>Feature sequence001 141 2117 gene locus_tag LOCUS_00010 141 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2186 3250 gene locus_tag LOCUS_00020 2186 3250 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009058447.1 protein_id gnl|my_center|LOCUS_00020 3263 5374 gene locus_tag LOCUS_00030 3263 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6713 5337 gene locus_tag LOCUS_00040 gene miaB 6713 5337 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_00040 7945 6722 gene locus_tag LOCUS_00050 gene rlmD 7945 6722 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_00050 8289 7966 gene locus_tag LOCUS_00060 8289 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9332 8403 gene locus_tag LOCUS_00070 9332 8403 CDS product DUF3750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391328.1 protein_id gnl|my_center|LOCUS_00070 9424 9975 gene locus_tag LOCUS_00080 9424 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11529 10060 gene locus_tag LOCUS_00090 11529 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11684 11956 gene locus_tag LOCUS_00100 11684 11956 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_00100 12018 14222 gene locus_tag LOCUS_00110 12018 14222 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202053.1 protein_id gnl|my_center|LOCUS_00110 15966 14353 gene locus_tag LOCUS_00120 15966 14353 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327627.1 protein_id gnl|my_center|LOCUS_00120 16694 15978 gene locus_tag LOCUS_00130 16694 15978 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_00130 16915 16721 gene locus_tag LOCUS_00140 16915 16721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 19061 16965 gene locus_tag LOCUS_00150 19061 16965 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111559.1 protein_id gnl|my_center|LOCUS_00150 19620 21854 gene locus_tag LOCUS_00160 19620 21854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 23525 21909 gene locus_tag LOCUS_00170 23525 21909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 25072 24524 gene locus_tag LOCUS_00180 25072 24524 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020686.1 protein_id gnl|my_center|LOCUS_00180 25200 25781 gene locus_tag LOCUS_00190 25200 25781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 27261 26113 gene locus_tag LOCUS_00200 27261 26113 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_00200 28974 27352 gene locus_tag LOCUS_00210 28974 27352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 29130 30329 gene locus_tag LOCUS_00220 29130 30329 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462130.1 protein_id gnl|my_center|LOCUS_00220 31489 30338 gene locus_tag LOCUS_00230 31489 30338 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_00230 31991 31578 gene locus_tag LOCUS_00240 gene mscL 31991 31578 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948242.1 protein_id gnl|my_center|LOCUS_00240 32179 33435 gene locus_tag LOCUS_00250 32179 33435 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_00250 33462 33920 gene locus_tag LOCUS_00260 33462 33920 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545228.1 protein_id gnl|my_center|LOCUS_00260 34043 34609 gene locus_tag LOCUS_00270 gene efp 34043 34609 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720643.1 protein_id gnl|my_center|LOCUS_00270 34774 35427 gene locus_tag LOCUS_00280 34774 35427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 36566 35571 gene locus_tag LOCUS_00290 36566 35571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 36746 38989 gene locus_tag LOCUS_00300 36746 38989 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775225.1 protein_id gnl|my_center|LOCUS_00300 40702 39020 gene locus_tag LOCUS_00310 gene recN 40702 39020 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_00310 40743 41516 gene locus_tag LOCUS_00320 40743 41516 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_00320 41582 42337 gene locus_tag LOCUS_00330 41582 42337 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_00330 42661 43203 gene locus_tag LOCUS_00340 42661 43203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 43268 43657 gene locus_tag LOCUS_00350 43268 43657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 43736 44065 gene locus_tag LOCUS_00360 43736 44065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 44100 44297 gene locus_tag LOCUS_00370 44100 44297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 45248 44385 gene locus_tag LOCUS_00380 gene lpxI 45248 44385 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_00380 46553 45279 gene locus_tag LOCUS_00390 46553 45279 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089073.1 protein_id gnl|my_center|LOCUS_00390 47546 46572 gene locus_tag LOCUS_00400 47546 46572 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258974.1 protein_id gnl|my_center|LOCUS_00400 48569 47568 gene locus_tag LOCUS_00410 48569 47568 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_00410 49578 48766 gene locus_tag LOCUS_00420 49578 48766 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262367.1 protein_id gnl|my_center|LOCUS_00420 49874 51031 gene locus_tag LOCUS_00430 gene mexX 49874 51031 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113509.1 protein_id gnl|my_center|LOCUS_00430 51038 54025 gene locus_tag LOCUS_00440 gene mexY 51038 54025 CDS product multidrug efflux RND transporter permease subunit MexY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113508.1 protein_id gnl|my_center|LOCUS_00440 53971 54141 gene locus_tag LOCUS_00450 53971 54141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00450 55138 54380 gene locus_tag LOCUS_00460 55138 54380 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_00460 55655 55254 gene locus_tag LOCUS_00470 55655 55254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 55760 57373 gene locus_tag LOCUS_00480 gene cobA 55760 57373 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_00480 57879 57445 gene locus_tag LOCUS_00490 57879 57445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 58121 60754 gene locus_tag LOCUS_00500 58121 60754 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525850.1 protein_id gnl|my_center|LOCUS_00500 61088 62260 gene locus_tag LOCUS_00510 61088 62260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 63151 62288 gene locus_tag LOCUS_00520 63151 62288 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475880.1 protein_id gnl|my_center|LOCUS_00520 63902 63237 gene locus_tag LOCUS_00530 63902 63237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 66846 64093 gene locus_tag LOCUS_00540 gene acnA 66846 64093 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_00540 67164 67370 gene locus_tag LOCUS_00550 67164 67370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 67442 67780 gene locus_tag LOCUS_00560 67442 67780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 >Feature sequence002 4657 218 gene locus_tag LOCUS_00570 gene gltB 4657 218 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 protein_id gnl|my_center|LOCUS_00570 5059 7191 gene locus_tag LOCUS_00580 5059 7191 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_00580 7449 10652 gene locus_tag LOCUS_00590 gene carB 7449 10652 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_00590 10683 11801 gene locus_tag LOCUS_00600 gene carA 10683 11801 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940372.1 protein_id gnl|my_center|LOCUS_00600 11953 13020 gene locus_tag LOCUS_00610 gene gmd 11953 13020 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107662.1 protein_id gnl|my_center|LOCUS_00610 13022 14110 gene locus_tag LOCUS_00620 13022 14110 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763415.1 protein_id gnl|my_center|LOCUS_00620 14144 15469 gene locus_tag LOCUS_00630 14144 15469 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764994.1 protein_id gnl|my_center|LOCUS_00630 15580 16827 gene locus_tag LOCUS_00640 15580 16827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 16903 17847 gene locus_tag LOCUS_00650 16903 17847 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_00650 17995 18726 gene locus_tag LOCUS_00660 17995 18726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 20925 19525 gene locus_tag LOCUS_00670 20925 19525 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372247.1 protein_id gnl|my_center|LOCUS_00670 21398 25051 gene locus_tag LOCUS_00680 21398 25051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 25849 25298 gene locus_tag LOCUS_00690 25849 25298 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460612.1 protein_id gnl|my_center|LOCUS_00690 29378 25854 gene locus_tag LOCUS_00700 29378 25854 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_00700 30412 29411 gene locus_tag LOCUS_00710 30412 29411 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103236.1 protein_id gnl|my_center|LOCUS_00710 30545 31189 gene locus_tag LOCUS_00720 gene thiE 30545 31189 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172766.1 protein_id gnl|my_center|LOCUS_00720 31405 31232 gene locus_tag LOCUS_00730 31405 31232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 31906 31499 gene locus_tag LOCUS_00740 31906 31499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 32676 31936 gene locus_tag LOCUS_00750 32676 31936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 34945 32696 gene locus_tag LOCUS_00760 34945 32696 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183692.1 protein_id gnl|my_center|LOCUS_00760 36396 35071 gene locus_tag LOCUS_00770 36396 35071 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883976.1 protein_id gnl|my_center|LOCUS_00770 37727 36393 gene locus_tag LOCUS_00780 37727 36393 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883977.1 protein_id gnl|my_center|LOCUS_00780 37869 38966 gene locus_tag LOCUS_00790 37869 38966 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405202.1 protein_id gnl|my_center|LOCUS_00790 41531 39387 gene locus_tag LOCUS_00800 gene pnp 41531 39387 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_00800 43385 41985 gene locus_tag LOCUS_00810 43385 41985 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_00810 44941 43382 gene locus_tag LOCUS_00820 44941 43382 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359439.1 protein_id gnl|my_center|LOCUS_00820 45979 44951 gene locus_tag LOCUS_00830 45979 44951 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966096.1 protein_id gnl|my_center|LOCUS_00830 46575 45958 gene locus_tag LOCUS_00840 46575 45958 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966545.1 protein_id gnl|my_center|LOCUS_00840 46977 46723 gene locus_tag LOCUS_00850 gene rpsO 46977 46723 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385566.1 protein_id gnl|my_center|LOCUS_00850 47720 47079 gene locus_tag LOCUS_00860 47720 47079 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141816.1 protein_id gnl|my_center|LOCUS_00860 48576 47698 gene locus_tag LOCUS_00870 48576 47698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 50309 48678 gene locus_tag LOCUS_00880 50309 48678 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705882.1 protein_id gnl|my_center|LOCUS_00880 55479 50296 gene locus_tag LOCUS_00890 55479 50296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 56756 55479 gene locus_tag LOCUS_00900 56756 55479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 56863 57690 gene locus_tag LOCUS_00910 gene truA 56863 57690 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_00910 58288 57713 gene locus_tag LOCUS_00920 58288 57713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 58987 58310 gene locus_tag LOCUS_00930 58987 58310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 >Feature sequence003 1205 468 gene locus_tag LOCUS_00940 1205 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 2192 1257 gene locus_tag LOCUS_00950 gene metF 2192 1257 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933036.1 protein_id gnl|my_center|LOCUS_00950 2981 2229 gene locus_tag LOCUS_00960 2981 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 5333 3015 gene locus_tag LOCUS_00970 gene bamA 5333 3015 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_00970 5701 7011 gene locus_tag LOCUS_00980 gene tig 5701 7011 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851938.1 protein_id gnl|my_center|LOCUS_00980 7167 7790 gene locus_tag LOCUS_00990 gene clpP 7167 7790 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327157.1 protein_id gnl|my_center|LOCUS_00990 7827 9197 gene locus_tag LOCUS_01000 gene clpX 7827 9197 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640796.1 protein_id gnl|my_center|LOCUS_01000 9216 10298 gene locus_tag LOCUS_01010 gene tsaD 9216 10298 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082750.1 protein_id gnl|my_center|LOCUS_01010 10504 10578 gene locus_tag LOCUS_t00010 10504 10578 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 10623 11807 gene locus_tag LOCUS_01020 gene tuf 10623 11807 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215366.1 protein_id gnl|my_center|LOCUS_01020 11901 11976 gene locus_tag LOCUS_t00020 11901 11976 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 12010 12237 gene locus_tag LOCUS_01030 12010 12237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 12265 12834 gene locus_tag LOCUS_01040 gene nusG 12265 12834 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_01040 12898 13326 gene locus_tag LOCUS_01050 gene rplK 12898 13326 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085792.1 protein_id gnl|my_center|LOCUS_01050 13377 14078 gene locus_tag LOCUS_01060 gene rplA 13377 14078 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235040.1 protein_id gnl|my_center|LOCUS_01060 14100 14603 gene locus_tag LOCUS_01070 gene rplJ 14100 14603 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_01070 14762 15133 gene locus_tag LOCUS_01080 gene rplL 14762 15133 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975165.1 protein_id gnl|my_center|LOCUS_01080 15335 19273 gene locus_tag LOCUS_01090 gene rpoB 15335 19273 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012263639.1 protein_id gnl|my_center|LOCUS_01090 19347 23543 gene locus_tag LOCUS_01100 gene rpoC 19347 23543 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871661.1 protein_id gnl|my_center|LOCUS_01100 24384 25010 gene locus_tag LOCUS_01110 24384 25010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 25108 25743 gene locus_tag LOCUS_01120 25108 25743 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989890.1 protein_id gnl|my_center|LOCUS_01120 25966 25763 gene locus_tag LOCUS_01130 25966 25763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 26225 28024 gene locus_tag LOCUS_01140 gene lepA 26225 28024 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816487.1 protein_id gnl|my_center|LOCUS_01140 28209 29171 gene locus_tag LOCUS_01150 28209 29171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 29486 31231 gene locus_tag LOCUS_01160 29486 31231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 31358 32902 gene locus_tag LOCUS_01170 31358 32902 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109236.1 protein_id gnl|my_center|LOCUS_01170 33024 34439 gene locus_tag LOCUS_01180 gene cysS 33024 34439 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873400.1 protein_id gnl|my_center|LOCUS_01180 34445 34789 gene locus_tag LOCUS_01190 34445 34789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 34786 35721 gene locus_tag LOCUS_01200 34786 35721 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234873.1 protein_id gnl|my_center|LOCUS_01200 36209 36793 gene locus_tag LOCUS_01210 36209 36793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 38882 36888 gene locus_tag LOCUS_01220 38882 36888 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_01220 39467 38964 gene locus_tag LOCUS_01230 39467 38964 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_01230 39640 40449 gene locus_tag LOCUS_01240 39640 40449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 40567 41136 gene locus_tag LOCUS_01250 40567 41136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 41133 42191 gene locus_tag LOCUS_01260 41133 42191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 42188 43153 gene locus_tag LOCUS_01270 42188 43153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 43221 43628 gene locus_tag LOCUS_01280 43221 43628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 44009 44614 gene locus_tag LOCUS_01290 44009 44614 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174792.1 protein_id gnl|my_center|LOCUS_01290 44630 45334 gene locus_tag LOCUS_01300 gene menH 44630 45334 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704503.1 protein_id gnl|my_center|LOCUS_01300 45331 45651 gene locus_tag LOCUS_01310 45331 45651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 46024 45689 gene locus_tag LOCUS_01320 46024 45689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 46284 46039 gene locus_tag LOCUS_01330 46284 46039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 46879 46289 gene locus_tag LOCUS_01340 46879 46289 CDS product DUF2589 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788696.1 protein_id gnl|my_center|LOCUS_01340 47696 46890 gene locus_tag LOCUS_01350 47696 46890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 48583 47732 gene locus_tag LOCUS_01360 48583 47732 CDS product DUF2589 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788700.1 protein_id gnl|my_center|LOCUS_01360 49217 48732 gene locus_tag LOCUS_01370 49217 48732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 50372 49401 gene locus_tag LOCUS_01380 50372 49401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 52007 50382 gene locus_tag LOCUS_01390 52007 50382 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861730.1 protein_id gnl|my_center|LOCUS_01390 52752 52000 gene locus_tag LOCUS_01400 52752 52000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 53898 52807 gene locus_tag LOCUS_01410 53898 52807 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790568.1 protein_id gnl|my_center|LOCUS_01410 54774 53920 gene locus_tag LOCUS_01420 gene phnX 54774 53920 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797923.1 protein_id gnl|my_center|LOCUS_01420 56116 54848 gene locus_tag LOCUS_01430 56116 54848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 <57209 56310 gene locus_tag LOCUS_01440 <57209 56310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002470366.1:assimilatory sulfite reductase (NADPH) hemoprotein subunit >Feature sequence004 3 3740 gene locus_tag LOCUS_01450 3 3740 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109085.1 protein_id gnl|my_center|LOCUS_01450 4743 4075 gene locus_tag LOCUS_01460 4743 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 5743 4766 gene locus_tag LOCUS_01470 5743 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 9263 6126 gene locus_tag LOCUS_01480 9263 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 9460 12138 gene locus_tag LOCUS_01490 9460 12138 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529647.1 protein_id gnl|my_center|LOCUS_01490 12157 12855 gene locus_tag LOCUS_01500 12157 12855 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103914.1 protein_id gnl|my_center|LOCUS_01500 13009 13788 gene locus_tag LOCUS_01510 13009 13788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 14035 15603 gene locus_tag LOCUS_01520 gene kdpA 14035 15603 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388910.1 protein_id gnl|my_center|LOCUS_01520 15634 17748 gene locus_tag LOCUS_01530 gene kdpB 15634 17748 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529645.1 protein_id gnl|my_center|LOCUS_01530 17778 18344 gene locus_tag LOCUS_01540 17778 18344 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405322.1 protein_id gnl|my_center|LOCUS_01540 20098 18494 gene locus_tag LOCUS_01550 20098 18494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 20284 22866 gene locus_tag LOCUS_01560 gene clpB 20284 22866 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_01560 23770 23018 gene locus_tag LOCUS_01570 23770 23018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 24742 26250 gene locus_tag LOCUS_r00010 24742 26250 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 26421 26496 gene locus_tag LOCUS_t00030 26421 26496 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 26586 26662 gene locus_tag LOCUS_t00040 26586 26662 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 26876 29706 gene locus_tag LOCUS_r00020 26876 29706 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 29948 30055 gene locus_tag LOCUS_r00030 29948 30055 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 30378 31934 gene locus_tag LOCUS_01580 30378 31934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 32239 32730 gene locus_tag LOCUS_01590 gene nrdR 32239 32730 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_01590 32753 33280 gene locus_tag LOCUS_01600 32753 33280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 34144 33290 gene locus_tag LOCUS_01610 34144 33290 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084558766.1 protein_id gnl|my_center|LOCUS_01610 34244 34576 gene locus_tag LOCUS_01620 34244 34576 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436216.1 protein_id gnl|my_center|LOCUS_01620 36262 34583 gene locus_tag LOCUS_01630 gene sulP 36262 34583 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797091.1 protein_id gnl|my_center|LOCUS_01630 37774 36398 gene locus_tag LOCUS_01640 gene argH 37774 36398 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_01640 37901 38647 gene locus_tag LOCUS_01650 37901 38647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 40152 38665 gene locus_tag LOCUS_01660 40152 38665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 41602 40322 gene locus_tag LOCUS_01670 gene eno 41602 40322 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_01670 42314 41766 gene locus_tag LOCUS_01680 42314 41766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01680 >Feature sequence005 71 1243 gene locus_tag LOCUS_01690 71 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 2246 1398 gene locus_tag LOCUS_01700 2246 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 3354 2596 gene locus_tag LOCUS_01710 3354 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 4313 3546 gene locus_tag LOCUS_01720 4313 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 4418 5797 gene locus_tag LOCUS_01730 4418 5797 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_01730 7729 5816 gene locus_tag LOCUS_01740 7729 5816 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 protein_id gnl|my_center|LOCUS_01740 8817 8176 gene locus_tag LOCUS_01750 gene bioD 8817 8176 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530983.1 protein_id gnl|my_center|LOCUS_01750 8982 8830 gene locus_tag LOCUS_01760 8982 8830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 9751 8960 gene locus_tag LOCUS_01770 gene cdaA 9751 8960 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_01770 10882 11868 gene locus_tag LOCUS_01780 10882 11868 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721273.1 protein_id gnl|my_center|LOCUS_01780 12557 11904 gene locus_tag LOCUS_01790 gene lolD 12557 11904 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172452211.1 protein_id gnl|my_center|LOCUS_01790 13432 12587 gene locus_tag LOCUS_01800 gene panC 13432 12587 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_01800 13582 14178 gene locus_tag LOCUS_01810 13582 14178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 14218 15255 gene locus_tag LOCUS_01820 gene lpxD 14218 15255 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882950.1 protein_id gnl|my_center|LOCUS_01820 16103 15312 gene locus_tag LOCUS_01830 16103 15312 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963435.1 protein_id gnl|my_center|LOCUS_01830 16888 16100 gene locus_tag LOCUS_01840 16888 16100 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963434.1 protein_id gnl|my_center|LOCUS_01840 17931 16885 gene locus_tag LOCUS_01850 17931 16885 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_01850 18059 18820 gene locus_tag LOCUS_01860 18059 18820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 21890 18924 gene locus_tag LOCUS_01870 21890 18924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 22623 22264 gene locus_tag LOCUS_01880 22623 22264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 23272 22766 gene locus_tag LOCUS_01890 gene gmhB 23272 22766 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194255.1 protein_id gnl|my_center|LOCUS_01890 23831 23262 gene locus_tag LOCUS_01900 23831 23262 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383606.1 protein_id gnl|my_center|LOCUS_01900 25318 23828 gene locus_tag LOCUS_01910 gene rfaE1 25318 23828 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387884.1 protein_id gnl|my_center|LOCUS_01910 25300 25530 gene locus_tag LOCUS_01920 25300 25530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 25548 25799 gene locus_tag LOCUS_01930 25548 25799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 25882 27162 gene locus_tag LOCUS_01940 gene hemL 25882 27162 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545461.1 protein_id gnl|my_center|LOCUS_01940 27234 28274 gene locus_tag LOCUS_01950 27234 28274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 30499 28592 gene locus_tag LOCUS_01960 30499 28592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 32422 30899 gene locus_tag LOCUS_01970 32422 30899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 32988 34625 gene locus_tag LOCUS_01980 32988 34625 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087605.1 protein_id gnl|my_center|LOCUS_01980 34649 35851 gene locus_tag LOCUS_01990 34649 35851 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_01990 35876 36364 gene locus_tag LOCUS_02000 gene ribH 35876 36364 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087790.1 protein_id gnl|my_center|LOCUS_02000 36396 37289 gene locus_tag LOCUS_02010 36396 37289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 37305 38153 gene locus_tag LOCUS_02020 37305 38153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 38171 39250 gene locus_tag LOCUS_02030 gene rlmN 38171 39250 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940164.1 protein_id gnl|my_center|LOCUS_02030 >Feature sequence006 1583 63 gene locus_tag LOCUS_02040 1583 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 2161 1898 gene locus_tag LOCUS_02050 2161 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 2457 3674 gene locus_tag LOCUS_02060 2457 3674 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625669.1 protein_id gnl|my_center|LOCUS_02060 4078 5352 gene locus_tag LOCUS_02070 4078 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 5507 6718 gene locus_tag LOCUS_02080 5507 6718 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_02080 7391 7726 gene locus_tag LOCUS_02090 7391 7726 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169602550.1 protein_id gnl|my_center|LOCUS_02090 9730 7796 gene locus_tag LOCUS_02100 9730 7796 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_02100 10062 10811 gene locus_tag LOCUS_02110 10062 10811 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858645.1 protein_id gnl|my_center|LOCUS_02110 11252 10986 gene locus_tag LOCUS_02120 11252 10986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 11402 12148 gene locus_tag LOCUS_02130 11402 12148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 15493 12299 gene locus_tag LOCUS_02140 gene carB 15493 12299 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_02140 15665 15859 gene locus_tag LOCUS_02150 15665 15859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 15846 16559 gene locus_tag LOCUS_02160 15846 16559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 16572 17090 gene locus_tag LOCUS_02170 16572 17090 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185796.1 protein_id gnl|my_center|LOCUS_02170 17647 17102 gene locus_tag LOCUS_02180 17647 17102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 18193 17696 gene locus_tag LOCUS_02190 18193 17696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 19193 18225 gene locus_tag LOCUS_02200 19193 18225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 19281 19772 gene locus_tag LOCUS_02210 gene hisI 19281 19772 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 protein_id gnl|my_center|LOCUS_02210 19837 20787 gene locus_tag LOCUS_02220 19837 20787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 20806 21321 gene locus_tag LOCUS_02230 20806 21321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 21351 22052 gene locus_tag LOCUS_02240 gene rsmI 21351 22052 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707588.1 protein_id gnl|my_center|LOCUS_02240 22818 22066 gene locus_tag LOCUS_02250 22818 22066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 23099 23401 gene locus_tag LOCUS_02260 23099 23401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 24833 23493 gene locus_tag LOCUS_02270 24833 23493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 25672 24977 gene locus_tag LOCUS_02280 25672 24977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 25835 26338 gene locus_tag LOCUS_02290 25835 26338 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107336.1 protein_id gnl|my_center|LOCUS_02290 27451 26396 gene locus_tag LOCUS_02300 gene recF 27451 26396 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906242.1 protein_id gnl|my_center|LOCUS_02300 28082 27471 gene locus_tag LOCUS_02310 28082 27471 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869529.1 protein_id gnl|my_center|LOCUS_02310 28720 28079 gene locus_tag LOCUS_02320 gene cmk 28720 28079 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640590.1 protein_id gnl|my_center|LOCUS_02320 28859 30700 gene locus_tag LOCUS_02330 28859 30700 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453777.1 protein_id gnl|my_center|LOCUS_02330 31647 30751 gene locus_tag LOCUS_02340 gene thiL 31647 30751 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_02340 32500 31637 gene locus_tag LOCUS_02350 32500 31637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 32701 34083 gene locus_tag LOCUS_02360 32701 34083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 34236 36824 gene locus_tag LOCUS_02370 34236 36824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 37124 38437 gene locus_tag LOCUS_02380 gene hflX 37124 38437 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883116.1 protein_id gnl|my_center|LOCUS_02380 >Feature sequence007 533 1171 gene locus_tag LOCUS_02390 533 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 1173 3674 gene locus_tag LOCUS_02400 gene uvrA 1173 3674 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122979.1 protein_id gnl|my_center|LOCUS_02400 3751 4746 gene locus_tag LOCUS_02410 3751 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 4851 6020 gene locus_tag LOCUS_02420 4851 6020 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_02420 6505 6179 gene locus_tag LOCUS_02430 6505 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 7947 6694 gene locus_tag LOCUS_02440 gene argJ 7947 6694 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546755.1 protein_id gnl|my_center|LOCUS_02440 9023 7980 gene locus_tag LOCUS_02450 gene argC 9023 7980 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937798.1 protein_id gnl|my_center|LOCUS_02450 9126 9202 gene locus_tag LOCUS_t00050 9126 9202 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9560 10309 gene locus_tag LOCUS_02460 9560 10309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 10729 11682 gene locus_tag LOCUS_02470 10729 11682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 12772 11705 gene locus_tag LOCUS_02480 12772 11705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 13952 12792 gene locus_tag LOCUS_02490 13952 12792 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039954.1 protein_id gnl|my_center|LOCUS_02490 14848 13958 gene locus_tag LOCUS_02500 14848 13958 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454111.1 protein_id gnl|my_center|LOCUS_02500 15963 14845 gene locus_tag LOCUS_02510 15963 14845 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_02510 17000 15960 gene locus_tag LOCUS_02520 17000 15960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 18112 16997 gene locus_tag LOCUS_02530 18112 16997 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107643.1 protein_id gnl|my_center|LOCUS_02530 19271 18114 gene locus_tag LOCUS_02540 19271 18114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 20812 19298 gene locus_tag LOCUS_02550 20812 19298 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476089.1 protein_id gnl|my_center|LOCUS_02550 21999 20809 gene locus_tag LOCUS_02560 21999 20809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 23165 21996 gene locus_tag LOCUS_02570 23165 21996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 24177 23152 gene locus_tag LOCUS_02580 24177 23152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 25332 24184 gene locus_tag LOCUS_02590 25332 24184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 26462 25329 gene locus_tag LOCUS_02600 26462 25329 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225897.1 protein_id gnl|my_center|LOCUS_02600 28865 26484 gene locus_tag LOCUS_02610 28865 26484 CDS product tyrosine-protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765281.1 protein_id gnl|my_center|LOCUS_02610 29655 28870 gene locus_tag LOCUS_02620 29655 28870 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039947.1 protein_id gnl|my_center|LOCUS_02620 31668 29674 gene