>Feature sequence001 815 483 gene locus_tag LOCUS_00010 815 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00010 1485 790 gene locus_tag LOCUS_00020 1485 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00020 2315 2148 gene locus_tag LOCUS_00030 2315 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2283 3446 gene locus_tag LOCUS_00040 2283 3446 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 protein_id gnl|my_center|LOCUS_00040 3827 5455 gene locus_tag LOCUS_00050 3827 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5651 7243 gene locus_tag LOCUS_00060 gene omcB 5651 7243 CDS product outer membrane complex protein OmcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872660.1 protein_id gnl|my_center|LOCUS_00060 7501 8298 gene locus_tag LOCUS_00070 7501 8298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8295 8756 gene locus_tag LOCUS_00080 8295 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 >Feature sequence002 <1 1051 gene locus_tag LOCUS_00090 <1 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082059.1:F0F1 ATP synthase subunit beta 1048 1452 gene locus_tag LOCUS_00100 1048 1452 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022411.1 protein_id gnl|my_center|LOCUS_00100 1452 1730 gene locus_tag LOCUS_00110 1452 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 1727 2392 gene locus_tag LOCUS_00120 1727 2392 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946786.1 protein_id gnl|my_center|LOCUS_00120 2406 2672 gene locus_tag LOCUS_00130 2406 2672 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019235654.1 protein_id gnl|my_center|LOCUS_00130 2669 3409 gene locus_tag LOCUS_00140 2669 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 3410 4906 gene locus_tag LOCUS_00150 gene atpA 3410 4906 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016337.1 protein_id gnl|my_center|LOCUS_00150 4909 5754 gene locus_tag LOCUS_00160 gene atpG 4909 5754 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582548.1 protein_id gnl|my_center|LOCUS_00160 6184 6975 gene locus_tag LOCUS_00170 6184 6975 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265631.1 protein_id gnl|my_center|LOCUS_00170 6972 8378 gene locus_tag LOCUS_00180 6972 8378 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_00180 8375 10495 gene locus_tag LOCUS_00190 gene glgP 8375 10495 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880430.1 protein_id gnl|my_center|LOCUS_00190 11083 10865 gene locus_tag LOCUS_00200 11083 10865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 >Feature sequence003 53 763 gene locus_tag LOCUS_00210 gene phoU 53 763 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_00210 1019 1954 gene locus_tag LOCUS_00220 gene mdh 1019 1954 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325654.1 protein_id gnl|my_center|LOCUS_00220 2279 2851 gene locus_tag LOCUS_00230 gene pyrE 2279 2851 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546400.1 protein_id gnl|my_center|LOCUS_00230 3014 3382 gene locus_tag LOCUS_00240 3014 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 3392 3766 gene locus_tag LOCUS_00250 3392 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 4316 6040 gene locus_tag LOCUS_00260 4316 6040 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_00260 6300 8180 gene locus_tag LOCUS_00270 6300 8180 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257267.1 protein_id gnl|my_center|LOCUS_00270 8711 10003 gene locus_tag LOCUS_00280 8711 10003 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057897531.1 protein_id gnl|my_center|LOCUS_00280 >Feature sequence004 <1 674 gene locus_tag LOCUS_00290 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545557.1:glycosyltransferase family 4 protein 1032 2672 gene locus_tag LOCUS_00300 1032 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 3129 3485 gene locus_tag LOCUS_00310 3129 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 3731 4588 gene locus_tag LOCUS_00320 3731 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 4585 5667 gene locus_tag LOCUS_00330 4585 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 5707 6594 gene locus_tag LOCUS_00340 5707 6594 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868277.1 protein_id gnl|my_center|LOCUS_00340 6865 7338 gene locus_tag LOCUS_00350 6865 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 7403 7945 gene locus_tag LOCUS_00360 7403 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 7961 8932 gene locus_tag LOCUS_00370 7961 8932 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_00370 9212 9415 gene locus_tag LOCUS_00380 9212 9415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 10487 9822 gene locus_tag LOCUS_00390 10487 9822 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020502.1 protein_id gnl|my_center|LOCUS_00390 >Feature sequence005 296 487 gene locus_tag LOCUS_00400 296 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 560 952 gene locus_tag LOCUS_00410 560 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 1178 1420 gene locus_tag LOCUS_00420 1178 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 1716 3449 gene locus_tag LOCUS_00430 1716 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 protein_id gnl|my_center|LOCUS_00430 4365 3409 gene locus_tag LOCUS_00440 4365 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 5490 4588 gene locus_tag LOCUS_00450 5490 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 6954 6574 gene locus_tag LOCUS_00460 6954 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 7230 6994 gene locus_tag LOCUS_00470 7230 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 9925 7325 gene locus_tag LOCUS_00480 9925 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 >Feature sequence006 526 789 gene locus_tag LOCUS_00490 526 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 913 4536 gene locus_tag LOCUS_00500 gene smc 913 4536 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361019.1 protein_id gnl|my_center|LOCUS_00500 4638 4841 gene locus_tag LOCUS_00510 4638 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 4895 5044 gene locus_tag LOCUS_00520 4895 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 5327 5527 gene locus_tag LOCUS_00530 5327 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 5639 7441 gene locus_tag LOCUS_00540 5639 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 7894 8232 gene locus_tag LOCUS_00550 gene glnB 7894 8232 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_00550 8308 8562 gene locus_tag LOCUS_00560 8308 8562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 8586 9512 gene locus_tag LOCUS_00570 8586 9512 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388064.1 protein_id gnl|my_center|LOCUS_00570 >Feature sequence007 1915 764 gene locus_tag LOCUS_00580 1915 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 3576 1924 gene locus_tag LOCUS_00590 3576 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 4027 3560 gene locus_tag LOCUS_00600 4027 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 5634 4024 gene locus_tag LOCUS_00610 5634 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 6752 5631 gene locus_tag LOCUS_00620 6752 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 7420 6752 gene locus_tag LOCUS_00630 7420 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 9018 7429 gene locus_tag LOCUS_00640 9018 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 >Feature sequence008 1370 870 gene locus_tag LOCUS_00650 1370 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 1819 1367 gene locus_tag LOCUS_00660 1819 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 3139 2015 gene locus_tag LOCUS_00670 3139 2015 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_00670 3726 3259 gene locus_tag LOCUS_00680 3726 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 4955 3984 gene locus_tag LOCUS_00690 4955 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 5844 5065 gene locus_tag LOCUS_00700 gene flgG 5844 5065 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412455.1 protein_id gnl|my_center|LOCUS_00700 6578 5856 gene locus_tag LOCUS_00710 gene flgF 6578 5856 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937818.1 protein_id gnl|my_center|LOCUS_00710 8654 7068 gene locus_tag LOCUS_00720 gene flgE 8654 7068 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918786.1 protein_id gnl|my_center|LOCUS_00720 >Feature sequence009 383 135 gene locus_tag LOCUS_00730 383 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 574 762 gene locus_tag LOCUS_00740 574 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 740 919 gene locus_tag LOCUS_00750 740 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 1041 1328 gene locus_tag LOCUS_00760 1041 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 1610 1867 gene locus_tag LOCUS_00770 1610 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00770 1848 2156 gene locus_tag LOCUS_00780 1848 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 2163 2411 gene locus_tag LOCUS_00790 2163 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 2683 2871 gene locus_tag LOCUS_00800 2683 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 3517 6990 gene locus_tag LOCUS_00810 3517 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 >Feature sequence010 428 297 gene locus_tag LOCUS_00820 428 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 1430 504 gene locus_tag LOCUS_00830 gene rsmA 1430 504 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651548.1 protein_id gnl|my_center|LOCUS_00830 1914 1555 gene locus_tag LOCUS_00840 1914 1555 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 protein_id gnl|my_center|LOCUS_00840 2995 1982 gene locus_tag LOCUS_00850 gene pdxA 2995 1982 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_00850 3639 2995 gene locus_tag LOCUS_00860 3639 2995 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881107.1 protein_id gnl|my_center|LOCUS_00860 4569 3913 gene locus_tag LOCUS_00870 4569 3913 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545974.1 protein_id gnl|my_center|LOCUS_00870 6000 4609 gene locus_tag LOCUS_00880 6000 4609 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_00880 6136 6987 gene locus_tag LOCUS_00890 6136 6987 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250768.1 protein_id gnl|my_center|LOCUS_00890 7313 7029 gene locus_tag LOCUS_00900 7313 7029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 7398 8342 gene locus_tag LOCUS_00910 7398 8342 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263895.1 protein_id gnl|my_center|LOCUS_00910 >Feature sequence011 909 2702 gene locus_tag LOCUS_00920 909 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 2932 2711 gene locus_tag LOCUS_00930 2932 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 3892 3023 gene locus_tag LOCUS_00940 gene moaA 3892 3023 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546124.1 protein_id gnl|my_center|LOCUS_00940 5489 4107 gene locus_tag LOCUS_00950 5489 4107 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_00950 <8299 5505 gene locus_tag LOCUS_00960 <8299 5505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942140.1:ATP-binding protein >Feature sequence012 <1 524 gene locus_tag LOCUS_00970 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115707.1:CusA/CzcA family heavy metal efflux RND transporter 1104 607 gene locus_tag LOCUS_00980 1104 607 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_00980 2586 1114 gene locus_tag LOCUS_00990 2586 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 3377 2604 gene locus_tag LOCUS_01000 3377 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 3770 3381 gene locus_tag LOCUS_01010 3770 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 4295 3798 gene locus_tag LOCUS_01020 4295 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 5592 4342 gene locus_tag LOCUS_01030 5592 4342 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_01030 7382 5640 gene locus_tag LOCUS_01040 7382 5640 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_01040 <8118 7414 gene locus_tag LOCUS_01050 <8118 7414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583238.1:type II secretion system ATPase GspE >Feature sequence013 1116 3302 gene locus_tag LOCUS_01060 1116 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 3904 4653 gene locus_tag LOCUS_01070 3904 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 4673 6115 gene locus_tag LOCUS_01080 4673 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 6112 7686 gene locus_tag LOCUS_01090 6112 7686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01090 >Feature sequence014 <1 587 gene locus_tag LOCUS_01100 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000892827.1:Ig-like domain-containing protein 710 2170 gene locus_tag LOCUS_01110 710 2170 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_01110 2251 3441 gene locus_tag LOCUS_01120 2251 3441 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021066.1 protein_id gnl|my_center|LOCUS_01120 3442 4806 gene locus_tag LOCUS_01130 gene mgtE 3442 4806 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680769.1 protein_id gnl|my_center|LOCUS_01130 5006 5302 gene locus_tag LOCUS_01140 5006 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 5299 6096 gene locus_tag LOCUS_01150 5299 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 6185 6460 gene locus_tag LOCUS_01160 6185 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 6499 7098 gene locus_tag LOCUS_01170 6499 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 7142 7885 gene locus_tag LOCUS_01180 7142 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 >Feature sequence015 791 1213 gene locus_tag LOCUS_01190 791 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 1210 1533 gene locus_tag LOCUS_01200 1210 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 1526 2098 gene locus_tag LOCUS_01210 1526 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 2756 2349 gene locus_tag LOCUS_01220 2756 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 2655 2933 gene locus_tag LOCUS_01230 2655 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 4086 3283 gene locus_tag LOCUS_01240 4086 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 protein_id gnl|my_center|LOCUS_01240 4415 4870 gene locus_tag LOCUS_01250 4415 4870 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071603.1 protein_id gnl|my_center|LOCUS_01250 4948 5166 gene locus_tag LOCUS_01260 4948 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 5212 5943 gene locus_tag LOCUS_01270 5212 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 6618 6031 gene locus_tag LOCUS_01280 6618 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 >Feature sequence016 <1 770 gene locus_tag LOCUS_01290 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546244.1:acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase 773 928 gene locus_tag LOCUS_01300 773 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01300 1040 1810 gene locus_tag LOCUS_01310 1040 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01310 1807 3054 gene locus_tag LOCUS_01320 1807 3054 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024301.1 protein_id gnl|my_center|LOCUS_01320 3084 3314 gene locus_tag LOCUS_01330 3084 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 3447 3749 gene locus_tag LOCUS_01340 3447 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 3773 4009 gene locus_tag LOCUS_01350 3773 4009 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017264174.1 protein_id gnl|my_center|LOCUS_01350 4091 5761 gene locus_tag LOCUS_01360 4091 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 6348 5953 gene locus_tag LOCUS_01370 gene gcvH 6348 5953 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583866.1 protein_id gnl|my_center|LOCUS_01370 7454 6345 gene locus_tag LOCUS_01380 gene gcvT 7454 6345 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_01380 >Feature sequence017 2475 1048 gene locus_tag LOCUS_01390 2475 1048 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_01390 2865 2494 gene locus_tag LOCUS_01400 2865 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 3506 2895 gene locus_tag LOCUS_01410 gene wrbA 3506 2895 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545384.1 protein_id gnl|my_center|LOCUS_01410 3908 3591 gene locus_tag LOCUS_01420 3908 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 4709 5320 gene locus_tag LOCUS_01430 4709 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 5354 6034 gene locus_tag LOCUS_01440 5354 6034 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880848.1 protein_id gnl|my_center|LOCUS_01440 >Feature sequence018 1007 276 gene locus_tag LOCUS_01450 1007 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 2084 1071 gene locus_tag LOCUS_01460 2084 1071 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250419.1 protein_id gnl|my_center|LOCUS_01460 2724 2167 gene locus_tag LOCUS_01470 gene efp 2724 2167 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886767.1 protein_id gnl|my_center|LOCUS_01470 3903 2761 gene locus_tag LOCUS_01480 gene hemW 3903 2761 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099423.1 protein_id gnl|my_center|LOCUS_01480 4678 3929 gene locus_tag LOCUS_01490 4678 3929 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_01490 5146 6834 gene locus_tag LOCUS_01500 gene ispH 5146 6834 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011417689.1 protein_id gnl|my_center|LOCUS_01500 7038 7529 gene locus_tag LOCUS_01510 7038 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01510 >Feature sequence019 <1 1156 gene locus_tag LOCUS_01520 <1 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393598.1:aminodeoxychorismate synthase component I 1153 2016 gene locus_tag LOCUS_01530 gene ilvE 1153 2016 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_01530 2303 2896 gene locus_tag LOCUS_01540 2303 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 3572 4036 gene locus_tag LOCUS_01550 3572 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 4021 4881 gene locus_tag LOCUS_01560 4021 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 5341 6540 gene locus_tag LOCUS_01570 5341 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01570 6596 7267 gene locus_tag LOCUS_01580 6596 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 >Feature sequence020 1047 1181 gene locus_tag LOCUS_01590 1047 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 2237 1389 gene locus_tag LOCUS_01600 2237 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 3913 2777 gene locus_tag LOCUS_01610 3913 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 7234 3926 gene locus_tag LOCUS_01620 7234 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 >Feature sequence021 1251 790 gene locus_tag LOCUS_01630 1251 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 1572 2621 gene locus_tag LOCUS_01640 gene galE 1572 2621 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_01640 3132 5558 gene locus_tag LOCUS_01650 3132 5558 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681381.1 protein_id gnl|my_center|LOCUS_01650 5549 6703 gene locus_tag LOCUS_01660 5549 6703 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766357.1 protein_id gnl|my_center|LOCUS_01660 6696 7100 gene locus_tag LOCUS_01670 6696 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 >Feature sequence022 1 2805 gene locus_tag LOCUS_01680 gene uvrA 1 2805 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583250.1 protein_id gnl|my_center|LOCUS_01680 3211 4065 gene locus_tag LOCUS_01690 gene nifU 3211 4065 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_01690 4062 5261 gene locus_tag LOCUS_01700 gene nifS 4062 5261 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_01700 6951 5389 gene locus_tag LOCUS_01710 6951 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 >Feature sequence023 <1 744 gene locus_tag LOCUS_01720 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165438795.1:transketolase 878 1105 gene locus_tag LOCUS_01730 878 1105 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104925.1 protein_id gnl|my_center|LOCUS_01730 1220 1861 gene locus_tag LOCUS_01740 gene nth 1220 1861 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065874.1 protein_id gnl|my_center|LOCUS_01740 2339 3691 gene locus_tag LOCUS_01750 gene glmM 2339 3691 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_01750 3909 5021 gene locus_tag LOCUS_01760 3909 5021 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868819.1 protein_id gnl|my_center|LOCUS_01760 6022 5162 gene locus_tag LOCUS_01770 6022 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 >Feature sequence024 <1 657 gene locus_tag LOCUS_01780 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546634.1:formate--tetrahydrofolate ligase 1029 3647 gene locus_tag LOCUS_01790 gene secA 1029 3647 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938126.1 protein_id gnl|my_center|LOCUS_01790 3718 5034 gene locus_tag LOCUS_01800 3718 5034 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_01800 5031 6200 gene locus_tag LOCUS_01810 gene metK 5031 6200 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_01810 >Feature sequence025 2012 768 gene locus_tag LOCUS_01820 gene icd 2012 768 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206898.1 protein_id gnl|my_center|LOCUS_01820 4855 2018 gene locus_tag LOCUS_01830 4855 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 5836 6075 gene locus_tag LOCUS_01840 5836 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 <6748 6119 gene locus_tag LOCUS_01850 <6748 6119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288207.1:glycosyltransferase family 2 protein >Feature sequence026 759 169 gene locus_tag LOCUS_01860 759 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 1070 1219 gene locus_tag LOCUS_01870 1070 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 1838 1416 gene locus_tag LOCUS_01880 1838 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 2632 1877 gene locus_tag LOCUS_01890 2632 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 4040 3159 gene locus_tag LOCUS_01900 gene czcD 4040 3159 CDS product CDF family zinc transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100957.1 protein_id gnl|my_center|LOCUS_01900 4399 4058 gene locus_tag LOCUS_01910 4399 4058 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942779.1 protein_id gnl|my_center|LOCUS_01910 <6737 4416 gene locus_tag LOCUS_01920 <6737 4416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444671.1:efflux RND transporter permease subunit >Feature sequence027 <1 1285 gene locus_tag LOCUS_01930 <1 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405103.1:ammonium transporter 1287 2825 gene locus_tag LOCUS_01940 1287 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 4043 3639 gene locus_tag LOCUS_01950 4043 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 5410 4292 gene locus_tag LOCUS_01960 gene scfB 5410 4292 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965577.1 protein_id gnl|my_center|LOCUS_01960 5906 5604 gene locus_tag LOCUS_01970 5906 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 >Feature sequence028 <1 1818 gene locus_tag LOCUS_01980 <1 1818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232079.1:primosomal protein N' 1865 5314 gene locus_tag LOCUS_01990 1865 5314 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065207.1 protein_id gnl|my_center|LOCUS_01990 5342 5596 gene locus_tag LOCUS_02000 5342 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 5720 5989 gene locus_tag LOCUS_02010 5720 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 5986 6459 gene locus_tag LOCUS_02020 5986 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 >Feature sequence029 948 634 gene locus_tag LOCUS_02030 948 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 1124 936 gene locus_tag LOCUS_02040 1124 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 3210 1339 gene locus_tag LOCUS_02050 3210 1339 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105162.1 protein_id gnl|my_center|LOCUS_02050 4844 3126 gene locus_tag LOCUS_02060 4844 3126 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 protein_id gnl|my_center|LOCUS_02060 <6649 5255 gene locus_tag LOCUS_02070 <6649 5255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038872.1:ATP-binding protein >Feature sequence030 150 2660 gene locus_tag LOCUS_02080 150 2660 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_02080 2962 4599 gene locus_tag LOCUS_02090 gene pgi 2962 4599 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141691.1 protein_id gnl|my_center|LOCUS_02090 4991 5941 gene locus_tag LOCUS_02100 gene fba 4991 5941 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_02100 >Feature sequence031 806 890 gene locus_tag LOCUS_t00010 806 890 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1332 952 gene locus_tag LOCUS_02110 1332 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 1883 1329 gene locus_tag LOCUS_02120 1883 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 4204 1883 gene locus_tag LOCUS_02130 4204 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 4943 4191 gene locus_tag LOCUS_02140 4943 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 6020 5070 gene locus_tag LOCUS_02150 6020 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 >Feature sequence032 216 527 gene locus_tag LOCUS_02160 216 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 1970 708 gene locus_tag LOCUS_02170 1970 708 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869463.1 protein_id gnl|my_center|LOCUS_02170 4878 2446 gene locus_tag LOCUS_02180 4878 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 <6552 4957 gene locus_tag LOCUS_02190 <6552 4957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057315.1:Gldg family protein >Feature sequence033 877 1176 gene locus_tag LOCUS_02200 877 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 1938 3596 gene locus_tag LOCUS_02210 1938 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 3744 3869 gene locus_tag LOCUS_02220 3744 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 4298 5554 gene locus_tag LOCUS_02230 4298 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 >Feature sequence034 <1 1053 gene locus_tag LOCUS_02240 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461874.1:heavy metal translocating P-type ATPase 1138 1515 gene locus_tag LOCUS_02250 1138 1515 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935061.1 