 gene locus_tag LOCUS_03290 13908 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 15009 14224 gene locus_tag LOCUS_03300 15009 14224 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_03300 15195 15076 gene locus_tag LOCUS_03310 15195 15076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 17897 15195 gene locus_tag LOCUS_03320 17897 15195 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369316.1 protein_id gnl|my_center|LOCUS_03320 18120 17965 gene locus_tag LOCUS_03330 18120 17965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 19541 18384 gene locus_tag LOCUS_03340 19541 18384 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983707.1 protein_id gnl|my_center|LOCUS_03340 >Feature sequence016 60 3323 gene locus_tag LOCUS_03350 60 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 4137 3481 gene locus_tag LOCUS_03360 gene sleB 4137 3481 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398991.1 protein_id gnl|my_center|LOCUS_03360 4863 4195 gene locus_tag LOCUS_03370 4863 4195 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_03370 5110 4865 gene locus_tag LOCUS_03380 5110 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 6579 5110 gene locus_tag LOCUS_03390 gene abfB 6579 5110 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_03390 7206 6694 gene locus_tag LOCUS_03400 7206 6694 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002785057.1 protein_id gnl|my_center|LOCUS_03400 7340 7534 gene locus_tag LOCUS_03410 7340 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 7534 7794 gene locus_tag LOCUS_03420 7534 7794 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454698.1 protein_id gnl|my_center|LOCUS_03420 7794 8444 gene locus_tag LOCUS_03430 7794 8444 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392905.1 protein_id gnl|my_center|LOCUS_03430 8480 9601 gene locus_tag LOCUS_03440 8480 9601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 9562 9783 gene locus_tag LOCUS_03450 9562 9783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 10007 10525 gene locus_tag LOCUS_03460 10007 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 10596 15227 gene locus_tag LOCUS_03470 10596 15227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 15388 15531 gene locus_tag LOCUS_03480 15388 15531 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_03480 15672 16019 gene locus_tag LOCUS_03490 15672 16019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 16172 17596 gene locus_tag LOCUS_03500 16172 17596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 17616 17945 gene locus_tag LOCUS_03510 17616 17945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 17967 18803 gene locus_tag LOCUS_03520 17967 18803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 >Feature sequence017 6567 136 gene locus_tag LOCUS_03530 6567 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 9627 6775 gene locus_tag LOCUS_03540 gene mngB 9627 6775 CDS product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861603.1 protein_id gnl|my_center|LOCUS_03540 10617 9628 gene locus_tag LOCUS_03550 10617 9628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 13034 10617 gene locus_tag LOCUS_03560 13034 10617 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_03560 14149 13046 gene locus_tag LOCUS_03570 14149 13046 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359828.1 protein_id gnl|my_center|LOCUS_03570 17360 14346 gene locus_tag LOCUS_03580 17360 14346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 >Feature sequence018 351 1583 gene locus_tag LOCUS_03590 351 1583 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906047.1 protein_id gnl|my_center|LOCUS_03590 1721 3502 gene locus_tag LOCUS_03600 gene recQ 1721 3502 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965975.1 protein_id gnl|my_center|LOCUS_03600 5353 3608 gene locus_tag LOCUS_03610 5353 3608 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_03610 5492 6877 gene locus_tag LOCUS_03620 5492 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 7080 7958 gene locus_tag LOCUS_03630 7080 7958 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_03630 7970 8236 gene locus_tag LOCUS_03640 7970 8236 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_03640 8229 8831 gene locus_tag LOCUS_03650 gene gmk 8229 8831 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_03650 8851 9174 gene locus_tag LOCUS_03660 8851 9174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 9177 11612 gene locus_tag LOCUS_03670 gene priA 9177 11612 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_03670 11627 12019 gene locus_tag LOCUS_03680 gene def 11627 12019 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_03680 12090 13031 gene locus_tag LOCUS_03690 gene fmt 12090 13031 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_03690 13034 13723 gene locus_tag LOCUS_03700 13034 13723 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047881.1 protein_id gnl|my_center|LOCUS_03700 13723 14982 gene locus_tag LOCUS_03710 gene rsmB 13723 14982 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_03710 14983 16002 gene locus_tag LOCUS_03720 gene rlmN 14983 16002 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_03720 16047 16790 gene locus_tag LOCUS_03730 16047 16790 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723065.1 protein_id gnl|my_center|LOCUS_03730 >Feature sequence019 35 1009 gene locus_tag LOCUS_03740 35 1009 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245533.1 protein_id gnl|my_center|LOCUS_03740 1009 1944 gene locus_tag LOCUS_03750 gene trxB 1009 1944 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416869.1 protein_id gnl|my_center|LOCUS_03750 1964 3127 gene locus_tag LOCUS_03760 1964 3127 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_03760 3343 5871 gene locus_tag LOCUS_03770 3343 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 5846 9259 gene locus_tag LOCUS_03780 5846 9259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 9228 9812 gene locus_tag LOCUS_03790 9228 9812 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890784.1 protein_id gnl|my_center|LOCUS_03790 9908 10069 gene locus_tag LOCUS_03800 9908 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 10306 11508 gene locus_tag LOCUS_03810 10306 11508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 11510 12154 gene locus_tag LOCUS_03820 11510 12154 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_03820 12151 12768 gene locus_tag LOCUS_03830 12151 12768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 12795 13112 gene locus_tag LOCUS_03840 gene trxA 12795 13112 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_03840 13275 14468 gene locus_tag LOCUS_03850 13275 14468 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082331.1 protein_id gnl|my_center|LOCUS_03850 14470 15387 gene locus_tag LOCUS_03860 gene argF 14470 15387 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808622.1 protein_id gnl|my_center|LOCUS_03860 15403 15900 gene locus_tag LOCUS_03870 15403 15900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 16122 17003 gene locus_tag LOCUS_03880 16122 17003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 18399 17041 gene locus_tag LOCUS_03890 18399 17041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 >Feature sequence020 105 1394 gene locus_tag LOCUS_03900 105 1394 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_03900 1437 2369 gene locus_tag LOCUS_03910 gene cysK 1437 2369 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_03910 2701 3459 gene locus_tag LOCUS_03920 2701 3459 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403988.1 protein_id gnl|my_center|LOCUS_03920 3456 3884 gene locus_tag LOCUS_03930 3456 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 4083 4862 gene locus_tag LOCUS_03940 4083 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 4919 6721 gene locus_tag LOCUS_03950 4919 6721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 6932 8278 gene locus_tag LOCUS_03960 gene gdhA 6932 8278 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_03960 8514 8663 gene locus_tag LOCUS_03970 8514 8663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 9516 8809 gene locus_tag LOCUS_03980 9516 8809 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067729.1 protein_id gnl|my_center|LOCUS_03980 10413 9577 gene locus_tag LOCUS_03990 10413 9577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 10841 10422 gene locus_tag LOCUS_04000 10841 10422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 11414 10905 gene locus_tag LOCUS_04010 11414 10905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 11461 11775 gene locus_tag LOCUS_04020 11461 11775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 12008 13312 gene locus_tag LOCUS_04030 gene thiC 12008 13312 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047970.1 protein_id gnl|my_center|LOCUS_04030 13573 13701 gene locus_tag LOCUS_04040 13573 13701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 14217 15545 gene locus_tag LOCUS_04050 14217 15545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 15718 16557 gene locus_tag LOCUS_04060 15718 16557 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_04060 16622 17347 gene locus_tag LOCUS_04070 16622 17347 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272546.1 protein_id gnl|my_center|LOCUS_04070 17513 18310 gene locus_tag LOCUS_04080 17513 18310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 >Feature sequence021 747 4 gene locus_tag LOCUS_04090 747 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 860 714 gene locus_tag LOCUS_04100 860 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 1835 936 gene locus_tag LOCUS_04110 gene era 1835 936 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_04110 2334 1846 gene locus_tag LOCUS_04120 gene ybeY 2334 1846 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047996.1 protein_id gnl|my_center|LOCUS_04120 3316 2327 gene locus_tag LOCUS_04130 3316 2327 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_04130 4532 3297 gene locus_tag LOCUS_04140 gene yqfD 4532 3297 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792498.1 protein_id gnl|my_center|LOCUS_04140 4817 4548 gene locus_tag LOCUS_04150 gene yqfC 4817 4548 CDS product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357863.1 protein_id gnl|my_center|LOCUS_04150 4916 6007 gene locus_tag LOCUS_04160 gene ylbJ 4916 6007 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392455.1 protein_id gnl|my_center|LOCUS_04160 7316 6036 gene locus_tag LOCUS_04170 gene obgE 7316 6036 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_04170 8353 7469 gene locus_tag LOCUS_04180 gene xerD 8353 7469 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_04180 9088 8495 gene locus_tag LOCUS_04190 9088 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 9233 13573 gene locus_tag LOCUS_04200 9233 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 14033 13779 gene locus_tag LOCUS_04210 gene rpmA 14033 13779 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053095207.1 protein_id gnl|my_center|LOCUS_04210 14384 14073 gene locus_tag LOCUS_04220 gene rplU 14384 14073 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_04220 15855 14509 gene locus_tag LOCUS_04230 15855 14509 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_04230 15994 16173 gene locus_tag LOCUS_04240 15994 16173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 17408 16218 gene locus_tag LOCUS_04250 gene trpB 17408 16218 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562635.1 protein_id gnl|my_center|LOCUS_04250 >Feature sequence022 109 255 gene locus_tag LOCUS_04260 109 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 1277 306 gene locus_tag LOCUS_04270 gene prfB 1277 306 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04270 2177 1452 gene locus_tag LOCUS_04280 2177 1452 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947927.1 protein_id gnl|my_center|LOCUS_04280 2638 2177 gene locus_tag LOCUS_04290 gene fabZ 2638 2177 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462206.1 protein_id gnl|my_center|LOCUS_04290 3685 2660 gene locus_tag LOCUS_04300 3685 2660 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_04300 4582 3773 gene locus_tag LOCUS_04310 4582 3773 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_04310 5970 4681 gene locus_tag LOCUS_04320 5970 4681 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987123.1 protein_id gnl|my_center|LOCUS_04320 6427 8100 gene locus_tag LOCUS_04330 6427 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 8112 8912 gene locus_tag LOCUS_04340 gene folP 8112 8912 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966209.1 protein_id gnl|my_center|LOCUS_04340 8928 9743 gene locus_tag LOCUS_04350 gene folK 8928 9743 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966210.1 protein_id gnl|my_center|LOCUS_04350 9921 11054 gene locus_tag LOCUS_04360 9921 11054 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_04360 11064 11816 gene locus_tag LOCUS_04370 11064 11816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 12002 12451 gene locus_tag LOCUS_04380 12002 12451 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371678.1 protein_id gnl|my_center|LOCUS_04380 12466 12837 gene locus_tag LOCUS_04390 12466 12837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 12834 13832 gene locus_tag LOCUS_04400 12834 13832 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966467.1 protein_id gnl|my_center|LOCUS_04400 13871 16324 gene locus_tag LOCUS_04410 13871 16324 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048366.1 protein_id gnl|my_center|LOCUS_04410 >Feature sequence023 <1 950 gene locus_tag LOCUS_04420 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244086.1:sugar ABC transporter permease 950 1825 gene locus_tag LOCUS_04430 950 1825 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_04430 1863 3452 gene locus_tag LOCUS_04440 1863 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 3565 4719 gene locus_tag LOCUS_04450 3565 4719 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963477.1 protein_id gnl|my_center|LOCUS_04450 4719 5252 gene locus_tag LOCUS_04460 gene nudF 4719 5252 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 protein_id gnl|my_center|LOCUS_04460 5383 5721 gene locus_tag LOCUS_04470 5383 5721 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227432.1 protein_id gnl|my_center|LOCUS_04470 5714 6493 gene locus_tag LOCUS_04480 5714 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 6505 8478 gene locus_tag LOCUS_04490 6505 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 8570 10720 gene locus_tag LOCUS_04500 8570 10720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 11089 12075 gene locus_tag LOCUS_04510 11089 12075 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_04510 12096 12977 gene locus_tag LOCUS_04520 12096 12977 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_04520 13087 14601 gene locus_tag LOCUS_04530 13087 14601 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_04530 14818 15741 gene locus_tag LOCUS_04540 14818 15741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 15769 16497 gene locus_tag LOCUS_04550 15769 16497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812187.1 protein_id gnl|my_center|LOCUS_04550 16494 17237 gene locus_tag LOCUS_04560 16494 17237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 >Feature sequence024 51 737 gene locus_tag LOCUS_04570 51 737 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_04570 749 1183 gene locus_tag LOCUS_04580 749 1183 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964777.1 protein_id gnl|my_center|LOCUS_04580 1339 1992 gene locus_tag LOCUS_04590 1339 1992 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562571.1 protein_id gnl|my_center|LOCUS_04590 2018 3049 gene locus_tag LOCUS_04600 2018 3049 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_04600 4265 3507 gene locus_tag LOCUS_04610 4265 3507 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966758.1 protein_id gnl|my_center|LOCUS_04610 5141 4503 gene locus_tag LOCUS_04620 gene phoU 5141 4503 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_04620 5887 5141 gene locus_tag LOCUS_04630 gene pstB 5887 5141 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_04630 6736 5915 gene locus_tag LOCUS_04640 gene pstA 6736 5915 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049767.1 protein_id gnl|my_center|LOCUS_04640 7590 6733 gene locus_tag LOCUS_04650 gene pstC 7590 6733 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595180.1 protein_id gnl|my_center|LOCUS_04650 8498 7587 gene locus_tag LOCUS_04660 8498 7587 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_04660 8714 9121 gene locus_tag LOCUS_04670 8714 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 10791 9205 gene locus_tag LOCUS_04680 10791 9205 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860806.1 protein_id gnl|my_center|LOCUS_04680 11863 11036 gene locus_tag LOCUS_04690 11863 11036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 12512 11886 gene locus_tag LOCUS_04700 12512 11886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 13173 12532 gene locus_tag LOCUS_04710 13173 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 14150 13206 gene locus_tag LOCUS_04720 14150 13206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 15377 14163 gene locus_tag LOCUS_04730 15377 14163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 16572 15394 gene locus_tag LOCUS_04740 16572 15394 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173870.1 protein_id gnl|my_center|LOCUS_04740 17038 16592 gene locus_tag LOCUS_04750 17038 16592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 >Feature sequence025 593 2542 gene locus_tag LOCUS_04760 593 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 2566 9630 gene locus_tag LOCUS_04770 2566 9630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 9650 16198 gene locus_tag LOCUS_04780 9650 16198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 >Feature sequence026 <1 1228 gene locus_tag LOCUS_04790 <1 1228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964566.1:TIGR03960 family B12-binding radical SAM protein 1221 1874 gene locus_tag LOCUS_04800 1221 1874 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964567.1 protein_id gnl|my_center|LOCUS_04800 1958 2347 gene locus_tag LOCUS_04810 1958 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 2420 3220 gene locus_tag LOCUS_04820 2420 3220 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762840.1 protein_id gnl|my_center|LOCUS_04820 3361 3828 gene locus_tag LOCUS_04830 3361 3828 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439159.1 protein_id gnl|my_center|LOCUS_04830 3821 4564 gene locus_tag LOCUS_04840 3821 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860913.1 protein_id gnl|my_center|LOCUS_04840 6621 4618 gene locus_tag LOCUS_04850 6621 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04850 7899 6646 gene locus_tag LOCUS_04860 7899 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04860 8112 9689 gene locus_tag LOCUS_04870 8112 9689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 10278 9742 gene locus_tag LOCUS_04880 gene spoVT 10278 9742 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_04880 11830 10520 gene locus_tag LOCUS_04890 gene aspS 11830 10520 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948698.1 protein_id gnl|my_center|LOCUS_04890 13262 11844 gene locus_tag LOCUS_04900 gene gatB 13262 11844 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_04900 14695 13259 gene locus_tag LOCUS_04910 gene gatA 14695 13259 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966260.1 protein_id gnl|my_center|LOCUS_04910 15000 14722 gene locus_tag LOCUS_04920 15000 14722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 17022 15205 gene locus_tag LOCUS_04930 17022 15205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 >Feature sequence027 <1 693 gene locus_tag LOCUS_04940 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462332.1:YidC/Oxa1 family membrane protein insertase 641 1603 gene locus_tag LOCUS_04950 641 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 1723 3675 gene locus_tag LOCUS_04960 1723 3675 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948262.1 protein_id gnl|my_center|LOCUS_04960 3907 3734 gene locus_tag LOCUS_04970 3907 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 5015 3939 gene locus_tag LOCUS_04980 5015 3939 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101284.1 protein_id gnl|my_center|LOCUS_04980 5154 6344 gene locus_tag LOCUS_04990 5154 6344 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261147.1 protein_id gnl|my_center|LOCUS_04990 6341 7438 gene locus_tag LOCUS_05000 6341 7438 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142191.1 protein_id gnl|my_center|LOCUS_05000 7480 8043 gene locus_tag LOCUS_05010 7480 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 8040 9317 gene locus_tag LOCUS_05020 8040 9317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 9468 10844 gene locus_tag LOCUS_05030 9468 10844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 10837 12708 gene locus_tag LOCUS_05040 10837 12708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 12726 13610 gene locus_tag LOCUS_05050 12726 13610 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_05050 13628 14287 gene locus_tag LOCUS_05060 13628 14287 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113620978.1 protein_id gnl|my_center|LOCUS_05060 14790 14939 gene locus_tag LOCUS_05070 14790 14939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 16994 14904 gene locus_tag LOCUS_05080 gene pnp 16994 14904 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence028 133 1146 gene locus_tag LOCUS_05090 gene gap 133 1146 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_05090 1324 2679 gene locus_tag LOCUS_05100 1324 2679 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_05100 2691 3044 gene locus_tag LOCUS_05110 2691 3044 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_05110 3644 3066 gene locus_tag LOCUS_05120 gene folE 3644 3066 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451708.1 protein_id gnl|my_center|LOCUS_05120 4325 3645 gene locus_tag LOCUS_05130 gene queE 4325 3645 CDS product putative 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966888.1 protein_id gnl|my_center|LOCUS_05130 4693 4337 gene locus_tag LOCUS_05140 gene queD 4693 4337 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790409.1 protein_id gnl|my_center|LOCUS_05140 5352 4681 gene locus_tag LOCUS_05150 gene queC 5352 4681 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966890.1 protein_id gnl|my_center|LOCUS_05150 5836 5366 gene locus_tag LOCUS_05160 