locus_tag LOCUS_02630 31668 29674 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107342.1 protein_id gnl|my_center|LOCUS_02630 33455 31668 gene locus_tag LOCUS_02640 33455 31668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 34063 33452 gene locus_tag LOCUS_02650 34063 33452 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_02650 35178 34060 gene locus_tag LOCUS_02660 35178 34060 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391405.1 protein_id gnl|my_center|LOCUS_02660 36335 35175 gene locus_tag LOCUS_02670 36335 35175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 >Feature sequence008 251 556 gene locus_tag LOCUS_02680 251 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 510 1310 gene locus_tag LOCUS_02690 510 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02690 1413 1853 gene locus_tag LOCUS_02700 1413 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 3259 2159 gene locus_tag LOCUS_02710 gene dnaN 3259 2159 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725022.1 protein_id gnl|my_center|LOCUS_02710 3764 4453 gene locus_tag LOCUS_02720 3764 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 5450 4545 gene locus_tag LOCUS_02730 5450 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 5745 6836 gene locus_tag LOCUS_02740 gene ribD 5745 6836 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057986.1 protein_id gnl|my_center|LOCUS_02740 9101 7200 gene locus_tag LOCUS_02750 gene mnmG 9101 7200 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929569.1 protein_id gnl|my_center|LOCUS_02750 10132 9086 gene locus_tag LOCUS_02760 gene holA 10132 9086 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279906.1 protein_id gnl|my_center|LOCUS_02760 10458 11906 gene locus_tag LOCUS_02770 10458 11906 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_02770 12031 12513 gene locus_tag LOCUS_02780 gene ilvN 12031 12513 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_02780 12583 16272 gene locus_tag LOCUS_02790 gene hrpA 12583 16272 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_02790 17010 16306 gene locus_tag LOCUS_02800 17010 16306 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985723.1 protein_id gnl|my_center|LOCUS_02800 18769 17021 gene locus_tag LOCUS_02810 18769 17021 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785879.1 protein_id gnl|my_center|LOCUS_02810 21454 19004 gene locus_tag LOCUS_02820 21454 19004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 22305 21532 gene locus_tag LOCUS_02830 22305 21532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 22763 23530 gene locus_tag LOCUS_02840 gene hisF 22763 23530 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817210.1 protein_id gnl|my_center|LOCUS_02840 23585 25717 gene locus_tag LOCUS_02850 23585 25717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 26309 27964 gene locus_tag LOCUS_02860 26309 27964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 28191 29033 gene locus_tag LOCUS_02870 28191 29033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 29646 30074 gene locus_tag LOCUS_02880 29646 30074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 33772 30194 gene locus_tag LOCUS_02890 gene nifJ 33772 30194 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_02890 34129 35610 gene locus_tag LOCUS_02900 gene lysS 34129 35610 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833056.1 protein_id gnl|my_center|LOCUS_02900 >Feature sequence009 534 1391 gene locus_tag LOCUS_02910 534 1391 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 protein_id gnl|my_center|LOCUS_02910 1412 1948 gene locus_tag LOCUS_02920 1412 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 3133 2027 gene locus_tag LOCUS_02930 3133 2027 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967895.1 protein_id gnl|my_center|LOCUS_02930 3498 4778 gene locus_tag LOCUS_02940 gene serS 3498 4778 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_02940 4815 5594 gene locus_tag LOCUS_02950 4815 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 6153 5827 gene locus_tag LOCUS_02960 6153 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 7495 6386 gene locus_tag LOCUS_02970 gene hemW 7495 6386 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775763.1 protein_id gnl|my_center|LOCUS_02970 10438 7511 gene locus_tag LOCUS_02980 10438 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 11277 10630 gene locus_tag LOCUS_02990 11277 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02990 11458 11979 gene locus_tag LOCUS_03000 gene pyrE 11458 11979 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940203.1 protein_id gnl|my_center|LOCUS_03000 11993 13057 gene locus_tag LOCUS_03010 11993 13057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 14111 13146 gene locus_tag LOCUS_03020 14111 13146 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918268.1 protein_id gnl|my_center|LOCUS_03020 18702 14320 gene locus_tag LOCUS_03030 18702 14320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 18877 20187 gene locus_tag LOCUS_03040 18877 20187 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937721.1 protein_id gnl|my_center|LOCUS_03040 21481 20498 gene locus_tag LOCUS_03050 21481 20498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 22093 21581 gene locus_tag LOCUS_03060 22093 21581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03060 23706 22099 gene locus_tag LOCUS_03070 gene metG 23706 22099 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_03070 26898 25702 gene locus_tag LOCUS_03080 26898 25702 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795962.1 protein_id gnl|my_center|LOCUS_03080 27345 26926 gene locus_tag LOCUS_03090 gene fucU 27345 26926 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920848.1 protein_id gnl|my_center|LOCUS_03090 28595 27417 gene locus_tag LOCUS_03100 28595 27417 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_03100 29501 28638 gene locus_tag LOCUS_03110 29501 28638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 30697 29648 gene locus_tag LOCUS_03120 30697 29648 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 protein_id gnl|my_center|LOCUS_03120 31199 30834 gene locus_tag LOCUS_03130 31199 30834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 31990 31805 gene locus_tag LOCUS_03140 31990 31805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 32829 32023 gene locus_tag LOCUS_03150 32829 32023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 35207 32898 gene locus_tag LOCUS_03160 35207 32898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 >Feature sequence010 2503 3405 gene locus_tag LOCUS_03170 2503 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 3470 5071 gene locus_tag LOCUS_03180 3470 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 5629 5405 gene locus_tag LOCUS_03190 5629 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 6063 5830 gene locus_tag LOCUS_03200 gene rpmB 6063 5830 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556947.1 protein_id gnl|my_center|LOCUS_03200 6353 7354 gene locus_tag LOCUS_03210 6353 7354 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207904.1 protein_id gnl|my_center|LOCUS_03210 7354 7899 gene locus_tag LOCUS_03220 7354 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 8363 7938 gene locus_tag LOCUS_03230 8363 7938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03230 9418 8360 gene locus_tag LOCUS_03240 9418 8360 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_03240 10169 9453 gene locus_tag LOCUS_03250 10169 9453 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_03250 12033 10192 gene locus_tag LOCUS_03260 12033 10192 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_03260 12159 13007 gene locus_tag LOCUS_03270 gene ispE 12159 13007 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706938.1 protein_id gnl|my_center|LOCUS_03270 13098 13637 gene locus_tag LOCUS_03280 13098 13637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 13652 15637 gene locus_tag LOCUS_03290 13652 15637 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_03290 16422 15652 gene locus_tag LOCUS_03300 16422 15652 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_03300 17231 16419 gene locus_tag LOCUS_03310 gene cbiQ 17231 16419 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 protein_id gnl|my_center|LOCUS_03310 18284 17238 gene locus_tag LOCUS_03320 18284 17238 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_03320 18624 18908 gene locus_tag LOCUS_03330 18624 18908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 19292 18927 gene locus_tag LOCUS_03340 19292 18927 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761537.1 protein_id gnl|my_center|LOCUS_03340 20267 19305 gene locus_tag LOCUS_03350 gene argB 20267 19305 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869561.1 protein_id gnl|my_center|LOCUS_03350 21256 20264 gene locus_tag LOCUS_03360 gene corA 21256 20264 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968502.1 protein_id gnl|my_center|LOCUS_03360 21887 21432 gene locus_tag LOCUS_03370 gene rplI 21887 21432 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_03370 22133 23680 gene locus_tag LOCUS_03380 gene purH 22133 23680 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909162.1 protein_id gnl|my_center|LOCUS_03380 23720 24460 gene locus_tag LOCUS_03390 gene pdxJ 23720 24460 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296302.1 protein_id gnl|my_center|LOCUS_03390 24498 24899 gene locus_tag LOCUS_03400 gene acpS 24498 24899 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370293.1 protein_id gnl|my_center|LOCUS_03400 26108 25038 gene locus_tag LOCUS_03410 26108 25038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 29500 26111 gene locus_tag LOCUS_03420 29500 26111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 32056 30230 gene locus_tag LOCUS_03430 32056 30230 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_03430 32327 32980 gene locus_tag LOCUS_03440 32327 32980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 >Feature sequence011 772 362 gene locus_tag LOCUS_03450 772 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 1871 774 gene locus_tag LOCUS_03460 1871 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 2341 3390 gene locus_tag LOCUS_03470 2341 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 3774 5009 gene locus_tag LOCUS_03480 3774 5009 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_03480 6287 7273 gene locus_tag LOCUS_03490 6287 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 7351 7638 gene locus_tag LOCUS_03500 7351 7638 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860072.1 protein_id gnl|my_center|LOCUS_03500 8117 7746 gene locus_tag LOCUS_03510 8117 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 8859 8368 gene locus_tag LOCUS_03520 8859 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 9468 9214 gene locus_tag LOCUS_03530 9468 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 9830 9492 gene locus_tag LOCUS_03540 9830 9492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 10094 10276 gene locus_tag LOCUS_03550 10094 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 10266 10496 gene locus_tag LOCUS_03560 10266 10496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 10483 11280 gene locus_tag LOCUS_03570 10483 11280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 11277 13316 gene locus_tag LOCUS_03580 11277 13316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 13322 14359 gene locus_tag LOCUS_03590 13322 14359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 14373 14930 gene locus_tag LOCUS_03600 14373 14930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 14948 15232 gene locus_tag LOCUS_03610 14948 15232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 15617 15913 gene locus_tag LOCUS_03620 15617 15913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 15888 16412 gene locus_tag LOCUS_03630 15888 16412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 16402 16611 gene locus_tag LOCUS_03640 16402 16611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 16625 17254 gene locus_tag LOCUS_03650 16625 17254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 17435 17686 gene locus_tag LOCUS_03660 17435 17686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 17901 18431 gene locus_tag LOCUS_03670 17901 18431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 18464 19069 gene locus_tag LOCUS_03680 18464 19069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 19198 19404 gene locus_tag LOCUS_03690 19198 19404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 19401 19658 gene locus_tag LOCUS_03700 19401 19658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 19672 20244 gene locus_tag LOCUS_03710 19672 20244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 20228 21160 gene locus_tag LOCUS_03720 20228 21160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 21157 21858 gene locus_tag LOCUS_03730 21157 21858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 21926 23923 gene locus_tag LOCUS_03740 21926 23923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 24044 25036 gene locus_tag LOCUS_03750 24044 25036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 25110 25478 gene locus_tag LOCUS_03760 25110 25478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 25521 26432 gene locus_tag LOCUS_03770 25521 26432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 26507 26935 gene locus_tag LOCUS_03780 26507 26935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 26984 27745 gene locus_tag LOCUS_03790 26984 27745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 27742 28377 gene locus_tag LOCUS_03800 27742 28377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 28370 28858 gene locus_tag LOCUS_03810 28370 28858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 28866 29081 gene locus_tag LOCUS_03820 28866 29081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 29181 29726 gene locus_tag LOCUS_03830 29181 29726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 29793 32015 gene locus_tag LOCUS_03840 29793 32015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 32018 32422 gene locus_tag LOCUS_03850 32018 32422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 32432 32737 gene locus_tag LOCUS_03860 32432 32737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 >Feature sequence012 461 2428 gene locus_tag LOCUS_03870 461 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 2732 4660 gene locus_tag LOCUS_03880 gene dnaK 2732 4660 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557108.1 protein_id gnl|my_center|LOCUS_03880 4755 5045 gene locus_tag LOCUS_03890 gene groES 4755 5045 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171493.1 protein_id gnl|my_center|LOCUS_03890 5093 6745 gene locus_tag LOCUS_03900 gene groL 5093 6745 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_03900 7068 9299 gene locus_tag LOCUS_03910 7068 9299 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_03910 9588 9515 gene locus_tag LOCUS_t00060 9588 9515 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9732 9805 gene locus_tag LOCUS_t00070 9732 9805 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9857 10516 gene locus_tag LOCUS_03920 9857 10516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 10565 11752 gene locus_tag LOCUS_03930 10565 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 11845 14052 gene locus_tag LOCUS_03940 11845 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 14064 14669 gene locus_tag LOCUS_03950 14064 14669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 15251 15784 gene locus_tag LOCUS_03960 15251 15784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 15844 16443 gene locus_tag LOCUS_03970 gene ruvA 15844 16443 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_03970 16668 17693 gene locus_tag LOCUS_03980 gene gap 16668 17693 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219957.1 protein_id gnl|my_center|LOCUS_03980 17862 19079 gene locus_tag LOCUS_03990 17862 19079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 19340 20305 gene locus_tag LOCUS_04000 19340 20305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 22416 20482 gene locus_tag LOCUS_04010 22416 20482 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265628.1 protein_id gnl|my_center|LOCUS_04010 22783 25344 gene locus_tag LOCUS_04020 22783 25344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 28657 25481 gene locus_tag LOCUS_04030 28657 25481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 29956 28772 gene locus_tag LOCUS_04040 29956 28772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 <31907 29992 gene locus_tag LOCUS_04050 <31907 29992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005822181.1:MFS transporter >Feature sequence013 459 79 gene locus_tag LOCUS_04060 459 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 2255 564 gene locus_tag LOCUS_04070 2255 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 2526 4187 gene locus_tag LOCUS_04080 2526 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 4240 4692 gene locus_tag LOCUS_04090 4240 4692 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458819.1 protein_id gnl|my_center|LOCUS_04090 4956 4708 gene locus_tag LOCUS_04100 4956 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 6919 5162 gene locus_tag LOCUS_04110 6919 5162 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765637.1 protein_id gnl|my_center|LOCUS_04110 7903 6989 gene locus_tag LOCUS_04120 7903 6989 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107441.1 protein_id gnl|my_center|LOCUS_04120 8068 8643 gene locus_tag LOCUS_04130 8068 8643 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941350.1 protein_id gnl|my_center|LOCUS_04130 9317 8703 gene locus_tag LOCUS_04140 9317 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 10122 9361 gene locus_tag LOCUS_04150 10122 9361 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615807.1 protein_id gnl|my_center|LOCUS_04150 10377 11672 gene locus_tag LOCUS_04160 gene nusA 10377 11672 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311294.1 protein_id gnl|my_center|LOCUS_04160 11715 13772 gene locus_tag LOCUS_04170 11715 13772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 13918 14295 gene locus_tag LOCUS_04180 13918 14295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 18512 14529 gene locus_tag LOCUS_04190 18512 14529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 19724 18963 gene locus_tag LOCUS_04200 19724 18963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 20055 21527 gene locus_tag LOCUS_04210 20055 21527 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937901.1 protein_id gnl|my_center|LOCUS_04210 21532 22875 gene locus_tag LOCUS_04220 gene lplT 21532 22875 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703329.1 protein_id gnl|my_center|LOCUS_04220 23034 23627 gene locus_tag LOCUS_04230 23034 23627 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_04230 23647 23895 gene locus_tag LOCUS_04240 23647 23895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 23956 25104 gene locus_tag LOCUS_04250 gene nagA 23956 25104 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080848.1 protein_id gnl|my_center|LOCUS_04250 25192 26232 gene locus_tag LOCUS_04260 25192 26232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 26296 26859 gene locus_tag LOCUS_04270 26296 26859 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987052.1 protein_id gnl|my_center|LOCUS_04270 28011 26935 gene locus_tag LOCUS_04280 28011 26935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 29147 28008 gene locus_tag LOCUS_04290 29147 28008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 30344 29256 gene locus_tag LOCUS_04300 30344 29256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 31451 30351 gene locus_tag LOCUS_04310 31451 30351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 >Feature sequence014 846 490 gene locus_tag LOCUS_04320 846 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 1036 2253 gene locus_tag LOCUS_04330 1036 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 4023 2308 gene locus_tag LOCUS_04340 4023 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922195.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04340 4506 4045 gene locus_tag LOCUS_04350 4506 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 6485 4503 gene locus_tag LOCUS_04360 6485 4503 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122098.1 protein_id gnl|my_center|LOCUS_04360 7467 6523 gene locus_tag LOCUS_04370 7467 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 8378 7491 gene locus_tag LOCUS_04380 gene spo0J 8378 7491 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_04380 8747 9073 gene locus_tag LOCUS_04390 8747 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 9177 9560 gene locus_tag LOCUS_04400 9177 9560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 10265 9705 gene locus_tag LOCUS_04410 10265 9705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 11123 11049 gene locus_tag LOCUS_t00080 11123 11049 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13359 11218 gene locus_tag LOCUS_04420 13359 11218 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091514757.1 protein_id gnl|my_center|LOCUS_04420 13855 13475 gene locus_tag LOCUS_04430 13855 13475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 14230 16395 gene locus_tag LOCUS_04440 14230 16395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 16370 16549 gene locus_tag LOCUS_04450 16370 16549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 18160 16910 gene locus_tag LOCUS_04460 18160 16910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 18799 18311 gene locus_tag LOCUS_04470 18799 18311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 20399 18819 gene locus_tag LOCUS_04480 20399 18819 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107897.1 protein_id gnl|my_center|LOCUS_04480 21771 20497 gene locus_tag LOCUS_04490 21771 20497 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832647.1 protein_id gnl|my_center|LOCUS_04490 23126 21807 gene locus_tag LOCUS_04500 23126 21807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 23370 24536 gene locus_tag LOCUS_04510 23370 24536 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_04510 24601 24996 gene locus_tag LOCUS_04520 24601 24996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 24993 26066 gene locus_tag LOCUS_04530 24993 26066 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_04530 26063 27655 gene locus_tag LOCUS_04540 26063 27655 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613941.1 protein_id gnl|my_center|LOCUS_04540 27878 28438 gene locus_tag LOCUS_04550 27878 28438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 28675 29244 gene locus_tag LOCUS_04560 28675 29244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 29530 30045 gene locus_tag LOCUS_04570 29530 30045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence015 14 1211 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattcacgcacctgtgaaggtgcgac 3040 1592 gene locus_tag LOCUS_04580 3040 1592 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_04580 3915 3253 gene locus_tag LOCUS_04590 3915 3253 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478872.1 protein_id gnl|my_center|LOCUS_04590 4738 3959 gene locus_tag LOCUS_04600 4738 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 5921 4752 gene locus_tag LOCUS_04610 5921 4752 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_04610 6356 5949 gene locus_tag LOCUS_04620 6356 5949 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_04620 6738 10253 gene locus_tag LOCUS_04630 6738 10253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 10778 10401 gene locus_tag LOCUS_04640 10778 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 11687 10797 gene locus_tag LOCUS_04650 11687 10797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 11832 13349 gene locus_tag LOCUS_04660 11832 13349 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_04660 13360 14217 gene locus_tag LOCUS_04670 13360 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 14324 14887 gene locus_tag LOCUS_04680 14324 14887 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084308.1 protein_id gnl|my_center|LOCUS_04680 14898 15593 gene locus_tag LOCUS_04690 14898 15593 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_04690 15680 17347 gene locus_tag LOCUS_04700 15680 17347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 18011 17421 gene locus_tag LOCUS_04710 18011 17421 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_04710 18856 17978 gene locus_tag LOCUS_04720 18856 17978 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_04720 20207 18867 gene locus_tag LOCUS_04730 20207 18867 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_04730 20364 21332 gene locus_tag LOCUS_04740 gene hprK 20364 21332 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_04740 21411 21677 gene locus_tag LOCUS_04750 21411 21677 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_04750 21724 23502 gene locus_tag LOCUS_04760 gene ptsP 21724 23502 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_04760 23630 25318 gene locus_tag LOCUS_04770 23630 25318 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_04770 25434 26351 gene locus_tag LOCUS_04780 gene argF 25434 26351 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_04780 26378 26797 gene locus_tag LOCUS_04790 26378 26797 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_04790 26808 27191 gene locus_tag LOCUS_04800 26808 27191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 29330 27321 gene locus_tag LOCUS_04810 29330 27321 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_04810 >Feature sequence016 <1 1095 gene locus_tag LOCUS_04820 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001198802.1:DUF805 domain-containing protein 2246 1167 gene locus_tag LOCUS_04830 2246 1167 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256167.1 protein_id gnl|my_center|LOCUS_04830 3238 2291 gene locus_tag LOCUS_04840 3238 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 3438 3848 gene locus_tag LOCUS_04850 3438 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 4272 4176 gene locus_tag LOCUS_t00090 4272 4176 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 4382 5251 gene locus_tag LOCUS_04860 gene pdxA 4382 5251 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086877.1 protein_id gnl|my_center|LOCUS_04860 6270 5248 gene locus_tag LOCUS_04870 6270 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 6425 6709 gene locus_tag LOCUS_04880 6425 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 8298 6832 gene locus_tag LOCUS_04890 8298 6832 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203343.1 protein_id gnl|my_center|LOCUS_04890 9234 8626 gene locus_tag LOCUS_04900 gene hisH 9234 8626 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057376.1 protein_id gnl|my_center|LOCUS_04900 9829 9239 gene locus_tag LOCUS_04910 gene hisB 9829 9239 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083477.1 protein_id gnl|my_center|LOCUS_04910 11346 10120 gene locus_tag LOCUS_04920 11346 10120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 12095 11490 gene locus_tag LOCUS_04930 12095 11490 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_04930 13158 12229 gene locus_tag LOCUS_04940 13158 12229 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_04940 13292 14191 gene locus_tag LOCUS_04950 13292 14191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 14206 14928 gene locus_tag LOCUS_04960 14206 14928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 15614 14949 gene locus_tag LOCUS_04970 15614 14949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 15695 16279 gene locus_tag LOCUS_04980 15695 16279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 16283 17659 gene locus_tag LOCUS_04990 16283 17659 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_04990 17715 18998 gene locus_tag LOCUS_05000 17715 18998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 19038 19958 gene locus_tag LOCUS_05010 gene hpnD 19038 19958 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930256.1 protein_id gnl|my_center|LOCUS_05010 20061 21734 gene locus_tag LOCUS_05020 20061 21734 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767406.1 protein_id gnl|my_center|LOCUS_05020 22858 21866 gene locus_tag LOCUS_05030 22858 21866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 23618 22881 gene locus_tag LOCUS_05040 23618 22881 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692438.1 protein_id gnl|my_center|LOCUS_05040 24798 23641 gene locus_tag LOCUS_05050 gene dnaJ 24798 23641 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209249.1 protein_id gnl|my_center|LOCUS_05050 25377 24823 gene locus_tag LOCUS_05060 25377 24823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 25803 25513 gene locus_tag LOCUS_05070 25803 25513 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921449.1 protein_id gnl|my_center|LOCUS_05070 26549 25800 gene locus_tag LOCUS_05080 26549 25800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 26739 27188 gene locus_tag LOCUS_05090 26739 27188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 28278 27265 gene locus_tag LOCUS_05100 28278 27265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 >Feature sequence017 1437 412 gene locus_tag LOCUS_05110 1437 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 2931 1450 gene locus_tag LOCUS_05120 2931 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 3698 3054 gene locus_tag LOCUS_05130 3698 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 3854 4477 gene locus_tag LOCUS_05140 3854 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 5251 4493 gene locus_tag LOCUS_05150 5251 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 6241 5324 gene locus_tag LOCUS_05160 6241 5324 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_05160 6279 7463 gene locus_tag LOCUS_05170 gene metK 6279 7463 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706910.1 protein_id gnl|my_center|LOCUS_05170 7485 8900 gene locus_tag LOCUS_05180 gene ahcY 7485 8900 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035988.1 protein_id gnl|my_center|LOCUS_05180 9881 10924 gene locus_tag LOCUS_05190 9881 10924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 10946 12205 gene locus_tag LOCUS_05200 10946 12205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 12578 13408 gene locus_tag LOCUS_05210 12578 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 15157 13508 gene locus_tag LOCUS_05220 15157 13508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 15254 17152 gene locus_tag LOCUS_05230 15254 17152 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236934.1 protein_id gnl|my_center|LOCUS_05230 18343 17156 gene locus_tag LOCUS_05240 18343 17156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 19548 18340 gene locus_tag LOCUS_05250 19548 18340 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222487.1 protein_id gnl|my_center|LOCUS_05250 20516 19566 gene locus_tag LOCUS_05260 20516 19566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 22195 20591 gene locus_tag LOCUS_05270 gene nadB 22195 20591 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_05270 22302 22889 gene locus_tag LOCUS_05280 gene rlmB 22302 22889 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704663.1 protein_id gnl|my_center|LOCUS_05280 22923 23744 gene locus_tag LOCUS_05290 22923 23744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 23840 24058 gene locus_tag LOCUS_05300 23840 24058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 24179 24586 gene locus_tag LOCUS_05310 24179 24586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 26743 24647 gene locus_tag LOCUS_05320 26743 24647 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791356.1 protein_id gnl|my_center|LOCUS_05320 27098 26868 gene locus_tag LOCUS_05330 27098 26868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 >Feature sequence018 2333 921 gene locus_tag LOCUS_05340 2333 921 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789653.1 protein_id gnl|my_center|LOCUS_05340 3823 2348 gene locus_tag LOCUS_05350 3823 2348 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118829.1 protein_id gnl|my_center|LOCUS_05350 4138 5100 gene locus_tag LOCUS_05360 4138 5100 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253312.1 protein_id gnl|my_center|LOCUS_05360 5394 5309 gene locus_tag LOCUS_t00100 5394 5309 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6013 5498 gene locus_tag LOCUS_05370 6013 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 6816 6010 gene locus_tag LOCUS_05380 gene tcdA 6816 6010 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173260.1 protein_id gnl|my_center|LOCUS_05380 7622 6819 gene locus_tag LOCUS_05390 7622 6819 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_05390 8126 7656 gene locus_tag LOCUS_05400 8126 7656 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963082.1 protein_id gnl|my_center|LOCUS_05400 9176 8211 gene locus_tag LOCUS_05410 gene trpS 9176 8211 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120916.1 protein_id gnl|my_center|LOCUS_05410 10222 9359 gene locus_tag LOCUS_05420 10222 9359 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 protein_id gnl|my_center|LOCUS_05420 10914 10219 gene locus_tag LOCUS_05430 gene ispD 10914 10219 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_05430 11366 10911 gene locus_tag LOCUS_05440 11366 10911 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939079.1 protein_id gnl|my_center|LOCUS_05440 12402 11488 gene locus_tag LOCUS_05450 12402 11488 