protein_id gnl|my_center|LOCUS_02250 1523 1747 gene locus_tag LOCUS_02260 1523 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 1864 2520 gene locus_tag LOCUS_02270 1864 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 2587 2910 gene locus_tag LOCUS_02280 2587 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02280 3625 3873 gene locus_tag LOCUS_02290 3625 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 3815 5185 gene locus_tag LOCUS_02300 3815 5185 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947654.1 protein_id gnl|my_center|LOCUS_02300 5290 5478 gene locus_tag LOCUS_02310 5290 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 6191 5571 gene locus_tag LOCUS_02320 6191 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 >Feature sequence035 645 1652 gene locus_tag LOCUS_02330 645 1652 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_02330 3426 1930 gene locus_tag LOCUS_02340 3426 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 4806 3550 gene locus_tag LOCUS_02350 4806 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 5723 5022 gene locus_tag LOCUS_02360 5723 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 <6535 5862 gene locus_tag LOCUS_02370 <6535 5862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460426.1:heavy metal translocating P-type ATPase >Feature sequence036 2644 965 gene locus_tag LOCUS_02380 gene nuoF 2644 965 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_02380 3159 2665 gene locus_tag LOCUS_02390 gene nuoE 3159 2665 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_02390 4109 3324 gene locus_tag LOCUS_02400 4109 3324 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 protein_id gnl|my_center|LOCUS_02400 4592 4320 gene locus_tag LOCUS_02410 4592 4320 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681985.1 protein_id gnl|my_center|LOCUS_02410 4764 4573 gene locus_tag LOCUS_02420 4764 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 <6506 5110 gene locus_tag LOCUS_02430 <6506 5110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080510933.1:formate dehydrogenase subunit alpha >Feature sequence037 1634 822 gene locus_tag LOCUS_02440 1634 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 3717 2605 gene locus_tag LOCUS_02450 3717 2605 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544929.1 protein_id gnl|my_center|LOCUS_02450 5049 3895 gene locus_tag LOCUS_02460 gene gmd 5049 3895 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546080.1 protein_id gnl|my_center|LOCUS_02460 5942 5157 gene locus_tag LOCUS_02470 5942 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 >Feature sequence038 1758 2753 gene locus_tag LOCUS_02480 gene cas7c 1758 2753 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388586.1 protein_id gnl|my_center|LOCUS_02480 2746 3906 gene locus_tag LOCUS_02490 2746 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02490 3943 4971 gene locus_tag LOCUS_02500 3943 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 5013 5585 gene locus_tag LOCUS_02510 5013 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 5593 6213 gene locus_tag LOCUS_02520 gene cas4 5593 6213 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932803.1 protein_id gnl|my_center|LOCUS_02520 >Feature sequence039 404 613 gene locus_tag LOCUS_02530 404 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 926 1870 gene locus_tag LOCUS_02540 926 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 2043 1867 gene locus_tag LOCUS_02550 2043 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 2874 2047 gene locus_tag LOCUS_02560 2874 2047 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_02560 5244 2878 gene locus_tag LOCUS_02570 5244 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 <6410 5450 gene locus_tag LOCUS_02580 <6410 5450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877854.1:tellurite-resistance/dicarboxylate transporter >Feature sequence040 1738 29 gene locus_tag LOCUS_02590 1738 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 3668 1917 gene locus_tag LOCUS_02600 3668 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 5068 3689 gene locus_tag LOCUS_02610 5068 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 5928 5170 gene locus_tag LOCUS_02620 5928 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 6103 5915 gene locus_tag LOCUS_02630 6103 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 >Feature sequence041 8 2314 gene locus_tag LOCUS_02640 8 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 2746 2558 gene locus_tag LOCUS_02650 2746 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 4095 4781 gene locus_tag LOCUS_02660 4095 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 5686 4778 gene locus_tag LOCUS_02670 5686 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 <6366 5695 gene locus_tag LOCUS_02680 <6366 5695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941290.1:GDP-L-fucose synthase >Feature sequence042 249 608 gene locus_tag LOCUS_02690 gene raiA 249 608 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021962.1 protein_id gnl|my_center|LOCUS_02690 642 1112 gene locus_tag LOCUS_02700 642 1112 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_02700 1281 3335 gene locus_tag LOCUS_02710 gene ptsP 1281 3335 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_02710 3528 4043 gene locus_tag LOCUS_02720 3528 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02720 4057 5577 gene locus_tag LOCUS_02730 4057 5577 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328924.1 protein_id gnl|my_center|LOCUS_02730 5690 6010 gene locus_tag LOCUS_02740 gene rplU 5690 6010 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020642.1 protein_id gnl|my_center|LOCUS_02740 >Feature sequence043 1725 1081 gene locus_tag LOCUS_02750 1725 1081 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_02750 2689 1718 gene locus_tag LOCUS_02760 2689 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_02760 3917 2901 gene locus_tag LOCUS_02770 gene lpxK 3917 2901 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121336.1 protein_id gnl|my_center|LOCUS_02770 4840 4199 gene locus_tag LOCUS_02780 4840 4199 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_02780 5794 4961 gene locus_tag LOCUS_02790 gene thiD 5794 4961 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_02790 >Feature sequence044 1475 249 gene locus_tag LOCUS_02800 1475 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 2589 1528 gene locus_tag LOCUS_02810 2589 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 3242 2484 gene locus_tag LOCUS_02820 3242 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 3798 3268 gene locus_tag LOCUS_02830 3798 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 5221 3779 gene locus_tag LOCUS_02840 5221 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 5805 5218 gene locus_tag LOCUS_02850 5805 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 6046 5958 gene locus_tag LOCUS_t00020 6046 5958 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence045 73 840 gene locus_tag LOCUS_02860 73 840 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920552.1 protein_id gnl|my_center|LOCUS_02860 1382 1131 gene locus_tag LOCUS_02870 1382 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 1447 1617 gene locus_tag LOCUS_02880 1447 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 1620 1976 gene locus_tag LOCUS_02890 1620 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 1934 2176 gene locus_tag LOCUS_02900 1934 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 2173 2325 gene locus_tag LOCUS_02910 2173 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 2325 3206 gene locus_tag LOCUS_02920 2325 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 3190 4047 gene locus_tag LOCUS_02930 3190 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 4120 4605 gene locus_tag LOCUS_02940 4120 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 4598 4786 gene locus_tag LOCUS_02950 4598 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 4838 4911 gene locus_tag LOCUS_t00030 4838 4911 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5019 5378 gene locus_tag LOCUS_02960 5019 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 5372 5761 gene locus_tag LOCUS_02970 5372 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 5892 6032 gene locus_tag LOCUS_02980 5892 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 >Feature sequence046 2232 625 gene locus_tag LOCUS_02990 2232 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 5073 2647 gene locus_tag LOCUS_03000 5073 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 <6175 5168 gene locus_tag LOCUS_03010 <6175 5168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001079544.1:cytochrome c peroxidase >Feature sequence047 <1 2363 gene locus_tag LOCUS_03020 <1 2363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391785.1:Ig-like domain-containing protein 2368 2964 gene locus_tag LOCUS_03030 2368 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 2992 4047 gene locus_tag LOCUS_03040 2992 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 4322 4053 gene locus_tag LOCUS_03050 4322 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 <6151 4635 gene locus_tag LOCUS_03060 <6151 4635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393440.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPB >Feature sequence048 3825 2683 gene locus_tag LOCUS_03070 3825 2683 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_03070 3957 4139 gene locus_tag LOCUS_03080 3957 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 4253 4498 gene locus_tag LOCUS_03090 4253 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 5209 4907 gene locus_tag LOCUS_03100 5209 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 <6109 5216 gene locus_tag LOCUS_03110 <6109 5216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124396.1:sodium-dependent bicarbonate transport family permease >Feature sequence049 7 294 gene locus_tag LOCUS_03120 7 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 432 893 gene locus_tag LOCUS_03130 gene bcp 432 893 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142372.1 protein_id gnl|my_center|LOCUS_03130 1429 1001 gene locus_tag LOCUS_03140 1429 1001 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460051.1 protein_id gnl|my_center|LOCUS_03140 2335 1571 gene locus_tag LOCUS_03150 2335 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 2603 3070 gene locus_tag LOCUS_03160 2603 3070 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249247.1 protein_id gnl|my_center|LOCUS_03160 3986 3129 gene locus_tag LOCUS_03170 3986 3129 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361083.1 protein_id gnl|my_center|LOCUS_03170 4735 4001 gene locus_tag LOCUS_03180 4735 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 5298 4780 gene locus_tag LOCUS_03190 gene raiA 5298 4780 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957331.1 protein_id gnl|my_center|LOCUS_03190 5398 5325 gene locus_tag LOCUS_t00040 5398 5325 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 <6087 5400 gene locus_tag LOCUS_03200 <6087 5400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941035.1:TIGR01212 family radical SAM protein >Feature sequence050 1170 871 gene locus_tag LOCUS_03210 1170 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 2276 1548 gene locus_tag LOCUS_03220 2276 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 2306 2491 gene locus_tag LOCUS_03230 2306 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 3583 2588 gene locus_tag LOCUS_03240 3583 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 4237 3842 gene locus_tag LOCUS_03250 4237 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 5580 4369 gene locus_tag LOCUS_03260 5580 4369 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856207.1 protein_id gnl|my_center|LOCUS_03260 >Feature sequence051 1861 629 gene locus_tag LOCUS_03270 gene fabF 1861 629 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_03270 3314 2103 gene locus_tag LOCUS_03280 gene fabF 3314 2103 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_03280 4908 3427 gene locus_tag LOCUS_03290 4908 3427 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_03290 5291 4905 gene locus_tag LOCUS_03300 gene acpS 5291 4905 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861979.1 protein_id gnl|my_center|LOCUS_03300 >Feature sequence052 2631 2233 gene locus_tag LOCUS_03310 2631 2233 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_03310 4484 2694 gene locus_tag LOCUS_03320 4484 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 <6001 5026 gene locus_tag LOCUS_03330 <6001 5026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206818499.1:response regulator >Feature sequence053 2544 1924 gene locus_tag LOCUS_03340 2544 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 3283 2996 gene locus_tag LOCUS_03350 3283 2996 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816231.1 protein_id gnl|my_center|LOCUS_03350 3561 3283 gene locus_tag LOCUS_03360 3561 3283 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605676.1 protein_id gnl|my_center|LOCUS_03360 4542 3979 gene locus_tag LOCUS_03370 4542 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 >Feature sequence054 1612 152 gene locus_tag LOCUS_03380 1612 152 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_03380 2162 2350 gene locus_tag LOCUS_03390 2162 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 3212 2271 gene locus_tag LOCUS_03400 3212 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 4632 3187 gene locus_tag LOCUS_03410 4632 3187 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073935.1 protein_id gnl|my_center|LOCUS_03410 5702 4629 gene locus_tag LOCUS_03420 5702 4629 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103242.1 protein_id gnl|my_center|LOCUS_03420 >Feature sequence055 2300 342 gene locus_tag LOCUS_03430 2300 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 2582 3052 gene locus_tag LOCUS_03440 2582 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 3351 3130 gene locus_tag LOCUS_03450 3351 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03450 3516 3355 gene locus_tag LOCUS_03460 3516 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 4476 3547 gene locus_tag LOCUS_03470 4476 3547 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_03470 5798 4713 gene locus_tag LOCUS_03480 5798 4713 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024691572.1 protein_id gnl|my_center|LOCUS_03480 >Feature sequence056 1231 545 gene locus_tag LOCUS_03490 gene ispD 1231 545 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048363.1 protein_id gnl|my_center|LOCUS_03490 2466 1312 gene locus_tag LOCUS_03500 2466 1312 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_03500 2955 2479 gene locus_tag LOCUS_03510 2955 2479 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_03510 3677 3270 gene locus_tag LOCUS_03520 3677 3270 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071464.1 protein_id gnl|my_center|LOCUS_03520 4534 3734 gene locus_tag LOCUS_03530 4534 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 5027 4851 gene locus_tag LOCUS_03540 5027 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 >Feature sequence057 441 2105 gene locus_tag LOCUS_03550 441 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 2298 5525 gene locus_tag LOCUS_03560 2298 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 >Feature sequence058 2 541 gene locus_tag LOCUS_03570 2 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 555 1754 gene locus_tag LOCUS_03580 gene spoVE 555 1754 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 protein_id gnl|my_center|LOCUS_03580 1873 2997 gene locus_tag LOCUS_03590 gene murG 1873 2997 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_03590 3224 4546 gene locus_tag LOCUS_03600 gene murC 3224 4546 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_03600 4563 5567 gene locus_tag LOCUS_03610 4563 5567 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_03610 >Feature sequence059 874 323 gene locus_tag LOCUS_03620 874 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03620 1422 877 gene locus_tag LOCUS_03630 gene gmk 1422 877 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_03630 2346 1462 gene locus_tag LOCUS_03640 2346 1462 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_03640 3019 2423 gene locus_tag LOCUS_03650 3019 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 3785 3057 gene locus_tag LOCUS_03660 gene tpiA 3785 3057 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902187.1 protein_id gnl|my_center|LOCUS_03660 4924 3842 gene locus_tag LOCUS_03670 gene pheA 4924 3842 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_03670 >Feature sequence060 3496 116 gene locus_tag LOCUS_03680 3496 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 <5712 3536 gene locus_tag LOCUS_03690 <5712 3536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924872.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence061 1883 1500 gene locus_tag LOCUS_03700 1883 1500 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405056.1 protein_id gnl|my_center|LOCUS_03700 2900 1956 gene locus_tag LOCUS_03710 2900 1956 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_03710 3044 3181 gene locus_tag LOCUS_03720 3044 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 3412 4221 gene locus_tag LOCUS_03730 3412 4221 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_03730 5568 4360 gene locus_tag LOCUS_03740 5568 4360 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986928.1 protein_id gnl|my_center|LOCUS_03740 >Feature sequence062 1762 422 gene locus_tag LOCUS_03750 1762 422 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_03750 2596 2333 gene locus_tag LOCUS_03760 2596 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 5341 3284 gene locus_tag LOCUS_03770 5341 3284 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence063 555 298 gene locus_tag LOCUS_03780 555 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 3097 668 gene locus_tag LOCUS_03790 3097 668 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_03790 3957 3172 gene locus_tag LOCUS_03800 3957 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 5271 3991 gene locus_tag LOCUS_03810 5271 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence064 193 759 gene locus_tag LOCUS_03820 193 759 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021943.1 protein_id gnl|my_center|LOCUS_03820 820 1488 gene locus_tag LOCUS_03830 820 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 1499 3310 gene locus_tag LOCUS_03840 1499 3310 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258690.1 protein_id gnl|my_center|LOCUS_03840 3402 3716 gene locus_tag LOCUS_03850 3402 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 >Feature sequence065 2430 172 gene locus_tag LOCUS_03860 2430 172 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_03860 3726 3007 gene locus_tag LOCUS_03870 3726 3007 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122349.1 protein_id gnl|my_center|LOCUS_03870 5488 4247 gene locus_tag LOCUS_03880 5488 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 >Feature sequence066 <1 1810 gene locus_tag LOCUS_03890 <1 1810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980092.1:glycoside hydrolase family 15 protein 2308 1826 gene locus_tag LOCUS_03900 gene bfr 2308 1826 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_03900 2795 4036 gene locus_tag LOCUS_03910 2795 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 4066 4488 gene locus_tag LOCUS_03920 4066 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 4572 5294 gene locus_tag LOCUS_03930 4572 5294 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_03930 >Feature sequence067 469 1803 gene locus_tag LOCUS_03940 gene der 469 1803 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330049.1 protein_id gnl|my_center|LOCUS_03940 1855 2538 gene locus_tag LOCUS_03950 1855 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 2734 3123 gene locus_tag LOCUS_03960 2734 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 5294 3360 gene locus_tag LOCUS_03970 5294 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 >Feature sequence068 >Feature sequence069 395 796 gene locus_tag LOCUS_03980 395 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 721 987 gene locus_tag LOCUS_03990 721 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03990 1682 1107 gene locus_tag LOCUS_04000 1682 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 3032 1683 gene locus_tag LOCUS_04010 gene rimO 3032 1683 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198793.1 protein_id gnl|my_center|LOCUS_04010 <5368 3034 gene locus_tag LOCUS_04020 <5368 3034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123442.1:DNA translocase FtsK >Feature sequence070 1249 389 gene locus_tag LOCUS_04030 1249 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 1659 1276 gene locus_tag LOCUS_04040 gene rpsM 1659 1276 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_04040 2067 1849 gene locus_tag LOCUS_04050 gene infA 2067 1849 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_04050 2837 2085 gene locus_tag LOCUS_04060 gene map 2837 2085 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_04060 3520 2834 gene locus_tag LOCUS_04070 3520 2834 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_04070 4899 3517 gene locus_tag LOCUS_04080 gene secY 4899 3517 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326816.1 protein_id gnl|my_center|LOCUS_04080 >Feature sequence071 93 941 gene locus_tag LOCUS_04090 93 941 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_04090 948 1985 gene locus_tag LOCUS_04100 948 1985 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723624.1 protein_id gnl|my_center|LOCUS_04100 2499 3902 gene locus_tag LOCUS_04110 2499 3902 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_04110 4001 4261 gene locus_tag LOCUS_04120 4001 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 4258 4677 gene locus_tag LOCUS_04130 4258 4677 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846620.1 protein_id gnl|my_center|LOCUS_04130 5330 4920 gene locus_tag LOCUS_04140 5330 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 >Feature sequence072 1684 575 gene locus_tag LOCUS_04150 1684 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 3681 1681 gene locus_tag LOCUS_04160 3681 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 4628 3684 gene locus_tag LOCUS_04170 4628 3684 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878124.1 protein_id gnl|my_center|LOCUS_04170 >Feature sequence073 146 334 gene locus_tag LOCUS_04180 146 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 331 1197 gene locus_tag LOCUS_04190 331 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 1200 1418 gene locus_tag LOCUS_04200 1200 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 1921 1580 gene locus_tag LOCUS_04210 1921 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 2408 1974 gene locus_tag LOCUS_04220 2408 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 4284 2503 gene locus_tag LOCUS_04230 gene fliD 4284 2503 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198208.1 protein_id gnl|my_center|LOCUS_04230 5303 4377 gene locus_tag LOCUS_04240 gene lafA 5303 4377 CDS product lateral flagellin LafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949083.1 protein_id gnl|my_center|LOCUS_04240 >Feature sequence074 <1 910 gene locus_tag LOCUS_04250 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786528.1:3'(2'),5'-bisphosphate nucleotidase CysQ 1147 1392 gene locus_tag LOCUS_04260 1147 1392 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963300.1 protein_id gnl|my_center|LOCUS_04260 1431 2228 gene locus_tag LOCUS_04270 1431 2228 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_04270 2159 2338 gene locus_tag LOCUS_04280 2159 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 3136 2480 gene locus_tag LOCUS_04290 3136 2480 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792164.1 protein_id gnl|my_center|LOCUS_04290 4583 3366 gene locus_tag LOCUS_04300 gene tyrS 4583 3366 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_04300 <5299 4764 gene locus_tag LOCUS_04310 <5299 4764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057727.1:type II CAAX endopeptidase family protein >Feature sequence075 671 228 gene locus_tag LOCUS_04320 671 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 717 1112 gene locus_tag LOCUS_04330 717 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 1753 3576 gene locus_tag LOCUS_04340 1753 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 <5285 4118 gene locus_tag LOCUS_04350 <5285 4118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970308.1:DEAD/DEAH box helicase family protein >Feature sequence076 493 750 gene locus_tag LOCUS_04360 493 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 725 1138 gene locus_tag LOCUS_04370 725 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 3248 1368 gene locus_tag LOCUS_04380 3248 1368 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065589.1 protein_id gnl|my_center|LOCUS_04380 >Feature sequence077 2431 254 gene locus_tag LOCUS_04390 2431 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 3596 2772 gene locus_tag LOCUS_04400 3596 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 3976 4374 gene locus_tag LOCUS_04410 3976 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 >Feature sequence078 563 1252 gene locus_tag LOCUS_04420 gene mqnB 563 1252 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228023.1 protein_id gnl|my_center|LOCUS_04420 1336 2169 gene locus_tag LOCUS_04430 1336 2169 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940021.1 protein_id gnl|my_center|LOCUS_04430 2220 3983 gene locus_tag LOCUS_04440 2220 3983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583044.1 protein_id gnl|my_center|LOCUS_04440 4234 4686 gene locus_tag LOCUS_04450 4234 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 >Feature sequence079 579 271 gene locus_tag LOCUS_04460 579 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 1057 569 gene locus_tag LOCUS_04470 1057 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 2379 1666 gene locus_tag LOCUS_04480 2379 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 3788 2511 gene locus_tag LOCUS_04490 3788 