gene queF 5836 5366 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689837.1 protein_id gnl|my_center|LOCUS_05160 6688 5849 gene locus_tag LOCUS_05170 6688 5849 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_05170 6860 7738 gene locus_tag LOCUS_05180 6860 7738 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_05180 7758 8618 gene locus_tag LOCUS_05190 7758 8618 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_05190 8615 9475 gene locus_tag LOCUS_05200 8615 9475 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_05200 9468 10286 gene locus_tag LOCUS_05210 9468 10286 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_05210 10303 11037 gene locus_tag LOCUS_05220 gene truA 10303 11037 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_05220 11037 12590 gene locus_tag LOCUS_05230 11037 12590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 12603 13253 gene locus_tag LOCUS_05240 12603 13253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 13267 14931 gene locus_tag LOCUS_05250 gene ilvD 13267 14931 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861428.1 protein_id gnl|my_center|LOCUS_05250 15051 16361 gene locus_tag LOCUS_05260 15051 16361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 >Feature sequence029 455 631 gene locus_tag LOCUS_05270 455 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 974 1558 gene locus_tag LOCUS_05280 974 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986441.1 protein_id gnl|my_center|LOCUS_05280 1578 3413 gene locus_tag LOCUS_05290 gene dxs 1578 3413 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965377.1 protein_id gnl|my_center|LOCUS_05290 3427 4230 gene locus_tag LOCUS_05300 3427 4230 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_05300 4248 5129 gene locus_tag LOCUS_05310 gene ispE 4248 5129 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947969.1 protein_id gnl|my_center|LOCUS_05310 5145 5834 gene locus_tag LOCUS_05320 5145 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 5853 6464 gene locus_tag LOCUS_05330 5853 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 7676 6720 gene locus_tag LOCUS_05340 7676 6720 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271954.1 protein_id gnl|my_center|LOCUS_05340 8102 7680 gene locus_tag LOCUS_05350 8102 7680 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948808.1 protein_id gnl|my_center|LOCUS_05350 9914 8160 gene locus_tag LOCUS_05360 gene pyk 9914 8160 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_05360 11007 10030 gene locus_tag LOCUS_05370 gene pfkA 11007 10030 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_05370 11233 11033 gene locus_tag LOCUS_05380 11233 11033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 11476 11264 gene locus_tag LOCUS_05390 gene mtrB 11476 11264 CDS product trp RNA-binding attenuation protein MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869580.1 protein_id gnl|my_center|LOCUS_05390 15074 11577 gene locus_tag LOCUS_05400 15074 11577 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963838.1 protein_id gnl|my_center|LOCUS_05400 <15719 15091 gene locus_tag LOCUS_05410 <15719 15091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436252.1:DNA-binding protein WhiA >Feature sequence030 246 425 gene locus_tag LOCUS_05420 246 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 429 1436 gene locus_tag LOCUS_05430 gene asnA 429 1436 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_05430 1530 2933 gene locus_tag LOCUS_05440 gene asnS 1530 2933 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966534.1 protein_id gnl|my_center|LOCUS_05440 3020 3844 gene locus_tag LOCUS_05450 3020 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 3825 5102 gene locus_tag LOCUS_05460 3825 5102 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_05460 5106 7016 gene locus_tag LOCUS_05470 5106 7016 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_05470 7042 7899 gene locus_tag LOCUS_05480 7042 7899 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055270852.1 protein_id gnl|my_center|LOCUS_05480 8027 9346 gene locus_tag LOCUS_05490 8027 9346 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_05490 9358 10683 gene locus_tag LOCUS_05500 gene der 9358 10683 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_05500 10696 11343 gene locus_tag LOCUS_05510 gene plsY 10696 11343 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_05510 11340 12329 gene locus_tag LOCUS_05520 11340 12329 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_05520 12326 13678 gene locus_tag LOCUS_05530 gene trkA 12326 13678 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_05530 13699 15141 gene locus_tag LOCUS_05540 13699 15141 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016814.1 protein_id gnl|my_center|LOCUS_05540 >Feature sequence031 1492 104 gene locus_tag LOCUS_05550 1492 104 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582827.1 protein_id gnl|my_center|LOCUS_05550 2656 1607 gene locus_tag LOCUS_05560 2656 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 4211 2643 gene locus_tag LOCUS_05570 4211 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 6010 4556 gene locus_tag LOCUS_05580 6010 4556 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_05580 10775 6078 gene locus_tag LOCUS_05590 gene gltB 10775 6078 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853155.1 protein_id gnl|my_center|LOCUS_05590 12162 10951 gene locus_tag LOCUS_05600 12162 10951 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940837.1 protein_id gnl|my_center|LOCUS_05600 13077 12235 gene locus_tag LOCUS_05610 gene dapF 13077 12235 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_05610 13616 13092 gene locus_tag LOCUS_05620 13616 13092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 14978 13650 gene locus_tag LOCUS_05630 gene glnA 14978 13650 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135328.1 protein_id gnl|my_center|LOCUS_05630 >Feature sequence032 229 1224 gene locus_tag LOCUS_05640 229 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 1344 1432 gene locus_tag LOCUS_t00040 1344 1432 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1576 2385 gene locus_tag LOCUS_05650 1576 2385 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287872.1 protein_id gnl|my_center|LOCUS_05650 2382 3218 gene locus_tag LOCUS_05660 gene panB 2382 3218 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_05660 3220 4059 gene locus_tag LOCUS_05670 gene panC 3220 4059 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 protein_id gnl|my_center|LOCUS_05670 4074 4457 gene locus_tag LOCUS_05680 4074 4457 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287876.1 protein_id gnl|my_center|LOCUS_05680 4483 5667 gene locus_tag LOCUS_05690 4483 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 5670 6680 gene locus_tag LOCUS_05700 5670 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 6770 7591 gene locus_tag LOCUS_05710 6770 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 7614 8060 gene locus_tag LOCUS_05720 7614 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 8079 9473 gene locus_tag LOCUS_05730 8079 9473 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964872.1 protein_id gnl|my_center|LOCUS_05730 9485 10600 gene locus_tag LOCUS_05740 9485 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 13863 10651 gene locus_tag LOCUS_05750 gene carB 13863 10651 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_05750 14917 13865 gene locus_tag LOCUS_05760 gene carA 14917 13865 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_05760 >Feature sequence033 18 221 gene locus_tag LOCUS_05770 18 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 260 487 gene locus_tag LOCUS_05780 260 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 471 1721 gene locus_tag LOCUS_05790 471 1721 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047809.1 protein_id gnl|my_center|LOCUS_05790 1718 3031 gene locus_tag LOCUS_05800 1718 3031 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921892.1 protein_id gnl|my_center|LOCUS_05800 3085 3600 gene locus_tag LOCUS_05810 3085 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 3632 4453 gene locus_tag LOCUS_05820 3632 4453 CDS product capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112195514.1 protein_id gnl|my_center|LOCUS_05820 4481 4840 gene locus_tag LOCUS_05830 4481 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 4824 5141 gene locus_tag LOCUS_05840 4824 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 5131 5454 gene locus_tag LOCUS_05850 5131 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 5459 5800 gene locus_tag LOCUS_05860 5459 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 5847 6446 gene locus_tag LOCUS_05870 5847 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 6457 6726 gene locus_tag LOCUS_05880 6457 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 6744 6911 gene locus_tag LOCUS_05890 6744 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 6914 8644 gene locus_tag LOCUS_05900 6914 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 8656 9501 gene locus_tag LOCUS_05910 8656 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 9494 10912 gene locus_tag LOCUS_05920 9494 10912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 10915 11946 gene locus_tag LOCUS_05930 10915 11946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 11963 12379 gene locus_tag LOCUS_05940 11963 12379 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357842.1 protein_id gnl|my_center|LOCUS_05940 12399 13196 gene locus_tag LOCUS_05950 12399 13196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 13380 13553 gene locus_tag LOCUS_05960 13380 13553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 13586 14029 gene locus_tag LOCUS_05970 13586 14029 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 protein_id gnl|my_center|LOCUS_05970 14075 14150 gene locus_tag LOCUS_t00050 14075 14150 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14489 14232 gene locus_tag LOCUS_05980 14489 14232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 >Feature sequence034 118 576 gene locus_tag LOCUS_05990 118 576 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_05990 595 1620 gene locus_tag LOCUS_06000 gene nusA 595 1620 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_06000 1626 1880 gene locus_tag LOCUS_06010 1626 1880 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965106.1 protein_id gnl|my_center|LOCUS_06010 1877 2179 gene locus_tag LOCUS_06020 1877 2179 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020853.1 protein_id gnl|my_center|LOCUS_06020 2214 4697 gene locus_tag LOCUS_06030 2214 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 4739 5077 gene locus_tag LOCUS_06040 gene rbfA 4739 5077 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_06040 5090 6049 gene locus_tag LOCUS_06050 5090 6049 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965110.1 protein_id gnl|my_center|LOCUS_06050 6061 6930 gene locus_tag LOCUS_06060 gene truB 6061 6930 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_06060 6944 7846 gene locus_tag LOCUS_06070 6944 7846 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986788.1 protein_id gnl|my_center|LOCUS_06070 7869 9227 gene locus_tag LOCUS_06080 gene glmU 7869 9227 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706816.1 protein_id gnl|my_center|LOCUS_06080 9298 9864 gene locus_tag LOCUS_06090 gene pth 9298 9864 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_06090 9932 13441 gene locus_tag LOCUS_06100 gene mfd 9932 13441 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_06100 13462 14412 gene locus_tag LOCUS_06110 gene prsA 13462 14412 CDS product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245079.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence035 114 545 gene locus_tag LOCUS_06120 114 545 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966812.1 protein_id gnl|my_center|LOCUS_06120 683 1726 gene locus_tag LOCUS_06130 683 1726 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_06130 1740 2546 gene locus_tag LOCUS_06140 1740 2546 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_06140 2574 3368 gene locus_tag LOCUS_06150 2574 3368 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_06150 3368 4636 gene locus_tag LOCUS_06160 3368 4636 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459712.1 protein_id gnl|my_center|LOCUS_06160 4756 5517 gene locus_tag LOCUS_06170 4756 5517 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_06170 5649 7763 gene locus_tag LOCUS_06180 gene ptsG 5649 7763 CDS product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948935.1 protein_id gnl|my_center|LOCUS_06180 8910 7843 gene locus_tag LOCUS_06190 8910 7843 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_06190 10143 9091 gene locus_tag LOCUS_06200 10143 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 10812 10150 gene locus_tag LOCUS_06210 gene pyrE 10812 10150 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_06210 11567 10830 gene locus_tag LOCUS_06220 11567 10830 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420464.1 protein_id gnl|my_center|LOCUS_06220 12249 11590 gene locus_tag LOCUS_06230 12249 11590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 13053 12469 gene locus_tag LOCUS_06240 13053 12469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 13757 13152 gene locus_tag LOCUS_06250 13757 13152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 >Feature sequence036 164 973 gene locus_tag LOCUS_06260 164 973 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965896.1 protein_id gnl|my_center|LOCUS_06260 2377 1280 gene locus_tag LOCUS_06270 2377 1280 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392538.1 protein_id gnl|my_center|LOCUS_06270 3671 2445 gene locus_tag LOCUS_06280 gene hisS 3671 2445 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964121.1 protein_id gnl|my_center|LOCUS_06280 4777 3668 gene locus_tag LOCUS_06290 gene murG 4777 3668 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110342.1 protein_id gnl|my_center|LOCUS_06290 5974 4793 gene locus_tag LOCUS_06300 gene spoVE 5974 4793 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753510.1 protein_id gnl|my_center|LOCUS_06300 7028 6003 gene locus_tag LOCUS_06310 gene mraY 7028 6003 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965426.1 protein_id gnl|my_center|LOCUS_06310 8420 7050 gene locus_tag LOCUS_06320 8420 7050 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861626.1 protein_id gnl|my_center|LOCUS_06320 9933 8497 gene locus_tag LOCUS_06330 9933 8497 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_06330 12186 9955 gene locus_tag LOCUS_06340 12186 9955 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_06340 12823 12302 gene locus_tag LOCUS_06350 12823 12302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 >Feature sequence037 1132 734 gene locus_tag LOCUS_06360 1132 734 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358712.1 protein_id gnl|my_center|LOCUS_06360 1653 1129 gene locus_tag LOCUS_06370 1653 1129 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_06370 2507 1650 gene locus_tag LOCUS_06380 gene aroE 2507 1650 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_06380 2927 2571 gene locus_tag LOCUS_06390 gene spoVAE 2927 2571 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_06390 3946 2939 gene locus_tag LOCUS_06400 gene spoVAD 3946 2939 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403641.1 protein_id gnl|my_center|LOCUS_06400 5340 4051 gene locus_tag LOCUS_06410 5340 4051 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 protein_id gnl|my_center|LOCUS_06410 6596 5340 gene locus_tag LOCUS_06420 6596 5340 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_06420 7575 6712 gene locus_tag LOCUS_06430 gene gpr 7575 6712 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048007.1 protein_id gnl|my_center|LOCUS_06430 8071 7667 gene locus_tag LOCUS_06440 8071 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 9380 8064 gene locus_tag LOCUS_06450 gene trmFO 9380 8064 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989721.1 protein_id gnl|my_center|LOCUS_06450 11467 9377 gene locus_tag LOCUS_06460 gene topA 11467 9377 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047858.1 protein_id gnl|my_center|LOCUS_06460 12596 11484 gene locus_tag LOCUS_06470 gene dprA 12596 11484 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_06470 <13360 12649 gene locus_tag LOCUS_06480 <13360 12649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965655.1:RNA methyltransferase >Feature sequence038 297 3026 gene locus_tag LOCUS_06490 297 3026 CDS product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 protein_id gnl|my_center|LOCUS_06490 3862 3395 gene locus_tag LOCUS_06500 3862 3395 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053897.1 protein_id gnl|my_center|LOCUS_06500 5301 3919 gene locus_tag LOCUS_06510 gene mgtE 5301 3919 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_06510 6499 5345 gene locus_tag LOCUS_06520 gene wecB 6499 5345 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947987.1 protein_id gnl|my_center|LOCUS_06520 7646 6516 gene locus_tag LOCUS_06530 7646 6516 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966159.1 protein_id gnl|my_center|LOCUS_06530 8659 7658 gene locus_tag LOCUS_06540 gene trpS 8659 7658 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048270.1 protein_id gnl|my_center|LOCUS_06540 9873 8680 gene locus_tag LOCUS_06550 9873 8680 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 protein_id gnl|my_center|LOCUS_06550 11557 9890 gene locus_tag LOCUS_06560 11557 9890 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_06560 13222 11564 gene locus_tag LOCUS_06570 13222 11564 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_06570 >Feature sequence039 24 1994 gene locus_tag LOCUS_06580 gene spoIIE 24 1994 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243026.1 protein_id gnl|my_center|LOCUS_06580 2086 4095 gene locus_tag LOCUS_06590 2086 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 5465 4128 gene locus_tag LOCUS_06600 5465 4128 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_06600 5597 6721 gene locus_tag LOCUS_06610 5597 6721 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_06610 7599 6673 gene locus_tag LOCUS_06620 7599 6673 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_06620 7739 8644 gene locus_tag LOCUS_06630 7739 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 8644 10515 gene locus_tag LOCUS_06640 gene mnmG 8644 10515 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_06640 11445 10552 gene locus_tag LOCUS_06650 11445 10552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 12021 11479 gene locus_tag LOCUS_06660 12021 11479 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851996.1 protein_id gnl|my_center|LOCUS_06660 13135 12170 gene locus_tag LOCUS_06670 13135 12170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence040 782 84 gene locus_tag LOCUS_06680 782 84 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860778.1 protein_id gnl|my_center|LOCUS_06680 1630 845 gene locus_tag LOCUS_06690 1630 845 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071302.1 protein_id gnl|my_center|LOCUS_06690 2415 1690 gene locus_tag LOCUS_06700 2415 1690 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774590.1 protein_id gnl|my_center|LOCUS_06700 3101 2412 gene locus_tag LOCUS_06710 3101 2412 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_06710 3279 3989 gene locus_tag LOCUS_06720 gene pduB 3279 3989 CDS product propanediol utilization microcompartment protein PduB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816690.1 protein_id gnl|my_center|LOCUS_06720 5640 4042 gene locus_tag LOCUS_06730 5640 4042 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435782.1 protein_id gnl|my_center|LOCUS_06730 6522 5704 gene locus_tag LOCUS_06740 6522 5704 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966224.1 protein_id gnl|my_center|LOCUS_06740 8456 6522 gene locus_tag LOCUS_06750 8456 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 11015 8508 gene locus_tag LOCUS_06760 11015 8508 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_06760 13055 11076 gene locus_tag LOCUS_06770 13055 11076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 >Feature sequence041 134 853 gene locus_tag LOCUS_06780 gene pyrH 134 853 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_06780 887 1438 gene locus_tag LOCUS_06790 gene frr 887 1438 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430598.1 protein_id gnl|my_center|LOCUS_06790 1510 2250 gene locus_tag LOCUS_06800 1510 2250 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_06800 2253 3089 gene locus_tag LOCUS_06810 2253 3089 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_06810 3120 4283 gene locus_tag LOCUS_06820 gene dxr 3120 4283 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986796.1 protein_id gnl|my_center|LOCUS_06820 4280 5434 gene locus_tag LOCUS_06830 gene rseP 4280 5434 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384669.1 protein_id gnl|my_center|LOCUS_06830 5446 6492 gene locus_tag LOCUS_06840 gene ispG 5446 6492 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_06840 6513 6947 gene locus_tag LOCUS_06850 gene aroQ 6513 6947 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757082.1 protein_id gnl|my_center|LOCUS_06850 6932 7984 gene locus_tag LOCUS_06860 6932 7984 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_06860 9013 8030 gene locus_tag LOCUS_06870 gene spoIVB 9013 8030 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_06870 9262 11481 gene locus_tag LOCUS_06880 gene pcrA 9262 11481 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363179.1 protein_id gnl|my_center|LOCUS_06880 12640 11765 gene locus_tag LOCUS_06890 12640 11765 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948557.1 protein_id gnl|my_center|LOCUS_06890 >Feature sequence042 <1 1175 gene locus_tag LOCUS_06900 <1 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393357.1:copper amine oxidase N-terminal domain-containing protein 1582 1507 gene locus_tag LOCUS_t00060 1582 1507 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1732 1902 gene locus_tag LOCUS_06910 1732 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 1914 2630 gene locus_tag LOCUS_06920 1914 2630 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897033.1 protein_id gnl|my_center|LOCUS_06920 3255 2593 gene locus_tag LOCUS_06930 3255 2593 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_06930 3802 3215 gene locus_tag LOCUS_06940 3802 3215 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_06940 3974 5299 gene locus_tag LOCUS_06950 3974 5299 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461524.1 protein_id gnl|my_center|LOCUS_06950 5299 6021 gene locus_tag LOCUS_06960 5299 6021 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582439.1 protein_id gnl|my_center|LOCUS_06960 6127 8076 gene locus_tag LOCUS_06970 6127 8076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 8189 9658 gene locus_tag LOCUS_06980 8189 9658 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765891.1 protein_id gnl|my_center|LOCUS_06980 9802 10113 gene locus_tag LOCUS_06990 9802 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 10119 11297 gene locus_tag LOCUS_07000 10119 11297 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_07000 11422 12537 gene locus_tag LOCUS_07010 11422 12537 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882793.