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963694.1 protein_id gnl|my_center|LOCUS_05450 14089 12533 gene locus_tag LOCUS_05460 14089 12533 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_05460 14259 15137 gene locus_tag LOCUS_05470 14259 15137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 15338 15706 gene locus_tag LOCUS_05480 15338 15706 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687781.1 protein_id gnl|my_center|LOCUS_05480 16686 15895 gene locus_tag LOCUS_05490 16686 15895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 19976 17394 gene locus_tag LOCUS_05500 19976 17394 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873700.1 protein_id gnl|my_center|LOCUS_05500 21059 20004 gene locus_tag LOCUS_05510 21059 20004 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_05510 21556 21065 gene locus_tag LOCUS_05520 21556 21065 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421255.1 protein_id gnl|my_center|LOCUS_05520 22532 21669 gene locus_tag LOCUS_05530 22532 21669 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101257.1 protein_id gnl|my_center|LOCUS_05530 23335 22529 gene locus_tag LOCUS_05540 23335 22529 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257863.1 protein_id gnl|my_center|LOCUS_05540 23760 23326 gene locus_tag LOCUS_05550 23760 23326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 24689 23757 gene locus_tag LOCUS_05560 24689 23757 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228054.1 protein_id gnl|my_center|LOCUS_05560 <27222 24757 gene locus_tag LOCUS_05570 <27222 24757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764135.1:DUF2339 domain-containing protein >Feature sequence019 <1 771 gene locus_tag LOCUS_05580 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105478.1:serine/threonine-protein phosphatase 1041 1697 gene locus_tag LOCUS_05590 gene plsY 1041 1697 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_05590 1699 2709 gene locus_tag LOCUS_05600 1699 2709 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_05600 2767 3201 gene locus_tag LOCUS_05610 2767 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 3348 4166 gene locus_tag LOCUS_05620 3348 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 4239 5300 gene locus_tag LOCUS_05630 4239 5300 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902856.1 protein_id gnl|my_center|LOCUS_05630 5293 6540 gene locus_tag LOCUS_05640 gene nirJ1 5293 6540 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460179.1 protein_id gnl|my_center|LOCUS_05640 6739 8028 gene locus_tag LOCUS_05650 6739 8028 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_05650 8526 9182 gene locus_tag LOCUS_05660 8526 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 10827 9292 gene locus_tag LOCUS_05670 10827 9292 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334446.1 protein_id gnl|my_center|LOCUS_05670 11707 10901 gene locus_tag LOCUS_05680 11707 10901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 12901 11861 gene locus_tag LOCUS_05690 12901 11861 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838662.1 protein_id gnl|my_center|LOCUS_05690 14139 13030 gene locus_tag LOCUS_05700 gene leuB 14139 13030 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943508.1 protein_id gnl|my_center|LOCUS_05700 14305 14379 gene locus_tag LOCUS_t00110 14305 14379 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 15073 15282 gene locus_tag LOCUS_05710 15073 15282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 15279 16574 gene locus_tag LOCUS_05720 15279 16574 CDS product DUF3440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723446.1 protein_id gnl|my_center|LOCUS_05720 16571 17086 gene locus_tag LOCUS_05730 16571 17086 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132085.1 protein_id gnl|my_center|LOCUS_05730 17104 17298 gene locus_tag LOCUS_05740 17104 17298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 17737 18207 gene locus_tag LOCUS_05750 17737 18207 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233853.1 protein_id gnl|my_center|LOCUS_05750 19288 18266 gene locus_tag LOCUS_05760 19288 18266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 19482 20138 gene locus_tag LOCUS_05770 19482 20138 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358896.1 protein_id gnl|my_center|LOCUS_05770 20167 20391 gene locus_tag LOCUS_05780 20167 20391 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460459.1 protein_id gnl|my_center|LOCUS_05780 20400 22541 gene locus_tag LOCUS_05790 gene feoB 20400 22541 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439379.1 protein_id gnl|my_center|LOCUS_05790 23585 22686 gene locus_tag LOCUS_05800 23585 22686 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019040.1 protein_id gnl|my_center|LOCUS_05800 24561 23995 gene locus_tag LOCUS_05810 24561 23995 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860666.1 protein_id gnl|my_center|LOCUS_05810 25127 24558 gene locus_tag LOCUS_05820 25127 24558 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_05820 25869 25510 gene locus_tag LOCUS_05830 25869 25510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 26520 25879 gene locus_tag LOCUS_05840 26520 25879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 >Feature sequence020 546 1328 gene locus_tag LOCUS_05850 gene pstB 546 1328 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_05850 1514 2161 gene locus_tag LOCUS_05860 gene phoU 1514 2161 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401254.1 protein_id gnl|my_center|LOCUS_05860 3217 2258 gene locus_tag LOCUS_05870 3217 2258 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_05870 3731 3252 gene locus_tag LOCUS_05880 3731 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021820.1 protein_id gnl|my_center|LOCUS_05880 4163 3879 gene locus_tag LOCUS_05890 4163 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 4358 6877 gene locus_tag LOCUS_05900 4358 6877 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929460.1 protein_id gnl|my_center|LOCUS_05900 7576 7256 gene locus_tag LOCUS_05910 7576 7256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 8177 7611 gene locus_tag LOCUS_05920 gene frr 8177 7611 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259405.1 protein_id gnl|my_center|LOCUS_05920 8958 8233 gene locus_tag LOCUS_05930 gene pyrH 8958 8233 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_05930 9876 9025 gene locus_tag LOCUS_05940 9876 9025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 11122 10079 gene locus_tag LOCUS_05950 11122 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 11754 11236 gene locus_tag LOCUS_05960 11754 11236 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_05960 11923 13704 gene locus_tag LOCUS_05970 11923 13704 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001969726.1 protein_id gnl|my_center|LOCUS_05970 13817 15367 gene locus_tag LOCUS_05980 13817 15367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 15382 15606 gene locus_tag LOCUS_05990 15382 15606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 16182 15802 gene locus_tag LOCUS_06000 16182 15802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 16761 16354 gene locus_tag LOCUS_06010 16761 16354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 17514 16906 gene locus_tag LOCUS_06020 gene recR 17514 16906 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 protein_id gnl|my_center|LOCUS_06020 17956 17507 gene locus_tag LOCUS_06030 17956 17507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 19291 18044 gene locus_tag LOCUS_06040 gene fabF 19291 18044 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_06040 21065 19356 gene locus_tag LOCUS_06050 21065 19356 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218033054.1 protein_id gnl|my_center|LOCUS_06050 21641 21195 gene locus_tag LOCUS_06060 21641 21195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 22901 21822 gene locus_tag LOCUS_06070 gene dinB 22901 21822 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768057.1 protein_id gnl|my_center|LOCUS_06070 24847 23945 gene locus_tag LOCUS_06080 24847 23945 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265914.1 protein_id gnl|my_center|LOCUS_06080 25063 25713 gene locus_tag LOCUS_06090 25063 25713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06090 >Feature sequence021 866 447 gene locus_tag LOCUS_06100 866 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06100 1348 902 gene locus_tag LOCUS_06110 1348 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 3436 1649 gene locus_tag LOCUS_06120 3436 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 5478 3433 gene locus_tag LOCUS_06130 5478 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 5888 5661 gene locus_tag LOCUS_06140 5888 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 6434 5910 gene locus_tag LOCUS_06150 6434 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 6877 6473 gene locus_tag LOCUS_06160 6877 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 7570 6935 gene locus_tag LOCUS_06170 7570 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 8596 8087 gene locus_tag LOCUS_06180 8596 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 9387 8623 gene locus_tag LOCUS_06190 9387 8623 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_06190 11208 9418 gene locus_tag LOCUS_06200 11208 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 13632 11233 gene locus_tag LOCUS_06210 13632 11233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 14108 13662 gene locus_tag LOCUS_06220 14108 13662 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_06220 14936 14145 gene locus_tag LOCUS_06230 14936 14145 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_06230 15121 16617 gene locus_tag LOCUS_06240 15121 16617 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_06240 16624 17061 gene locus_tag LOCUS_06250 16624 17061 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227792.1 protein_id gnl|my_center|LOCUS_06250 17500 17066 gene locus_tag LOCUS_06260 17500 17066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 18013 17618 gene locus_tag LOCUS_06270 gene rpsI 18013 17618 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354786.1 protein_id gnl|my_center|LOCUS_06270 18457 18029 gene locus_tag LOCUS_06280 gene rplM 18457 18029 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 protein_id gnl|my_center|LOCUS_06280 19048 19242 gene locus_tag LOCUS_06290 gene infA 19048 19242 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284370.1 protein_id gnl|my_center|LOCUS_06290 19338 20828 gene locus_tag LOCUS_06300 19338 20828 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256378.1 protein_id gnl|my_center|LOCUS_06300 20830 21570 gene locus_tag LOCUS_06310 gene radC 20830 21570 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816793.1 protein_id gnl|my_center|LOCUS_06310 21749 21657 gene locus_tag LOCUS_t00120 21749 21657 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 22035 21832 gene locus_tag LOCUS_06320 22035 21832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 22903 22112 gene locus_tag LOCUS_06330 22903 22112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 23724 22975 gene locus_tag LOCUS_06340 23724 22975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 >Feature sequence022 115 1476 gene locus_tag LOCUS_06350 115 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 3296 1509 gene locus_tag LOCUS_06360 3296 1509 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798670.1 protein_id gnl|my_center|LOCUS_06360 4170 3382 gene locus_tag LOCUS_06370 4170 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 5081 4326 gene locus_tag LOCUS_06380 5081 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 5378 7645 gene locus_tag LOCUS_06390 gene pflB 5378 7645 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437454.1 protein_id gnl|my_center|LOCUS_06390 7662 8444 gene locus_tag LOCUS_06400 gene pflA 7662 8444 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799649.1 protein_id gnl|my_center|LOCUS_06400 8759 8478 gene locus_tag LOCUS_06410 8759 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 10678 8834 gene locus_tag LOCUS_06420 10678 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 12009 11287 gene locus_tag LOCUS_06430 12009 11287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 12560 12697 gene locus_tag LOCUS_06440 12560 12697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 12784 13947 gene locus_tag LOCUS_06450 12784 13947 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259309.1 protein_id gnl|my_center|LOCUS_06450 14227 14538 gene locus_tag LOCUS_06460 14227 14538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 14720 15130 gene locus_tag LOCUS_06470 14720 15130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 24686 15255 gene locus_tag LOCUS_06480 24686 15255 CDS product autotransporter-associated beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104543246.1 protein_id gnl|my_center|LOCUS_06480 >Feature sequence023 1877 2611 gene locus_tag LOCUS_06490 1877 2611 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928634.1 protein_id gnl|my_center|LOCUS_06490 3535 2870 gene locus_tag LOCUS_06500 3535 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 3938 5314 gene locus_tag LOCUS_06510 3938 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 5545 6723 gene locus_tag LOCUS_06520 gene galK 5545 6723 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097521.1 protein_id gnl|my_center|LOCUS_06520 6736 9030 gene locus_tag LOCUS_06530 6736 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 9354 9554 gene locus_tag LOCUS_06540 9354 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 9508 10194 gene locus_tag LOCUS_06550 9508 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 12263 10257 gene locus_tag LOCUS_06560 12263 10257 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941556.1 protein_id gnl|my_center|LOCUS_06560 13208 12264 gene locus_tag LOCUS_06570 gene fmt 13208 12264 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_06570 13606 14733 gene locus_tag LOCUS_06580 13606 14733 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349606.1 protein_id gnl|my_center|LOCUS_06580 14739 15467 gene locus_tag LOCUS_06590 14739 15467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 15601 15843 gene locus_tag LOCUS_06600 gene acpP 15601 15843 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_06600 15938 16480 gene locus_tag LOCUS_06610 15938 16480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 16452 17213 gene locus_tag LOCUS_06620 16452 17213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 17210 17662 gene locus_tag LOCUS_06630 gene dtd 17210 17662 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_06630 18775 18008 gene locus_tag LOCUS_06640 18775 18008 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_06640 20774 18816 gene locus_tag LOCUS_06650 20774 18816 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_06650 21464 20796 gene locus_tag LOCUS_06660 21464 20796 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941836.1 protein_id gnl|my_center|LOCUS_06660 21722 21970 gene locus_tag LOCUS_06670 21722 21970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 22003 22788 gene locus_tag LOCUS_06680 22003 22788 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_06680 23044 22811 gene locus_tag LOCUS_06690 23044 22811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 24159 23470 gene locus_tag LOCUS_06700 24159 23470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence024 839 186 gene locus_tag LOCUS_06710 839 186 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095644.1 protein_id gnl|my_center|LOCUS_06710 1647 868 gene locus_tag LOCUS_06720 1647 868 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_06720 1805 2260 gene locus_tag LOCUS_06730 1805 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 2270 3835 gene locus_tag LOCUS_06740 2270 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 3859 4203 gene locus_tag LOCUS_06750 3859 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 4220 6319 gene locus_tag LOCUS_06760 4220 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 6327 7832 gene locus_tag LOCUS_06770 6327 7832 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_06770 7851 9224 gene locus_tag LOCUS_06780 7851 9224 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_06780 9230 10333 gene locus_tag LOCUS_06790 gene mraY 9230 10333 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_06790 10345 11655 gene locus_tag LOCUS_06800 gene murD 10345 11655 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_06800 11679 12479 gene locus_tag LOCUS_06810 11679 12479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 12507 13649 gene locus_tag LOCUS_06820 gene spoVE 12507 13649 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753510.1 protein_id gnl|my_center|LOCUS_06820 13646 14770 gene locus_tag LOCUS_06830 gene murG 13646 14770 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939774.1 protein_id gnl|my_center|LOCUS_06830 14763 17060 gene locus_tag LOCUS_06840 14763 17060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 17084 18019 gene locus_tag LOCUS_06850 17084 18019 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_06850 18118 19017 gene locus_tag LOCUS_06860 18118 19017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 19241 20281 gene locus_tag LOCUS_06870 gene recA 19241 20281 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_06870 20469 21455 gene locus_tag LOCUS_06880 20469 21455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 21490 22176 gene locus_tag LOCUS_06890 gene lipB 21490 22176 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943071.1 protein_id gnl|my_center|LOCUS_06890 22333 23745 gene locus_tag LOCUS_06900 gene leuC 22333 23745 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173294.1 protein_id gnl|my_center|LOCUS_06900 23765 24373 gene locus_tag LOCUS_06910 gene leuD 23765 24373 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228533.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence025 885 85 gene locus_tag LOCUS_06920 885 85 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401910.1 protein_id gnl|my_center|LOCUS_06920 1334 897 gene locus_tag LOCUS_06930 1334 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 1624 3783 gene locus_tag LOCUS_06940 gene glaB 1624 3783 CDS product alpha-1,3-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202199.1 protein_id gnl|my_center|LOCUS_06940 3904 4857 gene locus_tag LOCUS_06950 3904 4857 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_06950 5449 4997 gene locus_tag LOCUS_06960 5449 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 5514 6275 gene locus_tag LOCUS_06970 5514 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 6311 6886 gene locus_tag LOCUS_06980 gene rsmD 6311 6886 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_06980 6888 8174 gene locus_tag LOCUS_06990 gene waaA 6888 8174 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_06990 9129 8158 gene locus_tag LOCUS_07000 9129 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 10342 9182 gene locus_tag LOCUS_07010 gene rsgA 10342 9182 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459864.1 protein_id gnl|my_center|LOCUS_07010 11068 10385 gene locus_tag LOCUS_07020 11068 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 11130 12332 gene locus_tag LOCUS_07030 gene nifS 11130 12332 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_07030 15981 12490 gene locus_tag LOCUS_07040 15981 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 16194 16481 gene locus_tag LOCUS_07050 16194 16481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 17290 16541 gene locus_tag LOCUS_07060 17290 16541 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975619.1 protein_id gnl|my_center|LOCUS_07060 18849 17506 gene locus_tag LOCUS_07070 18849 17506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 21529 18866 gene locus_tag LOCUS_07080 21529 18866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 22586 21537 gene locus_tag LOCUS_07090 22586 21537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 23186 22602 gene locus_tag LOCUS_07100 23186 22602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 23790 23251 gene locus_tag LOCUS_07110 23790 23251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence026 118 1584 gene locus_tag LOCUS_07120 gene gatB 118 1584 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_07120 3401 1671 gene locus_tag LOCUS_07130 gene poxB 3401 1671 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729435.1 protein_id gnl|my_center|LOCUS_07130 3591 6128 gene locus_tag LOCUS_07140 3591 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 6905 6252 gene locus_tag LOCUS_07150 6905 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 7078 9834 gene locus_tag LOCUS_07160 7078 9834 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203665.1 protein_id gnl|my_center|LOCUS_07160 9945 11102 gene locus_tag LOCUS_07170 9945 11102 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_07170 11115 14276 gene locus_tag LOCUS_07180 11115 14276 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_07180 14661 14332 gene locus_tag LOCUS_07190 14661 14332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07190 15713 14604 gene locus_tag LOCUS_07200 15713 14604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07200 16204 16004 gene locus_tag LOCUS_07210 16204 16004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 17175 16402 gene locus_tag LOCUS_07220 gene thiD 17175 16402 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368307.1 protein_id gnl|my_center|LOCUS_07220 17303 17770 gene locus_tag LOCUS_07230 17303 17770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 18804 17767 gene locus_tag LOCUS_07240 18804 17767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 18975 19712 gene locus_tag LOCUS_07250 18975 19712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 20988 19726 gene locus_tag LOCUS_07260 20988 19726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 21111 21641 gene locus_tag LOCUS_07270 21111 21641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 23622 21589 gene locus_tag LOCUS_07280 23622 21589 CDS product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099504.1 protein_id gnl|my_center|LOCUS_07280 >Feature sequence027 3537 712 gene locus_tag LOCUS_07290 3537 712 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123057.1 protein_id gnl|my_center|LOCUS_07290 4280 3534 gene locus_tag LOCUS_07300 4280 3534 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339558.1 protein_id gnl|my_center|LOCUS_07300 6518 4296 gene locus_tag LOCUS_07310 6518 4296 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765172.1 protein_id gnl|my_center|LOCUS_07310 7526 6639 gene locus_tag LOCUS_07320 7526 6639 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_07320 8215 7613 gene locus_tag LOCUS_07330 8215 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 8577 11189 gene locus_tag LOCUS_07340 8577 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 11224 11643 gene locus_tag LOCUS_07350 11224 11643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 12062 11655 gene locus_tag LOCUS_07360 12062 11655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 12656 12249 gene locus_tag LOCUS_07370 12656 12249 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_07370 12750 15053 gene locus_tag LOCUS_07380 12750 15053 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530052.1 protein_id gnl|my_center|LOCUS_07380 15753 15130 gene locus_tag LOCUS_07390 15753 15130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 16509 15916 gene locus_tag LOCUS_07400 16509 15916 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700597.1 protein_id gnl|my_center|LOCUS_07400 18961 16511 gene locus_tag LOCUS_07410 gene mutS 18961 16511 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_07410 19690 19340 gene locus_tag LOCUS_07420 gene rsfS 19690 19340 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418177.1 protein_id gnl|my_center|LOCUS_07420 22066 19712 gene locus_tag LOCUS_07430 22066 19712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 23120 22323 gene locus_tag LOCUS_07440 23120 22323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence028 744 298 gene locus_tag LOCUS_07450 744 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 1130 804 gene locus_tag LOCUS_07460 1130 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 2258 1275 gene locus_tag LOCUS_07470 2258 1275 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545262.1 protein_id gnl|my_center|LOCUS_07470 3095 2277 gene locus_tag LOCUS_07480 3095 2277 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_07480 3911 3111 gene locus_tag LOCUS_07490 3911 3111 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815039.1 protein_id gnl|my_center|LOCUS_07490 5399 3987 gene locus_tag LOCUS_07500 5399 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 5578 7428 gene locus_tag LOCUS_07510 gene msbA 5578 7428 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_07510 7422 9206 gene locus_tag LOCUS_07520 gene msbA 7422 9206 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_07520 9315 11276 gene locus_tag LOCUS_07530 9315 11276 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_07530 11374 11919 gene locus_tag LOCUS_07540 11374 11919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 12089 13246 gene locus_tag LOCUS_07550 gene ftsA 12089 13246 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939770.1 protein_id gnl|my_center|LOCUS_07550 13272 14723 gene locus_tag LOCUS_07560 13272 14723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 14723 16108 gene locus_tag LOCUS_07570 14723 16108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 16265 17227 gene locus_tag LOCUS_07580 16265 17227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 17199 18002 gene locus_tag LOCUS_07590 17199 18002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 19009 18026 gene locus_tag LOCUS_07600 19009 18026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 19694 19362 gene locus_tag LOCUS_07610 19694 19362 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005015014.1 protein_id gnl|my_center|LOCUS_07610 21059 19836 gene locus_tag LOCUS_07620 21059 19836 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943175.1 protein_id gnl|my_center|LOCUS_07620 21351 22238 gene locus_tag LOCUS_07630 21351 22238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 22713 22594 gene locus_tag LOCUS_07640 22713 22594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence029 176 1720 gene locus_tag LOCUS_07650 gene gpmI 176 1720 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_07650 2476 2907 gene locus_tag LOCUS_07660 2476 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 3518 3790 gene locus_tag LOCUS_07670 3518 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 3818 4291 gene locus_tag LOCUS_07680 gene rpsG 3818 4291 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583341.1 protein_id gnl|my_center|LOCUS_07680 4355 6502 gene locus_tag LOCUS_07690 gene fusA 4355 6502 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_07690 6540 6848 gene locus_tag LOCUS_07700 gene rpsJ 6540 6848 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_07700 6894 7529 gene locus_tag LOCUS_07710 gene rplC 6894 7529 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417224.1 protein_id gnl|my_center|LOCUS_07710 7571 8179 gene locus_tag LOCUS_07720 gene rplD 7571 8179 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424397.1 protein_id gnl|my_center|LOCUS_07720 8186 8470 gene locus_tag LOCUS_07730 8186 8470 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_07730 8498 9334 gene locus_tag LOCUS_07740 gene rplB 8498 9334 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933839.1 protein_id gnl|my_center|LOCUS_07740 9370 9639 gene locus_tag LOCUS_07750 gene rpsS 9370 9639 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_07750 9660 10370 gene locus_tag LOCUS_07760 9660 10370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 10410 10748 gene locus_tag LOCUS_07770 gene rplV 10410 10748 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 protein_id gnl|my_center|LOCUS_07770 10788 11477 gene locus_tag LOCUS_07780 gene rpsC 10788 11477 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_07780 11538 11951 gene locus_tag LOCUS_07790 gene rplP 11538 11951 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_07790 12002 12169 gene locus_tag LOCUS_07800 12002 12169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 12219 12491 gene locus_tag LOCUS_07810 gene rpsQ 12219 12491 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963461.1 protein_id gnl|my_center|LOCUS_07810 12529 12894 gene locus_tag LOCUS_07820 gene rplN 12529 12894 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081816.1 protein_id gnl|my_center|LOCUS_07820 14401 13538 gene locus_tag LOCUS_07830 14401 13538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 17092 14420 gene locus_tag LOCUS_07840 17092 14420 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933216.1 protein_id gnl|my_center|LOCUS_07840 20210 17247 gene locus_tag LOCUS_07850 gene galB 20210 17247 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_07850 21635 20517 gene locus_tag LOCUS_07860 21635 20517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 21831 22538 gene locus_tag LOCUS_07870 21831 22538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 >Feature sequence030 <1 1326 gene locus_tag LOCUS_07880 <1 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119288.1:arylsulfatase 2330 1362 gene locus_tag LOCUS_07890 2330 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 2927 2484 gene locus_tag LOCUS_07900 2927 2484 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816014.1 protein_id gnl|my_center|LOCUS_07900 3610 3011 gene locus_tag LOCUS_07910 3610 3011 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_07910 4109 3774 gene locus_tag LOCUS_07920 4109 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 4894 4463 gene locus_tag LOCUS_07930 4894 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 5563 5012 gene locus_tag LOCUS_07940 5563 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 5630 6196 gene locus_tag LOCUS_07950 5630 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 6740 6153 gene locus_tag LOCUS_07960 6740 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 6996 9830 gene locus_tag LOCUS_07970 gene polA 6996 9830 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_07970 9924 11966 gene locus_tag LOCUS_07980 9924 11966 CDS product enterotoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703586.1 protein_id gnl|my_center|LOCUS_07980 13227 12118 gene locus_tag LOCUS_07990 13227 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 13710 13255 gene locus_tag LOCUS_08000 13710 13255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 15357 13933 gene locus_tag LOCUS_08010 gene purB 15357 13933 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_08010 16949 15696 gene locus_tag LOCUS_08020 gene pepT 16949 15696 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460034.1 protein_id gnl|my_center|LOCUS_08020 17066 19822 gene locus_tag LOCUS_08030 17066 19822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 19859 20692 gene locus_tag LOCUS_08040 19859 20692 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879952.1 protein_id gnl|my_center|LOCUS_08040 20706 22259 gene locus_tag LOCUS_08050 20706 22259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 >Feature sequence031 <1 2619 gene locus_tag LOCUS_08060 <1 2619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038821.1:autotransporter BatB 2924 3601 gene locus_tag LOCUS_08070 2924 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 4640 3651 gene locus_tag LOCUS_08080 gene queA 4640 3651 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081288.1 protein_id gnl|my_center|LOCUS_08080 4723 5784 gene locus_tag LOCUS_08090 gene floA 4723 5784 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_08090 5839 6489 gene locus_tag LOCUS_08100 5839 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 6800 7567 gene locus_tag LOCUS_08110 6800 7567 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945667.1 protein_id gnl|my_center|LOCUS_08110 8917 7613 gene locus_tag LOCUS_08120 8917 7613 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982162.1 protein_id gnl|my_center|LOCUS_08120 9071 9736 gene locus_tag LOCUS_08130 9071 9736 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203326.1 protein_id gnl|my_center|LOCUS_08130 9739 10908 gene locus_tag LOCUS_08140 9739 10908 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170771.1 protein_id gnl|my_center|LOCUS_08140 10912 12201 gene locus_tag LOCUS_08150 gene lysA 10912 12201 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_08150 12496 14022 gene locus_tag LOCUS_08160 12496 14022 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671898.1 protein_id gnl|my_center|LOCUS_08160 14215 15867 gene locus_tag LOCUS_08170 14215 15867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 15988 16986 gene locus_tag LOCUS_08180 gene fbaA 15988 16986 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015363.1 protein_id gnl|my_center|LOCUS_08180 17387 18457 gene locus_tag LOCUS_08190 17387 18457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 18454 19038 gene locus_tag LOCUS_08200 18454 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 18978 19598 gene locus_tag LOCUS_08210 18978 19598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 19893 20942 gene locus_tag LOCUS_08220 19893 20942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence032 163 684 