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 4290 3775 gene locus_tag LOCUS_04500 4290 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 >Feature sequence080 1003 227 gene locus_tag LOCUS_04510 1003 227 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_04510 1637 1110 gene locus_tag LOCUS_04520 1637 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 1823 3022 gene locus_tag LOCUS_04530 1823 3022 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879946.1 protein_id gnl|my_center|LOCUS_04530 3694 4638 gene locus_tag LOCUS_04540 3694 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 5043 5119 gene locus_tag LOCUS_t00050 5043 5119 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence081 374 2968 gene locus_tag LOCUS_04550 374 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 3904 2999 gene locus_tag LOCUS_04560 gene xerD 3904 2999 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723602.1 protein_id gnl|my_center|LOCUS_04560 >Feature sequence082 1679 909 gene locus_tag LOCUS_04570 1679 909 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815859.1 protein_id gnl|my_center|LOCUS_04570 3438 1663 gene locus_tag LOCUS_04580 3438 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 5054 3507 gene locus_tag LOCUS_04590 5054 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 >Feature sequence083 435 2510 gene locus_tag LOCUS_04600 435 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 2540 2905 gene locus_tag LOCUS_04610 2540 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 2909 3790 gene locus_tag LOCUS_04620 2909 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 3774 4811 gene locus_tag LOCUS_04630 3774 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 >Feature sequence084 1914 502 gene locus_tag LOCUS_04640 1914 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 2511 2068 gene locus_tag LOCUS_04650 2511 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 2793 2512 gene locus_tag LOCUS_04660 2793 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 3582 3926 gene locus_tag LOCUS_04670 3582 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04670 4011 4691 gene locus_tag LOCUS_04680 4011 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 >Feature sequence085 714 526 gene locus_tag LOCUS_04690 714 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 1765 1226 gene locus_tag LOCUS_04700 1765 1226 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_04700 3274 1787 gene locus_tag LOCUS_04710 gene aroE 3274 1787 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_04710 4847 3327 gene locus_tag LOCUS_04720 4847 3327 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_04720 >Feature sequence086 91 315 gene locus_tag LOCUS_04730 91 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 677 3322 gene locus_tag LOCUS_04740 677 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 >Feature sequence087 1063 245 gene locus_tag LOCUS_04750 gene lpxI 1063 245 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_04750 2168 1056 gene locus_tag LOCUS_04760 gene lpxD 2168 1056 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_04760 2916 2140 gene locus_tag LOCUS_04770 2916 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 3407 3679 gene locus_tag LOCUS_04780 3407 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 3993 4898 gene locus_tag LOCUS_04790 gene trpC 3993 4898 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence088 191 1378 gene locus_tag LOCUS_04800 191 1378 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880128.1 protein_id gnl|my_center|LOCUS_04800 1570 2547 gene locus_tag LOCUS_04810 gene trpS 1570 2547 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173293.1 protein_id gnl|my_center|LOCUS_04810 2736 4433 gene locus_tag LOCUS_04820 gene argS 2736 4433 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_04820 4998 4486 gene locus_tag LOCUS_04830 4998 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence089 437 1105 gene locus_tag LOCUS_04840 437 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 1697 2908 gene locus_tag LOCUS_04850 1697 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 >Feature sequence090 3804 3310 gene locus_tag LOCUS_04860 3804 3310 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225333.1 protein_id gnl|my_center|LOCUS_04860 <5012 4202 gene locus_tag LOCUS_04870 <5012 4202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140144.1:exodeoxyribonuclease III >Feature sequence091 843 541 gene locus_tag LOCUS_04880 843 541 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_04880 1054 854 gene locus_tag LOCUS_04890 1054 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 3907 1649 gene locus_tag LOCUS_04900 3907 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 4575 3904 gene locus_tag LOCUS_04910 4575 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 >Feature sequence092 210 608 gene locus_tag LOCUS_04920 210 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04920 673 1119 gene locus_tag LOCUS_04930 673 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 2131 1292 gene locus_tag LOCUS_04940 2131 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 2436 2627 gene locus_tag LOCUS_04950 2436 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 3088 3468 gene locus_tag LOCUS_04960 3088 3468 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679887.1 protein_id gnl|my_center|LOCUS_04960 3474 3950 gene locus_tag LOCUS_04970 gene lspA 3474 3950 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546319.1 protein_id gnl|my_center|LOCUS_04970 4810 3947 gene locus_tag LOCUS_04980 gene ilvE 4810 3947 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_04980 >Feature sequence093 2141 1095 gene locus_tag LOCUS_04990 gene argC 2141 1095 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_04990 2466 2239 gene locus_tag LOCUS_05000 2466 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 <4919 2532 gene locus_tag LOCUS_05010 <4919 2532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583909.1:endopeptidase La >Feature sequence094 819 1439 gene locus_tag LOCUS_05020 819 1439 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_05020 1552 4374 gene locus_tag LOCUS_05030 1552 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 4582 4818 gene locus_tag LOCUS_05040 4582 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 >Feature sequence095 2565 1081 gene locus_tag LOCUS_05050 gene gatA 2565 1081 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_05050 2880 2593 gene locus_tag LOCUS_05060 gene gatC 2880 2593 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_05060 3169 3011 gene locus_tag LOCUS_05070 3169 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3617 3186 gene locus_tag LOCUS_05080 3617 3186 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930868.1 protein_id gnl|my_center|LOCUS_05080 3819 3717 gene locus_tag LOCUS_r00010 3819 3717 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence096 4135 2174 gene locus_tag LOCUS_05090 gene cooS 4135 2174 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_05090 <4880 4291 gene locus_tag LOCUS_05100 <4880 4291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460477.1:carbon monoxide dehydrogenase accessory protein CooC >Feature sequence097 2781 1537 gene locus_tag LOCUS_05110 gene fabF 2781 1537 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_05110 4601 2775 gene locus_tag LOCUS_05120 4601 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 >Feature sequence098 388 1449 gene locus_tag LOCUS_05130 gene cobT 388 1449 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_05130 1977 1462 gene locus_tag LOCUS_05140 1977 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05140 2873 2001 gene locus_tag LOCUS_05150 2873 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05150 3048 3533 gene locus_tag LOCUS_05160 3048 3533 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_05160 3613 4038 gene locus_tag LOCUS_05170 gene arfB 3613 4038 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090218.1 protein_id gnl|my_center|LOCUS_05170 4116 4655 gene locus_tag LOCUS_05180 4116 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 >Feature sequence099 1268 2362 gene locus_tag LOCUS_05190 gene gnfL 1268 2362 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_05190 2493 3839 gene locus_tag LOCUS_05200 2493 3839 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_05200 >Feature sequence100 3812 342 gene locus_tag LOCUS_05210 3812 342 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence101 1944 1552 gene locus_tag LOCUS_05220 1944 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 3304 1928 gene locus_tag LOCUS_05230 3304 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 <4763 3858 gene locus_tag LOCUS_05240 <4763 3858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061277.1:ABC transporter permease >Feature sequence102 630 1010 gene locus_tag LOCUS_05250 630 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 1023 1292 gene locus_tag LOCUS_05260 1023 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 1706 2170 gene locus_tag LOCUS_05270 1706 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2154 2351 gene locus_tag LOCUS_05280 2154 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence103 <1 795 gene locus_tag LOCUS_05290 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000411056.1:Xaa-Pro dipeptidase 1006 1470 gene locus_tag LOCUS_05300 gene accB 1006 1470 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472859.1 protein_id gnl|my_center|LOCUS_05300 1523 2878 gene locus_tag LOCUS_05310 gene accC 1523 2878 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_05310 3013 3723 gene locus_tag LOCUS_05320 3013 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 >Feature sequence104 <1 2346 gene locus_tag LOCUS_05330 <1 2346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933671.1:mechanosensitive ion channel 2587 3825 gene locus_tag LOCUS_05340 2587 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 3843 4574 gene locus_tag LOCUS_05350 3843 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 >Feature sequence105 3561 1234 gene locus_tag LOCUS_05360 3561 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 >Feature sequence106 2333 399 gene locus_tag LOCUS_05370 gene dxs 2333 399 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_05370 2632 2384 gene locus_tag LOCUS_05380 2632 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 3962 2718 gene locus_tag LOCUS_05390 gene xseA 3962 2718 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_05390 <4691 3963 gene locus_tag LOCUS_05400 <4691 3963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941799.1:TIGR00282 family metallophosphoesterase >Feature sequence107 <1 642 gene locus_tag LOCUS_05410 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933839.1:50S ribosomal protein L2 676 957 gene locus_tag LOCUS_05420 gene rpsS 676 957 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326800.1 protein_id gnl|my_center|LOCUS_05420 1006 1368 gene locus_tag LOCUS_05430 gene rplV 1006 1368 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356206.1 protein_id gnl|my_center|LOCUS_05430 1382 2080 gene locus_tag LOCUS_05440 gene rpsC 1382 2080 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326802.1 protein_id gnl|my_center|LOCUS_05440 2025 2444 gene locus_tag LOCUS_05450 gene rplP 2025 2444 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121605.1 protein_id gnl|my_center|LOCUS_05450 2441 2671 gene locus_tag LOCUS_05460 2441 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 2668 2937 gene locus_tag LOCUS_05470 gene rpsQ 2668 2937 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503489.1 protein_id gnl|my_center|LOCUS_05470 2958 3326 gene locus_tag LOCUS_05480 gene rplN 2958 3326 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326806.1 protein_id gnl|my_center|LOCUS_05480 3373 3708 gene locus_tag LOCUS_05490 gene rplX 3373 3708 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459102.1 protein_id gnl|my_center|LOCUS_05490 3727 4269 gene locus_tag LOCUS_05500 gene rplE 3727 4269 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288671.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence108 1670 366 gene locus_tag LOCUS_05510 1670 366 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_05510 2500 1778 gene locus_tag LOCUS_05520 2500 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 2905 3630 gene locus_tag LOCUS_05530 2905 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 4535 3627 gene locus_tag LOCUS_05540 4535 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05540 >Feature sequence109 504 734 gene locus_tag LOCUS_05550 gene tatA 504 734 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631606.1 protein_id gnl|my_center|LOCUS_05550 2401 3153 gene locus_tag LOCUS_05560 2401 3153 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_05560 3242 4585 gene locus_tag LOCUS_05570 3242 4585 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393971.1 protein_id gnl|my_center|LOCUS_05570 >Feature sequence110 272 1069 gene locus_tag LOCUS_05580 272 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 1420 1112 gene locus_tag LOCUS_05590 1420 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05590 2032 1556 gene locus_tag LOCUS_05600 2032 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05600 2161 3966 gene locus_tag LOCUS_05610 gene uvrC 2161 3966 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_05610 >Feature sequence111 2343 1129 gene locus_tag LOCUS_05620 2343 1129 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875712.1 protein_id gnl|my_center|LOCUS_05620 4258 2513 gene locus_tag LOCUS_05630 4258 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence112 <1 663 gene locus_tag LOCUS_05640 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966369.1:sigma 54-interacting transcriptional regulator 760 2154 gene locus_tag LOCUS_05650 760 2154 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_05650 2151 3380 gene locus_tag LOCUS_05660 gene fabF 2151 3380 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_05660 >Feature sequence113 1248 736 gene locus_tag LOCUS_05670 1248 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 2417 1380 gene locus_tag LOCUS_05680 2417 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 3289 2414 gene locus_tag LOCUS_05690 3289 2414 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_05690 4345 3356 gene locus_tag LOCUS_05700 4345 3356 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_05700 >Feature sequence114 2810 1680 gene locus_tag LOCUS_05710 2810 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 3987 2860 gene locus_tag LOCUS_05720 3987 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 >Feature sequence115 <1 1285 gene locus_tag LOCUS_05730 <1 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389138.1:two-component system sensor histidine kinase AtoS 1354 2748 gene locus_tag LOCUS_05740 1354 2748 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_05740 2885 3262 gene locus_tag LOCUS_05750 gene flgB 2885 3262 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_05750 3275 3718 gene locus_tag LOCUS_05760 gene flgC 3275 3718 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546004.1 protein_id gnl|my_center|LOCUS_05760 3730 4032 gene locus_tag LOCUS_05770 gene fliE 3730 4032 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941077.1 protein_id gnl|my_center|LOCUS_05770 >Feature sequence116 495 262 gene locus_tag LOCUS_05780 495 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 1172 507 gene locus_tag LOCUS_05790 1172 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 1279 1419 gene locus_tag LOCUS_05800 1279 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 3012 1891 gene locus_tag LOCUS_05810 3012 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227417.1 protein_id gnl|my_center|LOCUS_05810 >Feature sequence117 3828 715 gene locus_tag LOCUS_05820 3828 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05820 <4512 3963 gene locus_tag LOCUS_05830 <4512 3963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003132130.1:radical SAM protein >Feature sequence118 <4482 2821 gene locus_tag LOCUS_05840 <4482 2821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941293.1:methyltransferase domain-containing protein >Feature sequence119 196 522 gene locus_tag LOCUS_05850 196 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 553 2262 gene locus_tag LOCUS_05860 gene recN 553 2262 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_05860 2268 3065 gene locus_tag LOCUS_05870 2268 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 3102 4442 gene locus_tag LOCUS_05880 gene thiC 3102 4442 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941266.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence120 412 203 gene locus_tag LOCUS_05890 412 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 1221 496 gene locus_tag LOCUS_05900 1221 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 2263 1499 gene locus_tag LOCUS_05910 2263 1499 CDS product PmeII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233708.1 protein_id gnl|my_center|LOCUS_05910 3104 2223 gene locus_tag LOCUS_05920 3104 2223 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256554.1 protein_id gnl|my_center|LOCUS_05920 <4477 3308 gene locus_tag LOCUS_05930 <4477 3308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272308.1:DEAD/DEAH box helicase >Feature sequence121 <1 554 gene locus_tag LOCUS_05940 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942659.1:EAL domain-containing protein 682 1815 gene locus_tag LOCUS_05950 682 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 2218 3855 gene locus_tag LOCUS_05960 gene groL 2218 3855 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_05960 >Feature sequence122 1742 2596 gene locus_tag LOCUS_05970 1742 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 3192 2593 gene locus_tag LOCUS_05980 3192 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 3335 3156 gene locus_tag LOCUS_05990 3335 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 4126 3344 gene locus_tag LOCUS_06000 gene soj 4126 3344 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence123 636 1304 gene locus_tag LOCUS_06010 636 1304 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_06010 1301 2689 gene locus_tag LOCUS_06020 1301 2689 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_06020 3489 3941 gene locus_tag LOCUS_06030 3489 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 >Feature sequence124 227 721 gene locus_tag LOCUS_06040 227 721 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_06040 2101 857 gene locus_tag LOCUS_06050 2101 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2172 2324 gene locus_tag LOCUS_06060 2172 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 3439 3017 gene locus_tag LOCUS_06070 3439 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 <4430 3880 gene locus_tag LOCUS_06080 <4430 3880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965461.1:molybdopterin-dependent oxidoreductase >Feature sequence125 226 465 gene locus_tag LOCUS_06090 226 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 462 869 gene locus_tag LOCUS_06100 462 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 1256 1729 gene locus_tag LOCUS_06110 1256 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 1731 1907 gene locus_tag LOCUS_06120 1731 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 3207 2830 gene locus_tag LOCUS_06130 3207 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 >Feature sequence126 856 4320 gene locus_tag LOCUS_06140 856 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 >Feature sequence127 1243 251 gene locus_tag LOCUS_06150 1243 251 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119981.1 protein_id gnl|my_center|LOCUS_06150 2091 1240 gene locus_tag LOCUS_06160 2091 1240 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583559.1 protein_id gnl|my_center|LOCUS_06160 2804 2088 gene locus_tag LOCUS_06170 2804 2088 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_06170 4096 2801 gene locus_tag LOCUS_06180 4096 2801 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545033.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence128 741 220 gene locus_tag LOCUS_06190 741 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 1299 1694 gene locus_tag LOCUS_06200 1299 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 2267 1809 gene locus_tag LOCUS_06210 2267 1809 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707183.1 protein_id gnl|my_center|LOCUS_06210 3292 2294 gene locus_tag LOCUS_06220 gene amrS 3292 2294 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_06220 >Feature sequence129 910 1755 gene locus_tag LOCUS_06230 910 1755 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_06230 3315 1813 gene locus_tag LOCUS_06240 3315 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 <4359 3475 gene locus_tag LOCUS_06250 <4359 3475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140889.1:arsenosugar biosynthesis radical SAM protein ArsS >Feature sequence130 <1 506 gene locus_tag LOCUS_06260 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_022771536.1:DUF1566 domain-containing protein 946 1659 gene locus_tag LOCUS_06270 946 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 2286 1927 gene locus_tag LOCUS_06280 2286 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 2453 2274 gene locus_tag LOCUS_06290 2453 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 3346 2801 gene locus_tag LOCUS_06300 3346 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 3826 3404 gene locus_tag LOCUS_06310 3826 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 >Feature sequence131 2528 378 gene locus_tag LOCUS_06320 2528 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 4266 2932 gene locus_tag LOCUS_06330 4266 2932 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_06330 >Feature sequence132 151 633 gene locus_tag LOCUS_06340 151 633 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_06340 709 1785 gene locus_tag LOCUS_06350 709 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 1788 2354 gene locus_tag LOCUS_06360 1788 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 2788 3138 gene locus_tag LOCUS_06370 2788 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 3116 3304 gene locus_tag LOCUS_06380 3116 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 3650 3504 gene locus_tag LOCUS_06390 3650 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 >Feature sequence133 1137 2138 gene locus_tag LOCUS_06400 1137 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence134 2152 3177 gene locus_tag LOCUS_06410 2152 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027361.1 protein_id gnl|my_center|LOCUS_06410 3237 4247 gene locus_tag LOCUS_06420 3237 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031363.1 protein_id gnl|my_center|LOCUS_06420 >Feature sequence135 93 1577 gene locus_tag LOCUS_06430 93 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 >Feature sequence136 930 349 gene locus_tag LOCUS_06440 930 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 3020 927 gene locus_tag LOCUS_06450 3020 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 <4292 3522 gene locus_tag LOCUS_06460 <4292 3522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080510933.1:formate dehydrogenase subunit alpha >Feature sequence137 161 3757 gene locus_tag LOCUS_06470 161 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 3939 4127 gene locus_tag LOCUS_06480 3939 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 >Feature sequence138 2394 880 gene locus_tag LOCUS_06490 gene guaB 2394 880 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070955.1 protein_id gnl|my_center|LOCUS_06490 <4275 2531 gene locus_tag LOCUS_06500 <4275 2531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_148590534.1:DUF499 domain-containing protein >Feature sequence139 54 821 gene locus_tag LOCUS_06510 54 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2245 1622 gene locus_tag LOCUS_06520 2245 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 2756 2271 gene locus_tag LOCUS_06530 2756 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 3683 3030 gene locus_tag LOCUS_06540 gene thiE 3683 3030 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence140 2788 344 gene locus_tag LOCUS_06550 gene gyrB 2788 344 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995225.1 protein_id gnl|my_center|LOCUS_06550 3122 2841 gene locus_tag LOCUS_06560 3122 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 4251 3151 gene locus_tag LOCUS_06570 gene dnaN 4251 3151 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058182.1 protein_id gnl|my_center|LOCUS_06570 >Feature sequence141 339 923 gene locus_tag LOCUS_06580 339 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 1615 2439 gene locus_tag LOCUS_06590 1615 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 >Feature sequence142 2622 811 gene locus_tag LOCUS_06600 2622 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 3752 2610 gene locus_tag LOCUS_06610 3752 2610 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence143 50 1144 gene locus_tag LOCUS_06620 50 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 1333 2187 gene locus_tag LOCUS_06630 1333 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 3600 2545 gene locus_tag LOCUS_06640 3600 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence144 >Feature sequence145 298 489 gene locus_tag LOCUS_06650 298 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 595 2130 gene locus_tag LOCUS_06660 595 2130 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_06660 2705 2145 gene locus_tag LOCUS_06670 gene rfbC 2705 2145 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_06670 3573 2707 gene locus_tag LOCUS_06680 gene rfbA 3573 2707 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721498.1 protein_id gnl|my_center|LOCUS_06680 <4193 3686 gene locus_tag LOCUS_06690 <4193 3686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869951.1:penicillin-binding protein 2 >Feature sequence146 692 1348 gene locus_tag LOCUS_06700 692 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 1380 2102 gene locus_tag LOCUS_06710 1380 2102 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_06710 3777 2197 gene locus_tag LOCUS_06720 gene serA 3777 2197 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence147 898 1989 gene locus_tag LOCUS_06730 898 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 2088 3125 gene locus_tag LOCUS_06740 2088 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 3136 4041 gene locus_tag LOCUS_06750 3136 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 >Feature sequence148 620 123 gene locus_tag LOCUS_06760 620 123 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_06760 <4158 788 gene locus_tag LOCUS_06770 <4158 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467599.1:RHS repeat-associated core domain-containing protein >Feature sequence149 249 1145 gene locus_tag LOCUS_06780 249 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 1246 1440 gene locus_tag LOCUS_06790 1246 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 1775 3295 gene locus_tag LOCUS_06800 1775 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 >Feature sequence150 1557 592 gene locus_tag LOCUS_06810 1557 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 3480 2002 gene locus_tag LOCUS_06820 3480 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 3974 3576 gene locus_tag LOCUS_06830 3974 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence151 >Feature sequence152 1531 2505 gene locus_tag LOCUS_06840 1531 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 2546 3757 gene locus_tag LOCUS_06850 2546 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 >Feature sequence153 <1 883 gene locus_tag LOCUS_06860 <1 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020657.1:pyruvate, phosphate dikinase 1945 1292 gene locus_tag LOCUS_06870 1945 1292 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_06870 3757 2177 gene locus_tag LOCUS_06880 3757 2177 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839239.1 protein_id gnl|my_center|LOCUS_06880 >Feature sequence154 782 333 gene locus_tag LOCUS_06890 782 333 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942446.1 protein_id gnl|my_center|LOCUS_06890 1137 1619 gene locus_tag LOCUS_06900 1137 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 2049 1672 gene locus_tag LOCUS_06910 2049 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06910 2213 2034 gene locus_tag LOCUS_06920 2213 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 3761 2220 gene locus_tag LOCUS_06930 3761 2220 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259553.1 protein_id gnl|my_center|LOCUS_06930 4133 3903 gene locus_tag LOCUS_06940 4133 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 >Feature sequence155 988 1875 gene locus_tag LOCUS_06950 988 1875 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846752.1 protein_id gnl|my_center|LOCUS_06950 3530 1899 gene locus_tag LOCUS_06960 3530 1899 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948610.1 protein_id gnl|my_center|LOCUS_06960 >Feature sequence156 864 2309 gene locus_tag LOCUS_06970 864 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 2296 3147 gene locus_tag LOCUS_06980 2296 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 3267 3932 gene locus_tag LOCUS_06990 gene cmk 3267 3932 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence157 413 1678 gene locus_tag LOCUS_07000 413 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 1675 3135 gene locus_tag LOCUS_07010 1675 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 >Feature sequence158 419 231 gene locus_tag LOCUS_07020 419 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 1067 702 gene locus_tag LOCUS_07030 1067 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 1656 1141 gene locus_tag LOCUS_07040 1656 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 2348 1704 gene locus_tag LOCUS_07050 gene nadD 2348 1704 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_07050 2527 3729 gene locus_tag LOCUS_07060 gene larC 2527 3729 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460167.