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence043 2200 3210 gene locus_tag LOCUS_07020 2200 3210 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963970.1 protein_id gnl|my_center|LOCUS_07020 3946 3509 gene locus_tag LOCUS_07030 3946 3509 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_07030 4650 3949 gene locus_tag LOCUS_07040 4650 3949 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_07040 7228 4820 gene locus_tag LOCUS_07050 7228 4820 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_07050 10247 7524 gene locus_tag LOCUS_07060 gene secA 10247 7524 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_07060 10613 10431 gene locus_tag LOCUS_07070 10613 10431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 10962 10672 gene locus_tag LOCUS_07080 10962 10672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 11806 10964 gene locus_tag LOCUS_07090 gene rsmI 11806 10964 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_07090 <12697 11830 gene locus_tag LOCUS_07100 <12697 11830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949153.1:methylenetetrahydrofolate reductase [NAD(P)H] >Feature sequence044 148 2166 gene locus_tag LOCUS_07110 gene gyrB 148 2166 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_07110 2183 4396 gene locus_tag LOCUS_07120 gene gyrA 2183 4396 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632827.1 protein_id gnl|my_center|LOCUS_07120 4439 5803 gene locus_tag LOCUS_07130 4439 5803 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_07130 5919 6062 gene locus_tag LOCUS_07140 5919 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 6242 6979 gene locus_tag LOCUS_07150 6242 6979 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546254.1 protein_id gnl|my_center|LOCUS_07150 6994 7668 gene locus_tag LOCUS_07160 6994 7668 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892113.1 protein_id gnl|my_center|LOCUS_07160 7665 9188 gene locus_tag LOCUS_07170 7665 9188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 9408 9878 gene locus_tag LOCUS_07180 9408 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 10740 9895 gene locus_tag LOCUS_07190 10740 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 10870 11715 gene locus_tag LOCUS_07200 10870 11715 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964264.1 protein_id gnl|my_center|LOCUS_07200 <12663 11755 gene locus_tag LOCUS_07210 <12663 11755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797938.1:family 43 glycosylhydrolase >Feature sequence045 67 1209 gene locus_tag LOCUS_07220 67 1209 CDS product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861386.1 protein_id gnl|my_center|LOCUS_07220 1290 2930 gene locus_tag LOCUS_07230 1290 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 3390 3010 gene locus_tag LOCUS_07240 3390 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 4073 3387 gene locus_tag LOCUS_07250 4073 3387 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460066.1 protein_id gnl|my_center|LOCUS_07250 4254 4547 gene locus_tag LOCUS_07260 4254 4547 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357450.1 protein_id gnl|my_center|LOCUS_07260 4540 5277 gene locus_tag LOCUS_07270 4540 5277 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_07270 5401 7956 gene locus_tag LOCUS_07280 gene gyrA 5401 7956 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947899.1 protein_id gnl|my_center|LOCUS_07280 7959 8912 gene locus_tag LOCUS_07290 7959 8912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 8931 9404 gene locus_tag LOCUS_07300 8931 9404 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966054.1 protein_id gnl|my_center|LOCUS_07300 10262 9450 gene locus_tag LOCUS_07310 10262 9450 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289121.1 protein_id gnl|my_center|LOCUS_07310 10900 10277 gene locus_tag LOCUS_07320 10900 10277 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_07320 11490 10945 gene locus_tag LOCUS_07330 11490 10945 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964415.1 protein_id gnl|my_center|LOCUS_07330 12079 11483 gene locus_tag LOCUS_07340 gene coaE 12079 11483 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548347.1 protein_id gnl|my_center|LOCUS_07340 <12649 12092 gene locus_tag LOCUS_07350 <12649 12092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003732773.1:uracil-DNA glycosylase >Feature sequence046 <1 2159 gene locus_tag LOCUS_07360 <1 2159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009895217.1:Tex family protein 2162 2959 gene locus_tag LOCUS_07370 gene lgt 2162 2959 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242661.1 protein_id gnl|my_center|LOCUS_07370 3099 3245 gene locus_tag LOCUS_07380 3099 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 7494 3271 gene locus_tag LOCUS_07390 7494 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 8576 7620 gene locus_tag LOCUS_07400 gene spoIID 8576 7620 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_07400 12594 8659 gene locus_tag LOCUS_07410 12594 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence047 757 1368 gene locus_tag LOCUS_07420 757 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 1370 2383 gene locus_tag LOCUS_07430 1370 2383 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047642.1 protein_id gnl|my_center|LOCUS_07430 2395 2727 gene locus_tag LOCUS_07440 2395 2727 CDS product phage head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047643.1 protein_id gnl|my_center|LOCUS_07440 2733 3086 gene locus_tag LOCUS_07450 2733 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429844.1 protein_id gnl|my_center|LOCUS_07450 3086 3520 gene locus_tag LOCUS_07460 3086 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 3517 3945 gene locus_tag LOCUS_07470 3517 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 3945 4991 gene locus_tag LOCUS_07480 3945 4991 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861188.1 protein_id gnl|my_center|LOCUS_07480 4998 5438 gene locus_tag LOCUS_07490 4998 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 5457 5837 gene locus_tag LOCUS_07500 5457 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 5861 6004 gene locus_tag LOCUS_07510 5861 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 6007 8445 gene locus_tag LOCUS_07520 6007 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 8454 9287 gene locus_tag LOCUS_07530 8454 9287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 9412 11337 gene locus_tag LOCUS_07540 9412 11337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 11334 11609 gene locus_tag LOCUS_07550 11334 11609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 11602 11988 gene locus_tag LOCUS_07560 11602 11988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence048 6168 2347 gene locus_tag LOCUS_07570 6168 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 7522 6299 gene locus_tag LOCUS_07580 7522 6299 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_07580 8208 7543 gene locus_tag LOCUS_07590 8208 7543 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438166.1 protein_id gnl|my_center|LOCUS_07590 9304 8222 gene locus_tag LOCUS_07600 9304 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 9493 11226 gene locus_tag LOCUS_07610 9493 11226 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_07610 11529 12509 gene locus_tag LOCUS_07620 11529 12509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence049 330 1856 gene locus_tag LOCUS_07630 330 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 2088 4232 gene locus_tag LOCUS_07640 2088 4232 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_07640 4243 4965 gene locus_tag LOCUS_07650 gene cas5c 4243 4965 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176707.1 protein_id gnl|my_center|LOCUS_07650 4959 6740 gene locus_tag LOCUS_07660 gene cas8c 4959 6740 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926986.1 protein_id gnl|my_center|LOCUS_07660 6757 7608 gene locus_tag LOCUS_07670 gene cas7c 6757 7608 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_07670 7605 8249 gene locus_tag LOCUS_07680 gene cas4 7605 8249 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_07680 8246 9268 gene locus_tag LOCUS_07690 gene cas1c 8246 9268 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_07690 9278 9568 gene locus_tag LOCUS_07700 gene cas2 9278 9568 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_07700 9714 10887 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcacgctccccacggagcgtgtgagttgaaat 12019 11096 gene locus_tag LOCUS_07710 12019 11096 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966067.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence050 <1 1587 gene locus_tag LOCUS_07720 <1 1587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861665.1:single-stranded-DNA-specific exonuclease RecJ 1592 3853 gene locus_tag LOCUS_07730 1592 3853 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_07730 3878 4108 gene locus_tag LOCUS_07740 gene yaaA 3878 4108 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420479.1 protein_id gnl|my_center|LOCUS_07740 4109 5203 gene locus_tag LOCUS_07750 gene recF 4109 5203 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470750.1 protein_id gnl|my_center|LOCUS_07750 5203 5448 gene locus_tag LOCUS_07760 5203 5448 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026196.1 protein_id gnl|my_center|LOCUS_07760 5492 7417 gene locus_tag LOCUS_07770 gene gyrB 5492 7417 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_07770 7585 8010 gene locus_tag LOCUS_07780 7585 8010 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_07780 8127 8486 gene locus_tag LOCUS_07790 8127 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 9424 8483 gene locus_tag LOCUS_07800 9424 8483 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986890.1 protein_id gnl|my_center|LOCUS_07800 11088 9403 gene locus_tag LOCUS_07810 11088 9403 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 protein_id gnl|my_center|LOCUS_07810 11614 11081 gene locus_tag LOCUS_07820 gene hpt 11614 11081 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966479.1 protein_id gnl|my_center|LOCUS_07820 >Feature sequence051 1002 91 gene locus_tag LOCUS_07830 1002 91 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787859.1 protein_id gnl|my_center|LOCUS_07830 1759 995 gene locus_tag LOCUS_07840 gene pyrK 1759 995 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983358.1 protein_id gnl|my_center|LOCUS_07840 2684 1770 gene locus_tag LOCUS_07850 gene pyrF 2684 1770 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_07850 3984 2695 gene locus_tag LOCUS_07860 3984 2695 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_07860 4920 4000 gene locus_tag LOCUS_07870 4920 4000 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_07870 5474 4923 gene locus_tag LOCUS_07880 gene pyrR 5474 4923 CDS product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156487.1 protein_id gnl|my_center|LOCUS_07880 5936 5754 gene locus_tag LOCUS_07890 5936 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 6711 6360 gene locus_tag LOCUS_tm00010 6711 6360 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 7188 6715 gene locus_tag LOCUS_07900 gene smpB 7188 6715 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_07900 7732 7262 gene locus_tag LOCUS_07910 7732 7262 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941462.1 protein_id gnl|my_center|LOCUS_07910 9428 7758 gene locus_tag LOCUS_07920 gene recN 9428 7758 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699855.1 protein_id gnl|my_center|LOCUS_07920 9890 9444 gene locus_tag LOCUS_07930 gene argR 9890 9444 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810957.1 protein_id gnl|my_center|LOCUS_07930 10752 9907 gene locus_tag LOCUS_07940 10752 9907 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_07940 10910 11950 gene locus_tag LOCUS_07950 10910 11950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence052 54 1739 gene locus_tag LOCUS_07960 54 1739 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107726402.1 protein_id gnl|my_center|LOCUS_07960 1741 1914 gene locus_tag LOCUS_07970 1741 1914 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405297.1 protein_id gnl|my_center|LOCUS_07970 1925 2473 gene locus_tag LOCUS_07980 1925 2473 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456102.1 protein_id gnl|my_center|LOCUS_07980 2479 2769 gene locus_tag LOCUS_07990 2479 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 2787 3497 gene locus_tag LOCUS_08000 2787 3497 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705455.1 protein_id gnl|my_center|LOCUS_08000 3516 3908 gene locus_tag LOCUS_08010 3516 3908 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957066.1 protein_id gnl|my_center|LOCUS_08010 4612 3965 gene locus_tag LOCUS_08020 gene fsa 4612 3965 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423115.1 protein_id gnl|my_center|LOCUS_08020 4752 5003 gene locus_tag LOCUS_08030 4752 5003 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_08030 5062 5583 gene locus_tag LOCUS_08040 5062 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 5847 7979 gene locus_tag LOCUS_08050 gene nrdD 5847 7979 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187770.1 protein_id gnl|my_center|LOCUS_08050 8153 8668 gene locus_tag LOCUS_08060 gene nrdG 8153 8668 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_08060 8658 9143 gene locus_tag LOCUS_08070 8658 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 10458 9202 gene locus_tag LOCUS_08080 10458 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 10681 10451 gene locus_tag LOCUS_08090 10681 10451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 11903 10719 gene locus_tag LOCUS_08100 11903 10719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence053 1 75 gene locus_tag LOCUS_t00070 1 75 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 128 202 gene locus_tag LOCUS_t00080 128 202 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 286 1485 gene locus_tag LOCUS_08110 286 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1975 2937 gene locus_tag LOCUS_08120 gene dusB 1975 2937 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_08120 3145 2924 gene locus_tag LOCUS_08130 3145 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 3030 4496 gene locus_tag LOCUS_08140 gene guaB 3030 4496 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264083.1 protein_id gnl|my_center|LOCUS_08140 6632 4545 gene locus_tag LOCUS_08150 6632 4545 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_08150 9182 6864 gene locus_tag LOCUS_08160 9182 6864 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027862.1 protein_id gnl|my_center|LOCUS_08160 9359 9940 gene locus_tag LOCUS_08170 9359 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 10101 11168 gene locus_tag LOCUS_08180 10101 11168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence054 767 282 gene locus_tag LOCUS_08190 767 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 1119 2144 gene locus_tag LOCUS_08200 gene galE 1119 2144 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_08200 2216 2923 gene locus_tag LOCUS_08210 2216 2923 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626384.1 protein_id gnl|my_center|LOCUS_08210 3633 2965 gene locus_tag LOCUS_08220 gene trmB 3633 2965 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_08220 6530 3771 gene locus_tag LOCUS_08230 6530 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 7164 6652 gene locus_tag LOCUS_08240 7164 6652 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966286.1 protein_id gnl|my_center|LOCUS_08240 7811 7161 gene locus_tag LOCUS_08250 7811 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_08250 9419 7812 gene locus_tag LOCUS_08260 9419 7812 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_08260 9513 10346 gene locus_tag LOCUS_08270 9513 10346 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_08270 10651 10385 gene locus_tag LOCUS_08280 10651 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 10794 11171 gene locus_tag LOCUS_08290 10794 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence055 51 308 gene locus_tag LOCUS_08300 51 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 370 831 gene locus_tag LOCUS_08310 gene nrdR 370 831 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_08310 815 1669 gene locus_tag LOCUS_08320 815 1669 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_08320 1705 3075 gene locus_tag LOCUS_08330 gene mnmE 1705 3075 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700790.1 protein_id gnl|my_center|LOCUS_08330 3209 4207 gene locus_tag LOCUS_08340 gene pta 3209 4207 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_08340 4478 5677 gene locus_tag LOCUS_08350 4478 5677 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_08350 6099 6827 gene locus_tag LOCUS_08360 gene radC 6099 6827 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016743.1 protein_id gnl|my_center|LOCUS_08360 6991 8202 gene locus_tag LOCUS_08370 6991 8202 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986436.1 protein_id gnl|my_center|LOCUS_08370 8202 9098 gene locus_tag LOCUS_08380 gene thrB 8202 9098 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986279.1 protein_id gnl|my_center|LOCUS_08380 9125 10333 gene locus_tag LOCUS_08390 9125 10333 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_08390 10456 11187 gene locus_tag LOCUS_08400 gene rlmB 10456 11187 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence056 43 441 gene locus_tag LOCUS_08410 43 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 428 1150 gene locus_tag LOCUS_08420 gene atpB 428 1150 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_08420 1202 1456 gene locus_tag LOCUS_08430 gene atpE 1202 1456 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_08430 1482 1976 gene locus_tag LOCUS_08440 1482 1976 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775942.1 protein_id gnl|my_center|LOCUS_08440 1986 2510 gene locus_tag LOCUS_08450 1986 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 2525 4021 gene locus_tag LOCUS_08460 gene atpA 2525 4021 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421367.1 protein_id gnl|my_center|LOCUS_08460 4035 4877 gene locus_tag LOCUS_08470 gene atpG 4035 4877 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_08470 5013 6407 gene locus_tag LOCUS_08480 gene atpD 5013 6407 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_08480 6404 6808 gene locus_tag LOCUS_08490 6404 6808 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262939.1 protein_id gnl|my_center|LOCUS_08490 7114 10059 gene locus_tag LOCUS_08500 gene ebgA 7114 10059 CDS product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706828.1 protein_id gnl|my_center|LOCUS_08500 11128 10103 gene locus_tag LOCUS_08510 11128 10103 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775175.