gene locus_tag LOCUS_08230 163 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 1066 2076 gene locus_tag LOCUS_08240 gene dusB 1066 2076 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927287.1 protein_id gnl|my_center|LOCUS_08240 2288 3934 gene locus_tag LOCUS_08250 2288 3934 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_08250 3963 5621 gene locus_tag LOCUS_08260 3963 5621 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_08260 5688 6956 gene locus_tag LOCUS_08270 5688 6956 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_08270 6940 7644 gene locus_tag LOCUS_08280 6940 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 7735 8724 gene locus_tag LOCUS_08290 7735 8724 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289773.1 protein_id gnl|my_center|LOCUS_08290 8733 9554 gene locus_tag LOCUS_08300 8733 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 10180 9725 gene locus_tag LOCUS_08310 gene ndk 10180 9725 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_08310 10457 10284 gene locus_tag LOCUS_08320 10457 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 11072 10491 gene locus_tag LOCUS_08330 11072 10491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 11166 11732 gene locus_tag LOCUS_08340 11166 11732 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035528.1 protein_id gnl|my_center|LOCUS_08340 11808 12029 gene locus_tag LOCUS_08350 11808 12029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 12144 12602 gene locus_tag LOCUS_08360 gene smpB 12144 12602 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057764.1 protein_id gnl|my_center|LOCUS_08360 13281 12718 gene locus_tag LOCUS_08370 13281 12718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 13361 13825 gene locus_tag LOCUS_08380 13361 13825 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_08380 14547 13933 gene locus_tag LOCUS_08390 14547 13933 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455361.1 protein_id gnl|my_center|LOCUS_08390 15704 14637 gene locus_tag LOCUS_08400 gene citZ 15704 14637 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_08400 16522 15854 gene locus_tag LOCUS_08410 gene tsaB 16522 15854 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917948.1 protein_id gnl|my_center|LOCUS_08410 16747 17556 gene locus_tag LOCUS_08420 16747 17556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 17637 18158 gene locus_tag LOCUS_08430 17637 18158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 18270 18722 gene locus_tag LOCUS_08440 18270 18722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 19675 18749 gene locus_tag LOCUS_08450 19675 18749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 20405 19689 gene locus_tag LOCUS_08460 20405 19689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 20868 21038 gene locus_tag LOCUS_08470 20868 21038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 >Feature sequence033 5 484 gene locus_tag LOCUS_08480 5 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1922 513 gene locus_tag LOCUS_08490 gene mdtD 1922 513 CDS product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084717.1 protein_id gnl|my_center|LOCUS_08490 3196 2039 gene locus_tag LOCUS_08500 3196 2039 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764054.1 protein_id gnl|my_center|LOCUS_08500 4351 3461 gene locus_tag LOCUS_08510 4351 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4703 5308 gene locus_tag LOCUS_08520 4703 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 5319 5570 gene locus_tag LOCUS_08530 5319 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 6584 5562 gene locus_tag LOCUS_08540 6584 5562 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_08540 7365 6601 gene locus_tag LOCUS_08550 gene gpmA 7365 6601 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789269.1 protein_id gnl|my_center|LOCUS_08550 7569 9500 gene locus_tag LOCUS_08560 7569 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 10154 9582 gene locus_tag LOCUS_08570 10154 9582 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766229.1 protein_id gnl|my_center|LOCUS_08570 10816 10163 gene locus_tag LOCUS_08580 10816 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 11106 13334 gene locus_tag LOCUS_08590 11106 13334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 13462 13998 gene locus_tag LOCUS_08600 13462 13998 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421522.1 protein_id gnl|my_center|LOCUS_08600 14018 14503 gene locus_tag LOCUS_08610 14018 14503 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020591.1 protein_id gnl|my_center|LOCUS_08610 14712 14797 gene locus_tag LOCUS_t00130 14712 14797 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 15029 16894 gene locus_tag LOCUS_08620 15029 16894 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795334.1 protein_id gnl|my_center|LOCUS_08620 17018 17254 gene locus_tag LOCUS_08630 17018 17254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 17379 17852 gene locus_tag LOCUS_08640 17379 17852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 18923 17892 gene locus_tag LOCUS_08650 18923 17892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 19594 19082 gene locus_tag LOCUS_08660 19594 19082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 21157 19604 gene locus_tag LOCUS_08670 21157 19604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence034 445 762 gene locus_tag LOCUS_08680 gene rplU 445 762 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564642.1 protein_id gnl|my_center|LOCUS_08680 791 1054 gene locus_tag LOCUS_08690 gene rpmA 791 1054 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_08690 1209 1649 gene locus_tag LOCUS_08700 1209 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 1665 2423 gene locus_tag LOCUS_08710 gene sufC 1665 2423 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946339.1 protein_id gnl|my_center|LOCUS_08710 2447 3883 gene locus_tag LOCUS_08720 gene sufB 2447 3883 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259322.1 protein_id gnl|my_center|LOCUS_08720 3892 5148 gene locus_tag LOCUS_08730 gene sufD 3892 5148 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_08730 5584 6546 gene locus_tag LOCUS_08740 5584 6546 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261984.1 protein_id gnl|my_center|LOCUS_08740 6533 8794 gene locus_tag LOCUS_08750 6533 8794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 8847 9104 gene locus_tag LOCUS_08760 8847 9104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 9189 10154 gene locus_tag LOCUS_08770 gene bioB 9189 10154 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_08770 10185 11534 gene locus_tag LOCUS_08780 gene bioA 10185 11534 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964671.1 protein_id gnl|my_center|LOCUS_08780 11640 12725 gene locus_tag LOCUS_08790 11640 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 14582 12807 gene locus_tag LOCUS_08800 14582 12807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 15058 14714 gene locus_tag LOCUS_08810 15058 14714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 15392 15051 gene locus_tag LOCUS_08820 15392 15051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 16354 15416 gene locus_tag LOCUS_08830 16354 15416 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407612.1 protein_id gnl|my_center|LOCUS_08830 16851 16351 gene locus_tag LOCUS_08840 16851 16351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 17987 16848 gene locus_tag LOCUS_08850 gene rffA 17987 16848 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099273.1 protein_id gnl|my_center|LOCUS_08850 19238 18117 gene locus_tag LOCUS_08860 19238 18117 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803908.1 protein_id gnl|my_center|LOCUS_08860 19418 19933 gene locus_tag LOCUS_08870 19418 19933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence035 3115 1607 gene locus_tag LOCUS_08880 3115 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08880 3430 3254 gene locus_tag LOCUS_08890 3430 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 4222 4839 gene locus_tag LOCUS_08900 4222 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 6310 4952 gene locus_tag LOCUS_08910 gene rimO 6310 4952 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_08910 7773 6337 gene locus_tag LOCUS_08920 7773 6337 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230024.1 protein_id gnl|my_center|LOCUS_08920 8006 9808 gene locus_tag LOCUS_08930 gene dnaG 8006 9808 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_08930 9868 11961 gene locus_tag LOCUS_08940 9868 11961 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883393.1 protein_id gnl|my_center|LOCUS_08940 12000 12731 gene locus_tag LOCUS_08950 gene vanX 12000 12731 CDS product D-Ala-D-Ala dipeptidase VanX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368685.1 protein_id gnl|my_center|LOCUS_08950 12827 13879 gene locus_tag LOCUS_08960 12827 13879 CDS product TQO small subunit DoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202970.1 protein_id gnl|my_center|LOCUS_08960 14062 14466 gene locus_tag LOCUS_08970 14062 14466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 14692 15105 gene locus_tag LOCUS_08980 14692 15105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 15249 16115 gene locus_tag LOCUS_08990 15249 16115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 17950 16250 gene locus_tag LOCUS_09000 17950 16250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 20333 18114 gene locus_tag LOCUS_09010 20333 18114 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926974.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence036 92 367 gene locus_tag LOCUS_09020 92 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 614 1690 gene locus_tag LOCUS_09030 gene apbC 614 1690 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_09030 1832 3208 gene locus_tag LOCUS_09040 1832 3208 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262007.1 protein_id gnl|my_center|LOCUS_09040 3798 3235 gene locus_tag LOCUS_09050 3798 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 4136 5230 gene locus_tag LOCUS_09060 4136 5230 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_09060 5292 7250 gene locus_tag LOCUS_09070 5292 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 7269 8666 gene locus_tag LOCUS_09080 gene uxaC 7269 8666 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174193.1 protein_id gnl|my_center|LOCUS_09080 8670 9314 gene locus_tag LOCUS_09090 8670 9314 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477517.1 protein_id gnl|my_center|LOCUS_09090 9335 10615 gene locus_tag LOCUS_09100 9335 10615 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_09100 10766 11470 gene locus_tag LOCUS_09110 10766 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 13074 11581 gene locus_tag LOCUS_09120 gene oadA 13074 11581 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_09120 14665 13211 gene locus_tag LOCUS_09130 gene cls 14665 13211 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144064.1 protein_id gnl|my_center|LOCUS_09130 14809 15624 gene locus_tag LOCUS_09140 14809 15624 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969714.1 protein_id gnl|my_center|LOCUS_09140 15646 16116 gene locus_tag LOCUS_09150 gene dfrA 15646 16116 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637205.1 protein_id gnl|my_center|LOCUS_09150 19331 16224 gene locus_tag LOCUS_09160 19331 16224 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393549.1 protein_id gnl|my_center|LOCUS_09160 20310 19339 gene locus_tag LOCUS_09170 20310 19339 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817170.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence037 1013 1513 gene locus_tag LOCUS_09180 1013 1513 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765089.1 protein_id gnl|my_center|LOCUS_09180 1678 2691 gene locus_tag LOCUS_09190 1678 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 3093 2734 gene locus_tag LOCUS_09200 3093 2734 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948666.1 protein_id gnl|my_center|LOCUS_09200 3602 4567 gene locus_tag LOCUS_09210 3602 4567 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937953.1 protein_id gnl|my_center|LOCUS_09210 4569 5276 gene locus_tag LOCUS_09220 gene cobI 4569 5276 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937949.1 protein_id gnl|my_center|LOCUS_09220 5273 6511 gene locus_tag LOCUS_09230 5273 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 6518 7180 gene locus_tag LOCUS_09240 gene cbiC 6518 7180 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999239.1 protein_id gnl|my_center|LOCUS_09240 7213 8331 gene locus_tag LOCUS_09250 7213 8331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 8319 9536 gene locus_tag LOCUS_09260 8319 9536 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 protein_id gnl|my_center|LOCUS_09260 9533 12151 gene locus_tag LOCUS_09270 9533 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 12195 12971 gene locus_tag LOCUS_09280 12195 12971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09280 12990 13637 gene locus_tag LOCUS_09290 12990 13637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09290 13650 14078 gene locus_tag LOCUS_09300 13650 14078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 14675 14139 gene locus_tag LOCUS_09310 gene cobO 14675 14139 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391114.1 protein_id gnl|my_center|LOCUS_09310 14908 14995 gene locus_tag LOCUS_t00140 14908 14995 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18022 15143 gene locus_tag LOCUS_09320 18022 15143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 18629 18093 gene locus_tag LOCUS_09330 18629 18093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence038 <1 797 gene locus_tag LOCUS_09340 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880593.1:nickel-dependent hydrogenase large subunit 794 1966 gene locus_tag LOCUS_09350 794 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1959 2534 gene locus_tag LOCUS_09360 1959 2534 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706346.1 protein_id gnl|my_center|LOCUS_09360 2527 2868 gene locus_tag LOCUS_09370 2527 2868 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225637.1 protein_id gnl|my_center|LOCUS_09370 3055 3945 gene locus_tag LOCUS_09380 3055 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 4437 4036 gene locus_tag LOCUS_09390 4437 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 4619 5359 gene locus_tag LOCUS_09400 4619 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 7788 5533 gene locus_tag LOCUS_09410 7788 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 8814 8170 gene locus_tag LOCUS_09420 8814 8170 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_09420 9938 8847 gene locus_tag LOCUS_09430 gene hisC 9938 8847 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_09430 11003 10404 gene locus_tag LOCUS_09440 11003 10404 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948585.1 protein_id gnl|my_center|LOCUS_09440 11234 11097 gene locus_tag LOCUS_09450 11234 11097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 11443 11231 gene locus_tag LOCUS_09460 11443 11231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 11600 12100 gene locus_tag LOCUS_09470 11600 12100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 12393 13979 gene locus_tag LOCUS_09480 12393 13979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 14028 15674 gene locus_tag LOCUS_09490 gene fumA 14028 15674 CDS product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096879.1 protein_id gnl|my_center|LOCUS_09490 16981 16445 gene locus_tag LOCUS_09500 16981 16445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 17008 17607 gene locus_tag LOCUS_09510 17008 17607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 18532 17741 gene locus_tag LOCUS_09520 18532 17741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 <20143 18884 gene locus_tag LOCUS_09530 <20143 18884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202545.1:family 20 glycosylhydrolase >Feature sequence039 49 840 gene locus_tag LOCUS_09540 49 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 4231 1070 gene locus_tag LOCUS_09550 4231 1070 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120396.1 protein_id gnl|my_center|LOCUS_09550 7106 4233 gene locus_tag LOCUS_09560 7106 4233 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120395.1 protein_id gnl|my_center|LOCUS_09560 8443 7526 gene locus_tag LOCUS_09570 8443 7526 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764292.1 protein_id gnl|my_center|LOCUS_09570 8637 8425 gene locus_tag LOCUS_09580 8637 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 13912 8855 gene locus_tag LOCUS_09590 13912 8855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 15300 14029 gene locus_tag LOCUS_09600 15300 14029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 16877 15690 gene locus_tag LOCUS_09610 16877 15690 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228869.1 protein_id gnl|my_center|LOCUS_09610 18481 16973 gene locus_tag LOCUS_09620 18481 16973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 18704 18778 gene locus_tag LOCUS_t00150 18704 18778 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19394 19152 gene locus_tag LOCUS_09630 19394 19152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 20005 19412 gene locus_tag LOCUS_09640 20005 19412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence040 <1 1015 gene locus_tag LOCUS_09650 <1 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_130566822.1:right-handed parallel beta-helix repeat-containing protein 1032 1637 gene locus_tag LOCUS_09660 1032 1637 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895513.1 protein_id gnl|my_center|LOCUS_09660 3603 2140 gene locus_tag LOCUS_09670 3603 2140 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461272.1 protein_id gnl|my_center|LOCUS_09670 3756 4349 gene locus_tag LOCUS_09680 3756 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 5361 4339 gene locus_tag LOCUS_09690 5361 4339 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035992.1 protein_id gnl|my_center|LOCUS_09690 7941 5422 gene locus_tag LOCUS_09700 gene pheT 7941 5422 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114408.1 protein_id gnl|my_center|LOCUS_09700 8985 7960 gene locus_tag LOCUS_09710 gene pheS 8985 7960 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018581.1 protein_id gnl|my_center|LOCUS_09710 10300 9155 gene locus_tag LOCUS_09720 10300 9155 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764112.1 protein_id gnl|my_center|LOCUS_09720 10810 11430 gene locus_tag LOCUS_09730 10810 11430 CDS product DUF417 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764769.1 protein_id gnl|my_center|LOCUS_09730 12278 11676 gene locus_tag LOCUS_09740 12278 11676 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_09740 14538 12685 gene locus_tag LOCUS_09750 14538 12685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 14731 16572 gene locus_tag LOCUS_09760 gene htpG 14731 16572 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460040.1 protein_id gnl|my_center|LOCUS_09760 16646 17488 gene locus_tag LOCUS_09770 16646 17488 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964627.1 protein_id gnl|my_center|LOCUS_09770 17644 18750 gene locus_tag LOCUS_09780 gene alr 17644 18750 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_09780 18851 19294 gene locus_tag LOCUS_09790 18851 19294 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence041 97 867 gene locus_tag LOCUS_09800 97 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2438 1038 gene locus_tag LOCUS_09810 gene asnS 2438 1038 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937318.1 protein_id gnl|my_center|LOCUS_09810 3719 2514 gene locus_tag LOCUS_09820 3719 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 4334 4017 gene locus_tag LOCUS_09830 gene trxA 4334 4017 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_09830 4861 4373 gene locus_tag LOCUS_09840 4861 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 4945 5106 gene locus_tag LOCUS_09850 4945 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 5282 5962 gene locus_tag LOCUS_09860 5282 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 5978 7162 gene locus_tag LOCUS_09870 5978 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 7180 8370 gene locus_tag LOCUS_09880 7180 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117732.1 protein_id gnl|my_center|LOCUS_09880 8632 9663 gene locus_tag LOCUS_09890 8632 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117732.1 protein_id gnl|my_center|LOCUS_09890 9660 10805 gene locus_tag LOCUS_09900 9660 10805 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203436.1 protein_id gnl|my_center|LOCUS_09900 10827 11936 gene locus_tag LOCUS_09910 10827 11936 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203436.1 protein_id gnl|my_center|LOCUS_09910 11915 12412 gene locus_tag LOCUS_09920 11915 12412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 12850 12431 gene locus_tag LOCUS_09930 12850 12431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 14728 13190 gene locus_tag LOCUS_09940 14728 13190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 14887 15801 gene locus_tag LOCUS_09950 14887 15801 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785776.1 protein_id gnl|my_center|LOCUS_09950 15923 16945 gene locus_tag LOCUS_09960 15923 16945 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659065.1 protein_id gnl|my_center|LOCUS_09960 17310 18323 gene locus_tag LOCUS_09970 17310 18323 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888750.1 protein_id gnl|my_center|LOCUS_09970 18388 18849 gene locus_tag LOCUS_09980 18388 18849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence042 889 3447 gene locus_tag LOCUS_09990 gene gyrB 889 3447 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458663.1 protein_id gnl|my_center|LOCUS_09990 3471 6092 gene locus_tag LOCUS_10000 gene gyrA 3471 6092 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_10000 6153 6785 gene locus_tag LOCUS_10010 6153 6785 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939415.1 protein_id gnl|my_center|LOCUS_10010 6824 8068 gene locus_tag LOCUS_10020 6824 8068 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555746.1 protein_id gnl|my_center|LOCUS_10020 8662 12057 gene locus_tag LOCUS_10030 8662 12057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 12065 13933 gene locus_tag LOCUS_10040 12065 13933 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_10040 13951 15075 gene locus_tag LOCUS_10050 13951 15075 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680414.1 protein_id gnl|my_center|LOCUS_10050 15136 15537 gene locus_tag LOCUS_10060 15136 15537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 16233 15559 gene locus_tag LOCUS_10070 gene phoU 16233 15559 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096661.1 protein_id gnl|my_center|LOCUS_10070 17041 16262 gene locus_tag LOCUS_10080 gene pstB 17041 16262 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_10080 <18563 17064 gene locus_tag LOCUS_10090 <18563 17064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_174518729.1:phosphate ABC transporter permease PstA >Feature sequence043 206 1090 gene locus_tag LOCUS_10100 206 1090 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418680.1 protein_id gnl|my_center|LOCUS_10100 1232 3469 gene locus_tag LOCUS_10110 1232 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 3541 4857 gene locus_tag LOCUS_10120 3541 4857 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_10120 6088 5129 gene locus_tag LOCUS_10130 6088 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 7083 6469 gene locus_tag LOCUS_10140 7083 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 7764 7156 gene locus_tag LOCUS_10150 7764 7156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 8799 7855 gene locus_tag LOCUS_10160 8799 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 10728 8902 gene locus_tag LOCUS_10170 gene thiC 10728 8902 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193963.1 protein_id gnl|my_center|LOCUS_10170 12966 11056 gene locus_tag LOCUS_10180 12966 11056 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_10180 13367 13092 gene locus_tag LOCUS_10190 13367 13092 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_10190 14066 13581 gene locus_tag LOCUS_10200 14066 13581 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287575.1 protein_id gnl|my_center|LOCUS_10200 14369 14962 gene locus_tag LOCUS_10210 14369 14962 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_10210 17321 15285 gene locus_tag LOCUS_10220 17321 15285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 17990 17478 gene locus_tag LOCUS_10230 17990 17478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 >Feature sequence044 2254 812 gene locus_tag LOCUS_10240 2254 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 3269 2244 gene locus_tag LOCUS_10250 3269 2244 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122104.1 protein_id gnl|my_center|LOCUS_10250 3969 3304 gene locus_tag LOCUS_10260 3969 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 6500 3966 gene locus_tag LOCUS_10270 6500 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 6885 8843 gene locus_tag LOCUS_10280 6885 8843 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258368.1 protein_id gnl|my_center|LOCUS_10280 8867 11011 gene locus_tag LOCUS_10290 gene scpA 8867 11011 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 protein_id gnl|my_center|LOCUS_10290 11281 11111 gene locus_tag LOCUS_10300 11281 11111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 11330 12223 gene locus_tag LOCUS_10310 11330 12223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 12319 13407 gene locus_tag LOCUS_10320 12319 13407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 13432 14970 gene locus_tag LOCUS_10330 13432 14970 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941965.1 protein_id gnl|my_center|LOCUS_10330 15176 15637 gene locus_tag LOCUS_10340 15176 15637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 15852 17798 gene locus_tag LOCUS_10350 15852 17798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence045 <1 805 gene locus_tag LOCUS_10360 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760888.1:NUDIX domain-containing protein 820 1281 gene locus_tag LOCUS_10370 820 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1399 1677 gene locus_tag LOCUS_10380 1399 1677 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008777585.1 protein_id gnl|my_center|LOCUS_10380 1813 2076 gene locus_tag LOCUS_10390 1813 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2133 2945 gene locus_tag LOCUS_10400 2133 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 4693 3356 gene locus_tag LOCUS_10410 gene bexA 4693 3356 CDS product multidrug efflux MATE transporter BexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107339.1 protein_id gnl|my_center|LOCUS_10410 6585 4831 gene locus_tag LOCUS_10420 6585 4831 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785879.1 protein_id gnl|my_center|LOCUS_10420 6832 6918 gene locus_tag LOCUS_t00160 6832 6918 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7176 8171 gene locus_tag LOCUS_10430 7176 8171 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210042844.1 protein_id gnl|my_center|LOCUS_10430 8351 9388 gene locus_tag LOCUS_10440 8351 9388 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966690.1 protein_id gnl|my_center|LOCUS_10440 9705 10889 gene locus_tag LOCUS_10450 9705 10889 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793345.1 protein_id gnl|my_center|LOCUS_10450 11064 11161 gene locus_tag LOCUS_t00170 11064 11161 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 11642 12628 gene locus_tag LOCUS_10460 11642 12628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 12703 13386 gene locus_tag LOCUS_10470 12703 13386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 14475 13423 gene locus_tag LOCUS_10480 14475 13423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 14738 15607 gene locus_tag LOCUS_10490 14738 15607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10490 15604 16131 gene locus_tag LOCUS_10500 15604 16131 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094124518.1 protein_id gnl|my_center|LOCUS_10500 16603 17583 gene locus_tag LOCUS_10510 gene ilvC 16603 17583 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218988.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence046 <1 2182 gene locus_tag LOCUS_10520 <1 2182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883089.1:polymorphic outer membrane protein middle domain-containing protein 3096 2308 gene locus_tag LOCUS_10530 gene trpA 3096 2308 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937778.1 protein_id gnl|my_center|LOCUS_10530 4282 3110 gene locus_tag LOCUS_10540 gene trpB 4282 3110 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937777.1 protein_id gnl|my_center|LOCUS_10540 4926 4279 gene locus_tag LOCUS_10550 4926 4279 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404413.1 protein_id gnl|my_center|LOCUS_10550 5708 4923 gene locus_tag LOCUS_10560 5708 4923 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937775.1 protein_id gnl|my_center|LOCUS_10560 7290 5698 gene locus_tag LOCUS_10570 7290 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 8680 7274 gene locus_tag LOCUS_10580 8680 7274 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937772.1 protein_id gnl|my_center|LOCUS_10580 11215 9032 gene locus_tag LOCUS_10590 11215 9032 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783961.1 protein_id gnl|my_center|LOCUS_10590 12647 11658 gene locus_tag LOCUS_10600 gene mgrA 12647 11658 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 protein_id gnl|my_center|LOCUS_10600 13379 12669 gene locus_tag LOCUS_10610 13379 12669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 14570 13500 gene locus_tag LOCUS_10620 14570 13500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 15386 14601 gene locus_tag LOCUS_10630 15386 14601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 16136 15429 gene locus_tag LOCUS_10640 16136 15429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 >Feature sequence047 204 398 gene locus_tag LOCUS_10650 204 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 424 858 gene locus_tag LOCUS_10660 424 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1871 1323 gene locus_tag LOCUS_10670 gene def 1871 1323 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940621.1 protein_id gnl|my_center|LOCUS_10670 2334 1906 gene locus_tag LOCUS_10680 2334 1906 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071947.1 protein_id gnl|my_center|LOCUS_10680 2968 2342 gene locus_tag LOCUS_10690 2968 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 4178 3012 gene locus_tag LOCUS_10700 4178 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 4421 4921 gene locus_tag LOCUS_10710 gene ssb 4421 4921 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_10710 5159 6415 gene locus_tag LOCUS_10720 gene purD 5159 6415 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404599.1 protein_id gnl|my_center|LOCUS_10720 6446 7024 gene locus_tag LOCUS_10730 6446 7024 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_10730 7331 8953 gene locus_tag LOCUS_10740 7331 8953 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966477.1 protein_id gnl|my_center|LOCUS_10740 8992 9909 gene locus_tag LOCUS_10750 8992 9909 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943321.1 protein_id gnl|my_center|LOCUS_10750 9929 10807 gene locus_tag LOCUS_10760 9929 10807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 10952 11710 gene locus_tag LOCUS_10770 10952 11710 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_10770 11886 13274 gene locus_tag LOCUS_10780 11886 13274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 13280 14887 gene locus_tag LOCUS_10790 13280 14887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 14913 17162 gene locus_tag LOCUS_10800 14913 17162 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706661.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence048 343 261 gene locus_tag LOCUS_t00180 343 261 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4438 479 gene locus_tag LOCUS_10810 4438 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 4766 5776 gene locus_tag LOCUS_10820 4766 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 6329 5784 gene locus_tag LOCUS_10830 gene cobU 6329 5784 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964692.1 protein_id gnl|my_center|LOCUS_10830 7161 6346 gene locus_tag LOCUS_10840 7161 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 7898 7158 gene locus_tag LOCUS_10850 7898 7158 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110464.1 protein_id gnl|my_center|LOCUS_10850 8958 7918 gene locus_tag LOCUS_10860 gene cobT 8958 7918 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_10860 9947 8964 gene locus_tag LOCUS_10870 gene cbiB 9947 8964 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816688.1 protein_id gnl|my_center|LOCUS_10870 12527 9951 gene locus_tag LOCUS_10880 12527 9951 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052877.1 protein_id gnl|my_center|LOCUS_10880 13046 15052 gene locus_tag LOCUS_10890 gene btuB 13046 15052 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_10890 15199 17178 gene locus_tag LOCUS_10900 15199 17178 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706661.