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence159 270 2327 gene locus_tag LOCUS_07070 gene shc 270 2327 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_07070 3000 2797 gene locus_tag LOCUS_07080 3000 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence160 819 1811 gene locus_tag LOCUS_07090 gene hemB 819 1811 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881381.1 protein_id gnl|my_center|LOCUS_07090 2013 2993 gene locus_tag LOCUS_07100 gene waaF 2013 2993 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_07100 3926 2982 gene locus_tag LOCUS_07110 3926 2982 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_07110 >Feature sequence161 <1 2797 gene locus_tag LOCUS_07120 <1 2797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114043.1:ribosome-associated ATPase/putative transporter RbbA 2800 3924 gene locus_tag LOCUS_07130 2800 3924 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301659.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence162 590 87 gene locus_tag LOCUS_07140 gene coaD 590 87 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_07140 3243 604 gene locus_tag LOCUS_07150 3243 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 <4046 3419 gene locus_tag LOCUS_07160 <4046 3419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583708.1:DegT/DnrJ/EryC1/StrS family aminotransferase >Feature sequence163 364 134 gene locus_tag LOCUS_07170 364 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 2577 1858 gene locus_tag LOCUS_07180 2577 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 3302 2577 gene locus_tag LOCUS_07190 gene cmoA 3302 2577 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072410.1 protein_id gnl|my_center|LOCUS_07190 3787 3458 gene locus_tag LOCUS_07200 3787 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 >Feature sequence164 <1 545 gene locus_tag LOCUS_07210 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259182.1:cyclase family protein 826 1905 gene locus_tag LOCUS_07220 gene aroB 826 1905 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_07220 2287 3387 gene locus_tag LOCUS_07230 gene dprA 2287 3387 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922340.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence165 <1 654 gene locus_tag LOCUS_07240 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545015.1:cyclic dehypoxanthinyl futalosine synthase 1979 921 gene locus_tag LOCUS_07250 1979 921 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880158.1 protein_id gnl|my_center|LOCUS_07250 2820 2014 gene locus_tag LOCUS_07260 2820 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 <4028 2932 gene locus_tag LOCUS_07270 <4028 2932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840059.1:PAS domain S-box protein >Feature sequence166 338 1393 gene locus_tag LOCUS_07280 338 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 1845 2864 gene locus_tag LOCUS_07290 gene galT 1845 2864 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence167 780 1286 gene locus_tag LOCUS_07300 780 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 1686 1540 gene locus_tag LOCUS_07310 1686 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 1903 1646 gene locus_tag LOCUS_07320 1903 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2840 1929 gene locus_tag LOCUS_07330 gene folD 2840 1929 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941526.1 protein_id gnl|my_center|LOCUS_07330 <4006 3013 gene locus_tag LOCUS_07340 <4006 3013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869956.1:M20 family metallo-hydrolase >Feature sequence168 427 227 gene locus_tag LOCUS_07350 427 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 2366 552 gene locus_tag LOCUS_07360 gene mnmG 2366 552 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_07360 3962 2370 gene locus_tag LOCUS_07370 gene rny 3962 2370 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287336.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence169 1755 586 gene locus_tag LOCUS_07380 1755 586 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941825.1 protein_id gnl|my_center|LOCUS_07380 2913 1756 gene locus_tag LOCUS_07390 2913 1756 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941824.1 protein_id gnl|my_center|LOCUS_07390 3592 2888 gene locus_tag LOCUS_07400 3592 2888 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence170 1798 1094 gene locus_tag LOCUS_07410 1798 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 2609 1764 gene locus_tag LOCUS_07420 2609 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 <3988 2606 gene locus_tag LOCUS_07430 <3988 2606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942973.1:trehalose-6-phosphate synthase >Feature sequence171 35 1702 gene locus_tag LOCUS_07440 35 1702 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045022.1 protein_id gnl|my_center|LOCUS_07440 1915 3444 gene locus_tag LOCUS_07450 gene trpE 1915 3444 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 protein_id gnl|my_center|LOCUS_07450 3425 3610 gene locus_tag LOCUS_07460 3425 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence172 964 3780 gene locus_tag LOCUS_07470 964 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence173 429 2531 gene locus_tag LOCUS_07480 429 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 >Feature sequence174 669 2399 gene locus_tag LOCUS_07490 669 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 >Feature sequence175 971 1618 gene locus_tag LOCUS_07500 gene fsa 971 1618 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943606.1 protein_id gnl|my_center|LOCUS_07500 1770 1928 gene locus_tag LOCUS_07510 1770 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 1915 2208 gene locus_tag LOCUS_07520 1915 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 2300 3646 gene locus_tag LOCUS_07530 2300 3646 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_07530 >Feature sequence176 844 635 gene locus_tag LOCUS_07540 gene yidD 844 635 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048456.1 protein_id gnl|my_center|LOCUS_07540 1220 825 gene locus_tag LOCUS_07550 gene rnpA 1220 825 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081756.1 protein_id gnl|my_center|LOCUS_07550 2184 1300 gene locus_tag LOCUS_07560 gene rfbD 2184 1300 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_07560 2858 2448 gene locus_tag LOCUS_07570 2858 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07570 3928 2891 gene locus_tag LOCUS_07580 3928 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07580 >Feature sequence177 641 1219 gene locus_tag LOCUS_07590 641 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 <3924 1593 gene locus_tag LOCUS_07600 <3924 1593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467599.1:RHS repeat-associated core domain-containing protein >Feature sequence178 2284 1265 gene locus_tag LOCUS_07610 gene gnd 2284 1265 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_07610 3316 2339 gene locus_tag LOCUS_07620 3316 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence179 390 842 gene locus_tag LOCUS_07630 390 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 1101 3350 gene locus_tag LOCUS_07640 1101 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 3467 3868 gene locus_tag LOCUS_07650 3467 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 >Feature sequence180 789 2465 gene locus_tag LOCUS_07660 789 2465 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963431.1 protein_id gnl|my_center|LOCUS_07660 2462 2791 gene locus_tag LOCUS_07670 2462 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence181 991 134 gene locus_tag LOCUS_07680 991 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07680 1739 1569 gene locus_tag LOCUS_07690 1739 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 <3884 1744 gene locus_tag LOCUS_07700 <3884 1744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022108.1:type I restriction-modification enzyme R subunit C-terminal domain-containing protein >Feature sequence182 378 2057 gene locus_tag LOCUS_07710 378 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881423.1 protein_id gnl|my_center|LOCUS_07710 2087 3013 gene locus_tag LOCUS_07720 2087 3013 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_07720 3063 3782 gene locus_tag LOCUS_07730 3063 3782 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902059.1 protein_id gnl|my_center|LOCUS_07730 >Feature sequence183 681 854 gene locus_tag LOCUS_07740 681 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 946 1986 gene locus_tag LOCUS_07750 946 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 1983 3086 gene locus_tag LOCUS_07760 1983 3086 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583454.1 protein_id gnl|my_center|LOCUS_07760 3173 3817 gene locus_tag LOCUS_07770 3173 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 >Feature sequence184 49 1038 gene locus_tag LOCUS_07780 49 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 1049 1510 gene locus_tag LOCUS_07790 1049 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 1593 3284 gene locus_tag LOCUS_07800 1593 3284 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130055498.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence185 1564 332 gene locus_tag LOCUS_07810 1564 332 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291985.1 protein_id gnl|my_center|LOCUS_07810 2553 1579 gene locus_tag LOCUS_07820 2553 1579 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258974.1 protein_id gnl|my_center|LOCUS_07820 3536 2550 gene locus_tag LOCUS_07830 3536 2550 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence186 579 1448 gene locus_tag LOCUS_07840 579 1448 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_07840 1411 2961 gene locus_tag LOCUS_07850 gene metG 1411 2961 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942872.1 protein_id gnl|my_center|LOCUS_07850 2991 3434 gene locus_tag LOCUS_07860 2991 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 3845 3438 gene locus_tag LOCUS_07870 3845 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 >Feature sequence187 1706 309 gene locus_tag LOCUS_07880 1706 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07880 2488 3501 gene locus_tag LOCUS_07890 2488 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence188 1250 45 gene locus_tag LOCUS_07900 1250 45 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761791.1 protein_id gnl|my_center|LOCUS_07900 2002 1262 gene locus_tag LOCUS_07910 2002 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 2430 2071 gene locus_tag LOCUS_07920 2430 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 2759 2508 gene locus_tag LOCUS_07930 2759 2508 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391974.1 protein_id gnl|my_center|LOCUS_07930 3320 3003 gene locus_tag LOCUS_07940 gene sugE 3320 3003 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932066.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence189 348 76 gene locus_tag LOCUS_07950 348 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 846 349 gene locus_tag LOCUS_07960 846 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 2009 843 gene locus_tag LOCUS_07970 2009 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 3447 2422 gene locus_tag LOCUS_07980 gene thiF 3447 2422 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065438.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence190 1912 974 gene locus_tag LOCUS_07990 1912 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 2706 1978 gene locus_tag LOCUS_08000 2706 1978 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081034.1 protein_id gnl|my_center|LOCUS_08000 <3766 2970 gene locus_tag LOCUS_08010 <3766 2970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926879.1:ABC transporter permease >Feature sequence191 1530 988 gene locus_tag LOCUS_08020 1530 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 <3758 2817 gene locus_tag LOCUS_08030 <3758 2817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776294.1:DNA recombination protein RmuC >Feature sequence192 321 647 gene locus_tag LOCUS_08040 321 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 856 780 gene locus_tag LOCUS_t00060 856 780 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1302 2063 gene locus_tag LOCUS_08050 1302 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 >Feature sequence193 139 984 gene locus_tag LOCUS_08060 gene htpX 139 984 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360263.1 protein_id gnl|my_center|LOCUS_08060 1270 1584 gene locus_tag LOCUS_08070 1270 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 1668 2936 gene locus_tag LOCUS_08080 gene leuC 1668 2936 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence194 582 1019 gene locus_tag LOCUS_08090 gene gspG 582 1019 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_08090 1068 2741 gene locus_tag LOCUS_08100 gene gspE 1068 2741 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691812.1 protein_id gnl|my_center|LOCUS_08100 2925 3152 gene locus_tag LOCUS_08110 2925 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 3665 3279 gene locus_tag LOCUS_08120 3665 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence195 1186 62 gene locus_tag LOCUS_08130 1186 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1488 1216 gene locus_tag LOCUS_08140 gene csrA 1488 1216 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865081.1 protein_id gnl|my_center|LOCUS_08140 1989 1516 gene locus_tag LOCUS_08150 gene fliW 1989 1516 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860685.1 protein_id gnl|my_center|LOCUS_08150 3174 2263 gene locus_tag LOCUS_08160 gene flgL 3174 2263 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence196 359 514 gene locus_tag LOCUS_08170 359 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 3008 1332 gene locus_tag LOCUS_08180 3008 1332 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence197 894 403 gene locus_tag LOCUS_08190 894 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 2357 1437 gene locus_tag LOCUS_08200 2357 1437 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_08200 2382 3134 gene locus_tag LOCUS_08210 2382 3134 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021737.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence198 1583 861 gene locus_tag LOCUS_08220 1583 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 2412 1636 gene locus_tag LOCUS_08230 2412 1636 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625442.1 protein_id gnl|my_center|LOCUS_08230 <3651 2473 gene locus_tag LOCUS_08240 <3651 2473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_088555170.1:FAD-dependent oxidoreductase >Feature sequence199 <1 1206 gene locus_tag LOCUS_08250 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986767.1:HD domain-containing protein 1302 3020 gene locus_tag LOCUS_08260 1302 3020 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545733.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence200 1038 586 gene locus_tag LOCUS_08270 1038 586 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023647.1 protein_id gnl|my_center|LOCUS_08270 2062 1121 gene locus_tag LOCUS_08280 gene trxB 2062 1121 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583127.1 protein_id gnl|my_center|LOCUS_08280 2655 2059 gene locus_tag LOCUS_08290 2655 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 2855 2691 gene locus_tag LOCUS_08300 2855 2691 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249479.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence201 1835 612 gene locus_tag LOCUS_08310 1835 612 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869050.1 protein_id gnl|my_center|LOCUS_08310 1973 1842 gene locus_tag LOCUS_08320 1973 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 <3633 2390 gene locus_tag LOCUS_08330 <3633 2390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027389.1:DEAD/DEAH box helicase family protein >Feature sequence202 1181 288 gene locus_tag LOCUS_08340 1181 288 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_08340 <3596 1232 gene locus_tag LOCUS_08350 <3596 1232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941031.1:ATP-dependent DNA helicase DinG >Feature sequence203 <1 1224 gene locus_tag LOCUS_08360 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941535.1:B12-binding domain-containing radical SAM protein 1545 2786 gene locus_tag LOCUS_08370 1545 2786 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_08370 <3590 2811 gene locus_tag LOCUS_08380 <3590 2811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948187.1:tetratricopeptide repeat protein >Feature sequence204 615 2360 gene locus_tag LOCUS_08390 615 2360 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256851.1 protein_id gnl|my_center|LOCUS_08390 2377 2871 gene locus_tag LOCUS_08400 gene ispF 2377 2871 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_08400 2897 3439 gene locus_tag LOCUS_08410 2897 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence205 1474 827 gene locus_tag LOCUS_08420 1474 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 2736 1471 gene locus_tag LOCUS_08430 2736 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 3000 3158 gene locus_tag LOCUS_08440 3000 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 3436 3155 gene locus_tag LOCUS_08450 3436 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 >Feature sequence206 1161 3326 gene locus_tag LOCUS_08460 1161 3326 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402805.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence207 143 424 gene locus_tag LOCUS_08470 143 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 447 674 gene locus_tag LOCUS_08480 447 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1105 1848 gene locus_tag LOCUS_08490 1105 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1963 2976 gene locus_tag LOCUS_08500 1963 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 >Feature sequence208 1478 2176 gene locus_tag LOCUS_08510 1478 2176 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024087.1 protein_id gnl|my_center|LOCUS_08510 2290 2901 gene locus_tag LOCUS_08520 gene grpE 2290 2901 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence209 <1 3205 gene locus_tag LOCUS_08530 <1 3205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946755.1:CusA/CzcA family heavy metal efflux RND transporter 3307 3501 gene locus_tag LOCUS_08540 3307 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence210 2143 281 gene locus_tag LOCUS_08550 gene typA 2143 281 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183842.1 protein_id gnl|my_center|LOCUS_08550 3353 2883 gene locus_tag LOCUS_08560 gene bfr 3353 2883 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence211 1393 281 gene locus_tag LOCUS_08570 gene per 1393 281 CDS product GDP-perosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918896.1 protein_id gnl|my_center|LOCUS_08570 1423 1683 gene locus_tag LOCUS_08580 1423 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 <3511 2829 gene locus_tag LOCUS_08590 <3511 2829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097853.1:undecaprenyl-phosphate galactose phosphotransferase WbaP >Feature sequence212 549 965 gene locus_tag LOCUS_08600 gene nikR 549 965 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932159.1 protein_id gnl|my_center|LOCUS_08600 1035 1634 gene locus_tag LOCUS_08610 gene cbiM 1035 1634 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_08610 1637 2068 gene locus_tag LOCUS_08620 1637 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 2065 2790 gene locus_tag LOCUS_08630 2065 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 2798 3463 gene locus_tag LOCUS_08640 2798 3463 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence213 488 829 gene locus_tag LOCUS_08650 488 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1202 1762 gene locus_tag LOCUS_08660 1202 1762 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943415.1 protein_id gnl|my_center|LOCUS_08660 1868 2962 gene locus_tag LOCUS_08670 1868 2962 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460725.1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence214 >Feature sequence215 1168 380 gene locus_tag LOCUS_08680 gene ygiD 1168 380 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174107.1 protein_id gnl|my_center|LOCUS_08680 1933 1289 gene locus_tag LOCUS_08690 1933 1289 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_08690 <3507 2388 gene locus_tag LOCUS_08700 <3507 2388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877688.1:molybdopterin-dependent oxidoreductase >Feature sequence216 <1 2110 gene locus_tag LOCUS_08710 <1 2110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000892827.1:Ig-like domain-containing protein <3505 2447 gene locus_tag LOCUS_08720 <3505 2447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943556.1:2-hydroxyacyl-CoA dehydratase >Feature sequence217 550 311 gene locus_tag LOCUS_08730 550 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 485 643 gene locus_tag LOCUS_08740 485 643 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545616.1 protein_id gnl|my_center|LOCUS_08740 647 2020 gene locus_tag LOCUS_08750 647 2020 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860267.1 protein_id gnl|my_center|LOCUS_08750 2220 3062 gene locus_tag LOCUS_08760 2220 3062 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860265.1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence218 1564 62 gene locus_tag LOCUS_08770 1564 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 2964 2200 gene locus_tag LOCUS_08780 2964 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 3501 3118 gene locus_tag LOCUS_08790 3501 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence219 1484 540 gene locus_tag LOCUS_08800 1484 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 3465 2056 gene locus_tag LOCUS_08810 3465 2056 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879242.