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence057 780 106 gene locus_tag LOCUS_08520 780 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 2477 792 gene locus_tag LOCUS_08530 2477 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 3030 2578 gene locus_tag LOCUS_08540 gene tadA 3030 2578 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_08540 3187 4200 gene locus_tag LOCUS_08550 gene aroF 3187 4200 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_08550 5015 4791 gene locus_tag LOCUS_08560 5015 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 5977 5024 gene locus_tag LOCUS_08570 5977 5024 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_08570 7181 6072 gene locus_tag LOCUS_08580 gene ugpC 7181 6072 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_08580 9486 7417 gene locus_tag LOCUS_08590 gene fusA 9486 7417 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_08590 10939 9941 gene locus_tag LOCUS_08600 10939 9941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence058 99 2405 gene locus_tag LOCUS_08610 99 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 3243 2437 gene locus_tag LOCUS_08620 3243 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 4077 3247 gene locus_tag LOCUS_08630 4077 3247 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357554.1 protein_id gnl|my_center|LOCUS_08630 4295 9742 gene locus_tag LOCUS_08640 4295 9742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 9828 10301 gene locus_tag LOCUS_08650 9828 10301 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence059 3432 5204 gene locus_tag LOCUS_08660 3432 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 5411 5845 gene locus_tag LOCUS_08670 5411 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 6120 6260 gene locus_tag LOCUS_08680 6120 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 7084 6314 gene locus_tag LOCUS_08690 7084 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 7562 7062 gene locus_tag LOCUS_08700 7562 7062 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_08700 7964 9139 gene locus_tag LOCUS_08710 7964 9139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 9195 9470 gene locus_tag LOCUS_08720 9195 9470 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671306.1 protein_id gnl|my_center|LOCUS_08720 9470 9778 gene locus_tag LOCUS_08730 9470 9778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 9889 10800 gene locus_tag LOCUS_08740 9889 10800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 >Feature sequence060 847 74 gene locus_tag LOCUS_08750 847 74 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901801.1 protein_id gnl|my_center|LOCUS_08750 1742 840 gene locus_tag LOCUS_08760 1742 840 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948810.1 protein_id gnl|my_center|LOCUS_08760 2761 1739 gene locus_tag LOCUS_08770 2761 1739 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439336.1 protein_id gnl|my_center|LOCUS_08770 3952 2930 gene locus_tag LOCUS_08780 3952 2930 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_08780 5875 4052 gene locus_tag LOCUS_08790 5875 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 7178 5904 gene locus_tag LOCUS_08800 7178 5904 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545033.1 protein_id gnl|my_center|LOCUS_08800 8047 7232 gene locus_tag LOCUS_08810 8047 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 9513 8080 gene locus_tag LOCUS_08820 gene purB 9513 8080 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_08820 10359 9652 gene locus_tag LOCUS_08830 10359 9652 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence061 169 687 gene locus_tag LOCUS_08840 169 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 2184 718 gene locus_tag LOCUS_08850 2184 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 3434 2532 gene locus_tag LOCUS_08860 3434 2532 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966656.1 protein_id gnl|my_center|LOCUS_08860 4660 3434 gene locus_tag LOCUS_08870 4660 3434 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966655.1 protein_id gnl|my_center|LOCUS_08870 5441 4671 gene locus_tag LOCUS_08880 5441 4671 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964806.1 protein_id gnl|my_center|LOCUS_08880 6282 5620 gene locus_tag LOCUS_08890 6282 5620 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_08890 8021 6387 gene locus_tag LOCUS_08900 8021 6387 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_08900 9623 8040 gene locus_tag LOCUS_08910 9623 8040 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_08910 10166 9876 gene locus_tag LOCUS_08920 10166 9876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence062 305 970 gene locus_tag LOCUS_08930 305 970 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_08930 1041 2111 gene locus_tag LOCUS_08940 gene prfA 1041 2111 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_08940 2124 2969 gene locus_tag LOCUS_08950 2124 2969 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245605.1 protein_id gnl|my_center|LOCUS_08950 3105 3016 gene locus_tag LOCUS_t00090 3105 3016 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3952 3173 gene locus_tag LOCUS_08960 3952 3173 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_08960 4484 4170 gene locus_tag LOCUS_08970 gene rhaM 4484 4170 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288247.1 protein_id gnl|my_center|LOCUS_08970 5873 4503 gene locus_tag LOCUS_08980 gene scfB 5873 4503 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_08980 6104 5961 gene locus_tag LOCUS_08990 gene scfA 6104 5961 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_08990 6575 6219 gene locus_tag LOCUS_09000 6575 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 7038 6637 gene locus_tag LOCUS_09010 7038 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 7740 7138 gene locus_tag LOCUS_09020 7740 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 9967 7892 gene locus_tag LOCUS_09030 9967 7892 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_09030 >Feature sequence063 1471 293 gene locus_tag LOCUS_09040 1471 293 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775184.1 protein_id gnl|my_center|LOCUS_09040 1853 1614 gene locus_tag LOCUS_09050 1853 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 1898 2494 gene locus_tag LOCUS_09060 1898 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 2898 2512 gene locus_tag LOCUS_09070 2898 2512 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191033.1 protein_id gnl|my_center|LOCUS_09070 4363 2885 gene locus_tag LOCUS_09080 gene malQ 4363 2885 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_09080 5031 4369 gene locus_tag LOCUS_09090 5031 4369 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680765.1 protein_id gnl|my_center|LOCUS_09090 5191 5787 gene locus_tag LOCUS_09100 5191 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 7069 6050 gene locus_tag LOCUS_09110 7069 6050 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762418.1 protein_id gnl|my_center|LOCUS_09110 7556 7203 gene locus_tag LOCUS_09120 gene rplT 7556 7203 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_09120 7782 7579 gene locus_tag LOCUS_09130 gene rpmI 7782 7579 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 protein_id gnl|my_center|LOCUS_09130 8366 7812 gene locus_tag LOCUS_09140 gene infC 8366 7812 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808206.1 protein_id gnl|my_center|LOCUS_09140 <10116 8561 gene locus_tag LOCUS_09150 <10116 8561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020062.1:sodium/proline symporter PutP >Feature sequence064 1263 166 gene locus_tag LOCUS_09160 1263 166 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109136.1 protein_id gnl|my_center|LOCUS_09160 3246 1285 gene locus_tag LOCUS_09170 3246 1285 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948262.1 protein_id gnl|my_center|LOCUS_09170 3594 3295 gene locus_tag LOCUS_09180 3594 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 4292 3591 gene locus_tag LOCUS_09190 4292 3591 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943112.1 protein_id gnl|my_center|LOCUS_09190 4524 8633 gene locus_tag LOCUS_09200 4524 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 9784 8738 gene locus_tag LOCUS_09210 gene xerS 9784 8738 CDS product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775101.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence065 158 1864 gene locus_tag LOCUS_09220 158 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 2840 1917 gene locus_tag LOCUS_09230 gene miaA 2840 1917 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_09230 4905 2833 gene locus_tag LOCUS_09240 gene mutL 4905 2833 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861409.1 protein_id gnl|my_center|LOCUS_09240 7557 4957 gene locus_tag LOCUS_09250 gene mutS 7557 4957 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_09250 7975 7595 gene locus_tag LOCUS_09260 7975 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 9411 7993 gene locus_tag LOCUS_09270 gene miaB 9411 7993 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence066 7396 7010 gene locus_tag LOCUS_09280 7396 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 8070 7393 gene locus_tag LOCUS_09290 8070 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 8305 8051 gene locus_tag LOCUS_09300 8305 8051 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963633.1 protein_id gnl|my_center|LOCUS_09300 8755 8372 gene locus_tag LOCUS_09310 8755 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 9454 8792 gene locus_tag LOCUS_09320 9454 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 >Feature sequence067 114 647 gene locus_tag LOCUS_09330 114 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 844 1284 gene locus_tag LOCUS_09340 844 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1781 2008 gene locus_tag LOCUS_09350 1781 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1998 2345 gene locus_tag LOCUS_09360 1998 2345 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458809.1 protein_id gnl|my_center|LOCUS_09360 2338 2493 gene locus_tag LOCUS_09370 2338 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 2506 2625 gene locus_tag LOCUS_09380 2506 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 2704 4230 gene locus_tag LOCUS_09390 2704 4230 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461951.1 protein_id gnl|my_center|LOCUS_09390 4337 5275 gene locus_tag LOCUS_09400 4337 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 5214 6830 gene locus_tag LOCUS_09410 5214 6830 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_09410 6890 7978 gene locus_tag LOCUS_09420 6890 7978 CDS product amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458834.1 protein_id gnl|my_center|LOCUS_09420 7998 8486 gene locus_tag LOCUS_09430 7998 8486 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462001.1 protein_id gnl|my_center|LOCUS_09430 8499 8741 gene locus_tag LOCUS_09440 8499 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 >Feature sequence068 1797 136 gene locus_tag LOCUS_09450 gene leuA 1797 136 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_09450 2165 2716 gene locus_tag LOCUS_09460 2165 2716 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851996.1 protein_id gnl|my_center|LOCUS_09460 2817 3671 gene locus_tag LOCUS_09470 gene rsmA 2817 3671 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651548.1 protein_id gnl|my_center|LOCUS_09470 3683 3976 gene locus_tag LOCUS_09480 3683 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 5849 4023 gene locus_tag LOCUS_09490 gene typA 5849 4023 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964991.1 protein_id gnl|my_center|LOCUS_09490 6024 7724 gene locus_tag LOCUS_09500 gene argS 6024 7724 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948742.1 protein_id gnl|my_center|LOCUS_09500 7750 7962 gene locus_tag LOCUS_09510 7750 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 9293 8271 gene locus_tag LOCUS_09520 9293 8271 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence069 840 145 gene locus_tag LOCUS_09530 840 145 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_09530 1627 860 gene locus_tag LOCUS_09540 1627 860 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_09540 1835 2509 gene locus_tag LOCUS_09550 1835 2509 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461203.1 protein_id gnl|my_center|LOCUS_09550 2522 3850 gene locus_tag LOCUS_09560 2522 3850 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_09560 5325 3934 gene locus_tag LOCUS_09570 gene murC 5325 3934 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_09570 5536 5817 gene locus_tag LOCUS_09580 gene spoVG 5536 5817 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966499.1 protein_id gnl|my_center|LOCUS_09580 6624 5857 gene locus_tag LOCUS_09590 6624 5857 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_09590 7187 6630 gene locus_tag LOCUS_09600 7187 6630 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964405.1 protein_id gnl|my_center|LOCUS_09600 7717 7184 gene locus_tag LOCUS_09610 7717 7184 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_09610 7890 9263 gene locus_tag LOCUS_09620 7890 9263 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence070 561 64 gene locus_tag LOCUS_09630 561 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 849 646 gene locus_tag LOCUS_09640 849 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09640 2189 852 gene locus_tag LOCUS_09650 2189 852 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837092.1 protein_id gnl|my_center|LOCUS_09650 3020 2643 gene locus_tag LOCUS_09660 3020 2643 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_09660 3370 3047 gene locus_tag LOCUS_09670 3370 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 4207 3437 gene locus_tag LOCUS_09680 4207 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 5696 4542 gene locus_tag LOCUS_09690 5696 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 6021 5686 gene locus_tag LOCUS_09700 6021 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 7102 6011 gene locus_tag LOCUS_09710 7102 6011 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_09710 7291 7103 gene locus_tag LOCUS_09720 7291 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395994.1 protein_id gnl|my_center|LOCUS_09720 7740 8270 gene locus_tag LOCUS_09730 7740 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 9039 8563 gene locus_tag LOCUS_09740 9039 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 >Feature sequence071 799 149 gene locus_tag LOCUS_09750 gene pflA 799 149 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_09750 3145 893 gene locus_tag LOCUS_09760 gene pflB 3145 893 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_09760 3775 3395 gene locus_tag LOCUS_09770 3775 3395 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_09770 4155 4367 gene locus_tag LOCUS_09780 4155 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 4389 4610 gene locus_tag LOCUS_09790 4389 4610 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_09790 4666 7173 gene locus_tag LOCUS_09800 4666 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 7211 7381 gene locus_tag LOCUS_09810 7211 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 7527 7997 gene locus_tag LOCUS_09820 7527 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 7994 8689 gene locus_tag LOCUS_09830 7994 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence072 106 744 gene locus_tag LOCUS_09840 106 744 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965894.1 protein_id gnl|my_center|LOCUS_09840 2141 1125 gene locus_tag LOCUS_09850 2141 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09850 2573 2157 gene locus_tag LOCUS_09860 2573 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09860 3180 2800 gene locus_tag LOCUS_09870 3180 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 3760 3113 gene locus_tag LOCUS_09880 gene sigH 3760 3113 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942746.1 protein_id gnl|my_center|LOCUS_09880 4481 3951 gene locus_tag LOCUS_09890 4481 3951 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_09890 5775 4501 gene locus_tag LOCUS_09900 5775 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 6594 5806 gene locus_tag LOCUS_09910 gene trpA 6594 5806 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966434.1 protein_id gnl|my_center|LOCUS_09910 7198 6587 gene locus_tag LOCUS_09920 7198 6587 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_09920 7973 7188 gene locus_tag LOCUS_09930 gene trpC 7973 7188 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966437.1 protein_id gnl|my_center|LOCUS_09930 9005 7992 gene locus_tag LOCUS_09940 gene trpD 9005 7992 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966438.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence073 1148 138 gene locus_tag LOCUS_09950 1148 138 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965056.1 protein_id gnl|my_center|LOCUS_09950 1822 1145 gene locus_tag LOCUS_09960 gene rnc 1822 1145 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_09960 3184 1946 gene locus_tag LOCUS_09970 gene fabF 3184 1946 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_09970 3523 3296 gene locus_tag LOCUS_09980 gene acpP 3523 3296 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_09980 4329 3589 gene locus_tag LOCUS_09990 gene fabG 4329 3589 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_09990 5283 4348 gene locus_tag LOCUS_10000 gene fabD 5283 4348 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_10000 6266 5325 gene locus_tag LOCUS_10010 gene fabK 6266 5325 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460502.1 protein_id gnl|my_center|LOCUS_10010 7276 6299 gene locus_tag LOCUS_10020 7276 6299 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438099.1 protein_id gnl|my_center|LOCUS_10020 8276 7269 gene locus_tag LOCUS_10030 gene plsX 8276 7269 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_10030 8833 8288 gene locus_tag LOCUS_10040 gene fapR 8833 8288 CDS product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419115.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence074 2099 807 gene locus_tag LOCUS_10050 2099 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2346 3476 gene locus_tag LOCUS_10060 2346 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 3466 4374 gene locus_tag LOCUS_10070 3466 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 4375 4704 gene locus_tag LOCUS_10080 4375 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 5412 7463 gene locus_tag LOCUS_10090 5412 7463 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045361.1 protein_id gnl|my_center|LOCUS_10090 7523 8593 gene locus_tag LOCUS_10100 7523 8593 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011578509.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence075 1441 1515 gene locus_tag LOCUS_t00100 1441 1515 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2965 1607 gene locus_tag LOCUS_10110 2965 1607 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891898.1 protein_id gnl|my_center|LOCUS_10110 3102 3974 gene locus_tag LOCUS_10120 gene pdxS 3102 3974 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_10120 3974 4540 gene locus_tag LOCUS_10130 gene pdxT 3974 4540 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687358.1 protein_id gnl|my_center|LOCUS_10130 4627 4821 gene locus_tag LOCUS_10140 4627 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 5396 4809 gene locus_tag LOCUS_10150 5396 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 6100 5393 gene locus_tag LOCUS_10160 6100 5393 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_10160 6869 6126 gene locus_tag LOCUS_10170 6869 6126 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048001.1 protein_id gnl|my_center|LOCUS_10170 7758 6862 gene locus_tag LOCUS_10180 7758 6862 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_10180 8130 7774 gene locus_tag LOCUS_10190 8130 7774 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438259.1 protein_id gnl|my_center|LOCUS_10190 8780 8133 gene locus_tag LOCUS_10200 8780 8133 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence076 53 3316 gene locus_tag LOCUS_10210 53 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 3316 4965 gene locus_tag LOCUS_10220 3316 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 5170 7260 gene locus_tag LOCUS_10230 5170 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 7545 8390 gene locus_tag LOCUS_10240 7545 8390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 8356 8718 gene locus_tag LOCUS_10250 8356 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence077 758 5503 gene locus_tag LOCUS_10260 758 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 5597 7450 gene locus_tag LOCUS_10270 5597 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence078 895 3372 gene locus_tag LOCUS_10280 895 3372 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 protein_id gnl|my_center|LOCUS_10280 4935 3415 gene locus_tag LOCUS_10290 4935 3415 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965259.1 protein_id gnl|my_center|LOCUS_10290 5098 4967 gene locus_tag LOCUS_10300 5098 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 5802 5146 gene locus_tag LOCUS_10310 5802 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 6668 5871 gene locus_tag LOCUS_10320 6668 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 8332 6665 gene locus_tag LOCUS_10330 8332 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence079 127 921 gene locus_tag LOCUS_10340 127 921 CDS product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148557.1 protein_id gnl|my_center|LOCUS_10340 978 1211 gene locus_tag LOCUS_10350 978 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1339 1515 gene locus_tag LOCUS_10360 1339 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1481 1651 gene locus_tag LOCUS_10370 1481 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1658 1939 gene locus_tag LOCUS_10380 1658 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1952 2095 gene locus_tag LOCUS_10390 1952 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2120 3424 gene locus_tag LOCUS_10400 2120 3424 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922059.1 protein_id gnl|my_center|LOCUS_10400 3424 4584 gene locus_tag LOCUS_10410 3424 4584 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922060.1 protein_id gnl|my_center|LOCUS_10410 4584 5060 gene locus_tag LOCUS_10420 4584 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 5074 6645 gene locus_tag LOCUS_10430 5074 6645 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922064.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence080 70 2064 gene locus_tag LOCUS_10440 gene ftsH 70 2064 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048280.1 protein_id gnl|my_center|LOCUS_10440 2039 2404 gene locus_tag LOCUS_10450 2039 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 2525 2827 gene locus_tag LOCUS_10460 gene rpsF 2525 2827 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966984.1 protein_id gnl|my_center|LOCUS_10460 2854 3342 gene locus_tag LOCUS_10470 gene ssb 2854 3342 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981966.1 protein_id gnl|my_center|LOCUS_10470 3379 3624 gene locus_tag LOCUS_10480 gene rpsR 3379 3624 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_10480 3691 4182 gene locus_tag LOCUS_10490 3691 4182 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_10490 4252 4743 gene locus_tag LOCUS_10500 4252 4743 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816021.1 protein_id gnl|my_center|LOCUS_10500 4736 5746 gene locus_tag LOCUS_10510 4736 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 5813 6733 gene locus_tag LOCUS_10520 5813 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 6857 7459 gene locus_tag LOCUS_10530 6857 7459 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_10530 7465 7959 gene locus_tag LOCUS_10540 7465 7959 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence081 480 145 gene locus_tag LOCUS_10550 480 145 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_10550 3426 787 gene locus_tag LOCUS_10560 gene alaS 3426 787 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964985.1 protein_id gnl|my_center|LOCUS_10560 4769 3513 gene locus_tag LOCUS_10570 4769 3513 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_10570 6693 4783 gene locus_tag LOCUS_10580 6693 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 6949 6779 gene locus_tag LOCUS_10590 6949 6779 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 protein_id gnl|my_center|LOCUS_10590 7882 7031 gene locus_tag LOCUS_10600 7882 7031 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_10600 8377 7910 gene locus_tag LOCUS_10610 8377 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 >Feature sequence082 36 278 gene locus_tag LOCUS_10620 36 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 549 2105 gene locus_tag LOCUS_10630 549 2105 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207962.1 protein_id gnl|my_center|LOCUS_10630 2730 2161 gene locus_tag LOCUS_10640 2730 2161 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938908.1 protein_id gnl|my_center|LOCUS_10640 2884 4242 gene locus_tag LOCUS_10650 2884 4242 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861997.1 protein_id gnl|my_center|LOCUS_10650 4235 6481 gene locus_tag LOCUS_10660 4235 6481 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_10660 6535 7167 gene locus_tag LOCUS_10670 6535 7167 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_10670 7716 7216 gene locus_tag LOCUS_10680 7716 7216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 8156 7737 gene locus_tag LOCUS_10690 8156 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence083 163 1551 gene locus_tag LOCUS_10700 163 1551 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_10700 1567 2751 gene locus_tag LOCUS_10710 1567 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2860 5001 gene locus_tag LOCUS_10720 gene gnpA 2860 5001 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389475.1 protein_id gnl|my_center|LOCUS_10720 5086 6435 gene locus_tag LOCUS_10730 5086 6435 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_10730 6451 8325 gene locus_tag LOCUS_10740 6451 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence084 2035 368 gene locus_tag LOCUS_10750 2035 368 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_10750 2462 3208 gene locus_tag LOCUS_10760 2462 3208 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323503.1 protein_id gnl|my_center|LOCUS_10760 3205 4107 gene locus_tag LOCUS_10770 gene pfkB 3205 4107 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_10770 4121 6091 gene locus_tag LOCUS_10780 4121 6091 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 protein_id gnl|my_center|LOCUS_10780 6113 6370 gene locus_tag LOCUS_10790 6113 6370 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_10790 7070 6411 gene locus_tag LOCUS_10800 7070 6411 CDS product DUF6320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804300.1 protein_id gnl|my_center|LOCUS_10800 8330 7071 gene locus_tag LOCUS_10810 8330 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068300.