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence049 9678 8845 gene locus_tag LOCUS_10910 9678 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 10406 9819 gene locus_tag LOCUS_10920 gene purN 10406 9819 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524113.1 protein_id gnl|my_center|LOCUS_10920 10488 11597 gene locus_tag LOCUS_10930 10488 11597 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_10930 11594 12448 gene locus_tag LOCUS_10940 gene yaeI 11594 12448 CDS product phosphodiesterase YaeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625631.1 protein_id gnl|my_center|LOCUS_10940 12467 14194 gene locus_tag LOCUS_10950 12467 14194 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_10950 14198 14872 gene locus_tag LOCUS_10960 14198 14872 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767460.1 protein_id gnl|my_center|LOCUS_10960 14967 15803 gene locus_tag LOCUS_10970 14967 15803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence050 21 1469 gene locus_tag LOCUS_10980 21 1469 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787371.1 protein_id gnl|my_center|LOCUS_10980 1638 2225 gene locus_tag LOCUS_10990 1638 2225 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966111.1 protein_id gnl|my_center|LOCUS_10990 2342 3100 gene locus_tag LOCUS_11000 2342 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 3105 4394 gene locus_tag LOCUS_11010 3105 4394 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_11010 10303 4478 gene locus_tag LOCUS_11020 10303 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 11333 10506 gene locus_tag LOCUS_11030 gene cysE 11333 10506 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704210.1 protein_id gnl|my_center|LOCUS_11030 11933 11469 gene locus_tag LOCUS_11040 11933 11469 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615575.1 protein_id gnl|my_center|LOCUS_11040 13238 12060 gene locus_tag LOCUS_11050 13238 12060 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123043.1 protein_id gnl|my_center|LOCUS_11050 14030 13245 gene locus_tag LOCUS_11060 14030 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 15114 14143 gene locus_tag LOCUS_11070 15114 14143 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 protein_id gnl|my_center|LOCUS_11070 15930 15151 gene locus_tag LOCUS_11080 15930 15151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 16439 15945 gene locus_tag LOCUS_11090 16439 15945 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083121.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence051 132 614 gene locus_tag LOCUS_11100 132 614 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980098.1 protein_id gnl|my_center|LOCUS_11100 1807 674 gene locus_tag LOCUS_11110 1807 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 2155 3402 gene locus_tag LOCUS_11120 gene kbl 2155 3402 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213823.1 protein_id gnl|my_center|LOCUS_11120 3438 6233 gene locus_tag LOCUS_11130 3438 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 6230 7000 gene locus_tag LOCUS_11140 6230 7000 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528736.1 protein_id gnl|my_center|LOCUS_11140 7245 9992 gene locus_tag LOCUS_11150 7245 9992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 10078 10656 gene locus_tag LOCUS_11160 10078 10656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 10964 11614 gene locus_tag LOCUS_11170 10964 11614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 11657 11731 gene locus_tag LOCUS_t00190 11657 11731 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 12167 11991 gene locus_tag LOCUS_11180 12167 11991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 13060 12899 gene locus_tag LOCUS_11190 13060 12899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 13812 13276 gene locus_tag LOCUS_11200 13812 13276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 14381 13941 gene locus_tag LOCUS_11210 14381 13941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 14561 14636 gene locus_tag LOCUS_t00200 14561 14636 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 14723 14950 gene locus_tag LOCUS_11220 gene thiS 14723 14950 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140405.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence052 1390 641 gene locus_tag LOCUS_11230 1390 641 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_11230 2564 1632 gene locus_tag LOCUS_11240 2564 1632 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787404.1 protein_id gnl|my_center|LOCUS_11240 4458 2821 gene locus_tag LOCUS_11250 4458 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 5166 4462 gene locus_tag LOCUS_11260 5166 4462 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461981.1 protein_id gnl|my_center|LOCUS_11260 5661 5290 gene locus_tag LOCUS_11270 5661 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 6713 5718 gene locus_tag LOCUS_11280 gene hemB 6713 5718 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124398.1 protein_id gnl|my_center|LOCUS_11280 8392 6770 gene locus_tag LOCUS_11290 8392 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 8562 8870 gene locus_tag LOCUS_11300 8562 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 8998 10890 gene locus_tag LOCUS_11310 gene thrS 8998 10890 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228977.1 protein_id gnl|my_center|LOCUS_11310 10996 11568 gene locus_tag LOCUS_11320 gene infC 10996 11568 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_11320 11633 12064 gene locus_tag LOCUS_11330 11633 12064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 13319 12096 gene locus_tag LOCUS_11340 13319 12096 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793345.1 protein_id gnl|my_center|LOCUS_11340 14499 13324 gene locus_tag LOCUS_11350 14499 13324 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546435.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence053 5153 4662 gene locus_tag LOCUS_11360 5153 4662 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_11360 5346 6797 gene locus_tag LOCUS_11370 gene guaB 5346 6797 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881325.1 protein_id gnl|my_center|LOCUS_11370 6810 8333 gene locus_tag LOCUS_11380 gene guaA 6810 8333 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_11380 8606 9412 gene locus_tag LOCUS_11390 8606 9412 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262778.1 protein_id gnl|my_center|LOCUS_11390 9482 10084 gene locus_tag LOCUS_11400 9482 10084 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993359.1 protein_id gnl|my_center|LOCUS_11400 10081 10728 gene locus_tag LOCUS_11410 10081 10728 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478804.1 protein_id gnl|my_center|LOCUS_11410 10784 11770 gene locus_tag LOCUS_11420 10784 11770 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969168.1 protein_id gnl|my_center|LOCUS_11420 11946 11767 gene locus_tag LOCUS_11430 11946 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 11997 12488 gene locus_tag LOCUS_11440 11997 12488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 13696 12629 gene locus_tag LOCUS_11450 gene aroG 13696 12629 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109233.1 protein_id gnl|my_center|LOCUS_11450 14481 13855 gene locus_tag LOCUS_11460 14481 13855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 15141 14662 gene locus_tag LOCUS_11470 15141 14662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 15425 15183 gene locus_tag LOCUS_11480 15425 15183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence054 <1 788 gene locus_tag LOCUS_11490 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965357.1:D-alanyl-D-alanine carboxypeptidase family protein 847 1968 gene locus_tag LOCUS_11500 gene ychF 847 1968 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_11500 2044 3129 gene locus_tag LOCUS_11510 gene gcvT 2044 3129 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_11510 3200 3580 gene locus_tag LOCUS_11520 gene gcvH 3200 3580 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355634.1 protein_id gnl|my_center|LOCUS_11520 3678 6524 gene locus_tag LOCUS_11530 gene gcvP 3678 6524 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089349.1 protein_id gnl|my_center|LOCUS_11530 7411 6662 gene locus_tag LOCUS_11540 7411 6662 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108268.1 protein_id gnl|my_center|LOCUS_11540 8115 7486 gene locus_tag LOCUS_11550 8115 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 10284 8125 gene locus_tag LOCUS_11560 10284 8125 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119288.1 protein_id gnl|my_center|LOCUS_11560 10496 10771 gene locus_tag LOCUS_11570 10496 10771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 10671 10877 gene locus_tag LOCUS_11580 10671 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 12761 10947 gene locus_tag LOCUS_11590 12761 10947 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940566.1 protein_id gnl|my_center|LOCUS_11590 12983 13759 gene locus_tag LOCUS_11600 12983 13759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 13771 15309 gene locus_tag LOCUS_11610 13771 15309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence055 1761 925 gene locus_tag LOCUS_11620 gene hisG 1761 925 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_11620 3149 1866 gene locus_tag LOCUS_11630 3149 1866 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_11630 3232 3969 gene locus_tag LOCUS_11640 3232 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 4051 4785 gene locus_tag LOCUS_11650 4051 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 5840 4782 gene locus_tag LOCUS_11660 gene lgt 5840 4782 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388399.1 protein_id gnl|my_center|LOCUS_11660 6931 5852 gene locus_tag LOCUS_11670 6931 5852 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583847.1 protein_id gnl|my_center|LOCUS_11670 7126 7839 gene locus_tag LOCUS_11680 7126 7839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 7945 9729 gene locus_tag LOCUS_11690 7945 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 9759 10715 gene locus_tag LOCUS_11700 9759 10715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 10749 11762 gene locus_tag LOCUS_11710 10749 11762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 11834 14563 gene locus_tag LOCUS_11720 11834 14563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 14658 15263 gene locus_tag LOCUS_11730 gene coaE 14658 15263 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387006.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence056 96 533 gene locus_tag LOCUS_11740 96 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1675 665 gene locus_tag LOCUS_11750 1675 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1908 2189 gene locus_tag LOCUS_11760 1908 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 3954 2164 gene locus_tag LOCUS_11770 3954 2164 CDS product ClcB-like voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192418.1 protein_id gnl|my_center|LOCUS_11770 4394 3951 gene locus_tag LOCUS_11780 4394 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 4612 5151 gene locus_tag LOCUS_11790 4612 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 5250 5870 gene locus_tag LOCUS_11800 5250 5870 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922130.1 protein_id gnl|my_center|LOCUS_11800 8917 6008 gene locus_tag LOCUS_11810 8917 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 9406 9104 gene locus_tag LOCUS_11820 9406 9104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 9874 9491 gene locus_tag LOCUS_11830 9874 9491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 12016 10577 gene locus_tag LOCUS_11840 12016 10577 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_11840 15273 12058 gene locus_tag LOCUS_11850 15273 12058 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532875.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence057 1382 1185 gene locus_tag LOCUS_11860 1382 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2443 1556 gene locus_tag LOCUS_11870 gene sucD 2443 1556 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941720.1 protein_id gnl|my_center|LOCUS_11870 3646 2465 gene locus_tag LOCUS_11880 gene sucC 3646 2465 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 protein_id gnl|my_center|LOCUS_11880 3849 5147 gene locus_tag LOCUS_11890 gene hisD 3849 5147 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_11890 5169 5813 gene locus_tag LOCUS_11900 gene psrA 5169 5813 CDS product transcriptional regulator PsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403692.1 protein_id gnl|my_center|LOCUS_11900 5837 6733 gene locus_tag LOCUS_11910 5837 6733 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_11910 6960 8627 gene locus_tag LOCUS_11920 6960 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 8706 10298 gene locus_tag LOCUS_11930 8706 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 10988 10662 gene locus_tag LOCUS_11940 10988 10662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 12494 11130 gene locus_tag LOCUS_11950 gene xseA 12494 11130 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_11950 14660 12498 gene locus_tag LOCUS_11960 14660 12498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence058 264 1262 gene locus_tag LOCUS_11970 264 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 2281 1355 gene locus_tag LOCUS_11980 2281 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 2491 3627 gene locus_tag LOCUS_11990 gene thiH 2491 3627 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260917.1 protein_id gnl|my_center|LOCUS_11990 3735 5621 gene locus_tag LOCUS_12000 3735 5621 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_12000 6842 5685 gene locus_tag LOCUS_12010 6842 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 7068 9422 gene locus_tag LOCUS_12020 7068 9422 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776819.1 protein_id gnl|my_center|LOCUS_12020 11064 9691 gene locus_tag LOCUS_12030 11064 9691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 11608 11081 gene locus_tag LOCUS_12040 11608 11081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 13288 11765 gene locus_tag LOCUS_12050 13288 11765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 14330 13518 gene locus_tag LOCUS_12060 14330 13518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12060 14754 14278 gene locus_tag LOCUS_12070 14754 14278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence059 1642 746 gene locus_tag LOCUS_12080 1642 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 2750 1665 gene locus_tag LOCUS_12090 gene aroC 2750 1665 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_12090 3151 2882 gene locus_tag LOCUS_12100 3151 2882 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476580.1 protein_id gnl|my_center|LOCUS_12100 4511 3234 gene locus_tag LOCUS_12110 gene murA 4511 3234 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_12110 5612 5160 gene locus_tag LOCUS_12120 5612 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 5917 7224 gene locus_tag LOCUS_12130 gene aroA 5917 7224 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392845.1 protein_id gnl|my_center|LOCUS_12130 7590 7252 gene locus_tag LOCUS_12140 7590 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 8430 7597 gene locus_tag LOCUS_12150 8430 7597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 8498 9430 gene locus_tag LOCUS_12160 8498 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 9971 9726 gene locus_tag LOCUS_12170 9971 9726 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788894.1 protein_id gnl|my_center|LOCUS_12170 12166 10109 gene locus_tag LOCUS_12180 12166 10109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 12852 12163 gene locus_tag LOCUS_12190 12852 12163 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461981.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence060 1114 116 gene locus_tag LOCUS_12200 1114 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1506 1237 gene locus_tag LOCUS_12210 1506 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1673 2533 gene locus_tag LOCUS_12220 1673 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 3771 2965 gene locus_tag LOCUS_12230 3771 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 4953 3799 gene locus_tag LOCUS_12240 4953 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 5210 6241 gene locus_tag LOCUS_12250 gene rfaD 5210 6241 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391026.1 protein_id gnl|my_center|LOCUS_12250 6263 7237 gene locus_tag LOCUS_12260 6263 7237 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_12260 7234 8259 gene locus_tag LOCUS_12270 7234 8259 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383750.1 protein_id gnl|my_center|LOCUS_12270 8281 9264 gene locus_tag LOCUS_12280 8281 9264 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296671.1 protein_id gnl|my_center|LOCUS_12280 10093 9278 gene locus_tag LOCUS_12290 10093 9278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 10329 10105 gene locus_tag LOCUS_12300 10329 10105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 11275 10424 gene locus_tag LOCUS_12310 11275 10424 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363393.1 protein_id gnl|my_center|LOCUS_12310 11445 11663 gene locus_tag LOCUS_12320 11445 11663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 11787 12764 gene locus_tag LOCUS_12330 11787 12764 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_12330 12761 13495 gene locus_tag LOCUS_12340 12761 13495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence061 1880 957 gene locus_tag LOCUS_12350 1880 957 CDS product ELM1/GtrOC1 family putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207641.1 protein_id gnl|my_center|LOCUS_12350 1982 3043 gene locus_tag LOCUS_12360 gene queG 1982 3043 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397385.1 protein_id gnl|my_center|LOCUS_12360 3162 3539 gene locus_tag LOCUS_12370 gene rpsM 3162 3539 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808138.1 protein_id gnl|my_center|LOCUS_12370 3574 4125 gene locus_tag LOCUS_12380 3574 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 4158 4769 gene locus_tag LOCUS_12390 gene rpsD 4158 4769 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258257.1 protein_id gnl|my_center|LOCUS_12390 4898 5665 gene locus_tag LOCUS_12400 4898 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 5790 6716 gene locus_tag LOCUS_12410 5790 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 7077 7898 gene locus_tag LOCUS_12420 7077 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 8404 7886 gene locus_tag LOCUS_12430 8404 7886 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101942.1 protein_id gnl|my_center|LOCUS_12430 9822 8401 gene locus_tag LOCUS_12440 gene pyk 9822 8401 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834388.1 protein_id gnl|my_center|LOCUS_12440 9935 11179 gene locus_tag LOCUS_12450 9935 11179 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_12450 11789 11169 gene locus_tag LOCUS_12460 11789 11169 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425720.1 protein_id gnl|my_center|LOCUS_12460 12770 11943 gene locus_tag LOCUS_12470 12770 11943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 <14132 13162 gene locus_tag LOCUS_12480 <14132 13162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788141.1:replicative DNA helicase >Feature sequence062 427 1656 gene locus_tag LOCUS_12490 427 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1653 3971 gene locus_tag LOCUS_12500 1653 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 5024 4602 gene locus_tag LOCUS_12510 5024 4602 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016796.1 protein_id gnl|my_center|LOCUS_12510 6411 5164 gene locus_tag LOCUS_12520 gene icd 6411 5164 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479852.1 protein_id gnl|my_center|LOCUS_12520 7290 6598 gene locus_tag LOCUS_12530 7290 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 7589 7302 gene locus_tag LOCUS_12540 7589 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 8105 8710 gene locus_tag LOCUS_12550 8105 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 8722 9219 gene locus_tag LOCUS_12560 8722 9219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 9403 10773 gene locus_tag LOCUS_12570 9403 10773 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404676.1 protein_id gnl|my_center|LOCUS_12570 10770 11390 gene locus_tag LOCUS_12580 gene tmk 10770 11390 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039005.1 protein_id gnl|my_center|LOCUS_12580 12125 11433 gene locus_tag LOCUS_12590 gene queC 12125 11433 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061849.1 protein_id gnl|my_center|LOCUS_12590 12541 12134 gene locus_tag LOCUS_12600 gene queF 12541 12134 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938262.1 protein_id gnl|my_center|LOCUS_12600 <13953 12572 gene locus_tag LOCUS_12610 <13953 12572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057573.1:mechanosensitive ion channel >Feature sequence063 149 1528 gene locus_tag LOCUS_12620 149 1528 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_12620 1553 2587 gene locus_tag LOCUS_12630 gene cydB 1553 2587 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_12630 2654 5419 gene locus_tag LOCUS_12640 2654 5419 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338417.1 protein_id gnl|my_center|LOCUS_12640 5435 6562 gene locus_tag LOCUS_12650 gene odhB 5435 6562 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538105.1 protein_id gnl|my_center|LOCUS_12650 7001 6651 gene locus_tag LOCUS_12660 7001 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 7366 6959 gene locus_tag LOCUS_12670 7366 6959 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_12670 8808 7420 gene locus_tag LOCUS_12680 gene lpdA 8808 7420 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_12680 10274 8955 gene locus_tag LOCUS_12690 10274 8955 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 protein_id gnl|my_center|LOCUS_12690 10422 11024 gene locus_tag LOCUS_12700 10422 11024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 13568 11274 gene locus_tag LOCUS_12710 13568 11274 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767049.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence064 226 1653 gene locus_tag LOCUS_12720 gene lidL 226 1653 CDS product Dot/Icm type IV secretion system effector LidL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946906.1 protein_id gnl|my_center|LOCUS_12720 1711 2010 gene locus_tag LOCUS_12730 gene tatA 1711 2010 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977193.1 protein_id gnl|my_center|LOCUS_12730 2678 3991 gene locus_tag LOCUS_12740 2678 3991 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_12740 4163 4522 gene locus_tag LOCUS_12750 4163 4522 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760124.1 protein_id gnl|my_center|LOCUS_12750 4498 5304 gene locus_tag LOCUS_12760 4498 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 7094 5430 gene locus_tag LOCUS_12770 gene glgP 7094 5430 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_12770 7357 8394 gene locus_tag LOCUS_12780 gene tdh 7357 8394 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532321.1 protein_id gnl|my_center|LOCUS_12780 9110 8502 gene locus_tag LOCUS_12790 9110 8502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 9362 10612 gene locus_tag LOCUS_12800 9362 10612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 10671 11456 gene locus_tag LOCUS_12810 10671 11456 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941357.1 protein_id gnl|my_center|LOCUS_12810 12210 11602 gene locus_tag LOCUS_12820 12210 11602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 12821 12324 gene locus_tag LOCUS_12830 12821 12324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 13016 13090 gene locus_tag LOCUS_t00210 13016 13090 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13133 13208 gene locus_tag LOCUS_t00220 13133 13208 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence065 779 1402 gene locus_tag LOCUS_12840 779 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 2154 1501 gene locus_tag LOCUS_12850 gene rpe 2154 1501 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815384.1 protein_id gnl|my_center|LOCUS_12850 4751 2178 gene locus_tag LOCUS_12860 gene leuS 4751 2178 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_12860 4936 6621 gene locus_tag LOCUS_12870 4936 6621 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_12870 8119 7331 gene locus_tag LOCUS_12880 8119 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 8299 9501 gene locus_tag LOCUS_12890 gene nspC 8299 9501 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_12890 9507 11327 gene locus_tag LOCUS_12900 gene speA 9507 11327 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792905.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12900 11219 11452 gene locus_tag LOCUS_12910 11219 11452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12910 12591 11524 gene locus_tag LOCUS_12920 12591 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence066 <1 954 gene locus_tag LOCUS_12930 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103194.1:DNA-3-methyladenine glycosylase 967 1509 gene locus_tag LOCUS_12940 967 1509 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462102.1 protein_id gnl|my_center|LOCUS_12940 1728 1654 gene locus_tag LOCUS_t00230 1728 1654 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3000 1888 gene locus_tag LOCUS_12950 3000 1888 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937438.1 protein_id gnl|my_center|LOCUS_12950 4111 3005 gene locus_tag LOCUS_12960 4111 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 5871 4108 gene locus_tag LOCUS_12970 5871 4108 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812261.1 protein_id gnl|my_center|LOCUS_12970 6890 5868 gene locus_tag LOCUS_12980 6890 5868 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_12980 7023 9851 gene locus_tag LOCUS_12990 gene alaS 7023 9851 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_12990 9885 10709 gene locus_tag LOCUS_13000 gene pssA 9885 10709 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770492.1 protein_id gnl|my_center|LOCUS_13000 11504 10989 gene locus_tag LOCUS_13010 11504 10989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 11596 12408 gene locus_tag LOCUS_13020 gene folP 11596 12408 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707079.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence067 1453 647 gene locus_tag LOCUS_13030 1453 647 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203012.1 protein_id gnl|my_center|LOCUS_13030 2736 1492 gene locus_tag LOCUS_13040 2736 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203009.1 protein_id gnl|my_center|LOCUS_13040 3487 2813 gene locus_tag LOCUS_13050 3487 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 4806 3475 gene locus_tag LOCUS_13060 4806 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 5798 4812 gene locus_tag LOCUS_13070 5798 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203008.1 protein_id gnl|my_center|LOCUS_13070 6672 5812 gene locus_tag LOCUS_13080 6672 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203007.1 protein_id gnl|my_center|LOCUS_13080 6213 6131 gene locus_tag LOCUS_t00240 6213 6131 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 8173 6677 gene locus_tag LOCUS_13090 8173 6677 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203002.1 protein_id gnl|my_center|LOCUS_13090 8500 8294 gene locus_tag LOCUS_13100 8500 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 10630 8567 gene locus_tag LOCUS_13110 10630 8567 CDS product tyrosine-protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765281.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13110 11453 10656 gene locus_tag LOCUS_13120 11453 10656 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_13120 12011 11490 gene locus_tag LOCUS_13130 12011 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 12767 12692 gene locus_tag LOCUS_t00250 12767 12692 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 <13507 12869 gene locus_tag LOCUS_13140 <13507 12869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009895475.1:NUDIX hydrolase >Feature sequence068 566 3943 gene locus_tag LOCUS_13150 566 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 3967 5409 gene locus_tag LOCUS_13160 3967 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 5564 6481 gene locus_tag LOCUS_13170 5564 6481 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921630.1 protein_id gnl|my_center|LOCUS_13170 6497 7678 gene locus_tag LOCUS_13180 6497 7678 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_13180 8814 8203 gene locus_tag LOCUS_13190 8814 8203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 9811 8795 gene locus_tag LOCUS_13200 9811 8795 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694271.1 protein_id gnl|my_center|LOCUS_13200 9842 10492 gene locus_tag LOCUS_13210 9842 10492 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_13210 10577 11713 gene locus_tag LOCUS_13220 10577 11713 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103456.1 protein_id gnl|my_center|LOCUS_13220 12453 11761 gene locus_tag LOCUS_13230 12453 11761 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730633.1 protein_id gnl|my_center|LOCUS_13230 12955 12464 gene locus_tag LOCUS_13240 12955 12464 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_13240 13497 12952 gene locus_tag LOCUS_13250 13497 12952 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195790.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence069 440 1342 gene locus_tag LOCUS_13260 gene xerC 440 1342 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692390.1 protein_id gnl|my_center|LOCUS_13260 1357 1983 gene locus_tag LOCUS_13270 1357 1983 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406892.1 protein_id gnl|my_center|LOCUS_13270 2151 2393 gene locus_tag LOCUS_13280 gene rpsP 2151 2393 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813195.1 protein_id gnl|my_center|LOCUS_13280 3063 2533 gene locus_tag LOCUS_13290 gene aroK 3063 2533 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116987.1 protein_id gnl|my_center|LOCUS_13290 3306 4388 gene locus_tag LOCUS_13300 3306 4388 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557353.1 protein_id gnl|my_center|LOCUS_13300 4390 4788 gene locus_tag LOCUS_13310 4390 4788 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_13310 4908 5399 gene locus_tag LOCUS_13320 4908 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 5423 5614 gene locus_tag LOCUS_13330 gene rpmF 5423 5614 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638547.1 protein_id gnl|my_center|LOCUS_13330 5764 6813 gene locus_tag LOCUS_13340 gene plsX 5764 6813 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_13340 6820 8574 gene locus_tag LOCUS_13350 6820 8574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 8558 9043 gene locus_tag LOCUS_13360 8558 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 9124 9200 gene locus_tag LOCUS_t00260 9124 9200 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9474 9671 gene locus_tag LOCUS_13370 9474 9671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 10305 9679 gene locus_tag LOCUS_13380 10305 9679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 10800 10408 gene locus_tag LOCUS_13390 10800 10408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 11126 13261 gene locus_tag LOCUS_13400 11126 13261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence070 94 1182 gene locus_tag LOCUS_13410 94 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 3116 1242 gene locus_tag LOCUS_13420 3116 1242 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720836.1 protein_id gnl|my_center|LOCUS_13420 3248 4093 gene locus_tag LOCUS_13430 gene gluQRS 3248 4093 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_13430 4644 4150 gene locus_tag LOCUS_13440 4644 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 5081 4650 gene locus_tag LOCUS_13450 5081 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 6048 5122 gene locus_tag LOCUS_13460 6048 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 6783 6076 gene locus_tag LOCUS_13470 6783 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 7147 7941 gene locus_tag LOCUS_13480 7147 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 9030 8110 gene locus_tag LOCUS_13490 9030 8110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 9927 9256 gene locus_tag LOCUS_13500 9927 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 10092 10820 gene locus_tag LOCUS_13510 10092 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 10890 11912 gene locus_tag LOCUS_13520 10890 11912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence071 285 635 gene locus_tag LOCUS_13530 285 635 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_13530 1768 632 gene locus_tag LOCUS_13540 1768 632 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582733.1 protein_id gnl|my_center|LOCUS_13540 3189 1894 gene locus_tag LOCUS_13550 3189 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 4923 4036 gene locus_tag LOCUS_13560 gene xerD 4923 4036 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700300.1 protein_id gnl|my_center|LOCUS_13560 6038 4944 gene locus_tag LOCUS_13570 6038 4944 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857221.1 protein_id gnl|my_center|LOCUS_13570 6796 7350 gene locus_tag LOCUS_13580 6796 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 8483 7476 gene locus_tag LOCUS_13590 8483 7476 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_13590 9221 8529 gene locus_tag LOCUS_13600 9221 8529 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780363.1 protein_id gnl|my_center|LOCUS_13600 9437 10231 gene locus_tag LOCUS_13610 9437 10231 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529142.1 protein_id gnl|my_center|LOCUS_13610 10318 10818 gene locus_tag LOCUS_13620 10318 10818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 11065 11499 gene locus_tag LOCUS_13630 11065 11499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 13170 11806 gene locus_tag LOCUS_13640 13170 11806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13640 >Feature sequence072 318 1919 gene locus_tag LOCUS_13650 gene serA 318 1919 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_13650 2076 3125 gene locus_tag LOCUS_13660 2076 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 3257 3940 gene locus_tag LOCUS_13670 3257 3940 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761795.1 protein_id gnl|my_center|LOCUS_13670 6012 4021 gene locus_tag LOCUS_13680 6012 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 6819 6064 gene locus_tag LOCUS_13690 6819 6064 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904156.1 protein_id gnl|my_center|LOCUS_13690 8459 7242 gene locus_tag LOCUS_13700 8459 7242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 9086 10438 gene locus_tag LOCUS_13710 9086 10438 CDS product cation-efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939066.1 protein_id gnl|my_center|LOCUS_13710 10481 11215 gene locus_tag LOCUS_13720 10481 11215 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808764.1 protein_id gnl|my_center|LOCUS_13720 12970 11228 gene locus_tag LOCUS_13730 12970 11228 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940935.