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence220 713 1228 gene locus_tag LOCUS_08820 713 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 1234 2085 gene locus_tag LOCUS_08830 1234 2085 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356900.1 protein_id gnl|my_center|LOCUS_08830 2091 3311 gene locus_tag LOCUS_08840 2091 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence221 849 2501 gene locus_tag LOCUS_08850 849 2501 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333284.1 protein_id gnl|my_center|LOCUS_08850 2589 3323 gene locus_tag LOCUS_08860 2589 3323 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence222 1178 231 gene locus_tag LOCUS_08870 1178 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2038 2388 gene locus_tag LOCUS_08880 2038 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 <3484 2893 gene locus_tag LOCUS_08890 <3484 2893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942996.1:malto-oligosyltrehalose synthase >Feature sequence223 201 425 gene locus_tag LOCUS_08900 201 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1315 554 gene locus_tag LOCUS_08910 1315 554 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875755.1 protein_id gnl|my_center|LOCUS_08910 1485 1691 gene locus_tag LOCUS_08920 1485 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence224 <1 989 gene locus_tag LOCUS_08930 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943854.1:TIGR03960 family B12-binding radical SAM protein 1037 1516 gene locus_tag LOCUS_08940 gene folK 1037 1516 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 protein_id gnl|my_center|LOCUS_08940 1521 2594 gene locus_tag LOCUS_08950 gene lptG 1521 2594 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933214.1 protein_id gnl|my_center|LOCUS_08950 2948 3418 gene locus_tag LOCUS_08960 2948 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence225 1934 927 gene locus_tag LOCUS_08970 1934 927 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_08970 3004 2318 gene locus_tag LOCUS_08980 gene bshB1 3004 2318 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333027.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence226 1424 63 gene locus_tag LOCUS_08990 1424 63 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141444.1 protein_id gnl|my_center|LOCUS_08990 <3466 1488 gene locus_tag LOCUS_09000 <3466 1488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941554.1:NAD-dependent DNA ligase LigA >Feature sequence227 1 2919 gene locus_tag LOCUS_09010 1 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence228 1029 235 gene locus_tag LOCUS_09020 1029 235 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_09020 1213 1013 gene locus_tag LOCUS_09030 gene thiS 1213 1013 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379876.1 protein_id gnl|my_center|LOCUS_09030 <3457 1219 gene locus_tag LOCUS_09040 <3457 1219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926868.1:NADPH-dependent glutamate synthase >Feature sequence229 1575 1030 gene locus_tag LOCUS_09050 1575 1030 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272617.1 protein_id gnl|my_center|LOCUS_09050 2200 1793 gene locus_tag LOCUS_09060 2200 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 <3456 2482 gene locus_tag LOCUS_09070 <3456 2482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084726.1:DUF87 domain-containing protein >Feature sequence230 813 238 gene locus_tag LOCUS_09080 813 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1912 2136 gene locus_tag LOCUS_09090 1912 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2265 2546 gene locus_tag LOCUS_09100 2265 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence231 2547 862 gene locus_tag LOCUS_09110 gene yidC 2547 862 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_09110 2722 2540 gene locus_tag LOCUS_09120 2722 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 <3444 2863 gene locus_tag LOCUS_09130 <3444 2863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327962.1:ScpA family protein >Feature sequence232 868 1203 gene locus_tag LOCUS_09140 868 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 1312 1470 gene locus_tag LOCUS_09150 1312 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1452 2243 gene locus_tag LOCUS_09160 gene soj 1452 2243 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_09160 2717 3367 gene locus_tag LOCUS_09170 2717 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence233 255 659 gene locus_tag LOCUS_09180 255 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 694 1746 gene locus_tag LOCUS_09190 694 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1743 2096 gene locus_tag LOCUS_09200 1743 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 3058 2120 gene locus_tag LOCUS_09210 3058 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence234 <1 1281 gene locus_tag LOCUS_09220 <1 1281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324371.1:30S ribosomal protein S1 1363 2124 gene locus_tag LOCUS_09230 1363 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 2128 2643 gene locus_tag LOCUS_09240 2128 2643 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_09240 2973 2710 gene locus_tag LOCUS_09250 2973 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence235 404 1210 gene locus_tag LOCUS_09260 gene amrB 404 1210 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942474.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence236 <1 2584 gene locus_tag LOCUS_09270 <1 2584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007333812.1:DNA-directed RNA polymerase subunit beta' 2601 2972 gene locus_tag LOCUS_09280 gene rpsL 2601 2972 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence237 1755 1087 gene locus_tag LOCUS_09290 gene clpP 1755 1087 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 protein_id gnl|my_center|LOCUS_09290 3112 1811 gene locus_tag LOCUS_09300 gene tig 3112 1811 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965929.1 protein_id gnl|my_center|LOCUS_09300 3212 3138 gene locus_tag LOCUS_t00070 3212 3138 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3309 3225 gene locus_tag LOCUS_t00080 3309 3225 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence238 >Feature sequence239 599 954 gene locus_tag LOCUS_tm00010 599 954 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1879 2919 gene locus_tag LOCUS_09310 1879 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence240 1930 926 gene locus_tag LOCUS_09320 1930 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 2254 1961 gene locus_tag LOCUS_09330 2254 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2743 2396 gene locus_tag LOCUS_09340 2743 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence241 1472 324 gene locus_tag LOCUS_09350 1472 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09350 1788 3254 gene locus_tag LOCUS_09360 1788 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence242 311 1363 gene locus_tag LOCUS_09370 311 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 3123 1660 gene locus_tag LOCUS_09380 3123 1660 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817405.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence243 1797 400 gene locus_tag LOCUS_09390 gene murC 1797 400 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546590.1 protein_id gnl|my_center|LOCUS_09390 2075 2497 gene locus_tag LOCUS_09400 gene speD 2075 2497 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545906.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence244 1022 255 gene locus_tag LOCUS_09410 1022 255 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_09410 3034 1109 gene locus_tag LOCUS_09420 3034 1109 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence245 961 1671 gene locus_tag LOCUS_09430 gene bioD 961 1671 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545503.1 protein_id gnl|my_center|LOCUS_09430 1990 3321 gene locus_tag LOCUS_09440 gene thiC 1990 3321 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024209.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence246 3170 2076 gene locus_tag LOCUS_09450 3170 2076 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063658.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence247 1026 130 gene locus_tag LOCUS_09460 1026 130 CDS product DUF4438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080391.1 protein_id gnl|my_center|LOCUS_09460 1422 1844 gene locus_tag LOCUS_09470 1422 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1834 3087 gene locus_tag LOCUS_09480 1834 3087 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982139.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence248 >Feature sequence249 86 760 gene locus_tag LOCUS_09490 86 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 2843 861 gene locus_tag LOCUS_09500 gene recG 2843 861 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence250 297 369 gene locus_tag LOCUS_t00090 297 369 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 445 531 gene locus_tag LOCUS_t00100 445 531 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 639 869 gene locus_tag LOCUS_09510 639 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 920 2029 gene locus_tag LOCUS_09520 920 2029 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_09520 2029 2799 gene locus_tag LOCUS_09530 gene ccsA 2029 2799 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943928.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence251 945 529 gene locus_tag LOCUS_09540 945 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1577 1023 gene locus_tag LOCUS_09550 gene pth 1577 1023 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122535.1 protein_id gnl|my_center|LOCUS_09550 2239 1592 gene locus_tag LOCUS_09560 2239 1592 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324826.1 protein_id gnl|my_center|LOCUS_09560 3236 2265 gene locus_tag LOCUS_09570 3236 2265 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence252 <1 2715 gene locus_tag LOCUS_09580 <1 2715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_200903603.1:acyl-CoA dehydratase activase 2762 3253 gene locus_tag LOCUS_09590 gene leuD 2762 3253 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544917.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence253 2294 1191 gene locus_tag LOCUS_09600 gene pilU 2294 1191 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_09600 <3281 2307 gene locus_tag LOCUS_09610 <3281 2307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073221.1:type IV pilus twitching motility protein PilT >Feature sequence254 1 1923 gene locus_tag LOCUS_09620 gene topA 1 1923 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_09620 2212 3216 gene locus_tag LOCUS_09630 2212 3216 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence255 2527 3126 gene locus_tag LOCUS_09640 2527 3126 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921805.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence256 241 1956 gene locus_tag LOCUS_09650 241 1956 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_09650 2002 2550 gene locus_tag LOCUS_09660 2002 2550 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082414.1 protein_id gnl|my_center|LOCUS_09660 2600 3070 gene locus_tag LOCUS_09670 gene ndk 2600 3070 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809738.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence257 55 438 gene locus_tag LOCUS_09680 55 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 468 1013 gene locus_tag LOCUS_09690 468 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09690 >Feature sequence258 50 1291 gene locus_tag LOCUS_09700 gene clpX 50 1291 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082752.1 protein_id gnl|my_center|LOCUS_09700 2763 1300 gene locus_tag LOCUS_09710 2763 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 >Feature sequence259 84 515 gene locus_tag LOCUS_09720 84 515 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583624.1 protein_id gnl|my_center|LOCUS_09720 624 2075 gene locus_tag LOCUS_09730 624 2075 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546530.1 protein_id gnl|my_center|LOCUS_09730 2185 2505 gene locus_tag LOCUS_09740 2185 2505 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393300.1 protein_id gnl|my_center|LOCUS_09740 2502 2744 gene locus_tag LOCUS_09750 2502 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence260 588 1958 gene locus_tag LOCUS_09760 588 1958 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021220.1 protein_id gnl|my_center|LOCUS_09760 1965 2894 gene locus_tag LOCUS_09770 1965 2894 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939854.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence261 716 276 gene locus_tag LOCUS_09780 716 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 840 1406 gene locus_tag LOCUS_09790 840 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1447 2766 gene locus_tag LOCUS_09800 1447 2766 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867854.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence262 1517 174 gene locus_tag LOCUS_09810 gene radA 1517 174 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_09810 <3245 1622 gene locus_tag LOCUS_09820 <3245 1622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121080.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence263 2074 1805 gene locus_tag LOCUS_09830 2074 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2951 2307 gene locus_tag LOCUS_09840 2951 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence264 1828 752 gene locus_tag LOCUS_09850 1828 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 2203 2766 gene locus_tag LOCUS_09860 2203 2766 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence265 1998 1084 gene locus_tag LOCUS_09870 1998 1084 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065352.1 protein_id gnl|my_center|LOCUS_09870 <3235 2464 gene locus_tag LOCUS_09880 <3235 2464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941997.1:amidohydrolase >Feature sequence266 692 60 gene locus_tag LOCUS_09890 692 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence267 2150 756 gene locus_tag LOCUS_09900 2150 756 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038871.1 protein_id gnl|my_center|LOCUS_09900 2538 2302 gene locus_tag LOCUS_09910 2538 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 3162 2839 gene locus_tag LOCUS_09920 3162 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence268 249 34 gene locus_tag LOCUS_09930 249 34 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545607.1 protein_id gnl|my_center|LOCUS_09930 2647 515 gene locus_tag LOCUS_09940 gene recQ 2647 515 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929065.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence269 1608 98 gene locus_tag LOCUS_r00020 1608 98 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 <3217 2323 gene locus_tag LOCUS_09950 <3217 2323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011166680.1:uracil-DNA glycosylase >Feature sequence270 869 135 gene locus_tag LOCUS_09960 gene ubiE 869 135 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328112.1 protein_id gnl|my_center|LOCUS_09960 1288 2211 gene locus_tag LOCUS_09970 gene dusB 1288 2211 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619224.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence271 411 1235 gene locus_tag LOCUS_09980 411 1235 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250866.1 protein_id gnl|my_center|LOCUS_09980 1394 2407 gene locus_tag LOCUS_09990 gene fbp 1394 2407 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932050.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence272 2311 2033 gene locus_tag LOCUS_10000 2311 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 2454 3005 gene locus_tag LOCUS_10010 2454 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence273 146 2926 gene locus_tag LOCUS_10020 146 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence274 983 2053 gene locus_tag LOCUS_10030 983 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence275 2372 2235 gene locus_tag LOCUS_10040 2372 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 2987 2397 gene locus_tag LOCUS_10050 2987 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence276 >Feature sequence277 1216 164 gene locus_tag LOCUS_10060 1216 164 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388243.1 protein_id gnl|my_center|LOCUS_10060 1926 1213 gene locus_tag LOCUS_10070 1926 1213 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949054.1 protein_id gnl|my_center|LOCUS_10070 <3198 2325 gene locus_tag LOCUS_10080 <3198 2325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545558.1:cofactor-independent phosphoglycerate mutase >Feature sequence278 292 1098 gene locus_tag LOCUS_10090 292 1098 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_10090 2001 1165 gene locus_tag LOCUS_10100 gene dapF 2001 1165 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_10100 3067 2114 gene locus_tag LOCUS_10110 3067 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence279 <1 2075 gene locus_tag LOCUS_10120 <1 2075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054935282.1:molybdopterin-dependent oxidoreductase 2253 2540 gene locus_tag LOCUS_10130 2253 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence280 <1 569 gene locus_tag LOCUS_10140 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001830636.1:acyltransferase family protein 617 1801 gene locus_tag LOCUS_10150 617 1801 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690973.1 protein_id gnl|my_center|LOCUS_10150 1802 2563 gene locus_tag LOCUS_10160 1802 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence281 129 2018 gene locus_tag LOCUS_10170 gene msbA 129 2018 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_10170 2015 2875 gene locus_tag LOCUS_10180 gene rfbD 2015 2875 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence282 779 33 gene locus_tag LOCUS_10190 779 33 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_10190 2129 1203 gene locus_tag LOCUS_10200 2129 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 <3181 2412 gene locus_tag LOCUS_10210 <3181 2412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232400.1:metallophosphoesterase >Feature sequence283 1192 467 gene locus_tag LOCUS_10220 gene cobM 1192 467 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870280.1 protein_id gnl|my_center|LOCUS_10220 1564 1199 gene locus_tag LOCUS_10230 1564 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1857 2531 gene locus_tag LOCUS_10240 1857 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 <3180 2575 gene locus_tag LOCUS_10250 <3180 2575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942049.1:GGDEF domain-containing protein >Feature sequence284 658 389 gene locus_tag LOCUS_10260 658 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1087 2616 gene locus_tag LOCUS_10270 1087 2616 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence285 <1 1363 gene locus_tag LOCUS_10280 <1 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082796.1:leucine--tRNA ligase 1670 1891 gene locus_tag LOCUS_10290 1670 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 2590 2219 gene locus_tag LOCUS_10300 2590 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence286 378 1382 gene locus_tag LOCUS_10310 gene hflK 378 1382 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_10310 1379 2341 gene locus_tag LOCUS_10320 gene hflC 1379 2341 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_10320 2415 2822 gene locus_tag LOCUS_10330 2415 2822 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence287 1834 608 gene locus_tag LOCUS_10340 gene ahbC 1834 608 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022974.1 protein_id gnl|my_center|LOCUS_10340 3124 1982 gene locus_tag LOCUS_10350 3124 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence288 3039 1834 gene locus_tag LOCUS_10360 3039 1834 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546769.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence289 1492 530 gene locus_tag LOCUS_10370 1492 530 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338657.1 protein_id gnl|my_center|LOCUS_10370 2530 1799 gene locus_tag LOCUS_10380 gene pssA 2530 1799 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546557.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence290 3061 1835 gene locus_tag LOCUS_10390 3061 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence291 323 1030 gene locus_tag LOCUS_10400 323 1030 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146546.1 protein_id gnl|my_center|LOCUS_10400 2295 1171 gene locus_tag LOCUS_10410 2295 1171 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147341.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence292 1276 872 gene locus_tag LOCUS_10420 1276 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1880 1422 gene locus_tag LOCUS_10430 1880 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 2221 2012 gene locus_tag LOCUS_10440 2221 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 <3138 2222 gene locus_tag LOCUS_10450 <3138 2222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083435015.1:RNA polymerase factor sigma-54 >Feature sequence293 612 328 gene locus_tag LOCUS_10460 612 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 800 1966 gene locus_tag LOCUS_10470 800 1966 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939045.1 protein_id gnl|my_center|LOCUS_10470 2158 2009 gene locus_tag LOCUS_10480 2158 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 <3137 2181 gene locus_tag LOCUS_10490 <3137 2181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405539.1:ABC transporter transmembrane domain-containing protein >Feature sequence294 2651 1008 gene locus_tag LOCUS_10500 gene recJ 2651 1008 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence295 >Feature sequence296 2087 501 gene locus_tag LOCUS_10510 2087 501 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_10510 2933 2097 gene locus_tag LOCUS_10520 2933 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence297 1118 675 gene locus_tag LOCUS_10530 1118 675 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870191.1 protein_id gnl|my_center|LOCUS_10530 2957 1305 gene locus_tag LOCUS_10540 gene nadB 2957 1305 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119573.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence298 1200 220 gene locus_tag LOCUS_10550 1200 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 3082 1265 gene locus_tag LOCUS_10560 3082 1265 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence299 >Feature sequence300 <1 1588 gene locus_tag LOCUS_10570 <1 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933392.1:DEAD/DEAH box helicase family protein 1671 2330 gene locus_tag LOCUS_10580 1671 2330 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence301 <3083 339 gene locus_tag LOCUS_10590 <3083 339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089864.1:cell division protein >Feature sequence302 >Feature sequence303 191 469 gene locus_tag LOCUS_10600 191 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 470 1939 gene locus_tag LOCUS_10610 470 1939 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence304 2534 336 gene locus_tag LOCUS_10620 2534 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 >Feature sequence305 937 548 gene locus_tag LOCUS_10630 937 548 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 protein_id gnl|my_center|LOCUS_10630 1161 934 gene locus_tag LOCUS_10640 1161 934 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932024.1 protein_id gnl|my_center|LOCUS_10640 1920 1558 gene locus_tag LOCUS_10650 1920 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 2196 1921 gene locus_tag LOCUS_10660 2196 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 2495 2319 gene locus_tag LOCUS_10670 2495 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 2771 2550 gene locus_tag LOCUS_10680 2771 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 2995 2771 gene locus_tag LOCUS_10690 2995 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence306 5 2746 gene locus_tag LOCUS_10700 5 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence307 156 461 gene locus_tag LOCUS_10710 156 461 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_10710 836 585 gene locus_tag LOCUS_10720 836 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1446 868 gene locus_tag LOCUS_10730 gene hxlB 1446 868 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061311.1 protein_id gnl|my_center|LOCUS_10730 1693 1935 gene locus_tag LOCUS_10740 1693 1935 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056384.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence308 938 306 gene locus_tag LOCUS_10750 938 306 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886588.1 protein_id gnl|my_center|LOCUS_10750 1879 1157 gene locus_tag LOCUS_10760 gene rph 1879 1157 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460930.1 protein_id gnl|my_center|LOCUS_10760 2813 1884 gene locus_tag LOCUS_10770 gene argF 2813 1884 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878750.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence309 1422 874 gene locus_tag LOCUS_10780 1422 874 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 protein_id gnl|my_center|LOCUS_10780 1842 2501 gene locus_tag LOCUS_10790 1842 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10790 2514 2696 gene locus_tag LOCUS_10800 2514 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence310 769 590 gene locus_tag LOCUS_10810 769 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 827 1486 gene locus_tag LOCUS_10820 827 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1643 2221 gene locus_tag LOCUS_10830 1643 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence311 1298 321 gene locus_tag LOCUS_10840 1298 321 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_10840 1974 2318 gene locus_tag LOCUS_10850 1974 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2266 2439 gene locus_tag LOCUS_10860 2266 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence312 1661 858 gene locus_tag LOCUS_10870 1661 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 2408 1677 gene locus_tag LOCUS_10880 2408 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence313 <3054 1901 gene locus_tag LOCUS_10890 <3054 1901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878124.1:glycosyltransferase family 2 protein >Feature sequence314 2201 1629 gene locus_tag LOCUS_10900 2201 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 2994 2215 gene locus_tag LOCUS_10910 2994 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10910 >Feature sequence315 2938 884 gene locus_tag LOCUS_10920 gene fusA 2938 884 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence316 1618 140 gene locus_tag LOCUS_10930 gene truD 1618 140 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545670.1 protein_id gnl|my_center|LOCUS_10930 2563 1688 gene locus_tag LOCUS_10940 2563 1688 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794809.1 protein_id gnl|my_center|LOCUS_10940 2798 2676 gene locus_tag LOCUS_10950 2798 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence317 <1 821 gene locus_tag LOCUS_10960 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922418.1:type I restriction-modification system subunit M 818 1267 gene locus_tag LOCUS_10970 818 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1260 2288 gene locus_tag LOCUS_10980 1260 2288 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014498593.