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence085 155 1231 gene locus_tag LOCUS_10820 155 1231 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861188.1 protein_id gnl|my_center|LOCUS_10820 1247 1699 gene locus_tag LOCUS_10830 1247 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1787 2161 gene locus_tag LOCUS_10840 1787 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 2110 2331 gene locus_tag LOCUS_10850 2110 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2340 5126 gene locus_tag LOCUS_10860 2340 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 5160 5714 gene locus_tag LOCUS_10870 5160 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10870 5778 6446 gene locus_tag LOCUS_10880 5778 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 6446 8026 gene locus_tag LOCUS_10890 6446 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence086 611 27 gene locus_tag LOCUS_10900 611 27 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174736.1 protein_id gnl|my_center|LOCUS_10900 2149 758 gene locus_tag LOCUS_10910 gene gltA 2149 758 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_10910 3020 2169 gene locus_tag LOCUS_10920 3020 2169 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_10920 4002 3109 gene locus_tag LOCUS_10930 4002 3109 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964578.1 protein_id gnl|my_center|LOCUS_10930 4667 4002 gene locus_tag LOCUS_10940 4667 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 5952 4672 gene locus_tag LOCUS_10950 5952 4672 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_10950 6099 6398 gene locus_tag LOCUS_10960 6099 6398 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262048.1 protein_id gnl|my_center|LOCUS_10960 6410 7636 gene locus_tag LOCUS_10970 6410 7636 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968802.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence087 340 1605 gene locus_tag LOCUS_10980 340 1605 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416818.1 protein_id gnl|my_center|LOCUS_10980 1755 2633 gene locus_tag LOCUS_10990 1755 2633 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_10990 4226 2979 gene locus_tag LOCUS_11000 4226 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 4447 5484 gene locus_tag LOCUS_11010 gene argC 4447 5484 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_11010 5500 6372 gene locus_tag LOCUS_11020 gene argB 5500 6372 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940826.1 protein_id gnl|my_center|LOCUS_11020 6393 8099 gene locus_tag LOCUS_11030 6393 8099 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966455.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence088 28 2262 gene locus_tag LOCUS_11040 28 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 2259 3800 gene locus_tag LOCUS_11050 gene murJ 2259 3800 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966328.1 protein_id gnl|my_center|LOCUS_11050 3805 5661 gene locus_tag LOCUS_11060 3805 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 5781 6896 gene locus_tag LOCUS_11070 5781 6896 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582960.1 protein_id gnl|my_center|LOCUS_11070 6910 7377 gene locus_tag LOCUS_11080 6910 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 7392 7877 gene locus_tag LOCUS_11090 7392 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence089 2627 1995 gene locus_tag LOCUS_11100 gene yihA 2627 1995 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640795.1 protein_id gnl|my_center|LOCUS_11100 4964 2652 gene locus_tag LOCUS_11110 gene lon 4964 2652 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357593.1 protein_id gnl|my_center|LOCUS_11110 6113 5043 gene locus_tag LOCUS_11120 6113 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 7710 6253 gene locus_tag LOCUS_11130 gene ctpA 7710 6253 CDS product carboxy-terminal processing protease CtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231186.1 protein_id gnl|my_center|LOCUS_11130 7868 7716 gene locus_tag LOCUS_11140 7868 7716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence090 56 391 gene locus_tag LOCUS_11150 56 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 763 299 gene locus_tag LOCUS_11160 763 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 778 7194 gene locus_tag LOCUS_11170 778 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 >Feature sequence091 322 89 gene locus_tag LOCUS_11180 322 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 497 1363 gene locus_tag LOCUS_11190 497 1363 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459574.1 protein_id gnl|my_center|LOCUS_11190 2643 1405 gene locus_tag LOCUS_11200 2643 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11200 4002 2653 gene locus_tag LOCUS_11210 4002 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11210 5163 4231 gene locus_tag LOCUS_11220 5163 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 6637 5153 gene locus_tag LOCUS_11230 6637 5153 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814305.1 protein_id gnl|my_center|LOCUS_11230 7295 6612 gene locus_tag LOCUS_11240 gene yycF 7295 6612 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131580.1 protein_id gnl|my_center|LOCUS_11240 7713 7348 gene locus_tag LOCUS_11250 7713 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 >Feature sequence092 >Feature sequence093 956 183 gene locus_tag LOCUS_11260 956 183 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 protein_id gnl|my_center|LOCUS_11260 1592 960 gene locus_tag LOCUS_11270 gene thiF 1592 960 CDS product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897548.1 protein_id gnl|my_center|LOCUS_11270 1787 1596 gene locus_tag LOCUS_11280 gene thiS 1787 1596 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430174.1 protein_id gnl|my_center|LOCUS_11280 2140 1925 gene locus_tag LOCUS_11290 2140 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 2929 2417 gene locus_tag LOCUS_11300 2929 2417 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900176.1 protein_id gnl|my_center|LOCUS_11300 3802 2951 gene locus_tag LOCUS_11310 gene nadC 3802 2951 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016071.1 protein_id gnl|my_center|LOCUS_11310 5066 3795 gene locus_tag LOCUS_11320 5066 3795 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430790.1 protein_id gnl|my_center|LOCUS_11320 5986 5078 gene locus_tag LOCUS_11330 gene nadA 5986 5078 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016069.1 protein_id gnl|my_center|LOCUS_11330 7080 6097 gene locus_tag LOCUS_11340 7080 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 7383 7084 gene locus_tag LOCUS_11350 7383 7084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence094 <1 742 gene locus_tag LOCUS_11360 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051754043.1:polymorphic toxin-type HINT domain-containing protein 1019 1291 gene locus_tag LOCUS_11370 1019 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1316 2830 gene locus_tag LOCUS_11380 1316 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 2820 3140 gene locus_tag LOCUS_11390 2820 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 3156 3512 gene locus_tag LOCUS_11400 3156 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 3515 3814 gene locus_tag LOCUS_11410 3515 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 3894 5222 gene locus_tag LOCUS_11420 3894 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 >Feature sequence095 1514 216 gene locus_tag LOCUS_11430 1514 216 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288357.1 protein_id gnl|my_center|LOCUS_11430 2288 1602 gene locus_tag LOCUS_11440 2288 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 2469 2684 gene locus_tag LOCUS_11450 2469 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2932 4368 gene locus_tag LOCUS_11460 2932 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 4638 4441 gene locus_tag LOCUS_11470 4638 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 5296 4652 gene locus_tag LOCUS_11480 5296 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 6156 5293 gene locus_tag LOCUS_11490 6156 5293 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897173.1 protein_id gnl|my_center|LOCUS_11490 6534 6157 gene locus_tag LOCUS_11500 6534 6157 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_11500 7046 6666 gene locus_tag LOCUS_11510 7046 6666 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence096 61 1347 gene locus_tag LOCUS_11520 gene tig 61 1347 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_11520 1377 1973 gene locus_tag LOCUS_11530 gene clpP 1377 1973 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_11530 1988 3259 gene locus_tag LOCUS_11540 gene clpX 1988 3259 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_11540 3286 4587 gene locus_tag LOCUS_11550 gene lysA 3286 4587 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963928.1 protein_id gnl|my_center|LOCUS_11550 4992 4642 gene locus_tag LOCUS_11560 4992 4642 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436216.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence097 490 65 gene locus_tag LOCUS_11570 490 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1008 511 gene locus_tag LOCUS_11580 gene purE 1008 511 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544997.1 protein_id gnl|my_center|LOCUS_11580 1478 1242 gene locus_tag LOCUS_11590 1478 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1709 2029 gene locus_tag LOCUS_11600 1709 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11600 2311 3981 gene locus_tag LOCUS_11610 2311 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 5053 4043 gene locus_tag LOCUS_11620 5053 4043 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_11620 5770 5078 gene locus_tag LOCUS_11630 5770 5078 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_11630 6007 7230 gene locus_tag LOCUS_11640 6007 7230 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence098 975 34 gene locus_tag LOCUS_11650 975 34 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 protein_id gnl|my_center|LOCUS_11650 1800 1048 gene locus_tag LOCUS_11660 gene pdaB 1800 1048 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965679.1 protein_id gnl|my_center|LOCUS_11660 2381 1866 gene locus_tag LOCUS_11670 2381 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 2523 5099 gene locus_tag LOCUS_11680 2523 5099 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_11680 5103 5333 gene locus_tag LOCUS_11690 5103 5333 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943881.1 protein_id gnl|my_center|LOCUS_11690 5334 7232 gene locus_tag LOCUS_11700 gene feoB 5334 7232 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948746.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence099 19 1242 gene locus_tag LOCUS_11710 19 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1310 1990 gene locus_tag LOCUS_11720 1310 1990 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861589.1 protein_id gnl|my_center|LOCUS_11720 1993 2493 gene locus_tag LOCUS_11730 1993 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11730 2527 3009 gene locus_tag LOCUS_11740 2527 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11740 3114 3284 gene locus_tag LOCUS_11750 3114 3284 CDS product cysteine-rich KTR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387697.1 protein_id gnl|my_center|LOCUS_11750 3775 4251 gene locus_tag LOCUS_11760 3775 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 4842 5207 gene locus_tag LOCUS_11770 4842 5207 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_11770 5200 5337 gene locus_tag LOCUS_11780 5200 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence100 <1 2591 gene locus_tag LOCUS_11790 <1 2591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814361.1:TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein 3446 2634 gene locus_tag LOCUS_11800 gene pheA 3446 2634 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060994.1 protein_id gnl|my_center|LOCUS_11800 4555 3536 gene locus_tag LOCUS_11810 gene aroF 4555 3536 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_11810 5740 4631 gene locus_tag LOCUS_11820 5740 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 6111 5797 gene locus_tag LOCUS_11830 6111 5797 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004612621.1 protein_id gnl|my_center|LOCUS_11830 7042 6128 gene locus_tag LOCUS_11840 7042 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence101 2623 212 gene locus_tag LOCUS_11850 gene leuS 2623 212 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830785.1 protein_id gnl|my_center|LOCUS_11850 2988 2647 gene locus_tag LOCUS_11860 gene rsfS 2988 2647 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880811.1 protein_id gnl|my_center|LOCUS_11860 3567 3004 gene locus_tag LOCUS_11870 gene yqeK 3567 3004 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_11870 4162 3557 gene locus_tag LOCUS_11880 gene nadD 4162 3557 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_11880 4461 4159 gene locus_tag LOCUS_11890 4461 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 5144 4872 gene locus_tag LOCUS_11900 5144 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 5636 5220 gene locus_tag LOCUS_11910 gene ruvX 5636 5220 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_11910 7018 5636 gene locus_tag LOCUS_11920 7018 5636 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence102 6777 6406 gene locus_tag LOCUS_11930 6777 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence103 1464 430 gene locus_tag LOCUS_11940 1464 430 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_11940 1680 1498 gene locus_tag LOCUS_11950 1680 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 3198 1705 gene locus_tag LOCUS_11960 3198 1705 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_11960 4716 3265 gene locus_tag LOCUS_11970 4716 3265 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861938.1 protein_id gnl|my_center|LOCUS_11970 6749 4995 gene locus_tag LOCUS_11980 6749 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence104 6589 77 gene locus_tag LOCUS_11990 6589 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence105 184 1164 gene locus_tag LOCUS_12000 184 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12000 1494 3242 gene locus_tag LOCUS_12010 gene thrS 1494 3242 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_12010 3303 3953 gene locus_tag LOCUS_12020 gene yunB 3303 3953 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418439.1 protein_id gnl|my_center|LOCUS_12020 4080 5954 gene locus_tag LOCUS_12030 gene ligA 4080 5954 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence106 580 65 gene locus_tag LOCUS_12040 580 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 2007 580 gene locus_tag LOCUS_12050 2007 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460135.1 protein_id gnl|my_center|LOCUS_12050 2372 2022 gene locus_tag LOCUS_12060 2372 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 2864 2388 gene locus_tag LOCUS_12070 2864 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 3397 2861 gene locus_tag LOCUS_12080 3397 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 3738 3403 gene locus_tag LOCUS_12090 3738 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 4069 3743 gene locus_tag LOCUS_12100 4069 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 4370 4083 gene locus_tag LOCUS_12110 4370 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 4760 4371 gene locus_tag LOCUS_12120 4760 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 6274 4763 gene locus_tag LOCUS_12130 6274 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272391.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence107 3735 2062 gene locus_tag LOCUS_12140 3735 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 4413 3739 gene locus_tag LOCUS_12150 gene sigI 4413 3739 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002082432.1 protein_id gnl|my_center|LOCUS_12150 5807 4461 gene locus_tag LOCUS_12160 5807 4461 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989199.1 protein_id gnl|my_center|LOCUS_12160 <6649 5876 gene locus_tag LOCUS_12170 <6649 5876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435793.1:SufD family Fe-S cluster assembly protein >Feature sequence108 240 425 gene locus_tag LOCUS_12180 240 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 560 745 gene locus_tag LOCUS_12190 560 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 756 932 gene locus_tag LOCUS_12200 756 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1137 2036 gene locus_tag LOCUS_12210 1137 2036 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263382.1 protein_id gnl|my_center|LOCUS_12210 2536 3138 gene locus_tag LOCUS_12220 2536 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence109 1722 2471 gene locus_tag LOCUS_12230 1722 2471 CDS product DUF4886 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119653.1 protein_id gnl|my_center|LOCUS_12230 2464 4722 gene locus_tag LOCUS_12240 2464 4722 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_12240 4744 5898 gene locus_tag LOCUS_12250 4744 5898 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence110 45 1181 gene locus_tag LOCUS_12260 45 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1195 3327 gene locus_tag LOCUS_12270 1195 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 3965 3369 gene locus_tag LOCUS_12280 gene recR 3965 3369 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_12280 4320 3967 gene locus_tag LOCUS_12290 4320 3967 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_12290 6201 4351 gene locus_tag LOCUS_12300 gene dnaX 6201 4351 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421622.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence111 3108 160 gene locus_tag LOCUS_12310 3108 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 3302 3649 gene locus_tag LOCUS_12320 3302 3649 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_12320 4942 3662 gene locus_tag LOCUS_12330 4942 3662 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_12330 6410 5031 gene locus_tag LOCUS_12340 gene purF 6410 5031 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence112 78 539 gene locus_tag LOCUS_12350 78 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 806 609 gene locus_tag LOCUS_12360 806 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1755 943 gene locus_tag LOCUS_12370 1755 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 2025 1759 gene locus_tag LOCUS_12380 2025 1759 CDS product DUF6275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386748.1 protein_id gnl|my_center|LOCUS_12380 2232 2032 gene locus_tag LOCUS_12390 2232 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 2545 2261 gene locus_tag LOCUS_12400 2545 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 2717 2550 gene locus_tag LOCUS_12410 2717 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3122 2730 gene locus_tag LOCUS_12420 3122 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 5460 3139 gene locus_tag LOCUS_12430 5460 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 6012 5473 gene locus_tag LOCUS_12440 6012 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence113 80 1171 gene locus_tag LOCUS_12450 80 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12450 1247 1777 gene locus_tag LOCUS_12460 1247 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12460 2966 2046 gene locus_tag LOCUS_12470 2966 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 4069 2966 gene locus_tag LOCUS_12480 4069 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 4377 4084 gene locus_tag LOCUS_12490 4377 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 5836 4448 gene locus_tag LOCUS_12500 5836 4448 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_12500 6346 6158 gene locus_tag LOCUS_12510 6346 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence114 2011 368 gene locus_tag LOCUS_12520 2011 368 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947970.1 protein_id gnl|my_center|LOCUS_12520 2193 2957 gene locus_tag LOCUS_12530 gene soj 2193 2957 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_12530 2988 3806 gene locus_tag LOCUS_12540 2988 3806 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_12540 3875 4381 gene locus_tag LOCUS_12550 3875 4381 CDS product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815159.1 protein_id gnl|my_center|LOCUS_12550 4374 4817 gene locus_tag LOCUS_12560 4374 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 4836 6107 gene locus_tag LOCUS_12570 gene serS 4836 6107 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963350.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence115 136 654 gene locus_tag LOCUS_12580 136 654 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_12580 671 1432 gene locus_tag LOCUS_12590 671 1432 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816623.1 protein_id gnl|my_center|LOCUS_12590 1434 2264 gene locus_tag LOCUS_12600 1434 2264 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275478.1 protein_id gnl|my_center|LOCUS_12600 2420 2647 gene locus_tag LOCUS_12610 2420 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12610 2726 3178 gene locus_tag LOCUS_12620 2726 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12620 3175 4398 gene locus_tag LOCUS_12630 gene larC 3175 4398 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964092.1 protein_id gnl|my_center|LOCUS_12630 4382 5185 gene locus_tag LOCUS_12640 gene larE 4382 5185 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_12640 5325 5564 gene locus_tag LOCUS_12650 5325 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 5561 6031 gene locus_tag LOCUS_12660 5561 6031 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803082.