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence073 1 243 gene locus_tag LOCUS_13740 1 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 258 1397 gene locus_tag LOCUS_13750 258 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1420 2592 gene locus_tag LOCUS_13760 1420 2592 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202692.1 protein_id gnl|my_center|LOCUS_13760 2589 3572 gene locus_tag LOCUS_13770 2589 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 3589 4800 gene locus_tag LOCUS_13780 3589 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 4805 5938 gene locus_tag LOCUS_13790 4805 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 5935 7071 gene locus_tag LOCUS_13800 5935 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 7068 8249 gene locus_tag LOCUS_13810 7068 8249 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107731.1 protein_id gnl|my_center|LOCUS_13810 8272 9852 gene locus_tag LOCUS_13820 8272 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 9887 10426 gene locus_tag LOCUS_13830 9887 10426 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974186.1 protein_id gnl|my_center|LOCUS_13830 10430 11278 gene locus_tag LOCUS_13840 10430 11278 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_13840 11302 12306 gene locus_tag LOCUS_13850 11302 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence074 2023 611 gene locus_tag LOCUS_13860 2023 611 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_13860 2338 2078 gene locus_tag LOCUS_13870 2338 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 2680 2411 gene locus_tag LOCUS_13880 gene rpsN 2680 2411 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085703.1 protein_id gnl|my_center|LOCUS_13880 2996 3226 gene locus_tag LOCUS_13890 2996 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3199 3762 gene locus_tag LOCUS_13900 3199 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 3777 4031 gene locus_tag LOCUS_13910 3777 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 4046 4954 gene locus_tag LOCUS_13920 4046 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 5142 6434 gene locus_tag LOCUS_13930 5142 6434 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545761.1 protein_id gnl|my_center|LOCUS_13930 6534 8153 gene locus_tag LOCUS_13940 6534 8153 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427770.1 protein_id gnl|my_center|LOCUS_13940 8185 9423 gene locus_tag LOCUS_13950 gene rsmB 8185 9423 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_13950 9476 10240 gene locus_tag LOCUS_13960 gene tpiA 9476 10240 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_13960 10388 11071 gene locus_tag LOCUS_13970 10388 11071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 11200 11811 gene locus_tag LOCUS_13980 11200 11811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 11980 12717 gene locus_tag LOCUS_13990 11980 12717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence075 <1 1339 gene locus_tag LOCUS_14000 <1 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888294.1:M3 family metallopeptidase 1364 2686 gene locus_tag LOCUS_14010 1364 2686 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_14010 3232 4041 gene locus_tag LOCUS_14020 3232 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 4174 7881 gene locus_tag LOCUS_14030 4174 7881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 10976 8184 gene locus_tag LOCUS_14040 10976 8184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 12404 11277 gene locus_tag LOCUS_14050 12404 11277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 12716 12417 gene locus_tag LOCUS_14060 12716 12417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence076 <1 910 gene locus_tag LOCUS_14070 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003231519.1:glycoside hydrolase family 10 protein 1127 1771 gene locus_tag LOCUS_14080 1127 1771 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461598.1 protein_id gnl|my_center|LOCUS_14080 1922 3013 gene locus_tag LOCUS_14090 1922 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 3027 4592 gene locus_tag LOCUS_14100 gene murJ 3027 4592 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946821.1 protein_id gnl|my_center|LOCUS_14100 4764 5930 gene locus_tag LOCUS_14110 4764 5930 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_14110 10501 6089 gene locus_tag LOCUS_14120 10501 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence077 726 2081 gene locus_tag LOCUS_14130 gene gdhA 726 2081 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_14130 3586 2468 gene locus_tag LOCUS_14140 gene lpxB 3586 2468 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_14140 3697 4371 gene locus_tag LOCUS_14150 3697 4371 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943605.1 protein_id gnl|my_center|LOCUS_14150 4389 4865 gene locus_tag LOCUS_14160 4389 4865 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_14160 5221 4922 gene locus_tag LOCUS_14170 5221 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 5862 5563 gene locus_tag LOCUS_14180 5862 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 6575 6099 gene locus_tag LOCUS_14190 6575 6099 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883561.1 protein_id gnl|my_center|LOCUS_14190 6775 6849 gene locus_tag LOCUS_t00270 6775 6849 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8146 7265 gene locus_tag LOCUS_14200 8146 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 8420 8139 gene locus_tag LOCUS_14210 8420 8139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 10051 8417 gene locus_tag LOCUS_14220 10051 8417 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939009.1 protein_id gnl|my_center|LOCUS_14220 10275 10060 gene locus_tag LOCUS_14230 10275 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 10556 11176 gene locus_tag LOCUS_14240 10556 11176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179259.1 protein_id gnl|my_center|LOCUS_14240 11227 11520 gene locus_tag LOCUS_14250 11227 11520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 11517 11780 gene locus_tag LOCUS_14260 11517 11780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 11883 12450 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcactccttgcggagtgcgac >Feature sequence078 2788 1493 gene locus_tag LOCUS_14270 2788 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 4963 2876 gene locus_tag LOCUS_14280 gene ppk1 4963 2876 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922240.1 protein_id gnl|my_center|LOCUS_14280 6555 4999 gene locus_tag LOCUS_14290 6555 4999 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_14290 7794 6721 gene locus_tag LOCUS_14300 7794 6721 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765274.1 protein_id gnl|my_center|LOCUS_14300 8610 7813 gene locus_tag LOCUS_14310 gene map 8610 7813 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943464.1 protein_id gnl|my_center|LOCUS_14310 9274 8624 gene locus_tag LOCUS_14320 9274 8624 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869908.1 protein_id gnl|my_center|LOCUS_14320 10785 9307 gene locus_tag LOCUS_14330 gene secY 10785 9307 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_14330 11408 10950 gene locus_tag LOCUS_14340 gene rplO 11408 10950 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810128.1 protein_id gnl|my_center|LOCUS_14340 11956 11471 gene locus_tag LOCUS_14350 gene rpsE 11956 11471 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence079 <1 676 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcacccgtgagggtgcgac 3021 1168 gene locus_tag LOCUS_14360 gene ilvB 3021 1168 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327661.1 protein_id gnl|my_center|LOCUS_14360 3781 3173 gene locus_tag LOCUS_14370 3781 3173 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706953.1 protein_id gnl|my_center|LOCUS_14370 3943 4206 gene locus_tag LOCUS_14380 3943 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 4286 4507 gene locus_tag LOCUS_14390 4286 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 5883 4669 gene locus_tag LOCUS_14400 5883 4669 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056884.1 protein_id gnl|my_center|LOCUS_14400 5951 6997 gene locus_tag LOCUS_14410 gene dusC 5951 6997 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706065.1 protein_id gnl|my_center|LOCUS_14410 7010 8149 gene locus_tag LOCUS_14420 7010 8149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 8146 9003 gene locus_tag LOCUS_14430 8146 9003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 9502 9050 gene locus_tag LOCUS_14440 9502 9050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 10391 9654 gene locus_tag LOCUS_14450 10391 9654 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582796.1 protein_id gnl|my_center|LOCUS_14450 11378 10503 gene locus_tag LOCUS_14460 gene folD 11378 10503 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_14460 12079 11351 gene locus_tag LOCUS_14470 12079 11351 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053541.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence080 3930 2314 gene locus_tag LOCUS_14480 3930 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 5132 3975 gene locus_tag LOCUS_14490 gene pheA 5132 3975 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_14490 5292 6053 gene locus_tag LOCUS_14500 5292 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 6451 6984 gene locus_tag LOCUS_14510 6451 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 8018 7047 gene locus_tag LOCUS_14520 8018 7047 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_14520 8811 8035 gene locus_tag LOCUS_14530 8811 8035 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_14530 10879 8825 gene locus_tag LOCUS_14540 10879 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence081 546 457 gene locus_tag LOCUS_t00280 546 457 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2384 903 gene locus_tag LOCUS_14550 2384 903 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660080.1 protein_id gnl|my_center|LOCUS_14550 2509 3543 gene locus_tag LOCUS_14560 gene ruvB 2509 3543 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_14560 3665 4684 gene locus_tag LOCUS_14570 3665 4684 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_14570 4720 5850 gene locus_tag LOCUS_14580 4720 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 6469 6029 gene locus_tag LOCUS_14590 6469 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 8838 7786 gene locus_tag LOCUS_14600 8838 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 9771 10253 gene locus_tag LOCUS_14610 9771 10253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 10314 11261 gene locus_tag LOCUS_14620 10314 11261 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201896.1 protein_id gnl|my_center|LOCUS_14620 11566 11345 gene locus_tag LOCUS_14630 11566 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence082 796 251 gene locus_tag LOCUS_14640 796 251 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704720.1 protein_id gnl|my_center|LOCUS_14640 1093 1977 gene locus_tag LOCUS_14650 1093 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 2001 2831 gene locus_tag LOCUS_14660 2001 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 3124 3783 gene locus_tag LOCUS_14670 3124 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 3871 4800 gene locus_tag LOCUS_14680 gene trxB 3871 4800 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231058.1 protein_id gnl|my_center|LOCUS_14680 4870 6249 gene locus_tag LOCUS_14690 4870 6249 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_14690 6351 7040 gene locus_tag LOCUS_14700 6351 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 7196 8206 gene locus_tag LOCUS_14710 7196 8206 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940307.1 protein_id gnl|my_center|LOCUS_14710 8244 9140 gene locus_tag LOCUS_14720 8244 9140 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_14720 9156 10019 gene locus_tag LOCUS_14730 gene nadC 9156 10019 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_14730 10039 10677 gene locus_tag LOCUS_14740 gene pdxH 10039 10677 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210959.1 protein_id gnl|my_center|LOCUS_14740 10674 11510 gene locus_tag LOCUS_14750 10674 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence083 224 2356 gene locus_tag LOCUS_14760 224 2356 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_14760 2390 3412 gene locus_tag LOCUS_14770 2390 3412 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719999.1 protein_id gnl|my_center|LOCUS_14770 3409 4548 gene locus_tag LOCUS_14780 3409 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 4523 7252 gene locus_tag LOCUS_14790 gene ileS 4523 7252 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081557.1 protein_id gnl|my_center|LOCUS_14790 7277 8050 gene locus_tag LOCUS_14800 7277 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 8058 8720 gene locus_tag LOCUS_14810 8058 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 8731 9213 gene locus_tag LOCUS_14820 8731 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 9216 10442 gene locus_tag LOCUS_14830 9216 10442 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707892.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence084 2905 1346 gene locus_tag LOCUS_14840 2905 1346 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107733.1 protein_id gnl|my_center|LOCUS_14840 3176 4363 gene locus_tag LOCUS_14850 3176 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 5512 5877 gene locus_tag LOCUS_14860 5512 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 5940 6542 gene locus_tag LOCUS_14870 5940 6542 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937654.1 protein_id gnl|my_center|LOCUS_14870 6550 7395 gene locus_tag LOCUS_14880 gene miaA 6550 7395 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265761.1 protein_id gnl|my_center|LOCUS_14880 7607 8596 gene locus_tag LOCUS_14890 7607 8596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 8615 9442 gene locus_tag LOCUS_14900 8615 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 9697 10737 gene locus_tag LOCUS_14910 gene mnmA 9697 10737 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268273.1 protein_id gnl|my_center|LOCUS_14910 10734 12083 gene locus_tag LOCUS_14920 gene mnmE 10734 12083 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944074.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence085 18 1139 gene locus_tag LOCUS_14930 18 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1182 2753 gene locus_tag LOCUS_14940 1182 2753 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_14940 2759 4339 gene locus_tag LOCUS_14950 2759 4339 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944579.1 protein_id gnl|my_center|LOCUS_14950 4376 5539 gene locus_tag LOCUS_14960 4376 5539 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110716881.1 protein_id gnl|my_center|LOCUS_14960 6727 5567 gene locus_tag LOCUS_14970 6727 5567 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704523.1 protein_id gnl|my_center|LOCUS_14970 7790 7260 gene locus_tag LOCUS_14980 7790 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 8518 7874 gene locus_tag LOCUS_14990 8518 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence086 2729 462 gene locus_tag LOCUS_15000 gene katE 2729 462 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077853.1 protein_id gnl|my_center|LOCUS_15000 2909 3544 gene locus_tag LOCUS_15010 2909 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 3785 4234 gene locus_tag LOCUS_15020 3785 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 4249 5238 gene locus_tag LOCUS_15030 4249 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 5398 8979 gene locus_tag LOCUS_15040 5398 8979 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121781.1 protein_id gnl|my_center|LOCUS_15040 9491 10645 gene locus_tag LOCUS_15050 9491 10645 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993669.1 protein_id gnl|my_center|LOCUS_15050 11044 11921 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcactctcacgagtgcgtggattgaaac >Feature sequence087 241 1020 gene locus_tag LOCUS_15060 241 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1159 2238 gene locus_tag LOCUS_15070 1159 2238 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405202.1 protein_id gnl|my_center|LOCUS_15070 3246 2776 gene locus_tag LOCUS_15080 3246 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 5996 3261 gene locus_tag LOCUS_15090 5996 3261 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109377.1 protein_id gnl|my_center|LOCUS_15090 6272 7303 gene locus_tag LOCUS_15100 6272 7303 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_15100 7500 9095 gene locus_tag LOCUS_15110 gene rng 7500 9095 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_15110 9158 10279 gene locus_tag LOCUS_15120 9158 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence088 <1 731 gene locus_tag LOCUS_15130 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005647567.1:LPS export ABC transporter ATP-binding protein 752 1636 gene locus_tag LOCUS_15140 752 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1665 3047 gene locus_tag LOCUS_15150 gene mpl 1665 3047 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_15150 3072 4391 gene locus_tag LOCUS_15160 3072 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 4475 6484 gene locus_tag LOCUS_15170 4475 6484 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080037.1 protein_id gnl|my_center|LOCUS_15170 7496 6531 gene locus_tag LOCUS_15180 7496 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 8026 11163 gene locus_tag LOCUS_15190 8026 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence089 1112 3097 gene locus_tag LOCUS_15200 1112 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 4453 3098 gene locus_tag LOCUS_15210 4453 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 5298 4450 gene locus_tag LOCUS_15220 5298 4450 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017014.1 protein_id gnl|my_center|LOCUS_15220 6382 5801 gene locus_tag LOCUS_15230 6382 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 7342 6494 gene locus_tag LOCUS_15240 7342 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 7499 8242 gene locus_tag LOCUS_15250 7499 8242 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 protein_id gnl|my_center|LOCUS_15250 8337 9722 gene locus_tag LOCUS_15260 8337 9722 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775783.1 protein_id gnl|my_center|LOCUS_15260 9709 10263 gene locus_tag LOCUS_15270 9709 10263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 10250 10612 gene locus_tag LOCUS_15280 10250 10612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 11137 10628 gene locus_tag LOCUS_15290 gene coaD 11137 10628 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692360.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence090 435 2282 gene locus_tag LOCUS_15300 gene greA 435 2282 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883379.1 protein_id gnl|my_center|LOCUS_15300 2705 3469 gene locus_tag LOCUS_15310 2705 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 3549 6416 gene locus_tag LOCUS_15320 3549 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 6442 8022 gene locus_tag LOCUS_15330 6442 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 10244 8325 gene locus_tag LOCUS_15340 gene tkt 10244 8325 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245397.1 protein_id gnl|my_center|LOCUS_15340 10125 10343 gene locus_tag LOCUS_15350 10125 10343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 11192 10530 gene locus_tag LOCUS_15360 11192 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence091 2649 721 gene locus_tag LOCUS_15370 2649 721 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 protein_id gnl|my_center|LOCUS_15370 3433 2783 gene locus_tag LOCUS_15380 3433 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 4329 3886 gene locus_tag LOCUS_15390 4329 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 4636 4403 gene locus_tag LOCUS_15400 4636 4403 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_15400 4773 6656 gene locus_tag LOCUS_15410 gene lnt 4773 6656 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210341.1 protein_id gnl|my_center|LOCUS_15410 7372 6629 gene locus_tag LOCUS_15420 7372 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 8285 7383 gene locus_tag LOCUS_15430 8285 7383 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933711.1 protein_id gnl|my_center|LOCUS_15430 8499 9758 gene locus_tag LOCUS_15440 8499 9758 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_15440 10973 10029 gene locus_tag LOCUS_15450 10973 10029 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403526.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence092 <1 602 gene locus_tag LOCUS_15460 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583501.1:ATP-dependent DNA helicase RecG note possible pseudo, internal stop codon 615 1829 gene locus_tag LOCUS_15470 615 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15470 1968 2411 gene locus_tag LOCUS_15480 1968 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 5380 2516 gene locus_tag LOCUS_15490 5380 2516 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228900.1 protein_id gnl|my_center|LOCUS_15490 6141 5563 gene locus_tag LOCUS_15500 6141 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 6948 6244 gene locus_tag LOCUS_15510 6948 6244 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228901.1 protein_id gnl|my_center|LOCUS_15510 8186 6981 gene locus_tag LOCUS_15520 8186 6981 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_15520 8593 8979 gene locus_tag LOCUS_15530 8593 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 10372 9260 gene locus_tag LOCUS_15540 gene aroB 10372 9260 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382321.1 protein_id gnl|my_center|LOCUS_15540 11011 10448 gene locus_tag LOCUS_15550 11011 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence093 <1 909 gene locus_tag LOCUS_15560 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679701.1:ATP-binding protein 906 2309 gene locus_tag LOCUS_15570 906 2309 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_15570 2306 4189 gene locus_tag LOCUS_15580 2306 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 4198 4458 gene locus_tag LOCUS_15590 4198 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 4439 6325 gene locus_tag LOCUS_15600 gene dxs 4439 6325 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393020.1 protein_id gnl|my_center|LOCUS_15600 6333 7106 gene locus_tag LOCUS_15610 6333 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 7106 7642 gene locus_tag LOCUS_15620 7106 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 7794 8885 gene locus_tag LOCUS_15630 7794 8885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 8939 10342 gene locus_tag LOCUS_15640 gene der 8939 10342 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016201.1 protein_id gnl|my_center|LOCUS_15640 10361 11338 gene locus_tag LOCUS_15650 10361 11338 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence094 163 792 gene locus_tag LOCUS_15660 163 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 825 3320 gene locus_tag LOCUS_15670 825 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 3539 5740 gene locus_tag LOCUS_15680 3539 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 6121 7005 gene locus_tag LOCUS_15690 gene atpB 6121 7005 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775579.1 protein_id gnl|my_center|LOCUS_15690 7106 7309 gene locus_tag LOCUS_15700 7106 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 7412 7939 gene locus_tag LOCUS_15710 7412 7939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 7948 8355 gene locus_tag LOCUS_15720 7948 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 8374 9906 gene locus_tag LOCUS_15730 gene atpA 8374 9906 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599658.1 protein_id gnl|my_center|LOCUS_15730 9928 10800 gene locus_tag LOCUS_15740 gene atpG 9928 10800 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403678.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence095 2825 4987 gene locus_tag LOCUS_15750 2825 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 5066 5773 gene locus_tag LOCUS_15760 5066 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 7398 5920 gene locus_tag LOCUS_15770 7398 5920 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704555.1 protein_id gnl|my_center|LOCUS_15770 7996 7385 gene locus_tag LOCUS_15780 7996 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 8764 8078 gene locus_tag LOCUS_15790 8764 8078 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941996.1 protein_id gnl|my_center|LOCUS_15790 10770 9130 gene locus_tag LOCUS_15800 10770 9130 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203204.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence096 1593 1438 gene locus_tag LOCUS_15810 1593 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2435 1716 gene locus_tag LOCUS_15820 gene trmD 2435 1716 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_15820 3455 2454 gene locus_tag LOCUS_15830 gene prfB 3455 2454 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096807630.1 protein_id gnl|my_center|LOCUS_15830 4270 3869 gene locus_tag LOCUS_15840 4270 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 6096 4408 gene locus_tag LOCUS_15850 gene rpsA 6096 4408 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872374.1 protein_id gnl|my_center|LOCUS_15850 6348 6980 gene locus_tag LOCUS_15860 6348 6980 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760532.1 protein_id gnl|my_center|LOCUS_15860 7526 7059 gene locus_tag LOCUS_15870 7526 7059 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965933.1 protein_id gnl|my_center|LOCUS_15870 7631 7707 gene locus_tag LOCUS_t00290 7631 7707 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9009 8500 gene locus_tag LOCUS_15880 9009 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 10637 9006 gene locus_tag LOCUS_15890 10637 9006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence097 1296 1487 gene locus_tag LOCUS_15900 1296 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1532 2074 gene locus_tag LOCUS_15910 1532 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2188 2571 gene locus_tag LOCUS_15920 2188 2571 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722102.1 protein_id gnl|my_center|LOCUS_15920 3798 2659 gene locus_tag LOCUS_15930 3798 2659 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486733.1 protein_id gnl|my_center|LOCUS_15930 4816 4139 gene locus_tag LOCUS_15940 gene tsaA 4816 4139 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_15940 6136 4856 gene locus_tag LOCUS_15950 6136 4856 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_15950 7063 6137 gene locus_tag LOCUS_15960 7063 6137 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545982.1 protein_id gnl|my_center|LOCUS_15960 7628 7092 gene locus_tag LOCUS_15970 gene pyrR 7628 7092 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_15970 8060 7650 gene locus_tag LOCUS_15980 gene purE 8060 7650 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763604.1 protein_id gnl|my_center|LOCUS_15980 8947 8228 gene locus_tag LOCUS_15990 8947 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 9498 8944 gene locus_tag LOCUS_16000 9498 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 10217 9585 gene locus_tag LOCUS_16010 10217 9585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 >Feature sequence098 428 3259 gene locus_tag LOCUS_16020 428 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 3568 5250 gene locus_tag LOCUS_16030 gene recJ 3568 5250 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_16030 5598 6758 gene locus_tag LOCUS_16040 5598 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 7044 7226 gene locus_tag LOCUS_16050 7044 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 7227 8126 gene locus_tag LOCUS_16060 7227 8126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 8389 8314 gene locus_tag LOCUS_t00300 8389 8314 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10005 8500 gene locus_tag LOCUS_16070 10005 8500 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867488.1 protein_id gnl|my_center|LOCUS_16070 10673 10002 gene locus_tag LOCUS_16080 gene ubiE 10673 10002 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_16080 10805 10731 gene locus_tag LOCUS_t00310 10805 10731 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence099 1154 309 gene locus_tag LOCUS_16090 1154 309 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113172.1 protein_id gnl|my_center|LOCUS_16090 2017 1595 gene locus_tag LOCUS_16100 2017 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 2210 5746 gene locus_tag LOCUS_16110 2210 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 5973 6539 gene locus_tag LOCUS_16120 5973 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 6804 7682 gene locus_tag LOCUS_16130 6804 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 7916 8311 gene locus_tag LOCUS_16140 7916 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 8528 8289 gene locus_tag LOCUS_16150 8528 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 8541 9419 gene locus_tag LOCUS_16160 8541 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 10015 9548 gene locus_tag LOCUS_16170 10015 9548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 10545 10063 gene locus_tag LOCUS_16180 10545 10063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence100 2775 415 gene locus_tag LOCUS_16190 gene rnr 2775 415 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_16190 5334 2815 gene locus_tag LOCUS_16200 5334 2815 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 protein_id gnl|my_center|LOCUS_16200 6563 5349 gene locus_tag LOCUS_16210 6563 5349 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_16210 7792 6776 gene locus_tag LOCUS_16220 7792 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 7958 9379 gene locus_tag LOCUS_16230 7958 9379 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_16230 10050 9607 gene locus_tag LOCUS_16240 10050 9607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence101 224 541 gene locus_tag LOCUS_16250 gene nuoK 224 541 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_16250 565 2397 gene locus_tag LOCUS_16260 gene nuoL 565 2397 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_16260 2419 3843 gene locus_tag LOCUS_16270 2419 3843 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813230.1 protein_id gnl|my_center|LOCUS_16270 3891 5273 gene locus_tag LOCUS_16280 gene nuoN 3891 5273 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087671.1 protein_id gnl|my_center|LOCUS_16280 5651 6541 gene locus_tag LOCUS_16290 5651 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 6544 6696 gene locus_tag LOCUS_16300 6544 6696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 7541 7068 gene locus_tag LOCUS_16310 7541 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 8091 7546 gene locus_tag LOCUS_16320 gene sufT 8091 7546 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_16320 8458 10197 gene locus_tag LOCUS_16330 8458 10197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence102 1497 742 gene locus_tag LOCUS_16340 gene larB 1497 742 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100884.1 protein_id gnl|my_center|LOCUS_16340 2309 1494 gene locus_tag LOCUS_16350 gene larE 2309 1494 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357133.1 protein_id gnl|my_center|LOCUS_16350 3492 2281 gene locus_tag LOCUS_16360 gene larC 3492 2281 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964092.1 protein_id gnl|my_center|LOCUS_16360 3703 4713 gene locus_tag LOCUS_16370 3703 4713 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344609.1 protein_id gnl|my_center|LOCUS_16370 5681 4968 gene locus_tag LOCUS_16380 5681 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 6148 6705 gene locus_tag LOCUS_16390 6148 6705 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_16390 7867 6812 gene locus_tag LOCUS_16400 gene rsgA 7867 6812 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107648.1 protein_id gnl|my_center|LOCUS_16400 8643 7864 gene locus_tag LOCUS_16410 8643 7864 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202509.1 protein_id gnl|my_center|LOCUS_16410 <10261 9131 gene locus_tag LOCUS_16420 <10261 9131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922508.1:POT family MFS transporter >Feature sequence103 2712 1798 gene locus_tag LOCUS_16430 gene prmC 2712 1798 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455843.1 protein_id gnl|my_center|LOCUS_16430 3804 2728 gene locus_tag LOCUS_16440 gene prfA 3804 2728 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940174.1 protein_id gnl|my_center|LOCUS_16440 4119 4044 gene locus_tag LOCUS_t00320 4119 4044 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5617 4208 gene locus_tag LOCUS_16450 5617 4208 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307517.1 protein_id gnl|my_center|LOCUS_16450 5966 6376 gene locus_tag LOCUS_16460 5966 6376 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890794.1 protein_id gnl|my_center|LOCUS_16460 7448 6507 gene locus_tag LOCUS_16470 gene glsA 7448 6507 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883028.1 protein_id gnl|my_center|LOCUS_16470 8925 7441 gene locus_tag LOCUS_16480 8925 7441 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 protein_id gnl|my_center|LOCUS_16480 9739 9290 gene locus_tag LOCUS_16490 9739 9290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 9853 10017 gene locus_tag LOCUS_16500 9853 10017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence104 3256 3951 gene locus_tag LOCUS_16510 3256 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 4035 4415 gene locus_tag LOCUS_16520 4035 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 6276 4960 gene locus_tag LOCUS_16530 6276 4960 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901032.1 protein_id gnl|my_center|LOCUS_16530 7719 6355 gene locus_tag LOCUS_16540 7719 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16540 8393 7716 gene locus_tag LOCUS_16550 8393 7716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546598.1 protein_id gnl|my_center|LOCUS_16550 9884 8487 gene locus_tag LOCUS_16560 9884 8487 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107657.