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence318 >Feature sequence319 1670 120 gene locus_tag LOCUS_10990 1670 120 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_10990 2871 1792 gene locus_tag LOCUS_11000 gene rlmN 2871 1792 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922584.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence320 >Feature sequence321 310 101 gene locus_tag LOCUS_11010 310 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1299 328 gene locus_tag LOCUS_11020 1299 328 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615392.1 protein_id gnl|my_center|LOCUS_11020 2605 1460 gene locus_tag LOCUS_11030 gene waaC 2605 1460 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence322 1224 805 gene locus_tag LOCUS_11040 1224 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence323 >Feature sequence324 <1 735 gene locus_tag LOCUS_11050 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009889064.1:alanine--tRNA ligase 1275 2291 gene locus_tag LOCUS_11060 gene plsX 1275 2291 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_11060 >Feature sequence325 539 1825 gene locus_tag LOCUS_11070 539 1825 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943971.1 protein_id gnl|my_center|LOCUS_11070 1952 2701 gene locus_tag LOCUS_11080 1952 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 2758 2946 gene locus_tag LOCUS_11090 2758 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence326 1495 1058 gene locus_tag LOCUS_11100 1495 1058 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269184.1 protein_id gnl|my_center|LOCUS_11100 2771 2088 gene locus_tag LOCUS_11110 2771 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence327 1588 611 gene locus_tag LOCUS_11120 gene cax 1588 611 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482137.1 protein_id gnl|my_center|LOCUS_11120 2141 2064 gene locus_tag LOCUS_t00110 2141 2064 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence328 1685 711 gene locus_tag LOCUS_11130 gene pstS 1685 711 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_11130 2046 1762 gene locus_tag LOCUS_11140 2046 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence329 988 338 gene locus_tag LOCUS_11150 988 338 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942031.1 protein_id gnl|my_center|LOCUS_11150 1398 991 gene locus_tag LOCUS_11160 1398 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 <2959 1399 gene locus_tag LOCUS_11170 <2959 1399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045027.1:ferrous iron transport protein B >Feature sequence330 137 1447 gene locus_tag LOCUS_11180 gene purD 137 1447 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880448.1 protein_id gnl|my_center|LOCUS_11180 1995 2228 gene locus_tag LOCUS_11190 1995 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 2381 2812 gene locus_tag LOCUS_11200 2381 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence331 230 93 gene locus_tag LOCUS_11210 230 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence332 591 205 gene locus_tag LOCUS_11220 591 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1449 874 gene locus_tag LOCUS_11230 1449 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11230 2744 1446 gene locus_tag LOCUS_11240 2744 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11240 >Feature sequence333 803 1207 gene locus_tag LOCUS_11250 803 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11250 1217 1528 gene locus_tag LOCUS_11260 1217 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11260 1649 2296 gene locus_tag LOCUS_11270 1649 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 2368 2571 gene locus_tag LOCUS_11280 2368 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence334 <1 1482 gene locus_tag LOCUS_11290 <1 1482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122658.1:oligoendopeptidase F 1630 2109 gene locus_tag LOCUS_11300 1630 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 <2935 2152 gene locus_tag LOCUS_11310 <2935 2152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_210266672.1:DEAD/DEAH box helicase >Feature sequence335 955 188 gene locus_tag LOCUS_11320 955 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 <2935 2012 gene locus_tag LOCUS_11330 <2935 2012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922132.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence336 1 435 gene locus_tag LOCUS_11340 1 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 437 1390 gene locus_tag LOCUS_11350 437 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence337 509 1402 gene locus_tag LOCUS_11360 509 1402 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272645.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11360 1436 1657 gene locus_tag LOCUS_11370 1436 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11370 1757 2914 gene locus_tag LOCUS_11380 gene dnaJ 1757 2914 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence338 1519 281 gene locus_tag LOCUS_11390 gene dacB 1519 281 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_11390 2374 1955 gene locus_tag LOCUS_11400 2374 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 2861 2424 gene locus_tag LOCUS_11410 gene smpB 2861 2424 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence339 <1 1355 gene locus_tag LOCUS_11420 <1 1355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434952.1:tRNA lysidine(34) synthetase TilS <2925 1418 gene locus_tag LOCUS_11430 <2925 1418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021623.1:tetratricopeptide repeat protein >Feature sequence340 962 240 gene locus_tag LOCUS_11440 gene cobI 962 240 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 protein_id gnl|my_center|LOCUS_11440 1609 959 gene locus_tag LOCUS_11450 gene cbiE 1609 959 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392603.1 protein_id gnl|my_center|LOCUS_11450 2850 1573 gene locus_tag LOCUS_11460 2850 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence341 524 715 gene locus_tag LOCUS_11470 524 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 2430 934 gene locus_tag LOCUS_11480 2430 934 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_11480 2756 2427 gene locus_tag LOCUS_11490 2756 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229974.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence342 26 101 gene locus_tag LOCUS_t00120 26 101 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 496 972 gene locus_tag LOCUS_11500 496 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11500 1106 1387 gene locus_tag LOCUS_11510 1106 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1388 1825 gene locus_tag LOCUS_11520 1388 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 >Feature sequence343 974 9 gene locus_tag LOCUS_11530 974 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1739 1221 gene locus_tag LOCUS_11540 1739 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 2748 1741 gene locus_tag LOCUS_11550 2748 1741 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267092.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence344 1366 20 gene locus_tag LOCUS_11560 1366 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1917 2423 gene locus_tag LOCUS_11570 gene ribE 1917 2423 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811752.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence345 15 1037 gene locus_tag LOCUS_11580 gene ruvB 15 1037 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772105.1 protein_id gnl|my_center|LOCUS_11580 1050 1733 gene locus_tag LOCUS_11590 1050 1733 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence346 1590 376 gene locus_tag LOCUS_11600 1590 376 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031442.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence347 949 428 gene locus_tag LOCUS_11610 gene rimI 949 428 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107807.1 protein_id gnl|my_center|LOCUS_11610 1694 1137 gene locus_tag LOCUS_11620 1694 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 2788 1787 gene locus_tag LOCUS_11630 gene ilvC 2788 1787 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence348 2879 2229 gene locus_tag LOCUS_11640 2879 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence349 1005 1148 gene locus_tag LOCUS_11650 1005 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1215 1481 gene locus_tag LOCUS_11660 1215 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 2799 2371 gene locus_tag LOCUS_11670 2799 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11670 >Feature sequence350 2602 1268 gene locus_tag LOCUS_11680 gene rho 2602 1268 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence351 1903 935 gene locus_tag LOCUS_11690 1903 935 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_11690 2842 1922 gene locus_tag LOCUS_11700 2842 1922 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545278.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence352 319 948 gene locus_tag LOCUS_11710 319 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 954 2156 gene locus_tag LOCUS_11720 954 2156 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546785.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence353 259 182 gene locus_tag LOCUS_t00130 259 182 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 426 2348 gene locus_tag LOCUS_11730 gene ftsH 426 2348 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869596.1 protein_id gnl|my_center|LOCUS_11730 2860 2360 gene locus_tag LOCUS_11740 2860 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence354 649 1014 gene locus_tag LOCUS_11750 649 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 2673 1678 gene locus_tag LOCUS_11760 2673 1678 CDS product IS110-like element ISGsu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941629.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence355 <1 2557 gene locus_tag LOCUS_11770 <1 2557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943065.1:pyruvate carboxylase >Feature sequence356 633 2357 gene locus_tag LOCUS_11780 633 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 2354 2638 gene locus_tag LOCUS_11790 2354 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence357 867 2120 gene locus_tag LOCUS_11800 867 2120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965625.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence358 580 146 gene locus_tag LOCUS_11810 580 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1348 917 gene locus_tag LOCUS_11820 1348 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11820 2285 1491 gene locus_tag LOCUS_11830 2285 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence359 2005 911 gene locus_tag LOCUS_11840 gene cobD 2005 911 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 protein_id gnl|my_center|LOCUS_11840 2773 2012 gene locus_tag LOCUS_11850 2773 2012 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870600.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence360 1314 583 gene locus_tag LOCUS_11860 1314 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2265 1462 gene locus_tag LOCUS_11870 2265 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence361 401 1336 gene locus_tag LOCUS_11880 401 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1562 2560 gene locus_tag LOCUS_11890 gene speY 1562 2560 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence362 1700 333 gene locus_tag LOCUS_11900 1700 333 CDS product DNA-directed RNA polymerase subunit alpha C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332711.1 protein_id gnl|my_center|LOCUS_11900 1988 2275 gene locus_tag LOCUS_11910 1988 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence363 408 1769 gene locus_tag LOCUS_11920 gene trkA 408 1769 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence364 1686 106 gene locus_tag LOCUS_11930 1686 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence365 1138 1323 gene locus_tag LOCUS_11940 1138 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1656 1372 gene locus_tag LOCUS_11950 1656 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1637 2464 gene locus_tag LOCUS_11960 1637 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence366 >Feature sequence367 67 198 gene locus_tag LOCUS_11970 67 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 328 708 gene locus_tag LOCUS_11980 328 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11980 1422 904 gene locus_tag LOCUS_11990 1422 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence368 >Feature sequence369 1928 1140 gene locus_tag LOCUS_12000 1928 1140 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037323.1 protein_id gnl|my_center|LOCUS_12000 2574 2362 gene locus_tag LOCUS_12010 2574 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 >Feature sequence370 <1 643 gene locus_tag LOCUS_12020 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729897.1:phosphoadenylyl-sulfate reductase 777 1775 gene locus_tag LOCUS_12030 gene akrN 777 1775 CDS product aldo/keto reductase AkrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245422.1 protein_id gnl|my_center|LOCUS_12030 2272 2451 gene locus_tag LOCUS_12040 2272 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence371 1067 2224 gene locus_tag LOCUS_12050 1067 2224 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence372 592 35 gene locus_tag LOCUS_12060 592 35 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880755.1 protein_id gnl|my_center|LOCUS_12060 2214 760 gene locus_tag LOCUS_12070 gene purB 2214 760 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence373 <1 2641 gene locus_tag LOCUS_12080 <1 2641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942256.1:efflux RND transporter permease subunit >Feature sequence374 386 1615 gene locus_tag LOCUS_12090 386 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence375 >Feature sequence376 1604 870 gene locus_tag LOCUS_12100 gene ccsB 1604 870 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_12100 2007 2231 gene locus_tag LOCUS_12110 2007 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2254 2472 gene locus_tag LOCUS_12120 2254 2472 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence377 499 2061 gene locus_tag LOCUS_12130 499 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence378 1 432 gene locus_tag LOCUS_12140 1 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1977 583 gene locus_tag LOCUS_12150 gene rsmB 1977 583 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_12150 2401 1958 gene locus_tag LOCUS_12160 2401 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence379 620 1495 gene locus_tag LOCUS_12170 gene cmr4 620 1495 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221897993.1 protein_id gnl|my_center|LOCUS_12170 1488 1892 gene locus_tag LOCUS_12180 1488 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1870 2643 gene locus_tag LOCUS_12190 1870 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence380 591 58 gene locus_tag LOCUS_12200 591 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1469 789 gene locus_tag LOCUS_12210 1469 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1725 1519 gene locus_tag LOCUS_12220 1725 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 2511 1936 gene locus_tag LOCUS_12230 2511 1936 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022274.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence381 <1 1054 gene locus_tag LOCUS_12240 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869326.1:ABC transporter substrate-binding protein/permease 1038 1793 gene locus_tag LOCUS_12250 1038 1793 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976231.1 protein_id gnl|my_center|LOCUS_12250 <2707 1807 gene locus_tag LOCUS_12260 <2707 1807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000064092.1:transcription elongation factor GreA >Feature sequence382 1138 686 gene locus_tag LOCUS_12270 1138 686 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064659.1 protein_id gnl|my_center|LOCUS_12270 <2706 1229 gene locus_tag LOCUS_12280 <2706 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460180.1:uroporphyrinogen-III C-methyltransferase >Feature sequence383 <1 591 gene locus_tag LOCUS_12290 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064390.1:MIP/aquaporin family protein 699 1346 gene locus_tag LOCUS_12300 699 1346 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_12300 1763 2257 gene locus_tag LOCUS_12310 1763 2257 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867756.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence384 242 865 gene locus_tag LOCUS_12320 242 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12320 1615 914 gene locus_tag LOCUS_12330 1615 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 2227 1733 gene locus_tag LOCUS_12340 2227 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence385 >Feature sequence386 467 2098 gene locus_tag LOCUS_12350 467 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 2061 2597 gene locus_tag LOCUS_12360 2061 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence387 884 732 gene locus_tag LOCUS_12370 884 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1748 1083 gene locus_tag LOCUS_12380 1748 1083 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922255.1 protein_id gnl|my_center|LOCUS_12380 <2684 1819 gene locus_tag LOCUS_12390 <2684 1819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172625442.1:cytochrome b N-terminal domain-containing protein >Feature sequence388 <1 892 gene locus_tag LOCUS_12400 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942781.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence389 >Feature sequence390 <1 1044 gene locus_tag LOCUS_12410 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902857.1:multicopper oxidase family protein 2136 1213 gene locus_tag LOCUS_12420 2136 1213 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545473.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence391 >Feature sequence392 <1 1172 gene locus_tag LOCUS_12430 <1 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546318.1:CTP synthase 2064 1330 gene locus_tag LOCUS_12440 2064 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 2499 2125 gene locus_tag LOCUS_12450 2499 2125 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545378.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence393 2571 223 gene locus_tag LOCUS_12460 2571 223 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767848.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence394 1499 1197 gene locus_tag LOCUS_12470 1499 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1916 2050 gene locus_tag LOCUS_12480 1916 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence395 2014 83 gene locus_tag LOCUS_12490 2014 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence396 449 571 gene locus_tag LOCUS_12500 449 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 >Feature sequence397 680 1222 gene locus_tag LOCUS_12510 680 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1276 2406 gene locus_tag LOCUS_12520 1276 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence398 2374 2105 gene locus_tag LOCUS_12530 gene rpsO 2374 2105 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257912.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence399 74 1507 gene locus_tag LOCUS_12540 74 1507 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182976528.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence400 356 502 gene locus_tag LOCUS_12550 356 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 2290 1481 gene locus_tag LOCUS_12560 2290 1481 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence401 1142 96 gene locus_tag LOCUS_12570 1142 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 <2636 1123 gene locus_tag LOCUS_12580 <2636 1123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001100021.1:SNF2-related protein >Feature sequence402 931 122 gene locus_tag LOCUS_12590 931 122 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_12590 1133 2278 gene locus_tag LOCUS_12600 gene rodA 1133 2278 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence403 503 1267 gene locus_tag LOCUS_12610 503 1267 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_12610 1923 1330 gene locus_tag LOCUS_12620 gene lpoB 1923 1330 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172966546.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence404 19 360 gene locus_tag LOCUS_12630 19 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 889 1281 gene locus_tag LOCUS_12640 889 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1384 2085 gene locus_tag LOCUS_12650 1384 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 <2625 2090 gene locus_tag LOCUS_12660 <2625 2090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009892066.1:peptidylprolyl isomerase >Feature sequence405 >Feature sequence406 2405 873 gene locus_tag LOCUS_12670 2405 873 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727940.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence407 >Feature sequence408 <1 717 gene locus_tag LOCUS_12680 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861887.1:sigma 54-interacting transcriptional regulator 948 1631 gene locus_tag LOCUS_12690 948 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence409 >Feature sequence410 202 687 gene locus_tag LOCUS_12700 202 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 930 1694 gene locus_tag LOCUS_12710 930 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875784.1 protein_id gnl|my_center|LOCUS_12710 <2613 1884 gene locus_tag LOCUS_12720 <2613 1884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048400.1:glutamate racemase >Feature sequence411 1499 735 gene locus_tag LOCUS_12730 1499 735 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807954.1 protein_id gnl|my_center|LOCUS_12730 2436 1516 gene locus_tag LOCUS_12740 2436 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 >Feature sequence412 1809 1402 gene locus_tag LOCUS_12750 1809 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence413 883 185 gene locus_tag LOCUS_12760 883 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1191 1499 gene locus_tag LOCUS_12770 1191 1499 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545454.1 protein_id gnl|my_center|LOCUS_12770 1633 2157 gene locus_tag LOCUS_12780 1633 2157 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021659.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence414 231 980 gene locus_tag LOCUS_12790 231 980 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674311.1 protein_id gnl|my_center|LOCUS_12790 1238 2173 gene locus_tag LOCUS_12800 1238 2173 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 protein_id gnl|my_center|LOCUS_12800 2458 2174 gene locus_tag LOCUS_12810 gene rpsT 2458 2174 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358111.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence415 1036 335 gene locus_tag LOCUS_12820 1036 335 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438111.1 protein_id gnl|my_center|LOCUS_12820 <2582 1255 gene locus_tag LOCUS_12830 <2582 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_181406033.1:ATP-dependent protease ATPase subunit HslU >Feature sequence416 2514 451 gene locus_tag LOCUS_12840 2514 451 CDS product siderophore amonabactin TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705839.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence417 <1 1098 gene locus_tag LOCUS_12850 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903528.1:isoleucine--tRNA ligase 2498 1464 gene locus_tag LOCUS_12860 gene holB 2498 1464 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_12860 >Feature sequence418 1052 2572 gene locus_tag LOCUS_12870 1052 2572 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence419 537 1622 gene locus_tag LOCUS_12880 537 1622 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_12880 <2572 1705 gene locus_tag LOCUS_12890 <2572 1705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000741259.1:cobyrinate a,c-diamide synthase >Feature sequence420 1224 1895 gene locus_tag LOCUS_12900 1224 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 2240 2019 gene locus_tag LOCUS_12910 2240 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 2455 2228 gene locus_tag LOCUS_12920 2455 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence421 298 1122 gene locus_tag LOCUS_12930 gene proC 298 1122 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence422 134 1114 gene locus_tag LOCUS_12940 134 1114 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941545.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence423 <2559 1763 gene locus_tag LOCUS_12950 <2559 1763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583184.1:UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase >Feature sequence424 151 954 gene locus_tag LOCUS_12960 gene modA 151 954 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881043.1 protein_id gnl|my_center|LOCUS_12960 1092 1301 gene locus_tag LOCUS_12970 1092 1301 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065065.1 protein_id gnl|my_center|LOCUS_12970 1605 2276 gene locus_tag LOCUS_12980 gene modB 1605 2276 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence425 462 1244 gene locus_tag LOCUS_12990 462 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence426 >Feature sequence427 1542 973 gene locus_tag LOCUS_13000 1542 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence428 852 670 gene locus_tag LOCUS_13010 852 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 942 2282 gene locus_tag LOCUS_13020 gene gcvPA 942 2282 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence429 572 147 gene locus_tag LOCUS_13030 572 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 968 795 gene locus_tag LOCUS_13040 968 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1108 932 gene locus_tag LOCUS_13050 1108 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 2171 1314 gene locus_tag LOCUS_13060 2171 1314 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143210.