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence116 268 3357 gene locus_tag LOCUS_12670 268 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 3457 5718 gene locus_tag LOCUS_12680 3457 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence117 420 181 gene locus_tag LOCUS_12690 420 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1253 324 gene locus_tag LOCUS_12700 1253 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12700 1616 1386 gene locus_tag LOCUS_12710 1616 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12710 2051 1623 gene locus_tag LOCUS_12720 2051 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 2494 2309 gene locus_tag LOCUS_12730 2494 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 3093 2452 gene locus_tag LOCUS_12740 3093 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 3261 4115 gene locus_tag LOCUS_12750 3261 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 4076 4585 gene locus_tag LOCUS_12760 4076 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 4592 4900 gene locus_tag LOCUS_12770 4592 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 5075 5209 gene locus_tag LOCUS_12780 5075 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence118 <1 764 gene locus_tag LOCUS_12790 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162470596.1:DUF2971 domain-containing protein 929 2362 gene locus_tag LOCUS_12800 929 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 2429 3028 gene locus_tag LOCUS_12810 2429 3028 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248985.1 protein_id gnl|my_center|LOCUS_12810 3249 3710 gene locus_tag LOCUS_12820 3249 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 3700 4650 gene locus_tag LOCUS_12830 3700 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 5028 5474 gene locus_tag LOCUS_12840 5028 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 5464 5892 gene locus_tag LOCUS_12850 5464 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence119 806 2713 gene locus_tag LOCUS_12860 806 2713 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048250.1 protein_id gnl|my_center|LOCUS_12860 2710 3153 gene locus_tag LOCUS_12870 gene dtd 2710 3153 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_12870 3164 3631 gene locus_tag LOCUS_12880 3164 3631 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_12880 3706 5238 gene locus_tag LOCUS_12890 gene guaA 3706 5238 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_12890 5599 5321 gene locus_tag LOCUS_12900 5599 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence120 <1 831 gene locus_tag LOCUS_12910 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861630.1:AraC family transcriptional regulator 5988 877 gene locus_tag LOCUS_12920 5988 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence121 <1 864 gene locus_tag LOCUS_12930 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009924790.1:sugar ABC transporter permease 879 1832 gene locus_tag LOCUS_12940 879 1832 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 protein_id gnl|my_center|LOCUS_12940 1863 4340 gene locus_tag LOCUS_12950 1863 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence122 167 760 gene locus_tag LOCUS_12960 167 760 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_12960 788 1765 gene locus_tag LOCUS_12970 788 1765 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_12970 1759 2586 gene locus_tag LOCUS_12980 gene prmC 1759 2586 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_12980 2599 3675 gene locus_tag LOCUS_12990 2599 3675 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_12990 4446 3757 gene locus_tag LOCUS_13000 gene sigK 4446 3757 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_13000 4665 5948 gene locus_tag LOCUS_13010 4665 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence123 57 4355 gene locus_tag LOCUS_13020 57 4355 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965697.1 protein_id gnl|my_center|LOCUS_13020 5850 4387 gene locus_tag LOCUS_13030 5850 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence124 426 25 gene locus_tag LOCUS_13040 426 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 681 1409 gene locus_tag LOCUS_13050 gene rgaR 681 1409 CDS product two-component system response regulator RgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432343.1 protein_id gnl|my_center|LOCUS_13050 1418 3325 gene locus_tag LOCUS_13060 1418 3325 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021374131.1 protein_id gnl|my_center|LOCUS_13060 4966 3365 gene locus_tag LOCUS_13070 4966 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 5184 5029 gene locus_tag LOCUS_13080 5184 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 <5874 5235 gene locus_tag LOCUS_13090 <5874 5235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986486.1:MATE family efflux transporter >Feature sequence125 <1 1248 gene locus_tag LOCUS_13100 <1 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009902537.1:multidrug efflux MATE transporter CdeA 3109 1280 gene locus_tag LOCUS_13110 3109 1280 CDS product DUF5695 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007753560.1 protein_id gnl|my_center|LOCUS_13110 3952 3134 gene locus_tag LOCUS_13120 3952 3134 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_13120 4149 5411 gene locus_tag LOCUS_13130 4149 5411 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_13130 5479 5613 gene locus_tag LOCUS_13140 5479 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence126 1335 166 gene locus_tag LOCUS_13150 1335 166 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_13150 1708 1412 gene locus_tag LOCUS_13160 1708 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 2270 1734 gene locus_tag LOCUS_13170 2270 1734 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 protein_id gnl|my_center|LOCUS_13170 3025 2270 gene locus_tag LOCUS_13180 3025 2270 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_13180 4085 3027 gene locus_tag LOCUS_13190 4085 3027 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_13190 4298 4089 gene locus_tag LOCUS_13200 4298 4089 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_13200 4995 4324 gene locus_tag LOCUS_13210 4995 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_13210 5647 5081 gene locus_tag LOCUS_13220 5647 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence127 317 5437 gene locus_tag LOCUS_13230 317 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence128 1247 267 gene locus_tag LOCUS_13240 1247 267 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891913.1 protein_id gnl|my_center|LOCUS_13240 2159 1302 gene locus_tag LOCUS_13250 gene rapZ 2159 1302 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_13250 3073 2174 gene locus_tag LOCUS_13260 gene murB 3073 2174 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_13260 3728 3093 gene locus_tag LOCUS_13270 3728 3093 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393968.1 protein_id gnl|my_center|LOCUS_13270 4839 3889 gene locus_tag LOCUS_13280 gene hprK 4839 3889 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_13280 5080 5268 gene locus_tag LOCUS_13290 gene rpmB 5080 5268 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965040.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence129 <1 1325 gene locus_tag LOCUS_13300 <1 1325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202067.1:glycosyl hydrolase 115 family protein 1427 3382 gene locus_tag LOCUS_13310 1427 3382 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575935.1 protein_id gnl|my_center|LOCUS_13310 3379 5391 gene locus_tag LOCUS_13320 3379 5391 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109145.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence130 1827 1543 gene locus_tag LOCUS_13330 1827 1543 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_13330 2029 1865 gene locus_tag LOCUS_13340 2029 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 2407 2045 gene locus_tag LOCUS_13350 2407 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 2644 5283 gene locus_tag LOCUS_13360 2644 5283 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048098.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence131 154 1971 gene locus_tag LOCUS_13370 154 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 3356 2130 gene locus_tag LOCUS_13380 3356 2130 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361987.1 protein_id gnl|my_center|LOCUS_13380 4738 3653 gene locus_tag LOCUS_13390 4738 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 5356 4748 gene locus_tag LOCUS_13400 5356 4748 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263264.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence132 1156 107 gene locus_tag LOCUS_13410 gene rhaS 1156 107 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582803.1 protein_id gnl|my_center|LOCUS_13410 2294 1230 gene locus_tag LOCUS_13420 2294 1230 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533602.1 protein_id gnl|my_center|LOCUS_13420 3283 2294 gene locus_tag LOCUS_13430 3283 2294 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226379.1 protein_id gnl|my_center|LOCUS_13430 4790 3300 gene locus_tag LOCUS_13440 4790 3300 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582804.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence133 232 2517 gene locus_tag LOCUS_13450 232 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 2598 4058 gene locus_tag LOCUS_13460 2598 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 4018 4167 gene locus_tag LOCUS_13470 4018 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 4160 4489 gene locus_tag LOCUS_13480 4160 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence134 559 362 gene locus_tag LOCUS_13490 559 362 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263444.1 protein_id gnl|my_center|LOCUS_13490 2498 687 gene locus_tag LOCUS_13500 gene lepA 2498 687 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_13500 3705 2566 gene locus_tag LOCUS_13510 3705 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 3888 4238 gene locus_tag LOCUS_13520 gene rplS 3888 4238 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_13520 4371 5057 gene locus_tag LOCUS_13530 gene lepB 4371 5057 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711853.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence135 83 577 gene locus_tag LOCUS_13540 83 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 610 771 gene locus_tag LOCUS_13550 610 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 805 1182 gene locus_tag LOCUS_13560 805 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1175 2563 gene locus_tag LOCUS_13570 gene terL 1175 2563 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819485.1 protein_id gnl|my_center|LOCUS_13570 2573 3934 gene locus_tag LOCUS_13580 2573 3934 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861027.1 protein_id gnl|my_center|LOCUS_13580 3903 5492 gene locus_tag LOCUS_13590 3903 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence136 1245 109 gene locus_tag LOCUS_13600 1245 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1599 1285 gene locus_tag LOCUS_13610 1599 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1788 3314 gene locus_tag LOCUS_13620 1788 3314 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_13620 3335 3766 gene locus_tag LOCUS_13630 3335 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 4952 4053 gene locus_tag LOCUS_13640 4952 4053 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882793.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13640 5168 5001 gene locus_tag LOCUS_13650 5168 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13650 >Feature sequence137 <1 1021 gene locus_tag LOCUS_13660 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072763.1:exonuclease SbcCD subunit D 1018 4098 gene locus_tag LOCUS_13670 1018 4098 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247465.1 protein_id gnl|my_center|LOCUS_13670 4136 4212 gene locus_tag LOCUS_t00110 4136 4212 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <5462 4267 gene locus_tag LOCUS_13680 <5462 4267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020940.1:sodium-dependent transporter >Feature sequence138 1780 248 gene locus_tag LOCUS_13690 1780 248 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903217.1 protein_id gnl|my_center|LOCUS_13690 2895 1858 gene locus_tag LOCUS_13700 2895 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3721 2819 gene locus_tag LOCUS_13710 3721 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence139 74 3082 gene locus_tag LOCUS_13720 74 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 4917 3160 gene locus_tag LOCUS_13730 4917 3160 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 protein_id gnl|my_center|LOCUS_13730 5363 4989 gene locus_tag LOCUS_13740 5363 4989 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964084.1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence140 34 1389 gene locus_tag LOCUS_13750 34 1389 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964253.1 protein_id gnl|my_center|LOCUS_13750 1412 2050 gene locus_tag LOCUS_13760 gene hisG 1412 2050 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436683.1 protein_id gnl|my_center|LOCUS_13760 2047 2760 gene locus_tag LOCUS_13770 gene hisA 2047 2760 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256251.1 protein_id gnl|my_center|LOCUS_13770 2779 3498 gene locus_tag LOCUS_13780 2779 3498 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_13780 5355 3748 gene locus_tag LOCUS_13790 5355 3748 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence141 516 1922 gene locus_tag LOCUS_13800 516 1922 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667252.1 protein_id gnl|my_center|LOCUS_13800 2780 1968 gene locus_tag LOCUS_13810 2780 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 3136 4161 gene locus_tag LOCUS_13820 gene queA 3136 4161 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_13820 4174 5295 gene locus_tag LOCUS_13830 gene tgt 4174 5295 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence142 657 226 gene locus_tag LOCUS_13840 657 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 1049 675 gene locus_tag LOCUS_13850 1049 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 1617 1033 gene locus_tag LOCUS_13860 1617 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 2857 3294 gene locus_tag LOCUS_13870 2857 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 3514 4305 gene locus_tag LOCUS_13880 3514 4305 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_13880 4305 5258 gene locus_tag LOCUS_13890 4305 5258 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429290.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence143 68 502 gene locus_tag LOCUS_13900 68 502 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_13900 504 1397 gene locus_tag LOCUS_13910 504 1397 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_13910 1719 1417 gene locus_tag LOCUS_13920 1719 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1839 3770 gene locus_tag LOCUS_13930 1839 3770 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence144 3189 682 gene locus_tag LOCUS_13940 3189 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 3514 3155 gene locus_tag LOCUS_13950 3514 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 3762 3511 gene locus_tag LOCUS_13960 3762 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 3955 3752 gene locus_tag LOCUS_13970 3955 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 4115 3972 gene locus_tag LOCUS_13980 4115 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 4309 4488 gene locus_tag LOCUS_13990 4309 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 4703 4506 gene locus_tag LOCUS_14000 4703 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 4948 4733 gene locus_tag LOCUS_14010 4948 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence145 1146 118 gene locus_tag LOCUS_14020 gene rmuC 1146 118 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765517.1 protein_id gnl|my_center|LOCUS_14020 1310 2473 gene locus_tag LOCUS_14030 1310 2473 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439713.1 protein_id gnl|my_center|LOCUS_14030 2592 3248 gene locus_tag LOCUS_14040 2592 3248 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_14040 3257 3988 gene locus_tag LOCUS_14050 3257 3988 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545170.1 protein_id gnl|my_center|LOCUS_14050 3981 4580 gene locus_tag LOCUS_14060 gene scpB 3981 4580 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_14060 4598 5221 gene locus_tag LOCUS_14070 4598 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence146 90 1343 gene locus_tag LOCUS_14080 90 1343 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435635.1 protein_id gnl|my_center|LOCUS_14080 1401 1814 gene locus_tag LOCUS_14090 1401 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_14090 1899 3401 gene locus_tag LOCUS_14100 gene thrC 1899 3401 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_14100 3472 4761 gene locus_tag LOCUS_14110 gene galK 3472 4761 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263235.1 protein_id gnl|my_center|LOCUS_14110 5263 4814 gene locus_tag LOCUS_14120 gene spoVAC 5263 4814 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965602.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence147 322 56 gene locus_tag LOCUS_14130 gene rpsO 322 56 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_14130 650 438 gene locus_tag LOCUS_14140 gene rpmE 650 438 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_14140 1964 738 gene locus_tag LOCUS_14150 1964 738 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_14150 2262 2855 gene locus_tag LOCUS_14160 2262 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 2880 3788 gene locus_tag LOCUS_14170 2880 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 4150 4755 gene locus_tag LOCUS_14180 gene hisH 4150 4755 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964257.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence148 30 1187 gene locus_tag LOCUS_14190 30 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3155 1581 gene locus_tag LOCUS_14200 3155 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 3404 4795 gene locus_tag LOCUS_14210 3404 4795 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence149 765 145 gene locus_tag LOCUS_14220 gene spoIIR 765 145 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966181.1 protein_id gnl|my_center|LOCUS_14220 884 1339 gene locus_tag LOCUS_14230 884 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1361 2710 gene locus_tag LOCUS_14240 gene ypeB 1361 2710 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966179.1 protein_id gnl|my_center|LOCUS_14240 2802 3986 gene locus_tag LOCUS_14250 gene metK 2802 3986 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966140.1 protein_id gnl|my_center|LOCUS_14250 <5244 4081 gene locus_tag LOCUS_14260 <5244 4081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986283.1:iron-containing alcohol dehydrogenase >Feature sequence150 32 105 gene locus_tag LOCUS_t00120 32 105 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 479 144 gene locus_tag LOCUS_14270 479 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 711 514 gene locus_tag LOCUS_14280 711 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1728 817 gene locus_tag LOCUS_14290 gene ftsY 1728 817 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965059.1 protein_id gnl|my_center|LOCUS_14290 <5167 1738 gene locus_tag LOCUS_14300 <5167 1738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861158.1:chromosome segregation protein SMC >Feature sequence151 <1 575 gene locus_tag LOCUS_14310 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963590.1:L-lactate dehydrogenase 685 840 gene locus_tag LOCUS_14320 685 840 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003018715.1 protein_id gnl|my_center|LOCUS_14320 863 2095 gene locus_tag LOCUS_14330 863 2095 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965827.1 protein_id gnl|my_center|LOCUS_14330 2238 2525 gene locus_tag LOCUS_14340 2238 2525 CDS product DUF960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296262.1 protein_id gnl|my_center|LOCUS_14340 2540 3610 gene locus_tag LOCUS_14350 2540 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3614 4534 gene locus_tag LOCUS_14360 3614 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 4835 4638 gene locus_tag LOCUS_14370 4835 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence152 436 3192 gene locus_tag LOCUS_14380 436 3192 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_14380 3202 3822 gene locus_tag LOCUS_14390 3202 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 4163 4897 gene locus_tag LOCUS_14400 gene dinD 4163 4897 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460715.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence153 1089 373 gene locus_tag LOCUS_14410 1089 373 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_14410 3207 1102 gene locus_tag LOCUS_14420 3207 1102 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_14420 4736 3210 gene locus_tag LOCUS_14430 4736 3210 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence154 469 1074 gene locus_tag LOCUS_14440 469 1074 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_14440 1154 1654 gene locus_tag LOCUS_14450 1154 1654 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_14450 2946 1756 gene locus_tag LOCUS_14460 2946 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 3599 3012 gene locus_tag LOCUS_14470 3599 3012 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_14470 4769 3624 gene locus_tag LOCUS_14480 gene aroC 4769 3624 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence155 2533 77 gene locus_tag LOCUS_14490 2533 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 3912 2740 gene locus_tag LOCUS_14500 3912 2740 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 protein_id gnl|my_center|LOCUS_14500 4676 3915 gene locus_tag LOCUS_14510 4676 3915 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence156 4752 1027 gene locus_tag LOCUS_14520 4752 1027 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence157 101 1798 gene locus_tag LOCUS_14530 101 1798 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_14530 1906 2676 gene locus_tag LOCUS_14540 1906 2676 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_14540 2627 3499 gene locus_tag LOCUS_14550 2627 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_14550 3504 4376 gene locus_tag LOCUS_14560 3504 4376 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948434.