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence105 1460 1167 gene locus_tag LOCUS_16570 gene gatC 1460 1167 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879817.1 protein_id gnl|my_center|LOCUS_16570 1836 1504 gene locus_tag LOCUS_16580 1836 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2450 1833 gene locus_tag LOCUS_16590 2450 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 2783 3583 gene locus_tag LOCUS_16600 2783 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 3580 4794 gene locus_tag LOCUS_16610 3580 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 4809 6329 gene locus_tag LOCUS_16620 4809 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 6365 7210 gene locus_tag LOCUS_16630 6365 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 8346 7303 gene locus_tag LOCUS_16640 8346 7303 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017578.1 protein_id gnl|my_center|LOCUS_16640 9099 8359 gene locus_tag LOCUS_16650 9099 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 9240 9112 gene locus_tag LOCUS_16660 9240 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 9429 9503 gene locus_tag LOCUS_t00330 9429 9503 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence106 <1 6086 gene locus_tag LOCUS_16670 <1 6086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094145972.1:autotransporter BatB 7001 6192 gene locus_tag LOCUS_16680 gene mazG 7001 6192 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098517.1 protein_id gnl|my_center|LOCUS_16680 7087 7389 gene locus_tag LOCUS_16690 7087 7389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 7420 8169 gene locus_tag LOCUS_16700 7420 8169 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_16700 8209 8640 gene locus_tag LOCUS_16710 8209 8640 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_16710 8726 8801 gene locus_tag LOCUS_t00340 8726 8801 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 9879 8989 gene locus_tag LOCUS_16720 9879 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence107 1261 98 gene locus_tag LOCUS_16730 gene bioF 1261 98 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_16730 2287 1286 gene locus_tag LOCUS_16740 2287 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 2753 3862 gene locus_tag LOCUS_16750 2753 3862 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202530.1 protein_id gnl|my_center|LOCUS_16750 5019 3931 gene locus_tag LOCUS_16760 5019 3931 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263349.1 protein_id gnl|my_center|LOCUS_16760 6086 5445 gene locus_tag LOCUS_16770 gene fabG 6086 5445 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225891.1 protein_id gnl|my_center|LOCUS_16770 7886 6126 gene locus_tag LOCUS_16780 7886 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence108 175 489 gene locus_tag LOCUS_16790 175 489 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_16790 502 1542 gene locus_tag LOCUS_16800 502 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 3345 1654 gene locus_tag LOCUS_16810 3345 1654 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326733.1 protein_id gnl|my_center|LOCUS_16810 4140 3367 gene locus_tag LOCUS_16820 4140 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 5050 4265 gene locus_tag LOCUS_16830 gene pyrF 5050 4265 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_16830 5172 7040 gene locus_tag LOCUS_16840 5172 7040 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904125.1 protein_id gnl|my_center|LOCUS_16840 9630 7111 gene locus_tag LOCUS_16850 9630 7111 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764525.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence109 1424 399 gene locus_tag LOCUS_16860 gene mutY 1424 399 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_16860 2349 1417 gene locus_tag LOCUS_16870 gene aroE 2349 1417 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257813.1 protein_id gnl|my_center|LOCUS_16870 3131 2514 gene locus_tag LOCUS_16880 3131 2514 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948434.1 protein_id gnl|my_center|LOCUS_16880 6877 3332 gene locus_tag LOCUS_16890 6877 3332 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926886.1 protein_id gnl|my_center|LOCUS_16890 7575 8981 gene locus_tag LOCUS_16900 7575 8981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 <9766 9085 gene locus_tag LOCUS_16910 <9766 9085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005111142.1:TIGR02206 family membrane protein >Feature sequence110 <1 1337 gene locus_tag LOCUS_16920 <1 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039407.1:OmpA family protein 1339 2214 gene locus_tag LOCUS_16930 1339 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 2417 4303 gene locus_tag LOCUS_16940 2417 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 4375 5637 gene locus_tag LOCUS_16950 4375 5637 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_16950 7713 6076 gene locus_tag LOCUS_16960 7713 6076 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941361.1 protein_id gnl|my_center|LOCUS_16960 8529 7843 gene locus_tag LOCUS_16970 8529 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 8653 9666 gene locus_tag LOCUS_16980 8653 9666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence111 2175 1048 gene locus_tag LOCUS_16990 gene msrB 2175 1048 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203359.1 protein_id gnl|my_center|LOCUS_16990 2602 2306 gene locus_tag LOCUS_17000 2602 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 3025 5217 gene locus_tag LOCUS_17010 3025 5217 CDS product M60 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764444.1 protein_id gnl|my_center|LOCUS_17010 6407 5292 gene locus_tag LOCUS_17020 6407 5292 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682062.1 protein_id gnl|my_center|LOCUS_17020 6537 7454 gene locus_tag LOCUS_17030 6537 7454 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109794.1 protein_id gnl|my_center|LOCUS_17030 8698 7466 gene locus_tag LOCUS_17040 8698 7466 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763377.1 protein_id gnl|my_center|LOCUS_17040 8943 9506 gene locus_tag LOCUS_17050 8943 9506 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249996.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence112 222 1811 gene locus_tag LOCUS_17060 222 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1818 2621 gene locus_tag LOCUS_17070 1818 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 2675 4171 gene locus_tag LOCUS_17080 2675 4171 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767431.1 protein_id gnl|my_center|LOCUS_17080 4672 4382 gene locus_tag LOCUS_17090 4672 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 5008 4691 gene locus_tag LOCUS_17100 5008 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 6164 5301 gene locus_tag LOCUS_17110 gene rfbA 6164 5301 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103413.1 protein_id gnl|my_center|LOCUS_17110 7226 6174 gene locus_tag LOCUS_17120 gene rfbB 7226 6174 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870348.1 protein_id gnl|my_center|LOCUS_17120 8228 7359 gene locus_tag LOCUS_17130 gene pfkA 8228 7359 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761048.1 protein_id gnl|my_center|LOCUS_17130 8432 9163 gene locus_tag LOCUS_17140 8432 9163 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_17140 9250 9558 gene locus_tag LOCUS_17150 9250 9558 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence113 1839 628 gene locus_tag LOCUS_17160 gene hisS 1839 628 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222811.1 protein_id gnl|my_center|LOCUS_17160 2566 2147 gene locus_tag LOCUS_17170 2566 2147 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764905.1 protein_id gnl|my_center|LOCUS_17170 2859 3542 gene locus_tag LOCUS_17180 gene hypB 2859 3542 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_17180 3523 5850 gene locus_tag LOCUS_17190 gene hypF 3523 5850 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_17190 5855 6097 gene locus_tag LOCUS_17200 gene hypC 5855 6097 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338277.1 protein_id gnl|my_center|LOCUS_17200 6138 7205 gene locus_tag LOCUS_17210 gene hypD 6138 7205 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_17210 7210 8244 gene locus_tag LOCUS_17220 gene hypE 7210 8244 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893646.1 protein_id gnl|my_center|LOCUS_17220 <9524 8417 gene locus_tag LOCUS_17230 <9524 8417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_149496819.1:SEL1-like repeat protein >Feature sequence114 1996 767 gene locus_tag LOCUS_17240 1996 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 2713 2009 gene locus_tag LOCUS_17250 2713 2009 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_17250 2999 4606 gene locus_tag LOCUS_17260 gene ilvD 2999 4606 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967560.1 protein_id gnl|my_center|LOCUS_17260 5271 4852 gene locus_tag LOCUS_17270 5271 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 9408 5341 gene locus_tag LOCUS_17280 9408 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence115 1280 1050 gene locus_tag LOCUS_17290 1280 1050 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_17290 1512 1312 gene locus_tag LOCUS_17300 1512 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 3157 1778 gene locus_tag LOCUS_17310 3157 1778 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793956.1 protein_id gnl|my_center|LOCUS_17310 4162 3224 gene locus_tag LOCUS_17320 gene lipA 4162 3224 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222888.1 protein_id gnl|my_center|LOCUS_17320 4770 4213 gene locus_tag LOCUS_17330 4770 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 4915 5913 gene locus_tag LOCUS_17340 4915 5913 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058188.1 protein_id gnl|my_center|LOCUS_17340 6086 7897 gene locus_tag LOCUS_17350 6086 7897 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459352.1 protein_id gnl|my_center|LOCUS_17350 8062 7913 gene locus_tag LOCUS_17360 8062 7913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 <9457 8124 gene locus_tag LOCUS_17370 <9457 8124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000179608.1:transcription termination factor Rho >Feature sequence116 1551 166 gene locus_tag LOCUS_17380 1551 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 3031 1586 gene locus_tag LOCUS_17390 gene rseP 3031 1586 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930352.1 protein_id gnl|my_center|LOCUS_17390 3155 3952 gene locus_tag LOCUS_17400 3155 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 4466 4083 gene locus_tag LOCUS_17410 gene rplT 4466 4083 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_17410 5002 4616 gene locus_tag LOCUS_17420 5002 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 6104 4950 gene locus_tag LOCUS_17430 6104 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 9248 7095 gene locus_tag LOCUS_17440 gene uvrB 9248 7095 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence117 <1 1225 gene locus_tag LOCUS_17450 <1 1225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390410.1:replication-associated recombination protein A 3805 1220 gene locus_tag LOCUS_17460 3805 1220 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202630.1 protein_id gnl|my_center|LOCUS_17460 7818 3949 gene locus_tag LOCUS_17470 7818 3949 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108747.1 protein_id gnl|my_center|LOCUS_17470 <9435 7841 gene locus_tag LOCUS_17480 <9435 7841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201964.1:glycoside hydrolase family 2 TIM barrel-domain containing protein >Feature sequence118 1090 122 gene locus_tag LOCUS_17490 1090 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1542 1102 gene locus_tag LOCUS_17500 1542 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2393 1578 gene locus_tag LOCUS_17510 gene kdsA 2393 1578 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545456.1 protein_id gnl|my_center|LOCUS_17510 2718 3443 gene locus_tag LOCUS_17520 2718 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 4915 3524 gene locus_tag LOCUS_17530 4915 3524 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_17530 5153 5929 gene locus_tag LOCUS_17540 gene rpsB 5153 5929 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303470.1 protein_id gnl|my_center|LOCUS_17540 5960 6832 gene locus_tag LOCUS_17550 gene tsf 5960 6832 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201392.1 protein_id gnl|my_center|LOCUS_17550 7561 8349 gene locus_tag LOCUS_17560 7561 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence119 1439 63 gene locus_tag LOCUS_17570 1439 63 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403748.1 protein_id gnl|my_center|LOCUS_17570 1996 1670 gene locus_tag LOCUS_17580 1996 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 3360 2434 gene locus_tag LOCUS_17590 3360 2434 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_17590 4483 3389 gene locus_tag LOCUS_17600 4483 3389 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_17600 5371 4496 gene locus_tag LOCUS_17610 5371 4496 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_17610 6199 5480 gene locus_tag LOCUS_17620 6199 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 6267 6995 gene locus_tag LOCUS_17630 6267 6995 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325327.1 protein_id gnl|my_center|LOCUS_17630 7050 8570 gene locus_tag LOCUS_17640 gene proS 7050 8570 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921836.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence120 84 776 gene locus_tag LOCUS_17650 84 776 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789656.1 protein_id gnl|my_center|LOCUS_17650 780 1523 gene locus_tag LOCUS_17660 780 1523 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_17660 2372 1644 gene locus_tag LOCUS_17670 2372 1644 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081998.1 protein_id gnl|my_center|LOCUS_17670 2534 3097 gene locus_tag LOCUS_17680 2534 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 3868 3170 gene locus_tag LOCUS_17690 3868 3170 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_17690 4077 6497 gene locus_tag LOCUS_17700 4077 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 6397 7239 gene locus_tag LOCUS_17710 6397 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 8012 7533 gene locus_tag LOCUS_17720 8012 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 8666 8133 gene locus_tag LOCUS_17730 8666 8133 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054412741.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence121 483 6674 gene locus_tag LOCUS_17740 483 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 6784 8991 gene locus_tag LOCUS_17750 6784 8991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 >Feature sequence122 2418 1189 gene locus_tag LOCUS_17760 2418 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 5249 3009 gene locus_tag LOCUS_17770 5249 3009 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_17770 7949 5364 gene locus_tag LOCUS_17780 gene hrpB 7949 5364 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_17780 8949 7987 gene locus_tag LOCUS_17790 8949 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence123 1251 3119 gene locus_tag LOCUS_17800 1251 3119 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107898.1 protein_id gnl|my_center|LOCUS_17800 3748 5109 gene locus_tag LOCUS_17810 3748 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 5761 5402 gene locus_tag LOCUS_tm00010 5761 5402 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 5919 5843 gene locus_tag LOCUS_t00350 5919 5843 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6135 8285 gene locus_tag LOCUS_17820 6135 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 8609 8701 gene locus_tag LOCUS_t00360 8609 8701 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence124 310 966 gene locus_tag LOCUS_17830 310 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 1050 2345 gene locus_tag LOCUS_17840 gene eno 1050 2345 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760327.1 protein_id gnl|my_center|LOCUS_17840 2374 2742 gene locus_tag LOCUS_17850 2374 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 4400 3003 gene locus_tag LOCUS_17860 4400 3003 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921292.1 protein_id gnl|my_center|LOCUS_17860 5336 4704 gene locus_tag LOCUS_17870 5336 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 6410 5547 gene locus_tag LOCUS_17880 6410 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 7380 6415 gene locus_tag LOCUS_17890 7380 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 8355 7660 gene locus_tag LOCUS_17900 8355 7660 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971437.1 protein_id gnl|my_center|LOCUS_17900 <9003 8362 gene locus_tag LOCUS_17910 <9003 8362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009930637.1:ABC transporter ATP-binding protein >Feature sequence125 4883 453 gene locus_tag LOCUS_17920 4883 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 6196 4991 gene locus_tag LOCUS_17930 gene lpxK 6196 4991 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_17930 6929 6228 gene locus_tag LOCUS_17940 6929 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 7368 6886 gene locus_tag LOCUS_17950 7368 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 8712 7405 gene locus_tag LOCUS_17960 8712 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence126 1329 2453 gene locus_tag LOCUS_17970 1329 2453 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_17970 2490 2900 gene locus_tag LOCUS_17980 gene rplQ 2490 2900 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531439.1 protein_id gnl|my_center|LOCUS_17980 3112 3990 gene locus_tag LOCUS_17990 gene fabD 3112 3990 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_17990 4559 4134 gene locus_tag LOCUS_18000 4559 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 5037 4606 gene locus_tag LOCUS_18010 5037 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 5809 5114 gene locus_tag LOCUS_18020 5809 5114 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245030.1 protein_id gnl|my_center|LOCUS_18020 7106 5796 gene locus_tag LOCUS_18030 gene lptG 7106 5796 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933214.1 protein_id gnl|my_center|LOCUS_18030 7449 8561 gene locus_tag LOCUS_18040 7449 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence127 491 3325 gene locus_tag LOCUS_18050 491 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 3501 3857 gene locus_tag LOCUS_18060 3501 3857 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_18060 5175 4240 gene locus_tag LOCUS_18070 gene hemC 5175 4240 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039609.1 protein_id gnl|my_center|LOCUS_18070 6181 5165 gene locus_tag LOCUS_18080 6181 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 6945 6187 gene locus_tag LOCUS_18090 6945 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 7761 6967 gene locus_tag LOCUS_18100 gene folE2 7761 6967 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_18100 8054 7869 gene locus_tag LOCUS_18110 gene rpsR 8054 7869 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549366.1 protein_id gnl|my_center|LOCUS_18110 8321 8148 gene locus_tag LOCUS_18120 gene rpmG 8321 8148 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933041.1 protein_id gnl|my_center|LOCUS_18120 <8870 8355 gene locus_tag LOCUS_18130 <8870 8355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943824.1:TraR/DksA family transcriptional regulator >Feature sequence128 1818 508 gene locus_tag LOCUS_18140 1818 508 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938380.1 protein_id gnl|my_center|LOCUS_18140 6042 2107 gene locus_tag LOCUS_18150 6042 2107 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202282.1 protein_id gnl|my_center|LOCUS_18150 6439 6363 gene locus_tag LOCUS_t00370 6439 6363 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6791 7384 gene locus_tag LOCUS_18160 gene raiA 6791 7384 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254221.1 protein_id gnl|my_center|LOCUS_18160 7598 7726 gene locus_tag LOCUS_18170 7598 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 8609 7974 gene locus_tag LOCUS_18180 8609 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence129 <1 583 gene locus_tag LOCUS_18190 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267808.1:metallophosphoesterase 795 1358 gene locus_tag LOCUS_18200 795 1358 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582689.1 protein_id gnl|my_center|LOCUS_18200 1388 2413 gene locus_tag LOCUS_18210 1388 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 3055 2570 gene locus_tag LOCUS_18220 3055 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 4045 3338 gene locus_tag LOCUS_18230 4045 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 4937 5386 gene locus_tag LOCUS_18240 4937 5386 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761472.1 protein_id gnl|my_center|LOCUS_18240 6966 5476 gene locus_tag LOCUS_18250 6966 5476 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109383.1 protein_id gnl|my_center|LOCUS_18250 <8470 7362 gene locus_tag LOCUS_18260 <8470 7362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761372.1:MATE family efflux transporter >Feature sequence130 3048 367 gene locus_tag LOCUS_18270 3048 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 4584 3127 gene locus_tag LOCUS_18280 4584 3127 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_18280 4974 4624 gene locus_tag LOCUS_18290 4974 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 5267 6151 gene locus_tag LOCUS_18300 5267 6151 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_18300 6362 6589 gene locus_tag LOCUS_18310 6362 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 6655 7236 gene locus_tag LOCUS_18320 gene rplE 6655 7236 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357534.1 protein_id gnl|my_center|LOCUS_18320 7249 7650 gene locus_tag LOCUS_18330 gene rpsH 7249 7650 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_18330 7672 8211 gene locus_tag LOCUS_18340 gene rplF 7672 8211 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379228.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence131 532 966 gene locus_tag LOCUS_18350 532 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 2175 5408 gene locus_tag LOCUS_18360 2175 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 5456 6499 gene locus_tag LOCUS_18370 5456 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 6018 5944 gene locus_tag LOCUS_t00380 6018 5944 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence132 516 1403 gene locus_tag LOCUS_18380 516 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 2881 1571 gene locus_tag LOCUS_18390 2881 1571 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 protein_id gnl|my_center|LOCUS_18390 3801 2878 gene locus_tag LOCUS_18400 gene rfbD 3801 2878 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_18400 3874 4824 gene locus_tag LOCUS_18410 3874 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 7077 4930 gene locus_tag LOCUS_18420 7077 4930 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 protein_id gnl|my_center|LOCUS_18420 7664 7218 gene locus_tag LOCUS_18430 7664 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence133 <1 1109 gene locus_tag LOCUS_18440 <1 1109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073343.1:DUF5009 domain-containing protein 2126 1293 gene locus_tag LOCUS_18450 2126 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 2712 4739 gene locus_tag LOCUS_18460 2712 4739 CDS product Sip1-related alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785073.1 protein_id gnl|my_center|LOCUS_18460 4778 5701 gene locus_tag LOCUS_18470 4778 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 5769 6110 gene locus_tag LOCUS_18480 5769 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 7107 6232 gene locus_tag LOCUS_18490 7107 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence134 <1 1202 gene locus_tag LOCUS_18500 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_184138029.1:amidohydrolase family protein 2663 1269 gene locus_tag LOCUS_18510 gene gltX 2663 1269 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869827.1 protein_id gnl|my_center|LOCUS_18510 2734 3882 gene locus_tag LOCUS_18520 2734 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 3909 4745 gene locus_tag LOCUS_18530 3909 4745 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_18530 4893 7178 gene locus_tag LOCUS_18540 4893 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence135 1544 393 gene locus_tag LOCUS_18550 gene tyrS 1544 393 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881135.1 protein_id gnl|my_center|LOCUS_18550 2062 1832 gene locus_tag LOCUS_18560 2062 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 2484 2122 gene locus_tag LOCUS_18570 2484 2122 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302630.1 protein_id gnl|my_center|LOCUS_18570 3460 2504 gene locus_tag LOCUS_18580 3460 2504 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144110.1 protein_id gnl|my_center|LOCUS_18580 4371 3457 gene locus_tag LOCUS_18590 gene oppB 4371 3457 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388349.1 protein_id gnl|my_center|LOCUS_18590 6236 4377 gene locus_tag LOCUS_18600 6236 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence136 2157 1264 gene locus_tag LOCUS_18610 2157 1264 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554743.1 protein_id gnl|my_center|LOCUS_18610 3680 2154 gene locus_tag LOCUS_18620 3680 2154 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_18620 5668 3878 gene locus_tag LOCUS_18630 5668 3878 CDS product ClcB-like voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192418.1 protein_id gnl|my_center|LOCUS_18630 5870 6469 gene locus_tag LOCUS_18640 5870 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 7307 6513 gene locus_tag LOCUS_18650 7307 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence137 1155 238 gene locus_tag LOCUS_18660 1155 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 1997 1152 gene locus_tag LOCUS_18670 1997 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2664 2065 gene locus_tag LOCUS_18680 2664 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292012.1 protein_id gnl|my_center|LOCUS_18680 3432 2881 gene locus_tag LOCUS_18690 3432 2881 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844912.1 protein_id gnl|my_center|LOCUS_18690 5116 3734 gene locus_tag LOCUS_18700 5116 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 5254 5946 gene locus_tag LOCUS_18710 5254 5946 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038721.1 protein_id gnl|my_center|LOCUS_18710 5961 6737 gene locus_tag LOCUS_18720 5961 6737 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017868968.1 protein_id gnl|my_center|LOCUS_18720 7390 6749 gene locus_tag LOCUS_18730 7390 6749 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence138 5089 3248 gene locus_tag LOCUS_18740 5089 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18740 6710 6393 gene locus_tag LOCUS_18750 6710 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 7003 7233 gene locus_tag LOCUS_18760 7003 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 >Feature sequence139 1011 2093 gene locus_tag LOCUS_18770 1011 2093 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_18770 2119 3213 gene locus_tag LOCUS_18780 2119 3213 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_18780 3241 4314 gene locus_tag LOCUS_18790 3241 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 4328 5380 gene locus_tag LOCUS_18800 4328 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 5616 5691 gene locus_tag LOCUS_t00390 5616 5691 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5816 7291 gene locus_tag LOCUS_18810 5816 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence140 805 731 gene locus_tag LOCUS_t00400 805 731 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3532 881 gene locus_tag LOCUS_18820 3532 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 4197 3622 gene locus_tag LOCUS_18830 4197 3622 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783570.1 protein_id gnl|my_center|LOCUS_18830 4935 4282 gene locus_tag LOCUS_18840 4935 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 7388 4932 gene locus_tag LOCUS_18850 7388 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence141 2200 365 gene locus_tag LOCUS_18860 gene typA 2200 365 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933091.1 protein_id gnl|my_center|LOCUS_18860 2400 3266 gene locus_tag LOCUS_18870 gene ilvE 2400 3266 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_18870 4593 3676 gene locus_tag LOCUS_18880 4593 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 4791 5288 gene locus_tag LOCUS_18890 4791 5288 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949083.1 protein_id gnl|my_center|LOCUS_18890 5913 5314 gene locus_tag LOCUS_18900 5913 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 6189 6653 gene locus_tag LOCUS_18910 6189 6653 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198802.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence142 1120 557 gene locus_tag LOCUS_18920 1120 557 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537600.1 protein_id gnl|my_center|LOCUS_18920 2421 1153 gene locus_tag LOCUS_18930 gene nuoH 2421 1153 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_18930 4193 2457 gene locus_tag LOCUS_18940 4193 2457 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_18940 5645 4245 gene locus_tag LOCUS_18950 gene nuoF 5645 4245 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829484.1 protein_id gnl|my_center|LOCUS_18950 6256 5675 gene locus_tag LOCUS_18960 6256 5675 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082449.1 protein_id gnl|my_center|LOCUS_18960 <7483 6306 gene locus_tag LOCUS_18970 <7483 6306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941009.1:NADH dehydrogenase (quinone) subunit D >Feature sequence143 2618 24 gene locus_tag LOCUS_18980 2618 24 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783265.1 protein_id gnl|my_center|LOCUS_18980 2835 3782 gene locus_tag LOCUS_18990 2835 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 3779 4951 gene locus_tag LOCUS_19000 3779 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 6143 5331 gene locus_tag LOCUS_19010 6143 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence144 7284 376 gene locus_tag LOCUS_19020 7284 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence145 2087 618 gene locus_tag LOCUS_19030 gene ffh 2087 618 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_19030 2169 3104 gene locus_tag LOCUS_19040 gene nadA 2169 3104 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_19040 3120 4118 gene locus_tag LOCUS_19050 3120 4118 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189567.1 protein_id gnl|my_center|LOCUS_19050 4662 4916 gene locus_tag LOCUS_19060 4662 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 5364 5945 gene locus_tag LOCUS_19070 gene nuoB 5364 5945 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403172.1 protein_id gnl|my_center|LOCUS_19070 5995 6579 gene locus_tag LOCUS_19080 5995 6579 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403173.