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence430 826 698 gene locus_tag LOCUS_13070 826 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 2489 1029 gene locus_tag LOCUS_13080 2489 1029 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940915.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence431 1922 744 gene locus_tag LOCUS_13090 1922 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence432 >Feature sequence433 899 651 gene locus_tag LOCUS_13100 899 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1203 973 gene locus_tag LOCUS_13110 1203 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1897 1640 gene locus_tag LOCUS_13120 1897 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 2354 2103 gene locus_tag LOCUS_13130 2354 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence434 1732 1127 gene locus_tag LOCUS_13140 1732 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 <2514 2010 gene locus_tag LOCUS_13150 <2514 2010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942631.1:PEP-CTERM system TPR-repeat protein PrsT >Feature sequence435 72 1361 gene locus_tag LOCUS_13160 72 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence436 662 859 gene locus_tag LOCUS_13170 662 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence437 126 365 gene locus_tag LOCUS_13180 126 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 362 835 gene locus_tag LOCUS_13190 362 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 841 1596 gene locus_tag LOCUS_13200 841 1596 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_13200 1620 1892 gene locus_tag LOCUS_13210 1620 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1905 2420 gene locus_tag LOCUS_13220 1905 2420 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931713.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence438 56 226 gene locus_tag LOCUS_13230 56 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 348 662 gene locus_tag LOCUS_13240 348 662 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940838.1 protein_id gnl|my_center|LOCUS_13240 631 1005 gene locus_tag LOCUS_13250 631 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1023 1247 gene locus_tag LOCUS_13260 1023 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1244 1429 gene locus_tag LOCUS_13270 1244 1429 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061317.1 protein_id gnl|my_center|LOCUS_13270 2210 1620 gene locus_tag LOCUS_13280 2210 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 2460 2215 gene locus_tag LOCUS_13290 2460 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence439 139 981 gene locus_tag LOCUS_13300 139 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13300 2027 1008 gene locus_tag LOCUS_13310 2027 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence440 867 406 gene locus_tag LOCUS_13320 867 406 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249196.1 protein_id gnl|my_center|LOCUS_13320 1456 851 gene locus_tag LOCUS_13330 1456 851 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583757.1 protein_id gnl|my_center|LOCUS_13330 2071 1538 gene locus_tag LOCUS_13340 gene rplQ 2071 1538 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313985.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence441 1047 292 gene locus_tag LOCUS_13350 1047 292 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056682.1 protein_id gnl|my_center|LOCUS_13350 2045 1044 gene locus_tag LOCUS_13360 2045 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence442 >Feature sequence443 303 85 gene locus_tag LOCUS_13370 303 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1186 308 gene locus_tag LOCUS_13380 1186 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence444 976 614 gene locus_tag LOCUS_13390 976 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1490 1140 gene locus_tag LOCUS_13400 1490 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1805 1611 gene locus_tag LOCUS_13410 1805 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2210 1842 gene locus_tag LOCUS_13420 2210 1842 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870246.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence445 <1 1447 gene locus_tag LOCUS_13430 <1 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877386.1:radical SAM protein >Feature sequence446 269 1759 gene locus_tag LOCUS_13440 269 1759 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070812.1 protein_id gnl|my_center|LOCUS_13440 1823 2194 gene locus_tag LOCUS_13450 1823 2194 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence447 <1 2196 gene locus_tag LOCUS_13460 <1 2196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002319708.1:DNA helicase PcrA >Feature sequence448 1041 805 gene locus_tag LOCUS_13470 1041 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1228 1103 gene locus_tag LOCUS_13480 1228 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence449 2 241 gene locus_tag LOCUS_13490 2 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 437 784 gene locus_tag LOCUS_13500 437 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1000 1131 gene locus_tag LOCUS_13510 1000 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1279 1145 gene locus_tag LOCUS_13520 1279 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence450 <1 1319 gene locus_tag LOCUS_13530 <1 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141170.1:glucose-6-phosphate dehydrogenase 1339 2106 gene locus_tag LOCUS_13540 gene pgl 1339 2106 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939587.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence451 710 1219 gene locus_tag LOCUS_13550 gene rfbC 710 1219 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence452 744 1250 gene locus_tag LOCUS_13560 744 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1324 1977 gene locus_tag LOCUS_13570 1324 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence453 1535 81 gene locus_tag LOCUS_13580 1535 81 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970485.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence454 <1 766 gene locus_tag LOCUS_13590 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015944231.1:methyltetrahydrofolate cobalamin methyltransferase 1335 1703 gene locus_tag LOCUS_13600 1335 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1915 2109 gene locus_tag LOCUS_13610 1915 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 >Feature sequence455 201 410 gene locus_tag LOCUS_13620 201 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 398 676 gene locus_tag LOCUS_13630 398 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 <2450 862 gene locus_tag LOCUS_13640 <2450 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392656.1:elongation factor G >Feature sequence456 1 570 gene locus_tag LOCUS_13650 1 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1980 775 gene locus_tag LOCUS_13660 1980 775 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380194.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence457 860 222 gene locus_tag LOCUS_13670 860 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1464 874 gene locus_tag LOCUS_13680 1464 874 CDS product papain-like cysteine protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226265.1 protein_id gnl|my_center|LOCUS_13680 2447 1890 gene locus_tag LOCUS_13690 2447 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888561.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence458 40 1854 gene locus_tag LOCUS_13700 40 1854 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence459 763 569 gene locus_tag LOCUS_13710 763 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1092 766 gene locus_tag LOCUS_13720 1092 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1476 1123 gene locus_tag LOCUS_13730 1476 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence460 1085 42 gene locus_tag LOCUS_13740 1085 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence461 644 1156 gene locus_tag LOCUS_13750 644 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1594 2091 gene locus_tag LOCUS_13760 1594 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence462 1248 1853 gene locus_tag LOCUS_13770 1248 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence463 1287 637 gene locus_tag LOCUS_13780 1287 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1956 1315 gene locus_tag LOCUS_13790 1956 1315 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545579.1 protein_id gnl|my_center|LOCUS_13790 2062 1987 gene locus_tag LOCUS_t00140 2062 1987 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence464 974 1852 gene locus_tag LOCUS_13800 974 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence465 181 1866 gene locus_tag LOCUS_13810 181 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1826 2272 gene locus_tag LOCUS_13820 1826 2272 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence466 >Feature sequence467 2216 1323 gene locus_tag LOCUS_13830 2216 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence468 <1 614 gene locus_tag LOCUS_13840 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966838.1:ACP S-malonyltransferase 637 870 gene locus_tag LOCUS_13850 637 870 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324899.1 protein_id gnl|my_center|LOCUS_13850 871 2115 gene locus_tag LOCUS_13860 gene fabF 871 2115 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331838.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence469 <1 885 gene locus_tag LOCUS_13870 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942901.1:lipid-A-disaccharide synthase 1917 925 gene locus_tag LOCUS_13880 1917 925 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803426.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence470 170 2248 gene locus_tag LOCUS_13890 170 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence471 20 253 gene locus_tag LOCUS_13900 20 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 880 332 gene locus_tag LOCUS_13910 880 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 2149 1133 gene locus_tag LOCUS_13920 2149 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence472 706 879 gene locus_tag LOCUS_13930 706 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1027 1566 gene locus_tag LOCUS_13940 1027 1566 CDS product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097873.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence473 2177 1194 gene locus_tag LOCUS_13950 2177 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence474 <1 1451 gene locus_tag LOCUS_13960 <1 1451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257953.1:geranylgeranyl diphosphate reductase 1577 1819 gene locus_tag LOCUS_13970 1577 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence475 320 448 gene locus_tag LOCUS_13980 320 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 468 653 gene locus_tag LOCUS_13990 468 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1090 758 gene locus_tag LOCUS_14000 1090 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2096 1314 gene locus_tag LOCUS_14010 2096 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence476 165 1766 gene locus_tag LOCUS_14020 165 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence477 1960 641 gene locus_tag LOCUS_14030 1960 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 >Feature sequence478 812 1786 gene locus_tag LOCUS_14040 gene bioB 812 1786 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_14040 2256 1783 gene locus_tag LOCUS_14050 2256 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence479 43 933 gene locus_tag LOCUS_14060 43 933 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942004.1 protein_id gnl|my_center|LOCUS_14060 945 1364 gene locus_tag LOCUS_14070 945 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1417 2349 gene locus_tag LOCUS_14080 1417 2349 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence480 713 423 gene locus_tag LOCUS_14090 713 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 2038 845 gene locus_tag LOCUS_14100 gene metK 2038 845 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056822.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence481 1100 492 gene locus_tag LOCUS_14110 gene recR 1100 492 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256424.1 protein_id gnl|my_center|LOCUS_14110 1483 1133 gene locus_tag LOCUS_14120 1483 1133 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence482 2 1768 gene locus_tag LOCUS_14130 2 1768 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065612062.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence483 1232 1570 gene locus_tag LOCUS_14140 gene glnB 1232 1570 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_14140 1932 1774 gene locus_tag LOCUS_14150 1932 1774 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_14150 2322 1966 gene locus_tag LOCUS_14160 2322 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence484 362 895 gene locus_tag LOCUS_14170 362 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1174 1677 gene locus_tag LOCUS_14180 1174 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence485 >Feature sequence486 270 85 gene locus_tag LOCUS_14190 270 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 475 302 gene locus_tag LOCUS_14200 475 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 884 657 gene locus_tag LOCUS_14210 884 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 <2309 900 gene locus_tag LOCUS_14220 <2309 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124464.1:TM0106 family RecB-like putative nuclease >Feature sequence487 1821 532 gene locus_tag LOCUS_14230 1821 532 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_14230 2126 1893 gene locus_tag LOCUS_14240 2126 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence488 298 666 gene locus_tag LOCUS_14250 298 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 837 1076 gene locus_tag LOCUS_14260 837 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence489 1753 416 gene locus_tag LOCUS_14270 gene hflX 1753 416 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121200.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence490 >Feature sequence491 1002 61 gene locus_tag LOCUS_14280 1002 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1917 1285 gene locus_tag LOCUS_14290 1917 1285 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392490.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence492 >Feature sequence493 1650 127 gene locus_tag LOCUS_14300 gene rfaE1 1650 127 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_14300 <2273 1695 gene locus_tag LOCUS_14310 <2273 1695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003305.1:sigma-54 dependent transcriptional regulator >Feature sequence494 1084 1602 gene locus_tag LOCUS_14320 1084 1602 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948618.1 protein_id gnl|my_center|LOCUS_14320 1635 2219 gene locus_tag LOCUS_14330 1635 2219 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913314.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence495 >Feature sequence496 296 1282 gene locus_tag LOCUS_14340 296 1282 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868082.1 protein_id gnl|my_center|LOCUS_14340 1328 1939 gene locus_tag LOCUS_14350 gene cysC 1328 1939 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468764.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence497 <1 622 gene locus_tag LOCUS_14360 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943774.1:4Fe-4S binding protein 1473 703 gene locus_tag LOCUS_14370 gene surE 1473 703 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404579.1 protein_id gnl|my_center|LOCUS_14370 2149 1478 gene locus_tag LOCUS_14380 2149 1478 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence498 717 13 gene locus_tag LOCUS_14390 717 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14390 862 638 gene locus_tag LOCUS_14400 862 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14400 1383 943 gene locus_tag LOCUS_14410 1383 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14410 1999 1625 gene locus_tag LOCUS_14420 1999 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14420 >Feature sequence499 1437 406 gene locus_tag LOCUS_14430 1437 406 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583454.1 protein_id gnl|my_center|LOCUS_14430 <2245 1472 gene locus_tag LOCUS_14440 <2245 1472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107360.1:electron transport complex subunit RsxC >Feature sequence500 >Feature sequence501 436 1533 gene locus_tag LOCUS_14450 436 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2086 >2243 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctgaaaggacattcctactg >Feature sequence502 2101 965 gene locus_tag LOCUS_14460 2101 965 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence503 307 606 gene locus_tag LOCUS_14470 307 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence504 <2216 768 gene locus_tag LOCUS_14480 <2216 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193383857.1:phosphate ABC transporter permease PstA >Feature sequence505 702 1163 gene locus_tag LOCUS_14490 702 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence506 1640 786 gene locus_tag LOCUS_14500 1640 786 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_14500 <2210 1646 gene locus_tag LOCUS_14510 <2210 1646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404896.1:AAA family ATPase >Feature sequence507 631 326 gene locus_tag LOCUS_14520 631 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1039 656 gene locus_tag LOCUS_14530 1039 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 <2208 1046 gene locus_tag LOCUS_14540 <2208 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047816828.1:SDR family oxidoreductase >Feature sequence508 >Feature sequence509 814 1674 gene locus_tag LOCUS_14550 814 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14550 >Feature sequence510 740 303 gene locus_tag LOCUS_14560 gene mraZ 740 303 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_14560 1033 2109 gene locus_tag LOCUS_14570 gene queA 1033 2109 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence511 >Feature sequence512 >Feature sequence513 <1 1476 gene locus_tag LOCUS_14580 <1 1476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943144.1:sigma-54 dependent transcriptional regulator >Feature sequence514 >Feature sequence515 312 1607 gene locus_tag LOCUS_14590 312 1607 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867786.1 protein_id gnl|my_center|LOCUS_14590 1604 2158 gene locus_tag LOCUS_14600 1604 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence516 435 1154 gene locus_tag LOCUS_14610 gene pyrH 435 1154 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546671.1 protein_id gnl|my_center|LOCUS_14610 1161 1721 gene locus_tag LOCUS_14620 gene frr 1161 1721 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339966.1 protein_id gnl|my_center|LOCUS_14620 1795 1870 gene locus_tag LOCUS_t00150 1795 1870 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2006 2082 gene locus_tag LOCUS_t00160 2006 2082 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence517 1741 1241 gene locus_tag LOCUS_14630 1741 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence518 283 615 gene locus_tag LOCUS_14640 283 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 618 1313 gene locus_tag LOCUS_14650 618 1313 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975625.1 protein_id gnl|my_center|LOCUS_14650 1945 1334 gene locus_tag LOCUS_14660 1945 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence519 <2157 1588 gene locus_tag LOCUS_14670 <2157 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000404330.1:DedA family protein >Feature sequence520 1651 206 gene locus_tag LOCUS_14680 1651 206 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence521 2147 1233 gene locus_tag LOCUS_14690 2147 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence522 93 854 gene locus_tag LOCUS_14700 93 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14700 826 1179 gene locus_tag LOCUS_14710 826 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14710 1919 1731 gene locus_tag LOCUS_14720 1919 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence523 <1 629 gene locus_tag LOCUS_14730 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868502.1:L-threonine 3-dehydrogenase 883 2004 gene locus_tag LOCUS_14740 gene alr 883 2004 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence524 57 281 gene locus_tag LOCUS_14750 57 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 383 1552 gene locus_tag LOCUS_14760 383 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence525 1121 828 gene locus_tag LOCUS_14770 1121 828 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946556.1 protein_id gnl|my_center|LOCUS_14770 1987 1424 gene locus_tag LOCUS_14780 1987 1424 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence526 512 952 gene locus_tag LOCUS_14790 512 952 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938877.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence527 >Feature sequence528 1056 1883 gene locus_tag LOCUS_14800 1056 1883 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14800 >Feature sequence529 <2127 1051 gene locus_tag LOCUS_14810 <2127 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938731.1:phosphotransacetylase family protein >Feature sequence530 695 576 gene locus_tag LOCUS_14820 695 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1567 1896 gene locus_tag LOCUS_14830 1567 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence531 <2118 661 gene locus_tag LOCUS_14840 <2118 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545591.1:1,4-alpha-glucan branching protein GlgB >Feature sequence532 290 84 gene locus_tag LOCUS_14850 290 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 724 287 gene locus_tag LOCUS_14860 724 287 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013196.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence533 358 618 gene locus_tag LOCUS_14870 358 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 <2107 1129 gene locus_tag LOCUS_14880 <2107 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941487.1:signal peptide peptidase SppA >Feature sequence534 <1 1129 gene locus_tag LOCUS_14890 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941009.1:NADH dehydrogenase (quinone) subunit D 1119 1652 gene locus_tag LOCUS_14900 gene nuoE 1119 1652 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence535 1736 381 gene locus_tag LOCUS_14910 1736 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence536 >Feature sequence537 1540 737 gene locus_tag LOCUS_14920 1540 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence538 152 6 gene locus_tag LOCUS_14930 152 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 881 162 gene locus_tag LOCUS_14940 881 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1216 863 gene locus_tag LOCUS_14950 1216 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence539 <1 1100 gene locus_tag LOCUS_14960 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941860.1:potassium/proton antiporter 1267 2037 gene locus_tag LOCUS_14970 1267 2037 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence540 <2064 194 gene locus_tag LOCUS_14980 <2064 194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337566.1:asparagine synthase-related protein >Feature sequence541 <1 1623 gene locus_tag LOCUS_14990 <1 1623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980092.1:glycoside hydrolase family 15 protein >Feature sequence542 1280 1038 gene locus_tag LOCUS_15000 1280 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1643 1918 gene locus_tag LOCUS_15010 1643 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence543 <1 1185 gene locus_tag LOCUS_15020 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583284.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence544 <1 880 gene locus_tag LOCUS_15030 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256944.1:deoxyribonuclease IV 1240 1488 gene locus_tag LOCUS_15040 1240 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1593 1901 gene locus_tag LOCUS_15050 1593 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence545 1641 13 gene locus_tag LOCUS_15060 1641 13 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169351683.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence546 >Feature sequence547 <1 1883 gene locus_tag LOCUS_15070 <1 1883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044978.1:response regulator >Feature sequence548 215 895 gene locus_tag LOCUS_15080 215 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1017 1310 gene locus_tag LOCUS_15090 1017 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 <2048 1352 gene locus_tag LOCUS_15100 <2048 1352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943017.1:anthranilate phosphoribosyltransferase >Feature sequence549 1728 688 gene locus_tag LOCUS_15110 1728 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence550 1173 619 gene locus_tag LOCUS_15120 gene hpt 1173 619 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_15120 <2042 1302 gene locus_tag LOCUS_15130 <2042 1302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393104.1:tetratricopeptide repeat protein >Feature sequence551 228 1142 gene locus_tag LOCUS_15140 228 1142 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence552 1369 1025 gene locus_tag LOCUS_15150 1369 1025 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_15150 <2039 1489 gene locus_tag LOCUS_15160 <2039 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082270.1:aldo/keto reductase >Feature sequence553 >Feature sequence554 >Feature sequence555 285 52 gene locus_tag LOCUS_15170 285 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 691 326 gene locus_tag LOCUS_15180 691 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 2030 939 gene locus_tag LOCUS_15190 2030 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence556 370 1584 gene locus_tag LOCUS_15200 370 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence557 665 33 gene locus_tag LOCUS_15210 665 33 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461805.1 protein_id gnl|my_center|LOCUS_15210 902 1438 gene locus_tag LOCUS_15220 902 1438 CDS product ADP-ribose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986716.