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence158 64 984 gene locus_tag LOCUS_14570 64 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1001 1219 gene locus_tag LOCUS_14580 1001 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1221 1499 gene locus_tag LOCUS_14590 1221 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1503 2291 gene locus_tag LOCUS_14600 1503 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2384 2593 gene locus_tag LOCUS_14610 2384 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 2717 2926 gene locus_tag LOCUS_14620 2717 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 2926 4200 gene locus_tag LOCUS_14630 2926 4200 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860746.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence159 1094 603 gene locus_tag LOCUS_14640 1094 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14640 1445 1122 gene locus_tag LOCUS_14650 1445 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14650 4624 1463 gene locus_tag LOCUS_14660 4624 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence160 45 1925 gene locus_tag LOCUS_14670 gene htpG 45 1925 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_14670 2593 1973 gene locus_tag LOCUS_14680 2593 1973 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775255.1 protein_id gnl|my_center|LOCUS_14680 3837 2590 gene locus_tag LOCUS_14690 3837 2590 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932313.1 protein_id gnl|my_center|LOCUS_14690 4652 3837 gene locus_tag LOCUS_14700 gene proB 4652 3837 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence161 2112 148 gene locus_tag LOCUS_14710 gene uvrB 2112 148 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891935.1 protein_id gnl|my_center|LOCUS_14710 2948 2133 gene locus_tag LOCUS_14720 2948 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679695.1 protein_id gnl|my_center|LOCUS_14720 3599 2961 gene locus_tag LOCUS_14730 3599 2961 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_14730 4554 3757 gene locus_tag LOCUS_14740 4554 3757 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966200.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence162 363 1424 gene locus_tag LOCUS_14750 363 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 2447 1470 gene locus_tag LOCUS_14760 gene galT 2447 1470 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080138.1 protein_id gnl|my_center|LOCUS_14760 3936 2518 gene locus_tag LOCUS_14770 3936 2518 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_14770 <4614 3936 gene locus_tag LOCUS_14780 <4614 3936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003359320.1:response regulator transcription factor >Feature sequence163 1061 105 gene locus_tag LOCUS_14790 1061 105 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948775.1 protein_id gnl|my_center|LOCUS_14790 1465 2484 gene locus_tag LOCUS_14800 gene pheS 1465 2484 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence164 1685 42 gene locus_tag LOCUS_14810 gene ade 1685 42 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_14810 1876 2301 gene locus_tag LOCUS_14820 1876 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence165 94 720 gene locus_tag LOCUS_14830 94 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14830 2841 835 gene locus_tag LOCUS_14840 2841 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3944 3192 gene locus_tag LOCUS_14850 3944 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 4512 3946 gene locus_tag LOCUS_14860 4512 3946 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272666.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence166 <1 613 gene locus_tag LOCUS_14870 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_101621619.1:restriction endonuclease subunit S 632 3334 gene locus_tag LOCUS_14880 632 3334 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068838.1 protein_id gnl|my_center|LOCUS_14880 3359 3781 gene locus_tag LOCUS_14890 3359 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14890 >Feature sequence167 761 531 gene locus_tag LOCUS_14900 761 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 954 2249 gene locus_tag LOCUS_14910 gene mtaB 954 2249 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_14910 4429 2285 gene locus_tag LOCUS_14920 4429 2285 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584017.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence168 3520 1016 gene locus_tag LOCUS_14930 3520 1016 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786535.1 protein_id gnl|my_center|LOCUS_14930 <4534 3575 gene locus_tag LOCUS_14940 <4534 3575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808153.1:diaminopimelate dehydrogenase >Feature sequence169 640 44 gene locus_tag LOCUS_14950 640 44 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813668.1 protein_id gnl|my_center|LOCUS_14950 816 640 gene locus_tag LOCUS_14960 816 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 3308 924 gene locus_tag LOCUS_14970 3308 924 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964652.1 protein_id gnl|my_center|LOCUS_14970 3487 3858 gene locus_tag LOCUS_14980 3487 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 3966 4400 gene locus_tag LOCUS_14990 3966 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence170 101 2176 gene locus_tag LOCUS_15000 gene glgB 101 2176 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_15000 2225 3430 gene locus_tag LOCUS_15010 gene glgC 2225 3430 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence171 116 1474 gene locus_tag LOCUS_15020 116 1474 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_15020 2480 1560 gene locus_tag LOCUS_15030 gene secF 2480 1560 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048082.1 protein_id gnl|my_center|LOCUS_15030 3775 2480 gene locus_tag LOCUS_15040 gene secD 3775 2480 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965576.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence172 46 2577 gene locus_tag LOCUS_15050 46 2577 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388658.1 protein_id gnl|my_center|LOCUS_15050 2590 3381 gene locus_tag LOCUS_15060 2590 3381 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901594.1 protein_id gnl|my_center|LOCUS_15060 3383 3826 gene locus_tag LOCUS_15070 3383 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 <4503 3933 gene locus_tag LOCUS_15080 <4503 3933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987043.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence173 239 868 gene locus_tag LOCUS_15090 239 868 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110319.1 protein_id gnl|my_center|LOCUS_15090 928 1248 gene locus_tag LOCUS_15100 928 1248 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393078.1 protein_id gnl|my_center|LOCUS_15100 1250 1477 gene locus_tag LOCUS_15110 1250 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1499 1903 gene locus_tag LOCUS_15120 1499 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1945 2268 gene locus_tag LOCUS_15130 1945 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 2292 2522 gene locus_tag LOCUS_15140 2292 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 2643 4121 gene locus_tag LOCUS_15150 2643 4121 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861147.1 protein_id gnl|my_center|LOCUS_15150 4137 4490 gene locus_tag LOCUS_15160 4137 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence174 <1 651 gene locus_tag LOCUS_15170 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459777.1:transcriptional repressor LexA 716 1966 gene locus_tag LOCUS_15180 716 1966 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438321.1 protein_id gnl|my_center|LOCUS_15180 2084 2335 gene locus_tag LOCUS_15190 2084 2335 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385813.1 protein_id gnl|my_center|LOCUS_15190 3201 2413 gene locus_tag LOCUS_15200 3201 2413 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464970.1 protein_id gnl|my_center|LOCUS_15200 4071 3256 gene locus_tag LOCUS_15210 gene noc 4071 3256 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence175 84 689 gene locus_tag LOCUS_15220 84 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 689 3838 gene locus_tag LOCUS_15230 689 3838 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390017.1 protein_id gnl|my_center|LOCUS_15230 3850 4473 gene locus_tag LOCUS_15240 3850 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence176 368 1210 gene locus_tag LOCUS_15250 gene cdaA 368 1210 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360232.1 protein_id gnl|my_center|LOCUS_15250 1207 2394 gene locus_tag LOCUS_15260 1207 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 2407 3291 gene locus_tag LOCUS_15270 gene hslO 2407 3291 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965667.1 protein_id gnl|my_center|LOCUS_15270 3422 3556 gene locus_tag LOCUS_15280 gene rpmH 3422 3556 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293121.1 protein_id gnl|my_center|LOCUS_15280 3638 3970 gene locus_tag LOCUS_15290 gene rnpA 3638 3970 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966998.1 protein_id gnl|my_center|LOCUS_15290 3967 4209 gene locus_tag LOCUS_15300 gene yidD 3967 4209 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966997.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence177 42 117 gene locus_tag LOCUS_t00130 42 117 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 486 411 gene locus_tag LOCUS_t00140 486 411 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 562 487 gene locus_tag LOCUS_t00150 562 487 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 656 580 gene locus_tag LOCUS_t00160 656 580 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 792 716 gene locus_tag LOCUS_t00170 792 716 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 872 799 gene locus_tag LOCUS_t00180 872 799 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2010 1003 gene locus_tag LOCUS_15310 2010 1003 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965651.1 protein_id gnl|my_center|LOCUS_15310 2365 2111 gene locus_tag LOCUS_15320 2365 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3629 2499 gene locus_tag LOCUS_15330 gene rodA 3629 2499 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_15330 4419 3844 gene locus_tag LOCUS_15340 4419 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence178 543 1067 gene locus_tag LOCUS_15350 543 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1173 1592 gene locus_tag LOCUS_15360 1173 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1627 3081 gene locus_tag LOCUS_15370 1627 3081 CDS product CpaF/VirB11 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272749.1 protein_id gnl|my_center|LOCUS_15370 3068 3997 gene locus_tag LOCUS_15380 3068 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458855.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence179 3479 1746 gene locus_tag LOCUS_15390 3479 1746 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_15390 3979 3533 gene locus_tag LOCUS_15400 3979 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence180 >Feature sequence181 832 1239 gene locus_tag LOCUS_15410 832 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1217 1444 gene locus_tag LOCUS_15420 1217 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1542 3716 gene locus_tag LOCUS_15430 1542 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence182 90 353 gene locus_tag LOCUS_15440 gene rpsT 90 353 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890686.1 protein_id gnl|my_center|LOCUS_15440 393 1301 gene locus_tag LOCUS_15450 393 1301 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966760.1 protein_id gnl|my_center|LOCUS_15450 1368 1808 gene locus_tag LOCUS_15460 1368 1808 CDS product effector binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966759.1 protein_id gnl|my_center|LOCUS_15460 1880 2347 gene locus_tag LOCUS_15470 1880 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15470 2357 2926 gene locus_tag LOCUS_15480 2357 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15480 3034 4314 gene locus_tag LOCUS_15490 3034 4314 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083681.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence183 476 1045 gene locus_tag LOCUS_15500 476 1045 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_15500 1657 1148 gene locus_tag LOCUS_15510 1657 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15510 2196 1804 gene locus_tag LOCUS_15520 2196 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15520 4176 2257 gene locus_tag LOCUS_15530 4176 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence184 190 963 gene locus_tag LOCUS_15540 190 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1277 2380 gene locus_tag LOCUS_15550 gene asd 1277 2380 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_15550 2413 3303 gene locus_tag LOCUS_15560 gene dapA 2413 3303 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422063.1 protein_id gnl|my_center|LOCUS_15560 3319 4077 gene locus_tag LOCUS_15570 gene dapB 3319 4077 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence185 285 473 gene locus_tag LOCUS_15580 285 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 857 1195 gene locus_tag LOCUS_15590 857 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1199 1780 gene locus_tag LOCUS_15600 1199 1780 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460384.1 protein_id gnl|my_center|LOCUS_15600 2183 1836 gene locus_tag LOCUS_15610 2183 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 4217 2202 gene locus_tag LOCUS_15620 4217 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 >Feature sequence186 376 1194 gene locus_tag LOCUS_15630 376 1194 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876451.1 protein_id gnl|my_center|LOCUS_15630 1301 3778 gene locus_tag LOCUS_15640 1301 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 >Feature sequence187 544 876 gene locus_tag LOCUS_15650 544 876 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723862.1 protein_id gnl|my_center|LOCUS_15650 910 2253 gene locus_tag LOCUS_15660 gene ffh 910 2253 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965061.1 protein_id gnl|my_center|LOCUS_15660 2313 2555 gene locus_tag LOCUS_15670 gene rpsP 2313 2555 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_15670 2573 2806 gene locus_tag LOCUS_15680 2573 2806 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_15680 2877 3389 gene locus_tag LOCUS_15690 gene rimM 2877 3389 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_15690 3386 4123 gene locus_tag LOCUS_15700 gene trmD 3386 4123 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384686.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence188 129 1871 gene locus_tag LOCUS_15710 gene iorA 129 1871 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_15710 1873 2433 gene locus_tag LOCUS_15720 1873 2433 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_15720 2444 2566 gene locus_tag LOCUS_15730 2444 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 2581 3888 gene locus_tag LOCUS_15740 2581 3888 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107332.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence189 33 536 gene locus_tag LOCUS_15750 gene ruvC 33 536 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_15750 816 1403 gene locus_tag LOCUS_15760 gene ruvA 816 1403 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_15760 1432 2439 gene locus_tag LOCUS_15770 gene ruvB 1432 2439 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_15770 2492 4051 gene locus_tag LOCUS_15780 2492 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence190 63 1214 gene locus_tag LOCUS_15790 63 1214 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108152.1 protein_id gnl|my_center|LOCUS_15790 1919 2596 gene locus_tag LOCUS_15800 1919 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 2637 2891 gene locus_tag LOCUS_15810 2637 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 3039 4052 gene locus_tag LOCUS_15820 3039 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence191 253 8 gene locus_tag LOCUS_15830 253 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1208 351 gene locus_tag LOCUS_15840 1208 351 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811435.1 protein_id gnl|my_center|LOCUS_15840 2741 1323 gene locus_tag LOCUS_15850 2741 1323 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976070.1 protein_id gnl|my_center|LOCUS_15850 4138 2921 gene locus_tag LOCUS_15860 4138 2921 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386376.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence192 1667 510 gene locus_tag LOCUS_15870 gene rpoD 1667 510 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_15870 3474 1672 gene locus_tag LOCUS_15880 gene dnaG 3474 1672 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_15880 <4111 3532 gene locus_tag LOCUS_15890 <4111 3532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392158.1:flavodoxin family protein >Feature sequence193 1871 3043 gene locus_tag LOCUS_15900 1871 3043 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence194 <1 852 gene locus_tag LOCUS_15910 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391968.1:mannonate dehydratase 1633 881 gene locus_tag LOCUS_15920 1633 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 2164 3945 gene locus_tag LOCUS_15930 2164 3945 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence195 3977 1821 gene locus_tag LOCUS_15940 3977 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence196 <1 665 gene locus_tag LOCUS_15950 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003433947.1:4Fe-4S binding protein 2875 707 gene locus_tag LOCUS_15960 2875 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 3048 3467 gene locus_tag LOCUS_15970 3048 3467 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543273.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence197 28 2160 gene locus_tag LOCUS_15980 gene mobP3 28 2160 CDS product MobP3 family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458828.1 protein_id gnl|my_center|LOCUS_15980 2413 2174 gene locus_tag LOCUS_15990 2413 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 2480 3250 gene locus_tag LOCUS_16000 2480 3250 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064443.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence198 46 1305 gene locus_tag LOCUS_16010 46 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1729 3732 gene locus_tag LOCUS_16020 1729 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence199 <1 1327 gene locus_tag LOCUS_16030 <1 1327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042338787.1:cell wall-binding repeat-containing protein 1623 2096 gene locus_tag LOCUS_16040 1623 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence200 1686 1018 gene locus_tag LOCUS_16050 1686 1018 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_16050 3433 1709 gene locus_tag LOCUS_16060 3433 1709 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence201 <1 1016 gene locus_tag LOCUS_16070 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072910.1:DNA cytosine methyltransferase 1037 1543 gene locus_tag LOCUS_16080 1037 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460160.1 protein_id gnl|my_center|LOCUS_16080 1548 2132 gene locus_tag LOCUS_16090 1548 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 2129 2614 gene locus_tag LOCUS_16100 2129 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 2822 3322 gene locus_tag LOCUS_16110 2822 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 3334 3480 gene locus_tag LOCUS_16120 3334 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 3501 3755 gene locus_tag LOCUS_16130 3501 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence202 1415 246 gene locus_tag LOCUS_16140 gene ftsZ 1415 246 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_16140 2517 1597 gene locus_tag LOCUS_16150 2517 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 3782 2532 gene locus_tag LOCUS_16160 gene murA 3782 2532 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence203 <1 1057 gene locus_tag LOCUS_16170 <1 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257681.1:class I SAM-dependent DNA methyltransferase 1041 1562 gene locus_tag LOCUS_16180 1041 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 2041 1559 gene locus_tag LOCUS_16190 2041 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 2198 3712 gene locus_tag LOCUS_16200 2198 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence204 143 601 gene locus_tag LOCUS_16210 143 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 687 944 gene locus_tag LOCUS_16220 687 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1095 1505 gene locus_tag LOCUS_16230 1095 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1498 3657 gene locus_tag LOCUS_16240 1498 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence205 1406 2236 gene locus_tag LOCUS_16250 gene kduI 1406 2236 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010741491.1 protein_id gnl|my_center|LOCUS_16250 2250 3065 gene locus_tag LOCUS_16260 2250 3065 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288254.1 protein_id gnl|my_center|LOCUS_16260 3195 3347 gene locus_tag LOCUS_16270 3195 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence206 53 814 gene locus_tag LOCUS_16280 gene pdaA 53 814 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244439.1 protein_id gnl|my_center|LOCUS_16280 917 3733 gene locus_tag LOCUS_16290 917 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence207 207 440 gene locus_tag LOCUS_16300 207 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 456 884 gene locus_tag LOCUS_16310 456 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 893 1357 gene locus_tag LOCUS_16320 893 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1375 2805 gene locus_tag LOCUS_16330 1375 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 2820 3704 gene locus_tag LOCUS_16340 2820 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence208 601 1644 gene locus_tag LOCUS_16350 601 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2039 1848 gene locus_tag LOCUS_16360 2039 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1966 3132 gene locus_tag LOCUS_16370 1966 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 <3707 3161 gene locus_tag LOCUS_16380 <3707 3161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000671185.1:ribosome-associated translation inhibitor RaiA >Feature sequence209 342 554 gene locus_tag LOCUS_16390 342 554 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_16390 649 3204 gene locus_tag LOCUS_16400 649 3204 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068835.