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence146 173 649 gene locus_tag LOCUS_19090 173 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1643 624 gene locus_tag LOCUS_19100 gene meaB 1643 624 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099360647.1 protein_id gnl|my_center|LOCUS_19100 3174 1660 gene locus_tag LOCUS_19110 3174 1660 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660080.1 protein_id gnl|my_center|LOCUS_19110 4690 3209 gene locus_tag LOCUS_19120 4690 3209 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303178.1 protein_id gnl|my_center|LOCUS_19120 5974 6351 gene locus_tag LOCUS_19130 5974 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 6546 6472 gene locus_tag LOCUS_t00410 6546 6472 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7151 6687 gene locus_tag LOCUS_19140 7151 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence147 389 1402 gene locus_tag LOCUS_19150 389 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 3814 1415 gene locus_tag LOCUS_19160 3814 1415 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 protein_id gnl|my_center|LOCUS_19160 4035 5333 gene locus_tag LOCUS_19170 4035 5333 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_19170 5382 6563 gene locus_tag LOCUS_19180 5382 6563 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_19180 6896 7225 gene locus_tag LOCUS_19190 6896 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence148 <1 983 gene locus_tag LOCUS_19200 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202541.1:GDSL-type esterase/lipase family protein 1219 1680 gene locus_tag LOCUS_19210 1219 1680 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123285.1 protein_id gnl|my_center|LOCUS_19210 1784 2785 gene locus_tag LOCUS_19220 gene purM 1784 2785 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880467.1 protein_id gnl|my_center|LOCUS_19220 2851 4770 gene locus_tag LOCUS_19230 2851 4770 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_19230 4804 5403 gene locus_tag LOCUS_19240 gene rpoE 4804 5403 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_19240 5510 6031 gene locus_tag LOCUS_19250 5510 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 6038 6913 gene locus_tag LOCUS_19260 6038 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence149 1217 2023 gene locus_tag LOCUS_19270 gene dapA 1217 2023 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880718.1 protein_id gnl|my_center|LOCUS_19270 2036 2776 gene locus_tag LOCUS_19280 gene dapB 2036 2776 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 protein_id gnl|my_center|LOCUS_19280 2820 3344 gene locus_tag LOCUS_19290 gene folK 2820 3344 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886816.1 protein_id gnl|my_center|LOCUS_19290 3365 4153 gene locus_tag LOCUS_19300 gene panB 3365 4153 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_19300 4224 5105 gene locus_tag LOCUS_19310 4224 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 5153 6022 gene locus_tag LOCUS_19320 5153 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 6885 6040 gene locus_tag LOCUS_19330 6885 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 >Feature sequence150 248 1504 gene locus_tag LOCUS_19340 248 1504 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146571912.1 protein_id gnl|my_center|LOCUS_19340 1528 2946 gene locus_tag LOCUS_19350 1528 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2995 6153 gene locus_tag LOCUS_19360 2995 6153 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_19360 6286 6912 gene locus_tag LOCUS_19370 6286 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence151 3035 633 gene locus_tag LOCUS_19380 gene purL 3035 633 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259203.1 protein_id gnl|my_center|LOCUS_19380 3512 3057 gene locus_tag LOCUS_19390 3512 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 4289 3579 gene locus_tag LOCUS_19400 4289 3579 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420966.1 protein_id gnl|my_center|LOCUS_19400 5345 6427 gene locus_tag LOCUS_19410 5345 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 6559 6783 gene locus_tag LOCUS_19420 6559 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence152 986 264 gene locus_tag LOCUS_19430 986 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 1917 994 gene locus_tag LOCUS_19440 1917 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2432 2349 gene locus_tag LOCUS_t00420 2432 2349 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2965 2504 gene locus_tag LOCUS_19450 2965 2504 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130072.1 protein_id gnl|my_center|LOCUS_19450 3120 4784 gene locus_tag LOCUS_19460 3120 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 4898 5392 gene locus_tag LOCUS_19470 4898 5392 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938859.1 protein_id gnl|my_center|LOCUS_19470 5492 5959 gene locus_tag LOCUS_19480 5492 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 5972 6490 gene locus_tag LOCUS_19490 5972 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531831.1 protein_id gnl|my_center|LOCUS_19490 >Feature sequence153 105 629 gene locus_tag LOCUS_19500 105 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 1263 1685 gene locus_tag LOCUS_19510 1263 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 1915 3582 gene locus_tag LOCUS_19520 gene argS 1915 3582 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225071.1 protein_id gnl|my_center|LOCUS_19520 3596 5209 gene locus_tag LOCUS_19530 3596 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 5274 5858 gene locus_tag LOCUS_19540 5274 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence154 1741 65 gene locus_tag LOCUS_19550 1741 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 3901 1751 gene locus_tag LOCUS_19560 3901 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 5035 4046 gene locus_tag LOCUS_19570 5035 4046 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_19570 5225 6547 gene locus_tag LOCUS_19580 5225 6547 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879940.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence155 122 2053 gene locus_tag LOCUS_19590 122 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 2081 3859 gene locus_tag LOCUS_19600 gene fucI 2081 3859 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724126.1 protein_id gnl|my_center|LOCUS_19600 3910 4161 gene locus_tag LOCUS_19610 3910 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19610 4291 5715 gene locus_tag LOCUS_19620 gene fucK 4291 5715 CDS product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808376.1 protein_id gnl|my_center|LOCUS_19620 5729 6544 gene locus_tag LOCUS_19630 5729 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence156 564 1424 gene locus_tag LOCUS_19640 564 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2295 1693 gene locus_tag LOCUS_19650 2295 1693 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803670.1 protein_id gnl|my_center|LOCUS_19650 3873 2320 gene locus_tag LOCUS_19660 3873 2320 CDS product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807020.1 protein_id gnl|my_center|LOCUS_19660 4127 5599 gene locus_tag LOCUS_19670 4127 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence157 1938 1441 gene locus_tag LOCUS_19680 1938 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 3954 1966 gene locus_tag LOCUS_19690 3954 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 5859 4090 gene locus_tag LOCUS_19700 5859 4090 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence158 2310 1135 gene locus_tag LOCUS_19710 2310 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 3108 2332 gene locus_tag LOCUS_19720 3108 2332 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203385.1 protein_id gnl|my_center|LOCUS_19720 3768 3163 gene locus_tag LOCUS_19730 3768 3163 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_19730 6204 3835 gene locus_tag LOCUS_19740 6204 3835 CDS product tyrosine-protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765281.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence159 206 2674 gene locus_tag LOCUS_19750 206 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 2969 2688 gene locus_tag LOCUS_19760 2969 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 4474 3290 gene locus_tag LOCUS_19770 4474 3290 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_19770 5143 5898 gene locus_tag LOCUS_19780 5143 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence160 2691 319 gene locus_tag LOCUS_19790 2691 319 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776819.1 protein_id gnl|my_center|LOCUS_19790 2909 4051 gene locus_tag LOCUS_19800 gene eboE 2909 4051 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_19800 4055 5005 gene locus_tag LOCUS_19810 4055 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 6184 5030 gene locus_tag LOCUS_19820 6184 5030 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171044.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence161 1037 2056 gene locus_tag LOCUS_19830 1037 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 3823 2189 gene locus_tag LOCUS_19840 gene cimA 3823 2189 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939200.1 protein_id gnl|my_center|LOCUS_19840 4107 6089 gene locus_tag LOCUS_19850 4107 6089 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888294.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence162 <1 2301 gene locus_tag LOCUS_19860 <1 2301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein 3203 2388 gene locus_tag LOCUS_19870 gene thiM 3203 2388 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047875.1 protein_id gnl|my_center|LOCUS_19870 3868 3254 gene locus_tag LOCUS_19880 gene thiE 3868 3254 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263207.1 protein_id gnl|my_center|LOCUS_19880 4817 3888 gene locus_tag LOCUS_19890 gene cysK 4817 3888 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_19890 6141 4855 gene locus_tag LOCUS_19900 6141 4855 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence163 <1 1790 gene locus_tag LOCUS_19910 <1 1790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461804.1:glutamine synthetase III 2001 2186 gene locus_tag LOCUS_19920 2001 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2273 2620 gene locus_tag LOCUS_19930 2273 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2620 2865 gene locus_tag LOCUS_19940 gene yidD 2620 2865 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106504.1 protein_id gnl|my_center|LOCUS_19940 2920 4815 gene locus_tag LOCUS_19950 2920 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence164 334 50 gene locus_tag LOCUS_19960 334 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 1650 559 gene locus_tag LOCUS_19970 1650 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2837 1701 gene locus_tag LOCUS_19980 2837 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 4096 2855 gene locus_tag LOCUS_19990 4096 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 4676 4107 gene locus_tag LOCUS_20000 4676 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 5782 4676 gene locus_tag LOCUS_20010 5782 4676 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203057.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence165 738 1709 gene locus_tag LOCUS_20020 738 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 1713 2498 gene locus_tag LOCUS_20030 1713 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 2640 5027 gene locus_tag LOCUS_20040 2640 5027 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_20040 5378 5022 gene locus_tag LOCUS_20050 5378 5022 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404560.1 protein_id gnl|my_center|LOCUS_20050 <6014 5407 gene locus_tag LOCUS_20060 <6014 5407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015944761.1:ribonuclease HII >Feature sequence166 988 1866 gene locus_tag LOCUS_20070 988 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 2057 2557 gene locus_tag LOCUS_20080 2057 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 3980 2763 gene locus_tag LOCUS_20090 3980 2763 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_20090 5330 4002 gene locus_tag LOCUS_20100 5330 4002 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813074.1 protein_id gnl|my_center|LOCUS_20100 >Feature sequence167 41 649 gene locus_tag LOCUS_20110 gene pgsA 41 649 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_20110 1163 2422 gene locus_tag LOCUS_20120 1163 2422 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918720.1 protein_id gnl|my_center|LOCUS_20120 2535 3143 gene locus_tag LOCUS_20130 2535 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 3544 3365 gene locus_tag LOCUS_20140 3544 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 3633 5078 gene locus_tag LOCUS_20150 3633 5078 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_20150 <5970 5422 gene locus_tag LOCUS_20160 <5970 5422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107878.1:GNAT family N-acetyltransferase >Feature sequence168 <1 1540 gene locus_tag LOCUS_20170 <1 1540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941590.1:ABC-F family ATP-binding cassette domain-containing protein 1608 2165 gene locus_tag LOCUS_20180 1608 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 2245 3018 gene locus_tag LOCUS_20190 gene fabG 2245 3018 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_20190 3043 4245 gene locus_tag LOCUS_20200 3043 4245 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_20200 4259 4915 gene locus_tag LOCUS_20210 4259 4915 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065188.1 protein_id gnl|my_center|LOCUS_20210 5804 5058 gene locus_tag LOCUS_20220 5804 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 >Feature sequence169 1237 668 gene locus_tag LOCUS_20230 1237 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 1855 1250 gene locus_tag LOCUS_20240 1855 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 3040 2465 gene locus_tag LOCUS_20250 gene gmk 3040 2465 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904066.1 protein_id gnl|my_center|LOCUS_20250 3942 3067 gene locus_tag LOCUS_20260 3942 3067 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_20260 5177 3963 gene locus_tag LOCUS_20270 5177 3963 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200164.1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence170 1243 203 gene locus_tag LOCUS_20280 1243 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 1388 2203 gene locus_tag LOCUS_20290 1388 2203 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975449.1 protein_id gnl|my_center|LOCUS_20290 2258 2761 gene locus_tag LOCUS_20300 2258 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 2792 3496 gene locus_tag LOCUS_20310 2792 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 3908 3594 gene locus_tag LOCUS_20320 3908 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 4094 3924 gene locus_tag LOCUS_20330 4094 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 4309 4031 gene locus_tag LOCUS_20340 4309 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 4849 4466 gene locus_tag LOCUS_20350 4849 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence171 80 566 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcactctcacgagtgcgtggattgaaac 1605 745 gene locus_tag LOCUS_20360 1605 745 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_20360 1866 2930 gene locus_tag LOCUS_20370 1866 2930 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764889.1 protein_id gnl|my_center|LOCUS_20370 3209 3769 gene locus_tag LOCUS_20380 3209 3769 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020463.1 protein_id gnl|my_center|LOCUS_20380 4552 5313 gene locus_tag LOCUS_20390 4552 5313 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976137.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence172 113 547 gene locus_tag LOCUS_20400 113 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 905 2140 gene locus_tag LOCUS_20410 gene trpB 905 2140 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722206.1 protein_id gnl|my_center|LOCUS_20410 2225 3163 gene locus_tag LOCUS_20420 2225 3163 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931410.1 protein_id gnl|my_center|LOCUS_20420 3182 4651 gene locus_tag LOCUS_20430 3182 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 4648 5103 gene locus_tag LOCUS_20440 4648 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 5100 5591 gene locus_tag LOCUS_20450 gene elsL 5100 5591 CDS product cell wall-recycling L,D-carboxypeptidase ElsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence173 300 1463 gene locus_tag LOCUS_20460 300 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 1579 2499 gene locus_tag LOCUS_20470 1579 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 3405 2575 gene locus_tag LOCUS_20480 3405 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 4242 3418 gene locus_tag LOCUS_20490 gene menB 4242 3418 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence174 214 1197 gene locus_tag LOCUS_20500 214 1197 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_20500 1293 2183 gene locus_tag LOCUS_20510 1293 2183 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_20510 2201 2815 gene locus_tag LOCUS_20520 2201 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 2822 3808 gene locus_tag LOCUS_20530 2822 3808 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_20530 >Feature sequence175 >Feature sequence176 188 1258 gene locus_tag LOCUS_20540 188 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 1419 2903 gene locus_tag LOCUS_20550 1419 2903 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476410.1 protein_id gnl|my_center|LOCUS_20550 2896 3645 gene locus_tag LOCUS_20560 2896 3645 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355616.1 protein_id gnl|my_center|LOCUS_20560 4633 3728 gene locus_tag LOCUS_20570 4633 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 >Feature sequence177 2070 2576 gene locus_tag LOCUS_20580 2070 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 5222 2763 gene locus_tag LOCUS_20590 5222 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 >Feature sequence178 <1 701 gene locus_tag LOCUS_20600 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122095.1:MoxR family ATPase 740 1642 gene locus_tag LOCUS_20610 740 1642 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_20610 1776 2333 gene locus_tag LOCUS_20620 gene pth 1776 2333 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287401.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence179 903 58 gene locus_tag LOCUS_20630 gene repC 903 58 CDS product replication protein C, IncQ-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240536.1 protein_id gnl|my_center|LOCUS_20630 1891 890 gene locus_tag LOCUS_20640 1891 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2513 2367 gene locus_tag LOCUS_20650 2513 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 3378 2782 gene locus_tag LOCUS_20660 3378 2782 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_20660 4888 3386 gene locus_tag LOCUS_20670 4888 3386 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785160.1 protein_id gnl|my_center|LOCUS_20670 >Feature sequence180 351 950 gene locus_tag LOCUS_20680 351 950 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_20680 1060 3288 gene locus_tag LOCUS_20690 1060 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 3315 4529 gene locus_tag LOCUS_20700 3315 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 4633 4893 gene locus_tag LOCUS_20710 4633 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence181 268 1356 gene locus_tag LOCUS_20720 268 1356 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548569.1 protein_id gnl|my_center|LOCUS_20720 1451 2476 gene locus_tag LOCUS_20730 1451 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 <5034 2522 gene locus_tag LOCUS_20740 <5034 2522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001225852.1:YfaP family protein >Feature sequence182 <1 923 gene locus_tag LOCUS_20750 <1 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083810.1:ABC transporter ATP-binding protein 958 1950 gene locus_tag LOCUS_20760 958 1950 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707193.1 protein_id gnl|my_center|LOCUS_20760 3412 2360 gene locus_tag LOCUS_20770 gene alr 3412 2360 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_20770 3680 3754 gene locus_tag LOCUS_t00430 3680 3754 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence183 301 735 gene locus_tag LOCUS_20780 301 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 754 1518 gene locus_tag LOCUS_20790 754 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 2223 1780 gene locus_tag LOCUS_20800 2223 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 2500 2237 gene locus_tag LOCUS_20810 2500 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 3212 2580 gene locus_tag LOCUS_20820 3212 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 3624 3319 gene locus_tag LOCUS_20830 3624 3319 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871614.1 protein_id gnl|my_center|LOCUS_20830 3820 4728 gene locus_tag LOCUS_20840 gene rnhC 3820 4728 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872309.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence184 1584 2972 gene locus_tag LOCUS_20850 1584 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_20850 3567 4838 gene locus_tag LOCUS_20860 3567 4838 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837602.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence185 1081 206 gene locus_tag LOCUS_20870 1081 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 1232 1507 gene locus_tag LOCUS_20880 1232 1507 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882762.1 protein_id gnl|my_center|LOCUS_20880 1612 2619 gene locus_tag LOCUS_20890 1612 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 3664 2573 gene locus_tag LOCUS_20900 gene pta 3664 2573 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_20900 3806 4615 gene locus_tag LOCUS_20910 3806 4615 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence186 1950 412 gene locus_tag LOCUS_20920 1950 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 2059 2538 gene locus_tag LOCUS_20930 gene mce 2059 2538 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_20930 2570 4135 gene locus_tag LOCUS_20940 2570 4135 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387812.1 protein_id gnl|my_center|LOCUS_20940 4157 4615 gene locus_tag LOCUS_20950 4157 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 >Feature sequence187 103 624 gene locus_tag LOCUS_20960 103 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 1231 728 gene locus_tag LOCUS_20970 gene ruvC 1231 728 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084351.1 protein_id gnl|my_center|LOCUS_20970 2442 1276 gene locus_tag LOCUS_20980 2442 1276 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_20980 3169 2540 gene locus_tag LOCUS_20990 3169 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 4301 3261 gene locus_tag LOCUS_21000 gene pyrC 4301 3261 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258604.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence188 641 84 gene locus_tag LOCUS_21010 641 84 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439149.1 protein_id gnl|my_center|LOCUS_21010 1233 2576 gene locus_tag LOCUS_21020 1233 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 2736 3671 gene locus_tag LOCUS_21030 2736 3671 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence189 393 1454 gene locus_tag LOCUS_21040 393 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 1487 1678 gene locus_tag LOCUS_21050 1487 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 2175 1768 gene locus_tag LOCUS_21060 2175 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 4102 2783 gene locus_tag LOCUS_21070 4102 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 >Feature sequence190 1 432 gene locus_tag LOCUS_21080 1 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 446 1312 gene locus_tag LOCUS_21090 446 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 1407 2159 gene locus_tag LOCUS_21100 gene lpxA 1407 2159 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071796.1 protein_id gnl|my_center|LOCUS_21100 2164 2868 gene locus_tag LOCUS_21110 2164 2868 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937441.1 protein_id gnl|my_center|LOCUS_21110 4298 3045 gene locus_tag LOCUS_21120 4298 3045 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137617.1 protein_id gnl|my_center|LOCUS_21120 >Feature sequence191 970 41 gene locus_tag LOCUS_21130 970 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 1088 2014 gene locus_tag LOCUS_21140 1088 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 2026 2607 gene locus_tag LOCUS_21150 2026 2607 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802121.1 protein_id gnl|my_center|LOCUS_21150 2795 3571 gene locus_tag LOCUS_21160 gene proC 2795 3571 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence192 2883 742 gene locus_tag LOCUS_21170 2883 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 4061 3015 gene locus_tag LOCUS_21180 4061 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 >Feature sequence193 <1 1198 gene locus_tag LOCUS_21190 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942109.1:aspartate--tRNA ligase 2078 1311 gene locus_tag LOCUS_21200 2078 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 2656 2090 gene locus_tag LOCUS_21210 2656 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence194 80 370 gene locus_tag LOCUS_21220 80 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 1234 827 gene locus_tag LOCUS_21230 gene mutT 1234 827 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932370.1 protein_id gnl|my_center|LOCUS_21230 1740 1234 gene locus_tag LOCUS_21240 1740 1234 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762515.1 protein_id gnl|my_center|LOCUS_21240 2714 1737 gene locus_tag LOCUS_21250 2714 1737 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920841.1 protein_id gnl|my_center|LOCUS_21250 3708 2719 gene locus_tag LOCUS_21260 3708 2719 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933663.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence195 1665 2192 gene locus_tag LOCUS_21270 1665 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 <4122 2528 gene locus_tag LOCUS_21280 <4122 2528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918335.1:family 20 glycosylhydrolase >Feature sequence196 3006 55 gene locus_tag LOCUS_21290 3006 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence197 2 2341 gene locus_tag LOCUS_21300 2 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 2373 3149 gene locus_tag LOCUS_21310 2373 3149 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788374.1 protein_id gnl|my_center|LOCUS_21310 3146 3643 gene locus_tag LOCUS_21320 3146 3643 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788377.1 protein_id gnl|my_center|LOCUS_21320 3745 3819 gene locus_tag LOCUS_t00440 3745 3819 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence198 764 432 gene locus_tag LOCUS_21330 764 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 1894 761 gene locus_tag LOCUS_21340 gene tgt 1894 761 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_21340 2625 1900 gene locus_tag LOCUS_21350 2625 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 3302 2625 gene locus_tag LOCUS_21360 3302 2625 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107446.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence199 2963 1656 gene locus_tag LOCUS_21370 2963 1656 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125805.1 protein_id gnl|my_center|LOCUS_21370 <3739 3040 gene locus_tag LOCUS_21380 <3739 3040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948716.1:DNA alkylation repair protein >Feature sequence200 1495 20 gene locus_tag LOCUS_21390 1495 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 2424 1570 gene locus_tag LOCUS_21400 gene bla 2424 1570 CDS product class A beta-lactamase, subclass A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109295.1 protein_id gnl|my_center|LOCUS_21400 2619 3122 gene locus_tag LOCUS_21410 2619 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 3294 3614 gene locus_tag LOCUS_21420 3294 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence201 277 1434 gene locus_tag LOCUS_21430 277 1434 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_21430 1564 2589 gene locus_tag LOCUS_21440 1564 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 3675 2620 gene locus_tag LOCUS_21450 3675 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence202 <1 548 gene locus_tag LOCUS_21460 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966771.1:flavodoxin family protein 729 1577 gene locus_tag LOCUS_21470 729 1577 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_21470 1704 2678 gene locus_tag LOCUS_21480 1704 2678 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence203 107 778 gene locus_tag LOCUS_21490 107 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 1378 815 gene locus_tag LOCUS_21500 1378 815 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_21500 2993 1431 gene locus_tag LOCUS_21510 gene ilvA 2993 1431 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125079.1 protein_id gnl|my_center|LOCUS_21510 3192 3115 gene locus_tag LOCUS_t00450 3192 3115 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence204 168 1079 gene locus_tag LOCUS_21520 168 1079 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_21520 1076 2251 gene locus_tag LOCUS_21530 1076 2251 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_21530 2340 3341 gene locus_tag LOCUS_21540 2340 3341 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_21540 >Feature sequence205 458 42 gene locus_tag LOCUS_21550 458 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21550 1210 1040 gene locus_tag LOCUS_21560 1210 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2314 1256 gene locus_tag LOCUS_21570 2314 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21570 2461 2315 gene locus_tag LOCUS_21580 2461 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 2707 3210 gene locus_tag LOCUS_21590 gene ybaK 2707 3210 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710860.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence206 280 206 gene locus_tag LOCUS_t00460 280 206 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 700 452 gene locus_tag LOCUS_21600 700 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 897 1685 gene locus_tag LOCUS_21610 897 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2547 1723 gene locus_tag LOCUS_21620 gene dapF 2547 1723 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939153.1 protein_id gnl|my_center|LOCUS_21620 3314 2607 gene locus_tag LOCUS_21630 3314 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21630 >Feature sequence207 798 325 gene locus_tag LOCUS_21640 798 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21640 1425 826 gene locus_tag LOCUS_21650 1425 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 <3400 1501 gene locus_tag LOCUS_21660 <3400 1501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932908.1:preprotein translocase subunit SecA >Feature sequence208 1110 481 gene locus_tag LOCUS_21670 1110 481 CDS product CatA-like O-acetyltransferase, family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705203.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence209 2088 136 gene locus_tag LOCUS_21680 2088 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence210 409 2340 gene locus_tag LOCUS_21690 409 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 2494 2826 gene locus_tag LOCUS_21700 2494 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence211 2508 127 gene locus_tag LOCUS_21710 2508 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 >Feature sequence212 <1 562 gene locus_tag LOCUS_21720 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_214185119.1:excinuclease ABC subunit UvrA 899 1408 gene locus_tag LOCUS_21730 899 1408 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172196.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence213 477 968 gene locus_tag LOCUS_21740 477 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 1065 1703 gene locus_tag LOCUS_21750 gene nth 1065 1703 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_21750 1797 2588 gene locus_tag LOCUS_21760 1797 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 >Feature sequence214 1384 14 gene locus_tag LOCUS_21770 gene rpoN 1384 14 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809012.1 protein_id gnl|my_center|LOCUS_21770 1554 2273 gene locus_tag LOCUS_21780 1554 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 >Feature sequence215 >Feature sequence216 1917 796 gene locus_tag LOCUS_21790 gene galE 1917 796 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929113.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence217 2459 1350 gene locus_tag LOCUS_21800 2459 1350 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764054.1 protein_id gnl|my_center|LOCUS_21800 >Feature sequence218 676 1290 gene locus_tag LOCUS_21810 676 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 2517 1390 gene locus_tag LOCUS_21820 gene dprA 2517 1390 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_21820 >Feature sequence219 1557 667 gene locus_tag LOCUS_21830 1557 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence220 402 1874 gene locus_tag LOCUS_21840 402 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840