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence558 1102 224 gene locus_tag LOCUS_15230 1102 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 <2015 1252 gene locus_tag LOCUS_15240 <2015 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008672011.1:lysine--tRNA ligase >Feature sequence559 >Feature sequence560 1519 650 gene locus_tag LOCUS_15250 gene xerC 1519 650 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence561 1040 39 gene locus_tag LOCUS_15260 gene gap 1040 39 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence562 1173 652 gene locus_tag LOCUS_15270 1173 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence563 <1 1546 gene locus_tag LOCUS_15280 <1 1546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942659.1:EAL domain-containing protein >Feature sequence564 649 11 gene locus_tag LOCUS_15290 649 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1822 752 gene locus_tag LOCUS_15300 gene purM 1822 752 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence565 355 164 gene locus_tag LOCUS_15310 355 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 552 839 gene locus_tag LOCUS_15320 552 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 842 1282 gene locus_tag LOCUS_15330 842 1282 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 protein_id gnl|my_center|LOCUS_15330 <1968 1385 gene locus_tag LOCUS_15340 <1968 1385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880602.1:M48 family metallopeptidase >Feature sequence566 761 579 gene locus_tag LOCUS_15350 761 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 761 1630 gene locus_tag LOCUS_15360 gene ubiA 761 1630 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence567 1349 3 gene locus_tag LOCUS_15370 gene glnA 1349 3 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287001.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence568 1853 858 gene locus_tag LOCUS_15380 1853 858 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence569 264 1145 gene locus_tag LOCUS_15390 264 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1337 1717 gene locus_tag LOCUS_15400 1337 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence570 1312 290 gene locus_tag LOCUS_15410 1312 290 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_15410 <1946 1396 gene locus_tag LOCUS_15420 <1946 1396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583175.1:serine hydroxymethyltransferase >Feature sequence571 35 481 gene locus_tag LOCUS_15430 gene mlaD 35 481 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545373.1 protein_id gnl|my_center|LOCUS_15430 485 1102 gene locus_tag LOCUS_15440 485 1102 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence572 1301 855 gene locus_tag LOCUS_15450 1301 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1760 1305 gene locus_tag LOCUS_15460 1760 1305 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869889.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence573 1749 1243 gene locus_tag LOCUS_15470 gene purE 1749 1243 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence574 1467 631 gene locus_tag LOCUS_15480 1467 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence575 >Feature sequence576 1918 140 gene locus_tag LOCUS_15490 1918 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence577 <1 1019 gene locus_tag LOCUS_15500 <1 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_096581549.1:MFS transporter 1679 1095 gene locus_tag LOCUS_15510 1679 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence578 22 711 gene locus_tag LOCUS_15520 22 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 782 1867 gene locus_tag LOCUS_15530 782 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence579 881 201 gene locus_tag LOCUS_15540 gene queC 881 201 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932219.1 protein_id gnl|my_center|LOCUS_15540 1658 888 gene locus_tag LOCUS_15550 1658 888 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545638.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence580 1855 359 gene locus_tag LOCUS_15560 gene malQ 1855 359 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940406.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence581 684 1820 gene locus_tag LOCUS_15570 gene wecB 684 1820 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866686.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence582 1600 899 gene locus_tag LOCUS_15580 1600 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1803 1597 gene locus_tag LOCUS_15590 1803 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence583 <1899 606 gene locus_tag LOCUS_15600 <1899 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949051.1:ASKHA domain-containing protein >Feature sequence584 946 1755 gene locus_tag LOCUS_15610 946 1755 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence585 1215 322 gene locus_tag LOCUS_15620 1215 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1837 1520 gene locus_tag LOCUS_15630 1837 1520 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092213181.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence586 <1 1015 gene locus_tag LOCUS_15640 <1 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120422.1:phosphoribosylformylglycinamidine synthase subunit PurL 1813 1148 gene locus_tag LOCUS_15650 gene phoU 1813 1148 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence587 <1 779 gene locus_tag LOCUS_15660 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790587.1:tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB 1307 855 gene locus_tag LOCUS_15670 1307 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 <1895 1346 gene locus_tag LOCUS_15680 <1895 1346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877391.1:dTDP-glucose 4,6-dehydratase >Feature sequence588 >Feature sequence589 <1888 434 gene locus_tag LOCUS_15690 <1888 434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005456445.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase >Feature sequence590 <1 507 gene locus_tag LOCUS_15700 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870209.1:TrkH family potassium uptake protein 572 648 gene locus_tag LOCUS_t00170 572 648 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 683 758 gene locus_tag LOCUS_t00180 683 758 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1879 1109 gene locus_tag LOCUS_15710 1879 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence591 1492 572 gene locus_tag LOCUS_15720 1492 572 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272216.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence592 901 128 gene locus_tag LOCUS_15730 901 128 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964447.1 protein_id gnl|my_center|LOCUS_15730 1193 1005 gene locus_tag LOCUS_15740 1193 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 <1877 1256 gene locus_tag LOCUS_15750 <1877 1256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870966.1:dihydroorotate dehydrogenase electron transfer subunit >Feature sequence593 <1874 817 gene locus_tag LOCUS_15760 <1874 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966836.1:beta-ketoacyl-ACP synthase II >Feature sequence594 <1 1843 gene locus_tag LOCUS_15770 <1 1843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964994.1:U32 family peptidase >Feature sequence595 <1 1751 gene locus_tag LOCUS_15780 <1 1751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048014.1:selenocysteine-specific translation elongation factor >Feature sequence596 140 1342 gene locus_tag LOCUS_15790 gene arsB 140 1342 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence597 166 1755 gene locus_tag LOCUS_15800 166 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986676.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence598 951 1400 gene locus_tag LOCUS_15810 951 1400 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_15810 1420 1824 gene locus_tag LOCUS_15820 1420 1824 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922983.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence599 987 232 gene locus_tag LOCUS_15830 987 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1494 1228 gene locus_tag LOCUS_15840 1494 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 >Feature sequence600 <1846 1037 gene locus_tag LOCUS_15850 <1846 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459300.1:acetylglutamate kinase >Feature sequence601 <1 582 gene locus_tag LOCUS_15860 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942273.1:phosphoglycerate kinase 668 1366 gene locus_tag LOCUS_15870 gene rpe 668 1366 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589959.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence602 399 1679 gene locus_tag LOCUS_15880 399 1679 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938556.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence603 107 841 gene locus_tag LOCUS_15890 107 841 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_15890 <1824 923 gene locus_tag LOCUS_15900 <1824 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_126322482.1:response regulator >Feature sequence604 <1823 674 gene locus_tag LOCUS_15910 <1823 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942467.1:DNA mismatch repair protein MutS >Feature sequence605 >Feature sequence606 206 529 gene locus_tag LOCUS_15920 206 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15920 >Feature sequence607 <1 746 gene locus_tag LOCUS_15930 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103038490.1:protein-L-isoaspartate(D-aspartate) O-methyltransferase 940 1191 gene locus_tag LOCUS_15940 940 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1175 1504 gene locus_tag LOCUS_15950 1175 1504 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence608 <1 922 gene locus_tag LOCUS_15960 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966435.1:tryptophan synthase subunit beta 980 1792 gene locus_tag LOCUS_15970 gene trpA 980 1792 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966434.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence609 1294 377 gene locus_tag LOCUS_15980 1294 377 CDS product IS4-like element IS421 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300563.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15980 >Feature sequence610 894 442 gene locus_tag LOCUS_15990 894 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence611 16 831 gene locus_tag LOCUS_16000 gene thiF 16 831 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880850.1 protein_id gnl|my_center|LOCUS_16000 912 1361 gene locus_tag LOCUS_16010 912 1361 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990749.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence612 >Feature sequence613 537 214 gene locus_tag LOCUS_16020 537 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 <1786 540 gene locus_tag LOCUS_16030 <1786 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393855.1:F0F1 ATP synthase subunit beta >Feature sequence614 339 896 gene locus_tag LOCUS_16040 gene gmhB 339 896 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_16040 1277 951 gene locus_tag LOCUS_16050 1277 951 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_16050 1695 1279 gene locus_tag LOCUS_16060 1695 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence615 <1 798 gene locus_tag LOCUS_16070 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943894.1:c-type cytochrome biogenesis protein CcsB 817 1095 gene locus_tag LOCUS_16080 817 1095 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_16080 1255 1599 gene locus_tag LOCUS_16090 1255 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence616 <1 1476 gene locus_tag LOCUS_16100 <1 1476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958448.1:APC family permease >Feature sequence617 >Feature sequence618 >Feature sequence619 1098 10 gene locus_tag LOCUS_16110 1098 10 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_16110 1349 1146 gene locus_tag LOCUS_16120 1349 1146 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942507.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence620 206 1210 gene locus_tag LOCUS_16130 206 1210 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence621 >Feature sequence622 <1747 1189 gene locus_tag LOCUS_16140 <1747 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020696.1:formylglycine-generating enzyme family protein >Feature sequence623 >Feature sequence624 633 190 gene locus_tag LOCUS_16150 633 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 837 658 gene locus_tag LOCUS_16160 837 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence625 1610 744 gene locus_tag LOCUS_16170 gene thiL 1610 744 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121111.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence626 <1732 926 gene locus_tag LOCUS_16180 <1732 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393655.1:NAD(P)H-hydrate dehydratase >Feature sequence627 1488 628 gene locus_tag LOCUS_16190 gene lgt 1488 628 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence628 38 376 gene locus_tag LOCUS_16200 38 376 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 protein_id gnl|my_center|LOCUS_16200 369 686 gene locus_tag LOCUS_16210 369 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1218 1628 gene locus_tag LOCUS_16220 1218 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence629 480 1454 gene locus_tag LOCUS_16230 480 1454 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence630 3 263 gene locus_tag LOCUS_16240 3 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 236 1570 gene locus_tag LOCUS_16250 236 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16250 >Feature sequence631 1480 137 gene locus_tag LOCUS_16260 1480 137 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence632 1174 491 gene locus_tag LOCUS_16270 gene nfi 1174 491 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583138.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence633 >Feature sequence634 632 276 gene locus_tag LOCUS_16280 632 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1660 680 gene locus_tag LOCUS_16290 1660 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence635 >Feature sequence636 >Feature sequence637 >Feature sequence638 >Feature sequence639 >Feature sequence640 >Feature sequence641 493 774 gene locus_tag LOCUS_16300 493 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence642 <1642 781 gene locus_tag LOCUS_16310 <1642 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003407657.1:glycosyltransferase >Feature sequence643 <1639 236 gene locus_tag LOCUS_16320 <1639 236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943221.1:patatin-like phospholipase family protein >Feature sequence644 1230 259 gene locus_tag LOCUS_16330 gene cbiB 1230 259 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861967.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence645 1339 482 gene locus_tag LOCUS_16340 1339 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16340 1504 1358 gene locus_tag LOCUS_16350 1504 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence646 66 887 gene locus_tag LOCUS_16360 66 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1029 1622 gene locus_tag LOCUS_16370 1029 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence647 >Feature sequence648 283 1464 gene locus_tag LOCUS_16380 283 1464 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704481.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence649 <1 569 gene locus_tag LOCUS_16390 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391574.1:tRNA adenosine(34) deaminase TadA 842 930 gene locus_tag LOCUS_t00190 842 930 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1065 1157 gene locus_tag LOCUS_t00200 1065 1157 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence650 519 1262 gene locus_tag LOCUS_16400 519 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16400 >Feature sequence651 1 1245 gene locus_tag LOCUS_16410 gene dnaB 1 1245 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence652 >Feature sequence653 110 613 gene locus_tag LOCUS_16420 110 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 665 946 gene locus_tag LOCUS_16430 665 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence654 >Feature sequence655 371 1126 gene locus_tag LOCUS_16440 371 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence656 >Feature sequence657 <1 526 gene locus_tag LOCUS_16450 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546190.1:class II fructose-bisphosphate aldolase 1295 564 gene locus_tag LOCUS_16460 gene thyX 1295 564 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546288.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence658 225 575 gene locus_tag LOCUS_16470 225 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 598 828 gene locus_tag LOCUS_16480 598 828 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096668979.1 protein_id gnl|my_center|LOCUS_16480 1103 1447 gene locus_tag LOCUS_16490 1103 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 >Feature sequence659 <1554 245 gene locus_tag LOCUS_16500 <1554 245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584142.1:pyruvate kinase >Feature sequence660 >Feature sequence661 >Feature sequence662 <1 1170 gene locus_tag LOCUS_16510 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879242.1:ammonium transporter >Feature sequence663 >Feature sequence664 >Feature sequence665 >Feature sequence666 >Feature sequence667 487 173 gene locus_tag LOCUS_16520 487 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1017 640 gene locus_tag LOCUS_16530 1017 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence668 >Feature sequence669 >Feature sequence670 >Feature sequence671 <1491 519 gene locus_tag LOCUS_16540 <1491 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228612.1:ABC transporter ATP-binding protein >Feature sequence672 <1489 270 gene locus_tag LOCUS_16550 <1489 270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025862442.1:protein-disulfide reductase DsbD >Feature sequence673 1116 643 gene locus_tag LOCUS_16560 1116 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16560 >Feature sequence674 841 464 gene locus_tag LOCUS_16570 841 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16570 >Feature sequence675 1444 941 gene locus_tag LOCUS_16580 1444 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence676 <1 860 gene locus_tag LOCUS_16590 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459951.1:PHP domain-containing protein >Feature sequence677 245 105 gene locus_tag LOCUS_16600 245 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 827 393 gene locus_tag LOCUS_16610 827 393 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545112.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence678 1 990 gene locus_tag LOCUS_16620 1 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence679 >Feature sequence680 <1 708 gene locus_tag LOCUS_16630 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941272.1:phosphoribosylamine--glycine ligase 833 1381 gene locus_tag LOCUS_16640 833 1381 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941339.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence681 275 421 gene locus_tag LOCUS_16650 275 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 505 639 gene locus_tag LOCUS_16660 505 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence682 1229 750 gene locus_tag LOCUS_16670 gene rpsD 1229 750 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence683 <1434 703 gene locus_tag LOCUS_16680 <1434 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582949.1:nucleotide sugar dehydrogenase >Feature sequence684 225 650 gene locus_tag LOCUS_16690 225 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence685 874 1281 gene locus_tag LOCUS_16700 874 1281 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence686 126 641 gene locus_tag LOCUS_16710 126 641 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967173.1 protein_id gnl|my_center|LOCUS_16710 1035 844 gene locus_tag LOCUS_16720 1035 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16720 >Feature sequence687 179 1303 gene locus_tag LOCUS_16730 179 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence688 >Feature sequence689 <1405 847 gene locus_tag LOCUS_16740 <1405 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583478.1:ROK family protein >Feature sequence690 813 370 gene locus_tag LOCUS_16750 813 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence691 <1381 72 gene locus_tag LOCUS_16760 <1381 72 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941005.1:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence692 610 1098 gene locus_tag LOCUS_16770 610 1098 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405521.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence693 1261 974 gene locus_tag LOCUS_16780 gene groES 1261 974 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174076.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence694 >Feature sequence695 322 1002 gene locus_tag LOCUS_16790 322 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence696 398 1324 gene locus_tag LOCUS_16800 gene speB 398 1324 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence697 <1 730 gene locus_tag LOCUS_16810 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545857.1:glutamate-5-semialdehyde dehydrogenase >Feature sequence698 1318 1073 gene locus_tag LOCUS_16820 1318 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence699 241 996 gene locus_tag LOCUS_16830 241 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence700 >Feature sequence701 1279 41 gene locus_tag LOCUS_16840 1279 41 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942352.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence702 234 824 gene locus_tag LOCUS_16850 gene hisB 234 824 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence703 >Feature sequence704 3 533 gene locus_tag LOCUS_16860 3 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 564 776 gene locus_tag LOCUS_16870 564 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence705 <1310 229 gene locus_tag LOCUS_16880 <1310 229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546813.1:bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II >Feature sequence706 162 1016 gene locus_tag LOCUS_16890 gene lpxC 162 1016 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035967.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence707 438 1127 gene locus_tag LOCUS_16900 438 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence708 677 93 gene locus_tag LOCUS_16910 677 93 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977603.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence709 101 538 gene locus_tag LOCUS_16920 101 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1257 637 gene locus_tag LOCUS_16930 1257 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence710 793 1050 gene locus_tag LOCUS_16940 793 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence711 1031 99 gene locus_tag LOCUS_16950 1031 99 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence712 <1 756 gene locus_tag LOCUS_16960 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393260.1:threonine--tRNA ligase >Feature sequence713 11 748 gene locus_tag LOCUS_16970 11 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence714 97 738 gene locus_tag LOCUS_16980 97 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence715 178 816 gene locus_tag LOCUS_16990 gene rsxA 178 816 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence716 >Feature sequence717 351 755 gene locus_tag LOCUS_17000 351 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence718 >Feature sequence719 <1241 338 gene locus_tag LOCUS_17010 <1241 338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970802.1:complex I NDUFA9 subunit family protein >Feature sequence720 859 479 gene locus_tag LOCUS_17020 859 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence721 <1228 16 gene locus_tag LOCUS_17030 <1228 16 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545264.1:homoserine dehydrogenase >Feature sequence722 1057 245 gene locus_tag LOCUS_17040 1057 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence723 <1 920 gene locus_tag LOCUS_17050 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545277.1:dihydropteroate synthase >Feature sequence724 >Feature sequence725 83 499 gene locus_tag LOCUS_17060 83 499 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence726 930 532 gene locus_tag LOCUS_17070 930 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence727 <1141 345 gene locus_tag LOCUS_17080 <1141 345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021092.1:phenylacetate--CoA ligase family protein >Feature sequence728 54 365 gene locus_tag LOCUS_17090 gene rpsJ 54 365 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_17090 391 1032 gene locus_tag LOCUS_17100 gene rplC 391 1032 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869928.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence729 1084 50 gene locus_tag LOCUS_17110 1084 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence730 388 672 gene locus_tag LOCUS_17120 388 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1082 822 gene locus_tag LOCUS_17130 1082 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence731 128 541 gene locus_tag LOCUS_17140 gene ruvX 128 541 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964987.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence732 128 919 gene locus_tag LOCUS_17150 128 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 >Feature sequence733 73 522 gene locus_tag LOCUS_17160 73 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence734 >Feature sequence735 <1060 528 gene locus_tag LOCUS_17170 <1060 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_019248574.1:peptidylprolyl isomerase >Feature sequence736 <1054 468 gene locus_tag LOCUS_17180 <1054 468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021765.1:DUF2341 domain-containing protein >Feature sequence737 285 623 gene locus_tag LOCUS_17190 285 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence738 >Feature sequence739 562 62 gene locus_tag LOCUS_17200 562 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence740 >Feature sequence741 >Feature sequence742 >Feature sequence743 259 858 gene locus_tag LOCUS_17210 259 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17210