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence210 90 1310 gene locus_tag LOCUS_16410 90 1310 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_16410 1448 2827 gene locus_tag LOCUS_16420 gene argH 1448 2827 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence211 2548 170 gene locus_tag LOCUS_16430 2548 170 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068835.1 protein_id gnl|my_center|LOCUS_16430 3002 2796 gene locus_tag LOCUS_16440 3002 2796 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence212 1451 795 gene locus_tag LOCUS_16450 1451 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 <3659 1471 gene locus_tag LOCUS_16460 <3659 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813061.1:C40 family peptidase >Feature sequence213 22 1380 gene locus_tag LOCUS_16470 22 1380 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_16470 2647 1427 gene locus_tag LOCUS_16480 gene tyrS 2647 1427 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_16480 2923 2738 gene locus_tag LOCUS_16490 2923 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 3618 2920 gene locus_tag LOCUS_16500 gene tepA 3618 2920 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence214 561 2105 gene locus_tag LOCUS_16510 561 2105 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_16510 2194 3351 gene locus_tag LOCUS_16520 gene alr 2194 3351 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_16520 3398 3559 gene locus_tag LOCUS_16530 3398 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence215 1 1815 gene locus_tag LOCUS_16540 gene walK 1 1815 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722908.1 protein_id gnl|my_center|LOCUS_16540 1830 2081 gene locus_tag LOCUS_16550 1830 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 2189 2632 gene locus_tag LOCUS_16560 2189 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 3590 2670 gene locus_tag LOCUS_16570 3590 2670 CDS product 4Fe-4S-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430299.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence216 594 400 gene locus_tag LOCUS_16580 594 400 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965947.1 protein_id gnl|my_center|LOCUS_16580 796 2805 gene locus_tag LOCUS_16590 796 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence217 1071 241 gene locus_tag LOCUS_16600 1071 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence218 51 1322 gene locus_tag LOCUS_16610 gene eno 51 1322 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964032.1 protein_id gnl|my_center|LOCUS_16610 2681 1365 gene locus_tag LOCUS_16620 2681 1365 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052123.1 protein_id gnl|my_center|LOCUS_16620 3267 2683 gene locus_tag LOCUS_16630 3267 2683 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947081.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence219 1655 585 gene locus_tag LOCUS_16640 gene mnmA 1655 585 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_16640 2344 1670 gene locus_tag LOCUS_16650 2344 1670 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_16650 <3466 2355 gene locus_tag LOCUS_16660 <3466 2355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000023877.1:HAMP domain-containing sensor histidine kinase >Feature sequence220 1555 59 gene locus_tag LOCUS_16670 1555 59 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_16670 2617 1559 gene locus_tag LOCUS_16680 2617 1559 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_16680 3327 2737 gene locus_tag LOCUS_16690 3327 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence221 683 312 gene locus_tag LOCUS_16700 gene ridA 683 312 CDS product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298042.1 protein_id gnl|my_center|LOCUS_16700 1632 712 gene locus_tag LOCUS_16710 1632 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence222 3253 146 gene locus_tag LOCUS_16720 3253 146 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272308.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence223 222 1196 gene locus_tag LOCUS_16730 222 1196 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570859.1 protein_id gnl|my_center|LOCUS_16730 2923 1391 gene locus_tag LOCUS_16740 2923 1391 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence224 1304 6 gene locus_tag LOCUS_16750 1304 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1731 1297 gene locus_tag LOCUS_16760 1731 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1942 2091 gene locus_tag LOCUS_16770 1942 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2234 2413 gene locus_tag LOCUS_16780 2234 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 3204 2440 gene locus_tag LOCUS_16790 3204 2440 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548147.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence225 2497 683 gene locus_tag LOCUS_16800 2497 683 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272394.1 protein_id gnl|my_center|LOCUS_16800 3076 2672 gene locus_tag LOCUS_16810 3076 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence226 <1 734 gene locus_tag LOCUS_16820 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392969.1:S-layer homology domain-containing protein 812 1483 gene locus_tag LOCUS_16830 812 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 1678 3072 gene locus_tag LOCUS_16840 1678 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence227 115 531 gene locus_tag LOCUS_16850 115 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 557 874 gene locus_tag LOCUS_16860 557 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 1405 920 gene locus_tag LOCUS_16870 1405 920 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047822.1 protein_id gnl|my_center|LOCUS_16870 1693 3042 gene locus_tag LOCUS_16880 1693 3042 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671452.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence228 894 694 gene locus_tag LOCUS_16890 894 694 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814511.1 protein_id gnl|my_center|LOCUS_16890 1075 887 gene locus_tag LOCUS_16900 1075 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1230 1069 gene locus_tag LOCUS_16910 1230 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 2599 1211 gene locus_tag LOCUS_16920 2599 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 2899 2618 gene locus_tag LOCUS_16930 2899 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence229 1574 924 gene locus_tag LOCUS_16940 1574 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1853 1599 gene locus_tag LOCUS_16950 1853 1599 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391595.1 protein_id gnl|my_center|LOCUS_16950 2318 1869 gene locus_tag LOCUS_16960 2318 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 2872 2321 gene locus_tag LOCUS_16970 2872 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence230 1791 493 gene locus_tag LOCUS_16980 1791 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 3176 1794 gene locus_tag LOCUS_16990 3176 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence231 <1 1592 gene locus_tag LOCUS_17000 <1 1592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011862014.1:diguanylate cyclase 3202 1610 gene locus_tag LOCUS_17010 3202 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence232 1572 400 gene locus_tag LOCUS_17020 1572 400 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010680900.1 protein_id gnl|my_center|LOCUS_17020 1836 3014 gene locus_tag LOCUS_17030 1836 3014 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085938409.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence233 42 548 gene locus_tag LOCUS_17040 gene thiW 42 548 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829480.1 protein_id gnl|my_center|LOCUS_17040 545 1330 gene locus_tag LOCUS_17050 gene thiM 545 1330 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_17050 1317 1952 gene locus_tag LOCUS_17060 gene thiE 1317 1952 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_17060 1949 2740 gene locus_tag LOCUS_17070 gene thiD 1949 2740 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence234 672 355 gene locus_tag LOCUS_17080 672 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 1238 669 gene locus_tag LOCUS_17090 1238 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2702 1362 gene locus_tag LOCUS_17100 2702 1362 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861101.1 protein_id gnl|my_center|LOCUS_17100 2992 2663 gene locus_tag LOCUS_17110 gene mobC 2992 2663 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861100.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence235 1265 267 gene locus_tag LOCUS_17120 1265 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1430 1651 gene locus_tag LOCUS_17130 1430 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1760 3085 gene locus_tag LOCUS_17140 1760 3085 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence236 1454 84 gene locus_tag LOCUS_17150 1454 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1651 1364 gene locus_tag LOCUS_17160 1651 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 <3194 1795 gene locus_tag LOCUS_17170 <3194 1795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003433949.1:hydroxylamine reductase >Feature sequence237 1963 1508 gene locus_tag LOCUS_17180 1963 1508 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460509.1 protein_id gnl|my_center|LOCUS_17180 2460 1984 gene locus_tag LOCUS_17190 gene coaD 2460 1984 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_17190 3102 2560 gene locus_tag LOCUS_17200 gene rsmD 3102 2560 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence238 836 1648 gene locus_tag LOCUS_17210 836 1648 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948300.1 protein_id gnl|my_center|LOCUS_17210 1862 1686 gene locus_tag LOCUS_17220 1862 1686 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_17220 3069 1954 gene locus_tag LOCUS_17230 3069 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence239 <3187 440 gene locus_tag LOCUS_17240 <3187 440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227184.1:family 43 glycosylhydrolase >Feature sequence240 1212 82 gene locus_tag LOCUS_17250 1212 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 2510 1332 gene locus_tag LOCUS_17260 2510 1332 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965744.1 protein_id gnl|my_center|LOCUS_17260 3041 2538 gene locus_tag LOCUS_17270 3041 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17270 >Feature sequence241 <1 3128 gene locus_tag LOCUS_17280 <1 3128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202205.1:DUF5107 domain-containing protein >Feature sequence242 <3152 102 gene locus_tag LOCUS_17290 <3152 102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986794.1:PolC-type DNA polymerase III >Feature sequence243 1067 273 gene locus_tag LOCUS_17300 1067 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1612 1064 gene locus_tag LOCUS_17310 1612 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 <3133 2589 gene locus_tag LOCUS_17320 <3133 2589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011837415.1:GNAT family protein >Feature sequence244 2809 716 gene locus_tag LOCUS_17330 2809 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 >Feature sequence245 751 23 gene locus_tag LOCUS_17340 gene rsmG 751 23 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048453.1 protein_id gnl|my_center|LOCUS_17340 1505 768 gene locus_tag LOCUS_17350 1505 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 2872 1523 gene locus_tag LOCUS_17360 gene glmM 2872 1523 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence246 240 863 gene locus_tag LOCUS_17370 240 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393882.1 protein_id gnl|my_center|LOCUS_17370 922 1785 gene locus_tag LOCUS_17380 gene fba 922 1785 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_17380 1841 2710 gene locus_tag LOCUS_17390 1841 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence247 2422 23 gene locus_tag LOCUS_17400 2422 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence248 <1 1674 gene locus_tag LOCUS_17410 <1 1674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048300.1:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD >Feature sequence249 <3087 530 gene locus_tag LOCUS_17420 <3087 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202204.1:beta-galactosidase >Feature sequence250 507 1658 gene locus_tag LOCUS_17430 507 1658 CDS product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733142.1 protein_id gnl|my_center|LOCUS_17430 3064 1862 gene locus_tag LOCUS_17440 3064 1862 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361987.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence251 159 794 gene locus_tag LOCUS_17450 159 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1312 791 gene locus_tag LOCUS_17460 1312 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2306 1323 gene locus_tag LOCUS_17470 2306 1323 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047820.1 protein_id gnl|my_center|LOCUS_17470 2759 2412 gene locus_tag LOCUS_17480 2759 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence252 144 1112 gene locus_tag LOCUS_17490 144 1112 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_17490 1096 1800 gene locus_tag LOCUS_17500 gene gldF 1096 1800 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence253 673 65 gene locus_tag LOCUS_17510 673 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 943 749 gene locus_tag LOCUS_17520 943 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1106 915 gene locus_tag LOCUS_17530 1106 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1705 1124 gene locus_tag LOCUS_17540 1705 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2745 1705 gene locus_tag LOCUS_17550 2745 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence254 1324 635 gene locus_tag LOCUS_17560 1324 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17560 1792 1346 gene locus_tag LOCUS_17570 gene rplI 1792 1346 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226915.1 protein_id gnl|my_center|LOCUS_17570 <3057 1807 gene locus_tag LOCUS_17580 <3057 1807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003429268.1:DHH family phosphoesterase >Feature sequence255 79 432 gene locus_tag LOCUS_17590 79 432 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_17590 445 2178 gene locus_tag LOCUS_17600 445 2178 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence256 <1 631 gene locus_tag LOCUS_17610 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461395.1:ATP-binding cassette domain-containing protein 631 1389 gene locus_tag LOCUS_17620 631 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 2860 2396 gene locus_tag LOCUS_17630 2860 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence257 969 670 gene locus_tag LOCUS_17640 969 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1208 987 gene locus_tag LOCUS_17650 1208 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 1542 2072 gene locus_tag LOCUS_17660 1542 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 2106 2690 gene locus_tag LOCUS_17670 2106 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence258 341 670 gene locus_tag LOCUS_17680 341 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 692 1651 gene locus_tag LOCUS_17690 692 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence259 88 1422 gene locus_tag LOCUS_17700 gene trpE 88 1422 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966440.1 protein_id gnl|my_center|LOCUS_17700 1419 1982 gene locus_tag LOCUS_17710 1419 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 2051 2293 gene locus_tag LOCUS_17720 2051 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 2863 2501 gene locus_tag LOCUS_17730 2863 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence260 1 210 gene locus_tag LOCUS_17740 1 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 226 1110 gene locus_tag LOCUS_17750 226 1110 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence261 147 2732 gene locus_tag LOCUS_17760 gene adhE 147 2732 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035380749.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence262 179 2686 gene locus_tag LOCUS_17770 179 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2674 2811 gene locus_tag LOCUS_17780 2674 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence263 239 2146 gene locus_tag LOCUS_17790 239 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 2362 2679 gene locus_tag LOCUS_17800 2362 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence264 >Feature sequence265 1488 334 gene locus_tag LOCUS_17810 1488 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2648 1575 gene locus_tag LOCUS_17820 2648 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence266 817 473 gene locus_tag LOCUS_17830 817 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 1312 1641 gene locus_tag LOCUS_17840 1312 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 1954 1670 gene locus_tag LOCUS_17850 1954 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 <2836 2168 gene locus_tag LOCUS_17860 <2836 2168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393357.1:copper amine oxidase N-terminal domain-containing protein >Feature sequence267 <1 1012 gene locus_tag LOCUS_17870 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001865532.1:type VII secretion protein EssC note possible pseudo, frameshifted 1009 2742 gene locus_tag LOCUS_17880 1009 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence268 1262 189 gene locus_tag LOCUS_17890 1262 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 2296 1268 gene locus_tag LOCUS_17900 2296 1268 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368732.1 protein_id gnl|my_center|LOCUS_17900 2821 2738 gene locus_tag LOCUS_t00190 2821 2738 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence269 1367 537 gene locus_tag LOCUS_17910 gene folD 1367 537 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_17910 2715 1261 gene locus_tag LOCUS_17920 2715 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17920 >Feature sequence270 2519 1341 gene locus_tag LOCUS_17930 2519 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence271 937 305 gene locus_tag LOCUS_17940 937 305 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262698.1 protein_id gnl|my_center|LOCUS_17940 1645 947 gene locus_tag LOCUS_17950 1645 947 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966938.1 protein_id gnl|my_center|LOCUS_17950 <2801 1638 gene locus_tag LOCUS_17960 <2801 1638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016309345.1:sensor histidine kinase KdpD >Feature sequence272 6 1214 gene locus_tag LOCUS_17970 6 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1204 2067 gene locus_tag LOCUS_17980 1204 2067 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681080.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence273 854 1441 gene locus_tag LOCUS_17990 854 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 <2769 1434 gene locus_tag LOCUS_18000 <2769 1434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000187233.1:restriction endonuclease subunit S >Feature sequence274 <1 745 gene locus_tag LOCUS_18010 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000288216.1:S-layer homology domain-containing protein 1515 1664 gene locus_tag LOCUS_18020 1515 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 1687 2619 gene locus_tag LOCUS_18030 1687 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence275 171 392 gene locus_tag LOCUS_18040 171 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 389 574 gene locus_tag LOCUS_18050 389 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 577 1383 gene locus_tag LOCUS_18060 577 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 1401 2105 gene locus_tag LOCUS_18070 1401 2105 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458865.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence276 1325 96 gene locus_tag LOCUS_18080 1325 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 938 848 gene locus_tag LOCUS_t00200 938 848 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2188 1343 gene locus_tag LOCUS_18090 2188 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence277 127 966 gene locus_tag LOCUS_18100 127 966 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_18100 970 1788 gene locus_tag LOCUS_18110 970 1788 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_18110 1785 2501 gene locus_tag LOCUS_18120 1785 2501 CDS product DUF2161 domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966295.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence278 162 1739 gene locus_tag LOCUS_18130 gene rny 162 1739 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence279 784 173 gene locus_tag LOCUS_18140 784 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 2318 762 gene locus_tag LOCUS_18150 2318 762 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 protein_id gnl|my_center|LOCUS_18150 2474 2352 gene locus_tag LOCUS_18160 2474 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence280 958 47 gene locus_tag LOCUS_18170 958 47 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_18170 1406 939 gene locus_tag LOCUS_18180 gene lspA 1406 939 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549207.1 protein_id gnl|my_center|LOCUS_18180 <2552 1418 gene locus_tag LOCUS_18190 <2552 1418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262699.1:3-dehydroquinate synthase >Feature sequence281 876 106 gene locus_tag LOCUS_18200 gene sigG 876 106 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_18200 1660 947 gene locus_tag LOCUS_18210 gene sigE 1660 947 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_18210 2220 1675 gene locus_tag LOCUS_18220 2220 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence282 176 1009 gene locus_tag LOCUS_18230 176 1009 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775663.1 protein_id gnl|my_center|LOCUS_18230 1537 1731 gene locus_tag LOCUS_18240 1537 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1774 2271 gene locus_tag LOCUS_18250 1774 2271 CDS product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862921.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence283 1112 810 gene locus_tag LOCUS_18260 1112 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 2325 1258 gene locus_tag LOCUS_18270 gene leuB 2325 1258 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_18270